
Summary of OsREG585 (All List)

OrganismOryza sativa  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
Total Entry Count3872  

Entry Sequences (3872 entries)

LocusGene modelSequenceDescription
AK059848GCCACGTCGGCCCATTEmopamil-binding family protein. 
AK058909GACGTGGCGSimilar to Thylakoid lumenal 15 kDa protein, chloroplast precursor (p15). 
AK071635GCCACGTCSimilar to Splicing factor RSZ33. 
Os01g0155800J065061I19GACGTGGCConserved hypothetical protein. 
Os01g0206600J065041P19GCCACGTCConserved hypothetical protein. 
AK062972GACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
AY620417GACGTGGCGSimilar to NTGB2 (Fragment). 
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein. 
J075061L04GCCACGTCConserved hypothetical protein. 
AK069749CGCCACGTCRedoxin domain containing protein. 
Os01g0314300AK073419GCCACGTCUncharacterized domain 2 containing protein. 
Os01g0314800AF323612GCCACGTCLate embryogenesis abundant protein 3 family protein. 
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein. 
Os01g0349000AK108540GCCACGTCConserved hypothetical protein. 
Os01g0372100J075029A10GACGTGGCConserved hypothetical protein. 
AK110939GCCACGTCCyclin-like F-box domain containing protein. 
AK067715GACGTGGCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
AK067715GCCACGTCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
AK061456GAGACGTGGCGProtein of unknown function DUF1000 family protein. 
AK066561GACGTGGCGProtein of unknown function DUF1644 family protein. 
Os01g0633400AK108988GACGTGGCTGGGCCBS domain containing protein. 
Os01g0698300AK100582CGCCACGTCZinc finger, BED-type predicted domain containing protein. 
Os01g0727400AK065692GCCACGTCConserved hypothetical protein. 
Os01g0745400AK107872GACGTGGCGSec34-like protein family protein. 
AK107872GACGTGGCGSec34-like protein family protein. 
Os01g0764800AK102809GACGTGGCSimilar to Nt-gh3 deduced protein. 
Os01g0769900AK065563GCCACGTCConserved hypothetical protein. 
Os01g0816700AK100654GACGTGGCGTGSimilar to L-ascorbate oxidase homolog precursor (EC (Ascorbase). 
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment). 
AK073540GACGTGGCGSAC3/GANP family protein. 
Os01g0841800AK111196GCCACGTCRibonuclease II and R domain containing protein. 
Os01g0851300AK101770GACGTGGCGTGReticulon family protein. 
Os01g0851400J065070P10GACGTGGCGMachado-Joseph disease protein MJD family protein. 
AK062402GACGTGGCGConserved hypothetical protein. 
Os01g0867900AK061366CACGCCACGTCProtein of unknown function DUF502 family protein. 
AK058284GAGACGTGGCSimilar to Photosystem II subunit PsbS. 
AK068254GACGTGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
Os01g0913400AK099881CGCCACGTCProtein prenyltransferase domain containing protein. 
AK065852GACGTGGCConserved hypothetical protein. 
Os01g0950900AK101121CGCCACGTCProtein of unknown function DUF221 domain containing protein. 
Os01g0965500J075073G20CGCCACGTCNuclear protein SET domain containing protein. 
Os01g0970400AK069207GCCACGTCEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK065652GACGTGGCSimilar to Cysteine synthase, mitochondrial precursor (EC (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C). 
AK106213GCCACGTCSimilar to Ferredoxin NADP+ reductase (EC (Fragment). 
AK064002GCCACGTCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75). 
AK101344GACGTGGCSimilar to Cell division control protein 28 (EC 
Os02g0127900AK102783GGTGACGTGGCHypothetical protein. 
AB055156GCCACGTCSimilar to Sec13-like protein (Fragment). 
AK065722GCCACGTCConserved hypothetical protein. 
Os02g0158900AK108324CGCCACGTCSimilar to SNF4. 
Os02g0165500AK060547GACGTGGCGConserved hypothetical protein. 
Os02g0169000AK101628GCCACGTCConserved hypothetical protein. 
AK067359GCCACGTCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK105236CGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK119874GCCACGTCSWAP/Surp domain containing protein. 
AK063627GACGTGGCGConserved hypothetical protein. 
Os02g0285800AK072177GACGTGGCSimilar to GTP-binding protein typA (Tyrosine phosphorylated protein A). 
Os02g0292800AK106941GCCACGTCProtein of unknown function DUF599 family protein. 
Os02g0299200AK105486GCCCGGCCACGTCIQ calmodulin-binding region domain containing protein. 
Os02g0464700AK107077GACGTGGCGConserved hypothetical protein. 
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein. 
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein. 
AK101016GACGTGGCMolybdenum cofactor biosynthesis domain containing protein. 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
AK122107GCCACGTCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
Os02g0530100AK058520GACGTGGCGHeavy metal transport/detoxification protein domain containing protein. 
Os02g0531450J065097O14GACGTGGCGHypothetical protein. 
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein. 
Os02g0534600GACGTGGCConserved hypothetical protein. 
AK063102GCCACGTCACCConserved hypothetical protein. 
AK108080GCCACGTCTCNo apical meristem (NAM) protein domain containing protein. 
AK062519GACGTGGCConserved hypothetical protein. 
AK062519GACGTGGCGConserved hypothetical protein. 
Os02g0652800AK063448CGCCACGTCMajor facilitator superfamily MFS_1 protein. 
Os02g0654100AK101814GCCACGTCSimilar to Enoyl-CoA hydratase. 
AY587109CGCCACGTCDehydrin family protein. 
J075053E22CGCCACGTCConserved hypothetical protein. 
AK121757GCCACGTCAAA ATPase domain containing protein. 
Os02g0717500AK067050GACGTGGCConserved hypothetical protein. 
AK121803CGCCACGTCSimilar to 65kD microtubule associated protein. 
Os02g0744900AK061968GTGACGTGGCSimilar to Geranylgeranyl reductase (Fragment). 
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
AK106018GACGTGGCGSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
Os02g0774300AK065228GACGTGGCGCCCCACCGCCCAGCCSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0803900AK106930GCCACGTCSimilar to UDP-glycosyltransferase 91D1. 
AK106930GCCACGTGGCGCCACGTCSimilar to UDP-glycosyltransferase 91D1. 
Os02g0827900AK099911CGCCACGTCSimilar to Signal peptidase 18 subunit (Fragment). 
AK103279GACGTGGCAGO1 homologous protein. 
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein. 
Os03g0119900AK058741CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os03g0124900AK070284GCCACGTCVirulence factor, pectin lyase fold family protein. 
AK063608GCCACGTCHypothetical protein. 
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC 
Os03g0144800AK103041CGCCACGTCSimilar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein). 
Os03g0149400AK111396GCCACGTCProtein prenyltransferase domain containing protein. 
AK101949GACGTGGCSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
J065154C08GCCACGTCTarget SNARE coiled-coil region domain containing protein. 
Os03g0197300AK102651GCCACGTCCupin, RmlC-type domain containing protein. 
Os03g0201100AK102337GCCACGTCSimilar to Cyclophilin-like protein PPIL3b. 
AK119298CGCCACGTCSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0251800AK067333CGCCACGTCACSimilar to Possible OmpA family member precursor. 
AK061276GCCACGTCSimilar to 40S ribosomal protein S7. 
AK101597GCCACGTCGCGTCGCMalonyl CoA-acyl carrier protein transacylase family protein. 
AK060996GACGTGGCHypothetical protein. 
AK071041GACGTGGCGProtein of unknown function DUF1645 family protein. 
AK068534GACGTGGCGProtein prenyltransferase domain containing protein. 
Os03g0312500AK106657GCCACGTCSimilar to Inhibitor of apoptosis-like protein. 
AK071431CGCCACGTCHypothetical protein. 
Os03g0338600AK066604CGCCACGTCtRNA pseudouridine synthase family protein. 
Os03g0341600AK067497GCCACGTCConserved hypothetical protein. 
Os03g0370000AK100033CGCCACGTCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 
Os03g0388100AK059680GACGTGGCHeavy metal transport/detoxification protein domain containing protein. 
AK071057GCCACGTCPeptidase S14, ClpP family protein. 
AY062181TCCGTCCGACGTGGCGSimilar to Potential histone-like transcription factor. 
Os03g0429000AK102768CGCCACGTCProteinase inhibitor I25, cystatin domain containing protein. 
AK066762GACGTGGCGSimilar to Photosystem II type II chlorophyll a/b binding protein (Fragment). 
Os03g0596800AK073603GCCACGTCConserved hypothetical protein. 
AK064308GCCACGTCConserved hypothetical protein. 
U45322GAGACGTGGCGCupin region domain containing protein. 
Os03g0668900AK108369GCCACGTCConserved hypothetical protein. 
Os03g0683700AK065067CGCCACGTCProtein of unknown function DUF810 family protein. 
AK073303TCGTGGGCCACGTCAlkaline phytoceramidase family protein. 
Os03g0738600AK073529CGCCACGTCSimilar to Lipoxygenase L-2 (EC 
Os03g0744800AK059983GCCACGTCACemp24/gp25L/p24 family protein. 
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein. 
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein. 
AK100003CGCCACGTCFAD dependent oxidoreductase family protein. 
J023002I24GCCACGTCMitochodrial transcription termination factor-related family protein. 
Os03g0788500AK072204GCCACGTCSimilar to Calcium-dependent protein kinase 2. 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
AK060010GGTGACGTGGCSimilar to Short-chain alcohol dehydrogenase. 
Os03g0820500J065073D04GCCACGTCSimilar to WCOR719. 
Os03g0822300AK060050GCCACGTCACRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
Os03g0837900AK068346GCCACGTCGGCCCAGAStreptomyces cyclase/dehydrase family protein. 
AK109338GACGTGGCConserved hypothetical protein. 
Os04g0259800AK111548GACGTGGCConserved hypothetical protein. 
Os04g0275966J065015F20GACGTGGCConserved hypothetical protein. 
AK062974GCCACGTCACCHypothetical protein. 
Os04g0313300AK121730GACGTGGCConserved hypothetical protein. 
AK061121GACGTGGCReticulon family protein. 
AK061121GACGTGGCReticulon family protein. 
AK101795CGCCACGTCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0389800AK109628GCCACGTCSimilar to Acetohydroxyacid synthase. 
Os04g0407900AK064758GACGTGGCSimilar to Cytochrom P450-like protein. 
AK058627GCCACGTCSimilar to DNA-binding protein S1FA. 
AK058848CGCCACGTCConserved hypothetical protein. 
AK063725GCCACGTCConserved hypothetical protein. 
Os04g0474600J023064N16CCCACGTGGCCACGTCGlycoside hydrolase, family 1 protein. 
Os04g0479000AK106344CGCCACGTCSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0479800AK121430GCCACGTCCyclin-like F-box domain containing protein. 
Os04g0502800AK099877GCCACGTCSimilar to Nodulin-like protein. 
Os04g0510000AK109180GACGTGGCGConserved hypothetical protein. 
AK066705GACGTGGCConserved hypothetical protein. 
Os04g0550200AK108473GCCACGTCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0561200AK107862GACGTGGCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
Os04g0583600AK059019CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os04g0589200AK068571GCCACGTCConserved hypothetical protein. 
Os04g0608100AK072315GCCACGTCGalactokinase family protein. 
AK067276GCCACGTCACBromodomain containing protein. 
Os04g0623300AK064902GACGTGGCGSimilar to Flavin-containing monamine oxidase family protein. 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
AK059277GACGTGGCGSimilar to Xyloglucan endotransglycosylase (Fragment). 
Os04g0677800AK102572GCCACGTCZinc finger, RanBP2-type domain containing protein. 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AK099495GACGTGGCXYPPX repeat containing protein. 
Os05g0129400AK102359ATCCGACGTGGCAnkyrin repeat containing protein. 
Os05g0140800AK110652CGCCACGTCSimilar to Dormancy related protein (Fragment). 
AK062395GCCACGTCConserved hypothetical protein. 
AK104336GCCACGTCSimilar to Na+/H+ antiporter. 
AK072977GACGTGGCATP-dependent DNA helicase RecQ family protein. 
AK063611CGCCACGTCConserved hypothetical protein. 
AK105434GCCACGTCConserved hypothetical protein. 
AK067940CGCCACGTCConserved hypothetical protein. 
AK119724GACGTGGCGConserved hypothetical protein. 
AK059562GCCACGTCSimilar to One helix protein (OHP). 
Os05g0325200J090038J19GCCACGTCCyclin-like domain containing protein. 
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7. 
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7. 
AK102727GCCACGTCACProtein of unknown function DUF538 family protein. 
AK102727GCCACGTCACProtein of unknown function DUF538 family protein. 
Os05g0357850J065118C17GCCACGTCHypothetical protein. 
Os05g0372400AK068781CGCCACGTCLipase, class 3 family protein. 
Os05g0377000Os05g0377000CGCCACGTCSimilar to Acyl carrier protein (ACP). 
AK065418GCCACGTCConserved hypothetical protein. 
AK066000CGCCACGTCProtein kinase-like domain containing protein. 
AK119240CACGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
AK101147GCCACGTCProtein of unknown function DUF1692 domain containing protein. 
Os05g0495900AK069244GACGTGGCSimilar to Beta-1,3-glucanase precursor (Fragment). 
Os05g0499400AK059489GCCACGTCHaem peroxidase family protein. 
AK103146GTCGCGCGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os05g0529300AK102648CGCCACGTCACCSimilar to ER lumen protein retaining receptor (HDEL receptor). 
AK063846GGTGACGTGGCGConserved hypothetical protein. 
Os05g0539400AK068572CGCCACGTCACTCCACGCCGlycoside hydrolase, family 35 protein. 
AK100389GCCACGTCACCSimilar to Blast and wounding induced mitogen-activated protein kinase. 
Os05g0566800AK065748CGCCACGTCCold acclimation protein COR413-TM1. 
Os05g0571600Os05g0571600GACGTGGCGConserved hypothetical protein. 
AK063033GACGTGGCConserved hypothetical protein. 
Os05g0574900AK107256GCCACGTCGRAS transcription factor domain containing protein. 
Os05g0588700AK100256GCCACGTCHistone deacetylase interacting domain containing protein. 
AK070159GACGTGGCPeptidase A1, pepsin family protein. 
Os06g0104000AK068490GACGTGGCConserved hypothetical protein. 
AK058833GCCACGTCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment). 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
AK063692CGCCACGTCTCTCCCCCACGCGTGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0136900AK107405GTGACGTGGCCGTGGProtein of unknown function DUF296 domain containing protein. 
AK103245GCCACGTCConserved hypothetical protein. 
Os06g0171700AK103771GTGACGTGGCGTGCdk-activating kinase assembly factor (MAT1) family protein. 
Os06g0219600AK060429GCCACGTCSimilar to Poly(A)-binding protein II-like. 
Os06g0258900AK067794CGCCACGTCKetose-bisphosphate aldolase, class-II family protein. 
Os06g0275500AK111743CACGTGGCGCCACGTCSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0286228AK069113CGCCACGTCCupredoxin domain containing protein. 
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment). 
Os06g0326700AK101908GCCACGTCDiacylglycerol acyltransferase family protein. 
Os06g0331900AK120017GCCACGTCProtein of unknown function UPF0005 family protein. 
Os06g0353700J065177D24GACGTGGCConserved hypothetical protein. 
Os06g0537700AK109530GACGTGGCX8 domain containing protein. 
AK063039GCCACGTCConserved hypothetical protein. 
Os06g0593100AK060274CACGCCACGTCACCSimilar to UDP-galactose/UDP-glucose transporter. 
Os06g0604400AK072121CGCCACGTCSimilar to Phospholipase D. 
Os06g0621300AK068751GCCACGTCConserved hypothetical protein. 
AK058459GCCACGTCACSimilar to Thioredoxin peroxidase. 
AK122074CGCCACGTCProtein of unknown function FAF1 domain containing protein. 
AK122074CGCCACGTCProtein of unknown function FAF1 domain containing protein. 
Os06g0664400Os06g0664400GCCACGTCHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0664400GCCACGTCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK071299GACGTGGCSimilar to Geranyl diphosphate synthase. 
Os06g0696500J080303G16GCCACGTCSimilar to Xyloglycan endo-transglycosylase precursor. 
Os06g0704300AK107008GACGTGGCZinc finger, CCCH-type domain containing protein. 
Os06g0704700AK120907CGCCACGTCCACGCCTCNmrA-like family protein. 
Os06g0712800AK121236CGCCACGTCACCSimilar to Ankyrin-like protein. 
Os06g0728700AK111637GACGTGGCGHomeodomain-like containing protein. 
AK061511GACGTGGCSimilar to Peroxidase2 precursor (EC 
AK120929CGCCACGTCSimilar to Glycolate oxidase (EC (Fragment). 
AK062969GACGTGGCConserved hypothetical protein. 
AK062969GACGTGGCConserved hypothetical protein. 
AK106274GACGTGGCEsterase/lipase/thioesterase domain containing protein. 
AK121818GCCACGTC2OG-Fe(II) oxygenase domain containing protein. 
Os07g0178800AF017356GACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
AK070512GCCACGTCACCSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 
Os07g0181500AK072431CGCCACGTCACCProtein of unknown function DUF506, plant family protein. 
AK063024GACGTGGCConserved hypothetical protein. 
Os07g0240300AK072205GACGTGGCCCCACCTGConserved hypothetical protein. 
Os07g0272800AK107279CGCCACGTCHypothetical protein. 
AK107279GCCACGTCHypothetical protein. 
Os07g0295000AK071844GACGTGGCMitochondrial substrate carrier family protein. 
Os07g0421000AK071522GCCACGTCCyclin-like F-box domain containing protein. 
AK061383GCCACGTCSimilar to 26S proteasome subunit RPN12. 
AK121702CGCCACGTCSimilar to 60S ribosomal protein L44. 
Os07g0510100AK066776GCCACGTCSimilar to Methionine aminopeptidase-like protein. 
Os07g0535100AK100978GCCACGTCCyclin-like F-box domain containing protein. 
AK109399ATCCGACGTGGCSimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK067895GACGTGGCGSimilar to ZF protein (Fragment). 
AK119176CGCCACGTCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
Os07g0597625J065130O18GACGTGGCD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
AK112118GCCACGTCSimilar to Nuclear factor Y transcription factor subunit B homolog. 
AK112118GCCACGTCSimilar to Nuclear factor Y transcription factor subunit B homolog. 
AK109489GACGTGGCTTGGGCTStrictosidine synthase family protein. 
Os07g0620800AK063671CGCCACGTCTCCyclin-like domain containing protein. 
Os07g0621201J065152G13GACGTGGCConserved hypothetical protein. 
Os07g0622700AK107120CGCCACGTCEpoxide hydrolase family protein. 
AK072927GCCACGTCWD40-like domain containing protein. 
Os07g0661100Os07g0661100GCCACGTCACGlycosyl transferase, family 4 protein. 
AK103678CGCCACGTCRibosomal protein S8E family protein. 
Os07g0674400AK119672GACGTGGCConserved hypothetical protein. 
AK068606CGCCACGTCACSimilar to OsNAC6 protein. 
Os08g0117100AK099630GACGTGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0128200AK120428GCCACGTCACCConserved hypothetical protein. 
Os08g0150800AK101530TGTGGGCCACGTCSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0155100AK069865CGCCACGTCACGCCTCGCCCMajor sperm protein domain containing protein. 
Os08g0192200AK064428GCCACGTCHypothetical protein. 
Os08g0206600AK064336CGCCACGTCAICARFT/IMPCHase bienzyme family protein. 
Os08g0267900AK107040CGCCACGTCConserved hypothetical protein. 
J075096F13GCCACGTCACCAdenylate cyclase domain containing protein. 
Os08g0414300AK072217GCCACGTCConserved hypothetical protein. 
Os08g0416100AK070406CGCCACGTCGGATDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os08g0416250J075097B22GACGTGGCHypothetical protein. 
AK100797GCCACGTCConserved hypothetical protein. 
AK060222CCGTCCGACGTGGCSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
Os08g0439900AK110628CGCCACGTCMitochondrial glycoprotein family protein. 
AK064141GACGTGGCConserved hypothetical protein. 
AK067364CGCCACGTCConserved hypothetical protein. 
Os08g0465300AK108076ATCCGACGTGGCConserved hypothetical protein. 
AK062647GACGTGGCGConserved hypothetical protein. 
Os08g0481500J065054C23CGCCACGTCConserved hypothetical protein. 
Os08g0497900AK071174GAGACGTGGCConserved hypothetical protein. 
AK071174GCCACGTCConserved hypothetical protein. 
Os08g0502700AK064774GCCACGTCGGACGGGTGTGGGCCCCACGAAAminotransferase, class V family protein.