version

Summary of OsREG585 (All List)

OrganismOryza sativa  
IDOsREG585  
SequenceGACGTGGC  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
Total Entry Count3872  

Entry Sequences (3872 entries)

LocusGene modelSequenceDescription
Os01g0103600006-072-A01GCCACGTCGGCCCATTNONE 
009-148-C12GCCACGTCGGCCCATTNONE 
AK059848GCCACGTCGGCCCATTEmopamil-binding family protein. 
AK102848GCCACGTCGGCCCATTNONE 
J033036P20GCCACGTCGGCCCATTNONE 
J065171N21GCCACGTCGGCCCATTNONE 
J065209M02GCCACGTCGGCCCATTNONE 
J075067A03GCCACGTCGGCCCATTNONE 
J075110C09GCCACGTCGGCCCATTNONE 
Os01g0144100006-118-E08GACGTGGCGNONE 
AK058909GACGTGGCGSimilar to Thylakoid lumenal 15 kDa protein, chloroplast precursor (p15). 
AK068113GACGTGGCGNONE 
AK104051GACGTGGCGNONE 
J065163E12GACGTGGCGNONE 
Os01g0155600006-048-F03GCCACGTCNONE 
AK060171GCCACGTCNONE 
AK071635GCCACGTCSimilar to Splicing factor RSZ33. 
J023080A03GCCACGTCNONE 
J023100L15GCCACGTCNONE 
J033075I17GCCACGTCNONE 
J033085O09GCCACGTCNONE 
J033105E15GCCACGTCNONE 
J033132N10GCCACGTCNONE 
J033132P12GCCACGTCNONE 
J033149H12GCCACGTCNONE 
J043026M03GCCACGTCNONE 
J080305J10GCCACGTCNONE 
J080308K03GCCACGTCNONE 
J090023M04GCCACGTCNONE 
J090078F24GCCACGTCNONE 
J100066P05GCCACGTCNONE 
Os01g0155800J065061I19GACGTGGCConserved hypothetical protein. 
Os01g0167100009-183-G08GCCACGTCNONE 
AK063153GCCACGTCNONE 
J065154C02GCCACGTCNONE 
Os01g0206600J065041P19GCCACGTCConserved hypothetical protein. 
Os01g0246400009-143-G05GACGTGGCNONE 
AK062972GACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os01g0254000006-037-A11GACGTGGCGNONE 
006-059-H09GACGTGGCGNONE 
006-088-D11GACGTGGCGNONE 
006-112-B06GACGTGGCGNONE 
006-120-E12GACGTGGCGNONE 
AK111904GACGTGGCGNONE 
AK111979GACGTGGCGNONE 
AK119548GACGTGGCGNONE 
AY620417GACGTGGCGSimilar to NTGB2 (Fragment). 
J023112F13GACGTGGCGNONE 
J053066C19GACGTGGCGNONE 
J065006L12GACGTGGCGNONE 
J065019L17GACGTGGCGNONE 
J065081J05GACGTGGCGNONE 
J065085D02GACGTGGCGNONE 
J065203D03GACGTGGCGNONE 
J065210O20GACGTGGCGNONE 
J090062P06GACGTGGCGNONE 
J090063N07GACGTGGCGNONE 
J100061H24GACGTGGCGNONE 
Os01g0257100J100030B03CGCCACGTCACCNONE 
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein. 
Os01g0258600J075028F17GCCACGTCNONE 
J075061L04GCCACGTCConserved hypothetical protein. 
J075071B09GCCACGTCNONE 
J075093E04GCCACGTCNONE 
J100033B11GCCACGTCNONE 
Os01g0261500J033071B09GCCACGTCNONE 
J090095O22GCCACGTCNONE 
Os01g0266600AK058396CGCCACGTCNONE 
AK069749CGCCACGTCRedoxin domain containing protein. 
J023030N01CGCCACGTCNONE 
J065065E03CGCCACGTCNONE 
J075006N11CGCCACGTCNONE 
J075017G04CGCCACGTCNONE 
J075023L15CGCCACGTCNONE 
J075126F05CGCCACGTCNONE 
Os01g0314300AK073419GCCACGTCUncharacterized domain 2 containing protein. 
AK104939GCCACGTCNONE 
J033044B03GCCACGTCNONE 
J033060E12GCCACGTCNONE 
J043037E21GCCACGTCNONE 
J065019O18GCCACGTCNONE 
J065025P22GCCACGTCNONE 
J065042P06GCCACGTCNONE 
J065074C19GCCACGTCNONE 
J065074E13GCCACGTCNONE 
J065094E05GCCACGTCNONE 
J065108N08GCCACGTCNONE 
J065134L13GCCACGTCNONE 
J065152N24GCCACGTCNONE 
J065162N24GCCACGTCNONE 
J065170P16GCCACGTCNONE 
J065177M20GCCACGTCNONE 
J065187N01GCCACGTCNONE 
J075012N12GCCACGTCNONE 
J075046C17GCCACGTCNONE 
J075055N06GCCACGTCNONE 
J075141H03GCCACGTCNONE 
J075150M11GCCACGTCNONE 
J090005B16GCCACGTCNONE 
J090079L11GCCACGTCNONE 
J100039F16GCCACGTCNONE 
Os01g0314800AF323612GCCACGTCLate embryogenesis abundant protein 3 family protein. 
J043003O18GCCACGTCNONE 
J065105K07GCCACGTCNONE 
J065123H16GCCACGTCNONE 
J065198K17GCCACGTCNONE 
J100027C20GCCACGTCNONE 
Os01g0331900013-026-D04GCCACGTCGGATNONE 
AK064784GCCACGTCGGATNONE 
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GCCACGTCGGATNONE 
J033090D07GCCACGTCGGATNONE 
J090006L21GCCACGTCGGATNONE 
Os01g0349000AK108540GCCACGTCConserved hypothetical protein. 
J065059M15GCCACGTCNONE 
Os01g0372100J075029A10GACGTGGCConserved hypothetical protein. 
Os01g0379400016-006-B06GCCACGTCNONE 
AK064420GCCACGTCNONE 
AK102388GCCACGTCNONE 
AK110939GCCACGTCCyclin-like F-box domain containing protein. 
J033092D18GCCACGTCNONE 
J065070N09GCCACGTCNONE 
J065078L01GCCACGTCNONE 
J065083G15GCCACGTCNONE 
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE 
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE 
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE 
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE 
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE 
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE 
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE 
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE 
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE 
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE 
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE 
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE 
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE 
Os01g0501800006-021-B07GACGTGGCNONE 
006-021-B07GCCACGTCNONE 
006-021-E12GACGTGGCNONE 
006-021-E12GCCACGTCNONE 
006-022-B08GACGTGGCNONE 
006-022-B08GCCACGTCNONE 
006-022-C09GACGTGGCNONE 
006-022-C09GCCACGTCNONE 
006-022-C12GACGTGGCNONE 
006-022-C12GCCACGTCNONE 
006-022-F10GACGTGGCNONE 
006-022-F10GCCACGTCNONE 
006-023-A09GACGTGGCNONE 
006-023-A09GCCACGTCNONE 
006-023-D02GACGTGGCNONE 
006-023-D02GCCACGTCNONE 
006-023-E06GACGTGGCNONE 
006-023-E06GCCACGTCNONE 
006-023-E11GACGTGGCNONE 
006-023-E11GCCACGTCNONE 
006-025-A01GACGTGGCNONE 
006-025-A01GCCACGTCNONE 
006-025-B07GACGTGGCNONE 
006-025-B07GCCACGTCNONE 
006-025-F04GACGTGGCNONE 
006-025-F04GCCACGTCNONE 
006-025-F11GACGTGGCNONE 
006-025-F11GCCACGTCNONE 
006-027-F05GACGTGGCNONE 
006-027-F05GCCACGTCNONE 
006-028-C02GACGTGGCNONE 
006-028-C02GCCACGTCNONE 
006-029-B01GACGTGGCNONE 
006-029-B01GCCACGTCNONE 
006-029-D09GACGTGGCNONE 
006-029-D09GCCACGTCNONE 
006-029-G02GACGTGGCNONE 
006-029-G02GCCACGTCNONE 
006-029-H08GACGTGGCNONE 
006-029-H08GCCACGTCNONE 
006-030-A02GACGTGGCNONE 
006-030-A02GCCACGTCNONE 
006-030-B05GACGTGGCNONE 
006-030-B05GCCACGTCNONE 
006-031-A01GACGTGGCNONE 
006-031-A01GCCACGTCNONE 
006-032-E09GACGTGGCNONE 
006-032-E09GCCACGTCNONE 
006-032-G10GACGTGGCNONE 
006-032-G10GCCACGTCNONE 
006-032-H11GACGTGGCNONE 
006-032-H11GCCACGTCNONE 
006-033-B08GACGTGGCNONE 
006-033-B08GCCACGTCNONE 
006-033-E11GACGTGGCNONE 
006-033-E11GCCACGTCNONE 
006-034-H01GACGTGGCNONE 
006-034-H01GCCACGTCNONE 
006-035-B09GACGTGGCNONE 
006-035-B09GCCACGTCNONE 
006-035-D08GACGTGGCNONE 
006-035-D08GCCACGTCNONE 
006-036-F01GACGTGGCNONE 
006-036-F01GCCACGTCNONE 
006-036-G01GACGTGGCNONE 
006-036-G01GCCACGTCNONE 
006-037-E12GACGTGGCNONE 
006-037-E12GCCACGTCNONE 
006-039-D07GACGTGGCNONE 
006-039-D07GCCACGTCNONE 
006-040-A03GACGTGGCNONE 
006-040-A03GCCACGTCNONE 
006-042-G11GACGTGGCNONE 
006-042-G11GCCACGTCNONE 
006-044-F11GACGTGGCNONE 
006-044-F11GCCACGTCNONE 
006-045-H04GACGTGGCNONE 
006-045-H04GCCACGTCNONE 
006-046-A09GACGTGGCNONE 
006-046-A09GCCACGTCNONE 
006-046-C12GACGTGGCNONE 
006-046-C12GCCACGTCNONE 
006-046-F10GACGTGGCNONE 
006-046-F10GCCACGTCNONE 
006-046-H08GACGTGGCNONE 
006-046-H08GCCACGTCNONE 
006-047-G05GACGTGGCNONE 
006-047-G05GCCACGTCNONE 
006-047-G06GACGTGGCNONE 
006-047-G06GCCACGTCNONE 
006-048-C05GACGTGGCNONE 
006-048-C05GCCACGTCNONE 
006-049-A07GACGTGGCNONE 
006-049-A07GCCACGTCNONE 
006-049-E03GACGTGGCNONE 
006-049-E03GCCACGTCNONE 
006-050-D08GACGTGGCNONE 
006-050-D08GCCACGTCNONE 
006-050-E02GACGTGGCNONE 
006-050-E02GCCACGTCNONE 
006-050-E07GACGTGGCNONE 
006-050-E07GCCACGTCNONE 
006-050-F11GACGTGGCNONE 
006-050-F11GCCACGTCNONE 
006-051-D04GACGTGGCNONE 
006-051-D04GCCACGTCNONE 
006-051-G07GACGTGGCNONE 
006-051-G07GCCACGTCNONE 
006-052-B06GACGTGGCNONE 
006-052-B06GCCACGTCNONE 
006-052-B11GACGTGGCNONE 
006-052-B11GCCACGTCNONE 
006-052-C06GACGTGGCNONE 
006-052-C06GCCACGTCNONE 
006-053-G03GACGTGGCNONE 
006-053-G03GCCACGTCNONE 
006-054-C01GACGTGGCNONE 
006-054-C01GCCACGTCNONE 
006-054-D09GACGTGGCNONE 
006-054-D09GCCACGTCNONE 
006-056-B11GACGTGGCNONE 
006-056-B11GCCACGTCNONE 
006-056-C07GACGTGGCNONE 
006-056-C07GCCACGTCNONE 
006-056-C12GACGTGGCNONE 
006-056-C12GCCACGTCNONE 
006-057-C05GACGTGGCNONE 
006-057-C05GCCACGTCNONE 
006-057-E08GACGTGGCNONE 
006-057-E08GCCACGTCNONE 
006-058-F03GACGTGGCNONE 
006-058-F03GCCACGTCNONE 
006-059-A03GACGTGGCNONE 
006-059-A03GCCACGTCNONE 
006-059-C12GACGTGGCNONE 
006-059-C12GCCACGTCNONE 
006-062-A06GACGTGGCNONE 
006-062-A06GCCACGTCNONE 
006-062-H04GACGTGGCNONE 
006-062-H04GCCACGTCNONE 
006-063-B08GACGTGGCNONE 
006-063-B08GCCACGTCNONE 
006-063-B10GACGTGGCNONE 
006-063-B10GCCACGTCNONE 
006-063-D11GACGTGGCNONE 
006-063-D11GCCACGTCNONE 
006-063-H07GACGTGGCNONE 
006-063-H07GCCACGTCNONE 
006-065-F08GACGTGGCNONE 
006-065-F08GCCACGTCNONE 
006-067-F07GACGTGGCNONE 
006-067-F07GCCACGTCNONE 
006-067-G04GACGTGGCNONE 
006-067-G04GCCACGTCNONE 
006-067-G12GACGTGGCNONE 
006-067-G12GCCACGTCNONE 
006-068-A12GACGTGGCNONE 
006-068-A12GCCACGTCNONE 
006-068-E08GACGTGGCNONE 
006-068-E08GCCACGTCNONE 
006-068-H01GACGTGGCNONE 
006-068-H01GCCACGTCNONE 
006-069-C01GACGTGGCNONE 
006-069-C01GCCACGTCNONE 
006-069-E08GACGTGGCNONE 
006-069-E08GCCACGTCNONE 
006-070-D05GACGTGGCNONE 
006-070-D05GCCACGTCNONE 
006-070-E10GACGTGGCNONE 
006-070-E10GCCACGTCNONE 
006-071-A02GACGTGGCNONE 
006-071-A02GCCACGTCNONE 
006-072-C01GACGTGGCNONE 
006-072-C01GCCACGTCNONE 
006-073-B07GACGTGGCNONE 
006-073-B07GCCACGTCNONE 
006-073-D02GACGTGGCNONE 
006-073-D02GCCACGTCNONE 
006-073-F06GACGTGGCNONE 
006-073-F06GCCACGTCNONE 
006-075-B10GACGTGGCNONE 
006-075-B10GCCACGTCNONE 
006-075-C01GACGTGGCNONE 
006-075-C01GCCACGTCNONE 
006-076-E10GACGTGGCNONE 
006-076-E10GCCACGTCNONE 
006-076-H12GACGTGGCNONE 
006-076-H12GCCACGTCNONE 
006-077-B10GACGTGGCNONE 
006-077-B10GCCACGTCNONE 
006-077-F12GACGTGGCNONE 
006-077-F12GCCACGTCNONE 
006-078-C04GACGTGGCNONE 
006-078-C04GCCACGTCNONE 
006-078-C10GACGTGGCNONE 
006-078-C10GCCACGTCNONE 
006-078-H11GACGTGGCNONE 
006-078-H11GCCACGTCNONE 
006-079-A05GACGTGGCNONE 
006-079-A05GCCACGTCNONE 
006-079-C01GACGTGGCNONE 
006-079-C01GCCACGTCNONE 
006-079-E04GACGTGGCNONE 
006-079-E04GCCACGTCNONE 
006-079-H06GACGTGGCNONE 
006-079-H06GCCACGTCNONE 
006-080-G05GACGTGGCNONE 
006-080-G05GCCACGTCNONE 
006-081-C07GACGTGGCNONE 
006-081-C07GCCACGTCNONE 
006-081-H07GACGTGGCNONE 
006-081-H07GCCACGTCNONE 
006-082-A09GACGTGGCNONE 
006-082-A09GCCACGTCNONE 
006-082-D02GACGTGGCNONE 
006-082-D02GCCACGTCNONE 
006-084-B11GACGTGGCNONE 
006-084-B11GCCACGTCNONE 
006-085-G10GACGTGGCNONE 
006-085-G10GCCACGTCNONE 
006-086-A05GACGTGGCNONE 
006-086-A05GCCACGTCNONE 
006-086-B05GACGTGGCNONE 
006-086-B05GCCACGTCNONE 
006-086-F09GACGTGGCNONE 
006-086-F09GCCACGTCNONE 
006-088-B09GACGTGGCNONE 
006-088-B09GCCACGTCNONE 
006-088-D02GACGTGGCNONE 
006-088-D02GCCACGTCNONE 
006-088-D10GACGTGGCNONE 
006-088-D10GCCACGTCNONE 
006-088-F05GACGTGGCNONE 
006-088-F05GCCACGTCNONE 
006-089-C06GACGTGGCNONE 
006-089-C06GCCACGTCNONE 
006-092-C07GACGTGGCNONE 
006-092-C07GCCACGTCNONE 
006-092-C08GACGTGGCNONE 
006-092-C08GCCACGTCNONE 
006-092-G09GACGTGGCNONE 
006-092-G09GCCACGTCNONE 
006-093-D12GACGTGGCNONE 
006-093-D12GCCACGTCNONE 
006-093-H10GACGTGGCNONE 
006-093-H10GCCACGTCNONE 
006-094-E07GACGTGGCNONE 
006-094-E07GCCACGTCNONE 
006-095-G01GACGTGGCNONE 
006-095-G01GCCACGTCNONE 
006-096-A10GACGTGGCNONE 
006-096-A10GCCACGTCNONE 
006-097-B06GACGTGGCNONE 
006-097-B06GCCACGTCNONE 
006-097-H12GACGTGGCNONE 
006-097-H12GCCACGTCNONE 
006-098-A08GACGTGGCNONE 
006-098-A08GCCACGTCNONE 
006-098-A10GACGTGGCNONE 
006-098-A10GCCACGTCNONE 
006-098-C10GACGTGGCNONE 
006-098-C10GCCACGTCNONE 
006-098-D02GACGTGGCNONE 
006-098-D02GCCACGTCNONE 
006-098-F10GACGTGGCNONE 
006-098-F10GCCACGTCNONE 
006-099-B08GACGTGGCNONE 
006-099-B08GCCACGTCNONE 
006-099-D02GACGTGGCNONE 
006-099-D02GCCACGTCNONE 
006-099-D05GACGTGGCNONE 
006-099-D05GCCACGTCNONE 
006-099-G10GACGTGGCNONE 
006-099-G10GCCACGTCNONE 
006-100-G06GACGTGGCNONE 
006-100-G06GCCACGTCNONE 
006-102-G09GACGTGGCNONE 
006-102-G09GCCACGTCNONE 
006-104-F06GACGTGGCNONE 
006-104-F06GCCACGTCNONE 
006-105-A12GACGTGGCNONE 
006-105-A12GCCACGTCNONE 
006-105-D04GACGTGGCNONE 
006-105-D04GCCACGTCNONE 
006-105-F05GACGTGGCNONE 
006-105-F05GCCACGTCNONE 
006-106-B01GACGTGGCNONE 
006-106-B01GCCACGTCNONE 
006-106-D05GACGTGGCNONE 
006-106-D05GCCACGTCNONE 
006-107-B01GACGTGGCNONE 
006-107-B01GCCACGTCNONE 
006-107-C02GACGTGGCNONE 
006-107-C02GCCACGTCNONE 
006-107-E01GACGTGGCNONE 
006-107-E01GCCACGTCNONE 
006-107-G03GACGTGGCNONE 
006-107-G03GCCACGTCNONE 
006-108-D09GACGTGGCNONE 
006-108-D09GCCACGTCNONE 
006-109-G01GACGTGGCNONE 
006-109-G01GCCACGTCNONE 
006-109-H07GACGTGGCNONE 
006-109-H07GCCACGTCNONE 
006-110-C04GACGTGGCNONE 
006-110-C04GCCACGTCNONE 
006-111-B11GACGTGGCNONE 
006-111-B11GCCACGTCNONE 
006-112-A02GACGTGGCNONE 
006-112-A02GCCACGTCNONE 
006-112-E03GACGTGGCNONE 
006-112-E03GCCACGTCNONE 
006-112-H04GACGTGGCNONE 
006-112-H04GCCACGTCNONE 
006-113-B07GACGTGGCNONE 
006-113-B07GCCACGTCNONE 
006-113-C08GACGTGGCNONE 
006-113-C08GCCACGTCNONE 
006-114-C12GACGTGGCNONE 
006-114-C12GCCACGTCNONE 
006-114-D06GACGTGGCNONE 
006-114-D06GCCACGTCNONE 
006-115-B06GACGTGGCNONE 
006-115-B06GCCACGTCNONE 
006-116-B01GACGTGGCNONE 
006-116-B01GCCACGTCNONE 
006-116-C02GACGTGGCNONE 
006-116-C02GCCACGTCNONE 
006-117-B05GACGTGGCNONE 
006-117-B05GCCACGTCNONE 
006-117-C06GACGTGGCNONE 
006-117-C06GCCACGTCNONE 
006-117-D10GACGTGGCNONE 
006-117-D10GCCACGTCNONE 
006-118-D04GACGTGGCNONE 
006-118-D04GCCACGTCNONE 
006-118-E12GACGTGGCNONE 
006-118-E12GCCACGTCNONE 
006-119-A06GACGTGGCNONE 
006-119-A06GCCACGTCNONE 
006-119-A09GACGTGGCNONE 
006-119-A09GCCACGTCNONE 
006-119-D02GACGTGGCNONE 
006-119-D02GCCACGTCNONE 
006-119-G07GACGTGGCNONE 
006-119-G07GCCACGTCNONE 
006-120-B03GACGTGGCNONE 
006-120-B03GCCACGTCNONE 
006-120-B07GACGTGGCNONE 
006-120-B07GCCACGTCNONE 
006-120-C01GACGTGGCNONE 
006-120-C01GCCACGTCNONE 
006-120-E04GACGTGGCNONE 
006-120-E04GCCACGTCNONE 
006-120-F11GACGTGGCNONE 
006-120-F11GCCACGTCNONE 
009-014-E11GACGTGGCNONE 
009-014-E11GCCACGTCNONE 
009-079-C06GACGTGGCNONE 
009-079-C06GCCACGTCNONE 
009-101-H06GACGTGGCNONE 
009-101-H06GCCACGTCNONE 
009-113-F07GACGTGGCNONE 
009-113-F07GCCACGTCNONE 
009-126-G04GACGTGGCNONE 
009-126-G04GCCACGTCNONE 
009-138-F01GACGTGGCNONE 
009-138-F01GCCACGTCNONE 
009-147-H02GACGTGGCNONE 
009-147-H02GCCACGTCNONE 
009-198-B08GACGTGGCNONE 
009-198-B08GCCACGTCNONE 
011-011-H03GACGTGGCNONE 
011-011-H03GCCACGTCNONE 
013-053-A06GACGTGGCNONE 
013-053-A06GCCACGTCNONE 
AK060886GACGTGGCNONE 
AK060886GCCACGTCNONE 
AK067715GACGTGGCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
AK067715GCCACGTCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
AK103920GACGTGGCNONE 
AK103920GCCACGTCNONE 
AK103937GACGTGGCNONE 
AK103937GCCACGTCNONE 
AK104080GACGTGGCNONE 
AK104080GCCACGTCNONE 
AK104649GACGTGGCNONE 
AK104649GCCACGTCNONE 
AK104760GACGTGGCNONE 
AK104760GCCACGTCNONE 
AK119163GACGTGGCNONE 
AK119163GCCACGTCNONE 
AK119188GACGTGGCNONE 
AK119188GCCACGTCNONE 
AK119515GACGTGGCNONE 
AK119515GCCACGTCNONE 
J013071M07GACGTGGCNONE 
J013071M07GCCACGTCNONE 
J013098E19GACGTGGCNONE 
J013098E19GCCACGTCNONE 
J013119C03GACGTGGCNONE 
J013119C03GCCACGTCNONE 
J013135O08GACGTGGCNONE 
J013135O08GCCACGTCNONE 
J023060H14GACGTGGCNONE 
J023060H14GCCACGTCNONE 
J023075M20GACGTGGCNONE 
J023075M20GCCACGTCNONE 
J023098P12GACGTGGCNONE 
J023098P12GCCACGTCNONE 
J053061C24GACGTGGCNONE 
J053061C24GCCACGTCNONE 
J053065C19GACGTGGCNONE 
J053065C19GCCACGTCNONE 
J053094K19GACGTGGCNONE 
J053094K19GCCACGTCNONE 
J075047M15GACGTGGCNONE 
J075047M15GCCACGTCNONE 
J075083H07GACGTGGCNONE 
J075083H07GCCACGTCNONE 
J075108K14GACGTGGCNONE 
J075108K14GCCACGTCNONE 
J075112B16GACGTGGCNONE 
J075112B16GCCACGTCNONE 
J075169L16GACGTGGCNONE 
J075169L16GCCACGTCNONE 
J075180P05GACGTGGCNONE 
J075180P05GCCACGTCNONE 
J075194D02GACGTGGCNONE 
J075194D02GCCACGTCNONE 
J080013D18GACGTGGCNONE 
J080013D18GCCACGTCNONE 
J080016G20GACGTGGCNONE 
J080016G20GCCACGTCNONE 
J080017E18GACGTGGCNONE 
J080017E18GCCACGTCNONE 
J080018J18GACGTGGCNONE 
J080018J18GCCACGTCNONE 
J080018N18GACGTGGCNONE 
J080018N18GCCACGTCNONE 
J080036G23GACGTGGCNONE 
J080036G23GCCACGTCNONE 
J080038O04GACGTGGCNONE 
J080038O04GCCACGTCNONE 
J080038P09GACGTGGCNONE 
J080038P09GCCACGTCNONE 
J080039N23GACGTGGCNONE 
J080039N23GCCACGTCNONE 
J080043F01GACGTGGCNONE 
J080043F01GCCACGTCNONE 
J080064J05GACGTGGCNONE 
J080064J05GCCACGTCNONE 
J080067C16GACGTGGCNONE 
J080067C16GCCACGTCNONE 
J080069B15GACGTGGCNONE 
J080069B15GCCACGTCNONE 
J080071H03GACGTGGCNONE 
J080071H03GCCACGTCNONE 
J080086L16GACGTGGCNONE 
J080086L16GCCACGTCNONE 
J080088H01GACGTGGCNONE 
J080088H01GCCACGTCNONE 
J080089B09GACGTGGCNONE 
J080089B09GCCACGTCNONE 
J080090K14GACGTGGCNONE 
J080090K14GCCACGTCNONE 
J080090N19GACGTGGCNONE 
J080090N19GCCACGTCNONE 
J080093H07GACGTGGCNONE 
J080093H07GCCACGTCNONE 
J080097B17GACGTGGCNONE 
J080097B17GCCACGTCNONE 
J080301J11GACGTGGCNONE 
J080301J11GCCACGTCNONE 
J080301K18GACGTGGCNONE 
J080301K18GCCACGTCNONE 
J080305K22GACGTGGCNONE 
J080305K22GCCACGTCNONE 
J090008D23GACGTGGCNONE 
J090008D23GCCACGTCNONE 
J090013H02GACGTGGCNONE 
J090013H02GCCACGTCNONE 
J090031N19GACGTGGCNONE 
J090031N19GCCACGTCNONE 
J090053G01GACGTGGCNONE 
J090053G01GCCACGTCNONE 
Os01g0559000006-032-B11GAGACGTGGCGNONE 
AK061456GAGACGTGGCGProtein of unknown function DUF1000 family protein. 
Os01g0564400J013160K14GCCACGTCACNONE 
J065063D15GCCACGTCACNONE 
J065162D09GCCACGTCACNONE 
J075006C23GCCACGTCACNONE 
J075112F15GCCACGTCACNONE 
Os01g0612600004-008-D07GACGTGGCGNONE 
009-057-C09GACGTGGCGNONE 
009-130-C01GACGTGGCGNONE 
AK062906GACGTGGCGNONE 
AK066561GACGTGGCGProtein of unknown function DUF1644 family protein. 
J013065E14GACGTGGCGNONE 
J013073D14GACGTGGCGNONE 
J023014A21GACGTGGCGNONE 
J023073M13GACGTGGCGNONE 
J023079F02GACGTGGCGNONE 
J023083B16GACGTGGCGNONE 
J023090G19GACGTGGCGNONE 
J023095F15GACGTGGCGNONE 
J023119H11GACGTGGCGNONE 
J033040B01GACGTGGCGNONE 
J033044F13GACGTGGCGNONE 
J033081E23GACGTGGCGNONE 
J033121K07GACGTGGCGNONE 
J033124D11GACGTGGCGNONE 
J033131N22GACGTGGCGNONE 
J065179E10GACGTGGCGNONE 
J090020A13GACGTGGCGNONE 
J090045K17GACGTGGCGNONE 
J090047M24GACGTGGCGNONE 
J090064G23GACGTGGCGNONE 
J090084G08GACGTGGCGNONE 
J090086F18GACGTGGCGNONE 
J100032D09GACGTGGCGNONE 
J100037O18GACGTGGCGNONE 
J100042B03GACGTGGCGNONE 
J100061D06GACGTGGCGNONE 
J100061I03GACGTGGCGNONE 
J100063B17GACGTGGCGNONE 
Os01g0633400AK108988GACGTGGCTGGGCCBS domain containing protein. 
Os01g0698300AK100582CGCCACGTCZinc finger, BED-type predicted domain containing protein. 
J023105O09CGCCACGTCNONE 
J023119F15CGCCACGTCNONE 
J075007N19CGCCACGTCNONE 
J075010F10CGCCACGTCNONE 
J075032M22CGCCACGTCNONE 
J075038E01CGCCACGTCNONE 
J075064J17CGCCACGTCNONE 
J075109L20CGCCACGTCNONE 
J075131O16CGCCACGTCNONE 
J075176A17CGCCACGTCNONE 
J075178N11CGCCACGTCNONE 
J075181N15CGCCACGTCNONE 
J090060I06CGCCACGTCNONE 
J090097O21CGCCACGTCNONE 
Os01g0708300AK060040GCCACGTCNONE 
Os01g0727400AK065692GCCACGTCConserved hypothetical protein. 
Os01g0745400AK107872GACGTGGCGSec34-like protein family protein. 
AK107872GACGTGGCGSec34-like protein family protein. 
Os01g0764800AK102809GACGTGGCSimilar to Nt-gh3 deduced protein. 
Os01g0769900AK065563GCCACGTCConserved hypothetical protein. 
J013034F04GCCACGTCNONE 
J023014B14GCCACGTCNONE 
J023077M21GCCACGTCNONE 
J023150J16GCCACGTCNONE 
J090023N16GCCACGTCNONE 
J090088K13GCCACGTCNONE 
Os01g0816700AK100654GACGTGGCGTGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment). 
Os01g0836400AK068741GACGTGGCGNONE 
AK073540GACGTGGCGSAC3/GANP family protein. 
J023019D11GACGTGGCGNONE 
J023139O22GACGTGGCGNONE 
J033042J20GACGTGGCGNONE 
J033046M18GACGTGGCGNONE 
J033124J09GACGTGGCGNONE 
J090015E05GACGTGGCGNONE 
J090076J09GACGTGGCGNONE 
Os01g0841800AK111196GCCACGTCRibonuclease II and R domain containing protein. 
Os01g0851300AK101770GACGTGGCGTGReticulon family protein. 
J033064I03GACGTGGCGTGNONE 
J100058A05GACGTGGCGTGNONE 
Os01g0851400J065070P10GACGTGGCGMachado-Joseph disease protein MJD family protein. 
J065153F01GACGTGGCGNONE 
Os01g0860700009-026-D05GACGTGGCGNONE 
AK062402GACGTGGCGConserved hypothetical protein. 
Os01g0867900AK061366CACGCCACGTCProtein of unknown function DUF502 family protein. 
Os01g0869800006-029-F03GAGACGTGGCNONE 
006-067-H02GAGACGTGGCNONE 
006-084-A06GAGACGTGGCNONE 
AK058284GAGACGTGGCSimilar to Photosystem II subunit PsbS. 
AK071827GAGACGTGGCNONE 
AK104275GAGACGTGGCNONE 
J013049J07GAGACGTGGCNONE 
J033089F12GAGACGTGGCNONE 
J090094I11GAGACGTGGCNONE 
Os01g0900800009-086-C08GACGTGGCNONE 
AK068254GACGTGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK105713GACGTGGCNONE 
J053025O10GACGTGGCNONE 
J065063K24GACGTGGCNONE 
J065167N21GACGTGGCNONE 
J100060A20GACGTGGCNONE 
J100079J03GACGTGGCNONE 
J100087D11GACGTGGCNONE 
J100089K10GACGTGGCNONE 
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0913400AK099881CGCCACGTCProtein prenyltransferase domain containing protein. 
Os01g0930000009-174-C11GACGTGGCNONE 
AK065852GACGTGGCConserved hypothetical protein. 
Os01g0950900AK101121CGCCACGTCProtein of unknown function DUF221 domain containing protein. 
J023036H24CGCCACGTCNONE 
J023084G23CGCCACGTCNONE 
J033025J04CGCCACGTCNONE 
J033139J18CGCCACGTCNONE 
J090006A09CGCCACGTCNONE 
J090036D02CGCCACGTCNONE 
Os01g0965500J075073G20CGCCACGTCNuclear protein SET domain containing protein. 
Os01g0970400AK069207GCCACGTCEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169GCCACGTCNONE 
J023009L14GCCACGTCNONE 
J075025G03GCCACGTCNONE 
J075198E21GCCACGTCNONE 
J090004B14GCCACGTCNONE 
J090071P11GCCACGTCNONE 
J100075A22GCCACGTCNONE 
U34597GCCACGTCNONE 
Os01g0978100005-013-E01GACGTGGCNONE 
011-026-E02GACGTGGCNONE 
011-064-C01GACGTGGCNONE 
AK065007GACGTGGCNONE 
AK065652GACGTGGCSimilar to Cysteine synthase, mitochondrial precursor (EC 2.5.1.47) (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C). 
AK099217GACGTGGCNONE 
AK104704GACGTGGCNONE 
J013001E19GACGTGGCNONE 
J013034J22GACGTGGCNONE 
J013037A05GACGTGGCNONE 
J013038D12GACGTGGCNONE 
J013043A14GACGTGGCNONE 
J013044E11GACGTGGCNONE 
J013058F11GACGTGGCNONE 
J013059C10GACGTGGCNONE 
J013059E23GACGTGGCNONE 
J013071O13GACGTGGCNONE 
J013072D12GACGTGGCNONE 
J013096G01GACGTGGCNONE 
J013110E17GACGTGGCNONE 
J013130A19GACGTGGCNONE 
J013158G08GACGTGGCNONE 
J023037H20GACGTGGCNONE 
J023038G11GACGTGGCNONE 
J023042A17GACGTGGCNONE 
J023045C21GACGTGGCNONE 
J023052H13GACGTGGCNONE 
J023055O19GACGTGGCNONE 
J023065I12GACGTGGCNONE 
J023087I12GACGTGGCNONE 
J023114D12GACGTGGCNONE 
J023126P03GACGTGGCNONE 
J023132E20GACGTGGCNONE 
J023133N04GACGTGGCNONE 
J023134C14GACGTGGCNONE 
J033039O20GACGTGGCNONE 
J033067L02GACGTGGCNONE 
J033094O10GACGTGGCNONE 
J043017P11GACGTGGCNONE 
J043036C15GACGTGGCNONE 
J053090I03GACGTGGCNONE 
J065013F14GACGTGGCNONE 
J065019J10GACGTGGCNONE 
J065036E05GACGTGGCNONE 
J065040L23GACGTGGCNONE 
J065050A13GACGTGGCNONE 
J065089D03GACGTGGCNONE 
J065193N04GACGTGGCNONE 
J080011O20GACGTGGCNONE 
J080015K08GACGTGGCNONE 
J080022G05GACGTGGCNONE 
J080027N24GACGTGGCNONE 
J080032G19GACGTGGCNONE 
J080046A18GACGTGGCNONE 
J080046B08GACGTGGCNONE 
J080051L24GACGTGGCNONE 
J080053C23GACGTGGCNONE 
J080054I20GACGTGGCNONE 
J080074J03GACGTGGCNONE 
J080080M04GACGTGGCNONE 
J080080P15GACGTGGCNONE 
J080086L08GACGTGGCNONE 
J090019O07GACGTGGCNONE 
J090033L11GACGTGGCNONE 
J090036M14GACGTGGCNONE 
J100054D04GACGTGGCNONE 
J100064M06GACGTGGCNONE 
Os02g0103800006-046-H11GCCACGTCNONE 
006-060-B05GCCACGTCNONE 
006-097-A09GCCACGTCNONE 
006-102-A10GCCACGTCNONE 
006-104-E11GCCACGTCNONE 
006-112-D09GCCACGTCNONE 
AK061774GCCACGTCNONE 
AK065309GCCACGTCNONE 
AK106213GCCACGTCSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13GCCACGTCNONE 
J013026F06GCCACGTCNONE 
J013037O14GCCACGTCNONE 
J013066N06GCCACGTCNONE 
J013108G22GCCACGTCNONE 
J023050M15GCCACGTCNONE 
J023054B21GCCACGTCNONE 
J023073C23GCCACGTCNONE 
J023086H17GCCACGTCNONE 
J023105A20GCCACGTCNONE 
J065019E16GCCACGTCNONE 
J065064G10GCCACGTCNONE 
J065071C18GCCACGTCNONE 
J065103B02GCCACGTCNONE 
J065153G06GCCACGTCNONE 
J075152G24GCCACGTCNONE 
J075166P04GCCACGTCNONE 
J080001F02GCCACGTCNONE 
J080001M07GCCACGTCNONE 
J080001O05GCCACGTCNONE 
J080003I19GCCACGTCNONE 
J080004C12GCCACGTCNONE 
J080008E17GCCACGTCNONE 
J080008M08GCCACGTCNONE 
J080010H21GCCACGTCNONE 
J080011F22GCCACGTCNONE 
J080012C16GCCACGTCNONE 
J080013D20GCCACGTCNONE 
J080018K15GCCACGTCNONE 
J080020O14GCCACGTCNONE 
J080020P21GCCACGTCNONE 
J080021A07GCCACGTCNONE 
J080021B06GCCACGTCNONE 
J080022G21GCCACGTCNONE 
J080022P14GCCACGTCNONE 
J080023H24GCCACGTCNONE 
J080023M08GCCACGTCNONE 
J080027E08GCCACGTCNONE 
J080027E18GCCACGTCNONE 
J080027O16GCCACGTCNONE 
J080029M22GCCACGTCNONE 
J080034A17GCCACGTCNONE 
J080038G04GCCACGTCNONE 
J080040F13GCCACGTCNONE 
J080040F22GCCACGTCNONE 
J080041L15GCCACGTCNONE 
J080042L04GCCACGTCNONE 
J080042M14GCCACGTCNONE 
J080043C22GCCACGTCNONE 
J080043O09GCCACGTCNONE 
J080045N17GCCACGTCNONE 
J080046N08GCCACGTCNONE 
J080047K11GCCACGTCNONE 
J080047O06GCCACGTCNONE 
J080048H10GCCACGTCNONE 
J080048N03GCCACGTCNONE 
J080050N02GCCACGTCNONE 
J080051A05GCCACGTCNONE 
J080052I20GCCACGTCNONE 
J080053E08GCCACGTCNONE 
J080055P05GCCACGTCNONE 
J080056F15GCCACGTCNONE 
J080056H07GCCACGTCNONE 
J080057M20GCCACGTCNONE 
J080059K09GCCACGTCNONE 
J080059M10GCCACGTCNONE 
J080060B12GCCACGTCNONE 
J080061N09GCCACGTCNONE 
J080062H11GCCACGTCNONE 
J080062M13GCCACGTCNONE 
J080063D14GCCACGTCNONE 
J080063G10GCCACGTCNONE 
J080063H18GCCACGTCNONE 
J080066J23GCCACGTCNONE 
J080067J06GCCACGTCNONE 
J080069I11GCCACGTCNONE 
J080069O22GCCACGTCNONE 
J080070P11GCCACGTCNONE 
J080072D06GCCACGTCNONE 
J080072J22GCCACGTCNONE 
J080075A20GCCACGTCNONE 
J080076F11GCCACGTCNONE 
J080076J24GCCACGTCNONE 
J080076K05GCCACGTCNONE 
J080077O10GCCACGTCNONE 
J080078L19GCCACGTCNONE 
J080080I08GCCACGTCNONE 
J080081J23GCCACGTCNONE 
J080083A17GCCACGTCNONE 
J080085C05GCCACGTCNONE 
J080086G24GCCACGTCNONE 
J080087H02GCCACGTCNONE 
J080089A13GCCACGTCNONE 
J080090K08GCCACGTCNONE 
J080092M01GCCACGTCNONE 
J080095A19GCCACGTCNONE 
J080095B20GCCACGTCNONE 
J100028F13GCCACGTCNONE 
J100040G22GCCACGTCNONE 
Os02g0118400012-047-C10GCCACGTCNONE 
AK064002GCCACGTCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75). 
AK101004GCCACGTCNONE 
J065022L23GCCACGTCNONE 
J065087F24GCCACGTCNONE 
Os02g0123100011-014-B01GACGTGGCNONE 
012-013-G11GACGTGGCNONE 
016-011-A12GACGTGGCNONE 
AK063438GACGTGGCNONE 
AK064363GACGTGGCNONE 
AK101344GACGTGGCSimilar to Cell division control protein 28 (EC 2.7.1.37). 
X60375GACGTGGCNONE 
Os02g0127900AK102783GGTGACGTGGCHypothetical protein. 
J065042F15GGTGACGTGGCNONE 
J075005J10GGTGACGTGGCNONE 
J075038F02GGTGACGTGGCNONE 
J075048K10GGTGACGTGGCNONE 
J075064D21GGTGACGTGGCNONE 
J075074M07GGTGACGTGGCNONE 
J075078D20GGTGACGTGGCNONE 
J075109P15GGTGACGTGGCNONE 
J075115K24GGTGACGTGGCNONE 
J075135G01GGTGACGTGGCNONE 
J075156B07GGTGACGTGGCNONE 
Os02g0135800006-039-F03GCCACGTCNONE 
AB055156GCCACGTCSimilar to Sec13-like protein (Fragment). 
AK111732GCCACGTCNONE 
AK112028GCCACGTCNONE 
J023038B14GCCACGTCNONE 
J023039H16GCCACGTCNONE 
J033033L03GCCACGTCNONE 
J033082B07GCCACGTCNONE 
J065076M03GCCACGTCNONE 
J065159C05GCCACGTCNONE 
J075052L24GCCACGTCNONE 
J075087J09GCCACGTCNONE 
J075119I03GCCACGTCNONE 
J075124I20GCCACGTCNONE 
J100042B01GCCACGTCNONE 
J100067M10GCCACGTCNONE 
Os02g0139100009-069-E01GCCACGTCNONE 
AK065722GCCACGTCConserved hypothetical protein. 
J033139D09GCCACGTCNONE 
Os02g0158900AK108324CGCCACGTCSimilar to SNF4. 
Os02g0165500AK060547GACGTGGCGConserved hypothetical protein. 
Os02g0169000AK101628GCCACGTCConserved hypothetical protein. 
Os02g0180100005-013-B11GCCACGTCNONE 
AK067359GCCACGTCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700GCCACGTCNONE 
J013090O22GCCACGTCNONE 
J013099P19GCCACGTCNONE 
J090041M21GCCACGTCNONE 
J090049C14GCCACGTCNONE 
Os02g0188000011-003-E06CGCCACGTCNONE 
AK105236CGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os02g0245000AK119770GCCACGTCNONE 
AK119874GCCACGTCSWAP/Surp domain containing protein. 
J065038L11GCCACGTCNONE 
J100059I06GCCACGTCNONE 
J100076C23GCCACGTCNONE 
J100081P08GCCACGTCNONE 
J100084C13GCCACGTCNONE 
Os02g0254600014-004-F08GACGTGGCGNONE 
AK063627GACGTGGCGConserved hypothetical protein. 
J065022D02GACGTGGCGNONE 
J065168J03GACGTGGCGNONE 
J065170D03GACGTGGCGNONE 
J080021G21GACGTGGCGNONE 
J080069G24GACGTGGCGNONE 
J080071O10GACGTGGCGNONE 
J080072L02GACGTGGCGNONE 
J080093D22GACGTGGCGNONE 
Os02g0285800AK072177GACGTGGCSimilar to GTP-binding protein typA (Tyrosine phosphorylated protein A). 
AK099035GACGTGGCNONE 
Os02g0292800AK106941GCCACGTCProtein of unknown function DUF599 family protein. 
Os02g0299200AK105486GCCCGGCCACGTCIQ calmodulin-binding region domain containing protein. 
Os02g0464700AK107077GACGTGGCGConserved hypothetical protein. 
Os02g0506500AK062572CGCCACGTCNONE 
AK062572CGCCACGTCNONE 
AK062572GACGTGGCNONE 
AK063549CGCCACGTCNONE 
AK063549CGCCACGTCNONE 
AK063549GACGTGGCNONE 
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein. 
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein. 
AK101016GACGTGGCMolybdenum cofactor biosynthesis domain containing protein. 
AK109318CGCCACGTCNONE 
AK109318CGCCACGTCNONE 
AK109318GACGTGGCNONE 
J013000C16CGCCACGTCNONE 
J013000C16CGCCACGTCNONE 
J013000C16GACGTGGCNONE 
J013155N06CGCCACGTCNONE 
J013155N06CGCCACGTCNONE 
J013155N06GACGTGGCNONE 
J023067A02CGCCACGTCNONE 
J023067A02CGCCACGTCNONE 
J023067A02GACGTGGCNONE 
J023149E02CGCCACGTCNONE 
J023149E02CGCCACGTCNONE 
J023149E02GACGTGGCNONE 
J033033J18CGCCACGTCNONE 
J033033J18CGCCACGTCNONE 
J033033J18GACGTGGCNONE 
J033051O15CGCCACGTCNONE 
J033051O15CGCCACGTCNONE 
J033051O15GACGTGGCNONE 
J075034C22CGCCACGTCNONE 
J075034C22CGCCACGTCNONE 
J075034C22GACGTGGCNONE 
J075054O10CGCCACGTCNONE 
J075054O10CGCCACGTCNONE 
J075054O10GACGTGGCNONE 
J075108L14CGCCACGTCNONE 
J075108L14CGCCACGTCNONE 
J075108L14GACGTGGCNONE 
J090043O06CGCCACGTCNONE 
J090043O06CGCCACGTCNONE 
J090043O06GACGTGGCNONE 
J100024P03CGCCACGTCNONE 
J100024P03CGCCACGTCNONE 
J100024P03GACGTGGCNONE 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK058487GCCACGTCNONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
AK122107GCCACGTCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J033126F06GCCACGTCNONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04GCCACGTCNONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11GCCACGTCNONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14GCCACGTCNONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03GCCACGTCNONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05GCCACGTCNONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03GCCACGTCNONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05GCCACGTCNONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15GCCACGTCNONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24GCCACGTCNONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19GCCACGTCNONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05GCCACGTCNONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22GCCACGTCNONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23GCCACGTCNONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21GCCACGTCNONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20GCCACGTCNONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15GCCACGTCNONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19GCCACGTCNONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15GCCACGTCNONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19GCCACGTCNONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04GCCACGTCNONE 
Os02g0522700012-086-C03GCCACGTCACCNONE 
Os02g0530100AK058520GACGTGGCGHeavy metal transport/detoxification protein domain containing protein. 
Os02g0531450J065097O14GACGTGGCGHypothetical protein. 
J075155C16GACGTGGCGNONE 
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein. 
Os02g0534600GACGTGGCConserved hypothetical protein. 
Os02g0551600009-174-H09GCCACGTCACCNONE 
AK063102GCCACGTCACCConserved hypothetical protein. 
Os02g0579000AB028180GCCACGTCTCNONE 
AK108080GCCACGTCTCNo apical meristem (NAM) protein domain containing protein. 
J065045C05GCCACGTCTCNONE 
J065191M18GCCACGTCTCNONE 
J065207F02GCCACGTCTCNONE 
J065213H24GCCACGTCTCNONE 
J075003H02GCCACGTCTCNONE 
J075143B14GCCACGTCTCNONE 
J100051O03GCCACGTCTCNONE 
J100075K22GCCACGTCTCNONE 
Os02g0612600009-058-F12GACGTGGCNONE 
009-058-F12GACGTGGCGNONE 
AK062519GACGTGGCConserved hypothetical protein. 
AK062519GACGTGGCGConserved hypothetical protein. 
Os02g0612650Os02g0612650GACGTGGCNONE 
Os02g0612650GACGTGGCGNONE 
Os02g0652800AK063448CGCCACGTCMajor facilitator superfamily MFS_1 protein. 
Os02g0654100AK101814GCCACGTCSimilar to Enoyl-CoA hydratase. 
Os02g0658100AK064728CGCCACGTCNONE 
Os02g0669100012-068-E10CGCCACGTCNONE 
016-075-F09CGCCACGTCNONE 
AB011367CGCCACGTCNONE 
AK070197CGCCACGTCNONE 
AY587109CGCCACGTCDehydrin family protein. 
AY786415CGCCACGTCNONE 
J023042N13CGCCACGTCNONE 
J023128F01CGCCACGTCNONE 
J065002K05CGCCACGTCNONE 
J090057I09CGCCACGTCNONE 
J090067J23CGCCACGTCNONE 
J090071B04CGCCACGTCNONE 
J100018L23CGCCACGTCNONE 
J100036A11CGCCACGTCNONE 
J100063L18CGCCACGTCNONE 
J100071G02CGCCACGTCNONE 
J100084P19CGCCACGTCNONE 
Os02g0671200J065152N20CGCCACGTCNONE 
J075053E22CGCCACGTCConserved hypothetical protein. 
Os02g0677700AK119947CGCCACGTCNONE 
Os02g0697600011-021-B01GCCACGTCNONE 
AK121757GCCACGTCAAA ATPase domain containing protein. 
Os02g0717500AK067050GACGTGGCConserved hypothetical protein. 
J013092A12GACGTGGCNONE 
J013124H24GACGTGGCNONE 
J013154C11GACGTGGCNONE 
J075098L15GACGTGGCNONE 
J090083L24GACGTGGCNONE 
J100049G21GACGTGGCNONE 
J100073N20GACGTGGCNONE 
Os02g0720200AK105451CGCCACGTCNONE 
AK121803CGCCACGTCSimilar to 65kD microtubule associated protein. 
Os02g0744900AK061968GTGACGTGGCSimilar to Geranylgeranyl reductase (Fragment). 
AK098873GTGACGTGGCNONE 
J013001C18GTGACGTGGCNONE 
J080003D07GTGACGTGGCNONE 
J080003H24GTGACGTGGCNONE 
J080010C23GTGACGTGGCNONE 
J080011I04GTGACGTGGCNONE 
J080011O03GTGACGTGGCNONE 
J080012F13GTGACGTGGCNONE 
J080020E06GTGACGTGGCNONE 
J080025H22GTGACGTGGCNONE 
J080026D15GTGACGTGGCNONE 
J080028D20GTGACGTGGCNONE 
J080029P20GTGACGTGGCNONE 
J080031K22GTGACGTGGCNONE 
J080034I05GTGACGTGGCNONE 
J080036E11GTGACGTGGCNONE 
J080036H13GTGACGTGGCNONE 
J080037E17GTGACGTGGCNONE 
J080043N05GTGACGTGGCNONE 
J080044L23GTGACGTGGCNONE 
J080047N11GTGACGTGGCNONE 
J080048O04GTGACGTGGCNONE 
J080049M01GTGACGTGGCNONE 
J080050F21GTGACGTGGCNONE 
J080054F09GTGACGTGGCNONE 
J080055N20GTGACGTGGCNONE 
J080058C02GTGACGTGGCNONE 
J080058K15GTGACGTGGCNONE 
J080062G02GTGACGTGGCNONE 
J080066H16GTGACGTGGCNONE 
J080066O05GTGACGTGGCNONE 
J080067O16GTGACGTGGCNONE 
J080068E13GTGACGTGGCNONE 
J080069P16GTGACGTGGCNONE 
J080072M11GTGACGTGGCNONE 
J080076H09GTGACGTGGCNONE 
J080081G24GTGACGTGGCNONE 
J080082J05GTGACGTGGCNONE 
J080084I10GTGACGTGGCNONE 
J080087L24GTGACGTGGCNONE 
J080089H07GTGACGTGGCNONE 
J080089M05GTGACGTGGCNONE 
J080092G18GTGACGTGGCNONE 
J080095N08GTGACGTGGCNONE 
Os02g0771500006-096-D12GACGTGGCNONE 
006-096-D12GACGTGGCNONE 
006-096-D12GACGTGGCGNONE 
009-011-G02GACGTGGCNONE 
009-011-G02GACGTGGCNONE 
009-011-G02GACGTGGCGNONE 
AK062335GACGTGGCNONE 
AK062335GACGTGGCNONE 
AK062335GACGTGGCGNONE 
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
AK106018GACGTGGCGSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
Os02g0774300AK065228GACGTGGCGCCCCACCGCCCAGCCSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0803900AK106930GCCACGTCSimilar to UDP-glycosyltransferase 91D1. 
AK106930GCCACGTGGCGCCACGTCSimilar to UDP-glycosyltransferase 91D1. 
Os02g0827900AK099911CGCCACGTCSimilar to Signal peptidase 18 subunit (Fragment). 
Os02g0831600AB081951GACGTGGCNONE 
AK103279GACGTGGCAGO1 homologous protein. 
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein. 
Os03g0119900AK058741CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07CGCCACGTCNONE 
J065035O07CGCCACGTCACCGATCCGNONE 
J065165C24CGCCACGTCNONE 
J065165C24CGCCACGTCACCGATCCGNONE 
J075039M05CGCCACGTCNONE 
J075039M05CGCCACGTCACCGATCCGNONE 
Os03g0124900AK070284GCCACGTCVirulence factor, pectin lyase fold family protein. 
J013052O13GCCACGTCNONE 
J023048L01GCCACGTCNONE 
J090085D12GCCACGTCNONE 
Os03g0133100013-080-E12GCCACGTCNONE 
AK063608GCCACGTCHypothetical protein. 
AK119680GCCACGTCNONE 
J075192B05GCCACGTCNONE 
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK068968GCCCCACCGCGCGCGACGTGGCSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092CGCCACGTCACCCGCACGCGNONE 
AK100092GCCCCACCGCGCGCGACGTGGCNONE 
J023003L18CGCCACGTCACCCGCACGCGNONE 
J023003L18GCCCCACCGCGCGCGACGTGGCNONE 
J023022K18CGCCACGTCACCCGCACGCGNONE 
J023022K18GCCCCACCGCGCGCGACGTGGCNONE 
J023107H13CGCCACGTCACCCGCACGCGNONE 
J023107H13GCCCCACCGCGCGCGACGTGGCNONE 
J023107K02CGCCACGTCACCCGCACGCGNONE 
J023107K02GCCCCACCGCGCGCGACGTGGCNONE 
Os03g0144800AK103041CGCCACGTCSimilar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein). 
J013043M12CGCCACGTCNONE 
J013043N11CGCCACGTCNONE 
J013093E21CGCCACGTCNONE 
J033030E13CGCCACGTCNONE 
J033044H20CGCCACGTCNONE 
J033084H08CGCCACGTCNONE 
J033117F03CGCCACGTCNONE 
J043005E24CGCCACGTCNONE 
J065218M08CGCCACGTCNONE 
Os03g0149400AK111396GCCACGTCProtein prenyltransferase domain containing protein. 
Os03g0177400006-108-A03GCCACGTCNONE 
AK062030GCCACGTCNONE 
Os03g0183000006-054-A01GACGTGGCNONE 
009-133-H05GACGTGGCNONE 
AK060527GACGTGGCNONE 
AK060929GACGTGGCNONE 
AK101949GACGTGGCSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
J023007J03GACGTGGCNONE 
J033075A14GACGTGGCNONE 
J033075D23GACGTGGCNONE 
J065170B03GACGTGGCNONE 
J075118K09GACGTGGCNONE 
J100024E23GACGTGGCNONE 
J100025G08GACGTGGCNONE 
J100035L20GACGTGGCNONE 
J100040B04GACGTGGCNONE 
J100059P18GACGTGGCNONE 
J100075F05GACGTGGCNONE 
Os03g0187700009-155-F05GCCACGTCNONE 
J033140E21GCCACGTCNONE 
J033142E21GCCACGTCNONE 
J065014P17GCCACGTCNONE 
J065083L20GCCACGTCNONE 
J065092E08GCCACGTCNONE 
J065154C08GCCACGTCTarget SNARE coiled-coil region domain containing protein. 
J075142H08GCCACGTCNONE 
J075175K21GCCACGTCNONE 
J090070B20GCCACGTCNONE 
J100071M06GCCACGTCNONE 
Os03g0197300AK102651GCCACGTCCupin, RmlC-type domain containing protein. 
Os03g0201100AK102337GCCACGTCSimilar to Cyclophilin-like protein PPIL3b. 
J033091A16GCCACGTCNONE 
J075063K10GCCACGTCNONE 
J075092L23GCCACGTCNONE 
J075093A14GCCACGTCNONE 
Os03g0220700J100064H16CGCCACGTCNONE 
J100064H16CGCCACGTCNONE 
Os03g0251500AK101151CGCCACGTCNONE 
AK119298CGCCACGTCSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0251800AK067333CGCCACGTCACSimilar to Possible OmpA family member precursor. 
AK073337CGCCACGTCACNONE 
Os03g0297100006-113-D12GCCACGTCNONE 
AK061276GCCACGTCSimilar to 40S ribosomal protein S7. 
J033119B03GCCACGTCNONE 
J065205G10GCCACGTCNONE 
J080069C17GCCACGTCNONE 
J100069E15GCCACGTCNONE 
J100081D07GCCACGTCNONE 
Os03g0297400AK060653GCCACGTCGCGTCGCNONE 
AK061403GCCACGTCGCGTCGCNONE 
AK101597GCCACGTCGCGTCGCMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0298900006-028-C11GACGTGGCNONE 
AK060996GACGTGGCHypothetical protein. 
Os03g0303100015-002-B09GACGTGGCGNONE 
015-005-B02GACGTGGCGNONE 
015-017-E10GACGTGGCGNONE 
AK071041GACGTGGCGProtein of unknown function DUF1645 family protein. 
J065140F05GACGTGGCGNONE 
Os03g0308800AK066789GACGTGGCGNONE 
AK068534GACGTGGCGProtein prenyltransferase domain containing protein. 
Os03g0312500AK106657GCCACGTCSimilar to Inhibitor of apoptosis-like protein. 
AK109328GCCACGTCNONE 
Os03g0324800AK059868CGCCACGTCNONE 
AK071431CGCCACGTCHypothetical protein. 
Os03g0338600AK066604CGCCACGTCtRNA pseudouridine synthase family protein. 
Os03g0341600AK067497GCCACGTCConserved hypothetical protein. 
Os03g0370000AK100033CGCCACGTCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0388100AK059680GACGTGGCHeavy metal transport/detoxification protein domain containing protein. 
AK099133GACGTGGCNONE 
Os03g0411500AK058696GCCACGTCNONE 
AK071057GCCACGTCPeptidase S14, ClpP family protein. 
Os03g0413000009-180-E02TCCGTCCGACGTGGCGNONE 
009-188-B06TCCGTCCGACGTGGCGNONE 
AK060225TCCGTCCGACGTGGCGNONE 
AY062181TCCGTCCGACGTGGCGSimilar to Potential histone-like transcription factor. 
Os03g0429000AK102768CGCCACGTCProteinase inhibitor I25, cystatin domain containing protein. 
J033107F20CGCCACGTCNONE 
J065042C20CGCCACGTCNONE 
J065106L01CGCCACGTCNONE 
J065142N05CGCCACGTCNONE 
J075112D23CGCCACGTCNONE 
J080001J15CGCCACGTCNONE 
J080005I06CGCCACGTCNONE 
J080011L11CGCCACGTCNONE 
J080011P21CGCCACGTCNONE 
J080024E07CGCCACGTCNONE 
J080029G10CGCCACGTCNONE 
J080039C16CGCCACGTCNONE 
J080039E19CGCCACGTCNONE 
J080045E04CGCCACGTCNONE 
J080063D02CGCCACGTCNONE 
J080063L14CGCCACGTCNONE 
J080077L02CGCCACGTCNONE 
J080077O08CGCCACGTCNONE 
J080078D15CGCCACGTCNONE 
J080079M10CGCCACGTCNONE 
J080085D01CGCCACGTCNONE 
J080089E07CGCCACGTCNONE 
J080089E22CGCCACGTCNONE 
J080097B13CGCCACGTCNONE 
J080302C24CGCCACGTCNONE 
Os03g0581600J065037H09CGCCACGTCNONE 
J065183O12CGCCACGTCNONE 
Os03g0592500003-125-D02GACGTGGCGNONE 
006-021-F01GACGTGGCGNONE 
006-025-C12GACGTGGCGNONE 
006-027-A06GACGTGGCGNONE 
006-031-D08GACGTGGCGNONE 
006-031-H05GACGTGGCGNONE 
006-034-A10GACGTGGCGNONE 
006-034-H11GACGTGGCGNONE 
006-035-D10GACGTGGCGNONE 
006-037-H08GACGTGGCGNONE 
006-044-B09GACGTGGCGNONE 
006-044-F02GACGTGGCGNONE 
006-045-B11GACGTGGCGNONE 
006-045-E09GACGTGGCGNONE 
006-046-H12GACGTGGCGNONE 
006-047-D04GACGTGGCGNONE 
006-047-F02GACGTGGCGNONE 
006-050-C12GACGTGGCGNONE 
006-052-B07GACGTGGCGNONE 
006-053-A09GACGTGGCGNONE 
006-057-H02GACGTGGCGNONE 
006-061-G12GACGTGGCGNONE 
006-064-A04GACGTGGCGNONE 
006-067-G10GACGTGGCGNONE 
006-069-F06GACGTGGCGNONE 
006-070-D02GACGTGGCGNONE 
006-076-D11GACGTGGCGNONE 
006-078-B12GACGTGGCGNONE 
006-080-A10GACGTGGCGNONE 
006-082-B04GACGTGGCGNONE 
006-082-C05GACGTGGCGNONE 
006-082-C08GACGTGGCGNONE 
006-085-G08GACGTGGCGNONE 
006-086-E03GACGTGGCGNONE 
006-087-E03GACGTGGCGNONE 
006-088-A07GACGTGGCGNONE 
006-088-H06GACGTGGCGNONE 
006-089-G09GACGTGGCGNONE 
006-092-C03GACGTGGCGNONE 
006-092-C06GACGTGGCGNONE 
006-093-D09GACGTGGCGNONE 
006-097-B08GACGTGGCGNONE 
006-098-B09GACGTGGCGNONE 
006-102-D11GACGTGGCGNONE 
006-103-G02GACGTGGCGNONE 
006-104-A12GACGTGGCGNONE 
006-106-D10GACGTGGCGNONE 
006-108-A08GACGTGGCGNONE 
006-108-A12GACGTGGCGNONE 
006-108-B08GACGTGGCGNONE 
006-110-D07GACGTGGCGNONE 
006-110-D09GACGTGGCGNONE 
006-111-B04GACGTGGCGNONE 
006-111-G11GACGTGGCGNONE 
006-117-A08GACGTGGCGNONE 
006-119-A08GACGTGGCGNONE 
009-005-H11GACGTGGCGNONE 
009-013-A12GACGTGGCGNONE 
009-023-H09GACGTGGCGNONE 
009-056-D04GACGTGGCGNONE 
009-073-F11GACGTGGCGNONE 
009-127-B01GACGTGGCGNONE 
009-175-E01GACGTGGCGNONE 
AF022739GACGTGGCGNONE 
AF061577GACGTGGCGNONE 
AK058315GACGTGGCGNONE 
AK066762GACGTGGCGSimilar to Photosystem II type II chlorophyll a/b binding protein (Fragment). 
D00642GACGTGGCGNONE 
J013075I09GACGTGGCGNONE 
J023115C07GACGTGGCGNONE 
J065024G17GACGTGGCGNONE 
J065051K08GACGTGGCGNONE 
J065137D16GACGTGGCGNONE 
J075057E17GACGTGGCGNONE 
J075096E24GACGTGGCGNONE 
J075105K04GACGTGGCGNONE 
J075125F06GACGTGGCGNONE 
J075132E10GACGTGGCGNONE 
J075149I20GACGTGGCGNONE 
J075151M21GACGTGGCGNONE 
J075160K21GACGTGGCGNONE 
J075187C08GACGTGGCGNONE 
J075187E15GACGTGGCGNONE 
J075194K02GACGTGGCGNONE 
J075194L07GACGTGGCGNONE 
J090008E24GACGTGGCGNONE 
Os03g0596800AK073603GCCACGTCConserved hypothetical protein. 
J033052N01GCCACGTCNONE 
Os03g0647500015-025-E10GCCACGTCNONE 
AK064308GCCACGTCConserved hypothetical protein. 
AK103649GCCACGTCNONE 
J033135D01GCCACGTCNONE 
Os03g0663800011-023-B06GAGACGTGGCGNONE 
011-033-C06GAGACGTGGCGNONE 
012-011-E03GAGACGTGGCGNONE 
012-014-F04GAGACGTGGCGNONE 
012-027-C01GAGACGTGGCGNONE 
012-027-H07GAGACGTGGCGNONE 
012-031-A02GAGACGTGGCGNONE 
012-044-E05GAGACGTGGCGNONE 
012-045-G10GAGACGTGGCGNONE 
012-049-H02GAGACGTGGCGNONE 
012-053-G08GAGACGTGGCGNONE 
012-058-D07GAGACGTGGCGNONE 
012-061-H02GAGACGTGGCGNONE 
012-066-A02GAGACGTGGCGNONE 
012-074-F12GAGACGTGGCGNONE 
012-079-D08GAGACGTGGCGNONE 
012-081-E05GAGACGTGGCGNONE 
012-083-F04GAGACGTGGCGNONE 
012-084-F08GAGACGTGGCGNONE 
012-086-E08GAGACGTGGCGNONE 
012-086-F01GAGACGTGGCGNONE 
012-087-F03GAGACGTGGCGNONE 
012-087-H02GAGACGTGGCGNONE 
012-088-E05GAGACGTGGCGNONE 
012-089-B02GAGACGTGGCGNONE 
014-016-A04GAGACGTGGCGNONE 
AK105347GAGACGTGGCGNONE 
J075032I06GAGACGTGGCGNONE 
J075041O22GAGACGTGGCGNONE 
J075093E24GAGACGTGGCGNONE 
J075094E06GAGACGTGGCGNONE 
U45322GAGACGTGGCGCupin region domain containing protein. 
Os03g0668900AK108369GCCACGTCConserved hypothetical protein. 
Os03g0683700AK065067CGCCACGTCProtein of unknown function DUF810 family protein. 
Os03g0698900013-074-A08TCGTGGGCCACGTCNONE 
AK073303TCGTGGGCCACGTCAlkaline phytoceramidase family protein. 
AK103953TCGTGGGCCACGTCNONE 
J033024P22TCGTGGGCCACGTCNONE 
J065194N16TCGTGGGCCACGTCNONE 
J065195O11TCGTGGGCCACGTCNONE 
J075020F03TCGTGGGCCACGTCNONE 
J075032P18TCGTGGGCCACGTCNONE 
J075037H13TCGTGGGCCACGTCNONE 
J075147I01TCGTGGGCCACGTCNONE 
J075187B13TCGTGGGCCACGTCNONE 
J100043G08TCGTGGGCCACGTCNONE 
J100060L06TCGTGGGCCACGTCNONE 
J100063O21TCGTGGGCCACGTCNONE 
J100066O13TCGTGGGCCACGTCNONE 
J100072K20TCGTGGGCCACGTCNONE 
J100083G21TCGTGGGCCACGTCNONE 
J100085D07TCGTGGGCCACGTCNONE 
Os03g0725000AK059294GCCACGTCNONE 
J043026H11GCCACGTCNONE 
J065187O06GCCACGTCNONE 
J090066M23GCCACGTCNONE 
Os03g0738600AK073529CGCCACGTCSimilar to Lipoxygenase L-2 (EC 1.13.11.12). 
X64396CGCCACGTCNONE 
Os03g0744800AK059983GCCACGTCACemp24/gp25L/p24 family protein. 
J065067D01GCCACGTCACNONE 
J065122L19GCCACGTCACNONE 
J090041I03GCCACGTCACNONE 
J100039H03GCCACGTCACNONE 
Os03g0745000AK109590CGCCACGTCACCGCACNONE 
AY332465CGCCACGTCACCGCACNONE 
AY344486CGCCACGTCACCGCACNONE 
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein. 
Os03g0745600014-030-E09CGCCACGTCGGATCNONE 
J053057E07CGCCACGTCGGATCNONE 
J075044L08CGCCACGTCGGATCNONE 
J075069C24CGCCACGTCGGATCNONE 
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein. 
J075180G21CGCCACGTCGGATCNONE 
J075189M22CGCCACGTCGGATCNONE 
J075192P11CGCCACGTCGGATCNONE 
Os03g0764800AK104299GACGTGGCNONE 
Os03g0784000AK067337CGCCACGTCNONE 
AK100003CGCCACGTCFAD dependent oxidoreductase family protein. 
J013102O14CGCCACGTCNONE 
J013135F18CGCCACGTCNONE 
Os03g0784500AK109744GCCACGTCNONE 
Os03g0785200003-116-B06GCCACGTCNONE 
J013098I23GCCACGTCNONE 
J023002I24GCCACGTCMitochodrial transcription termination factor-related family protein. 
J075150G04GCCACGTCNONE 
Os03g0788500AK072204GCCACGTCSimilar to Calcium-dependent protein kinase 2. 
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE 
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE 
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE 
Os03g0810800006-060-G12GGTGACGTGGCNONE 
006-063-F08GGTGACGTGGCNONE 
006-102-H09GGTGACGTGGCNONE 
AK060010GGTGACGTGGCSimilar to Short-chain alcohol dehydrogenase. 
AK070201GGTGACGTGGCNONE 
AK105938GGTGACGTGGCNONE 
J023042C15GGTGACGTGGCNONE 
J053075K10GGTGACGTGGCNONE 
J065061E08GGTGACGTGGCNONE 
J065079B21GGTGACGTGGCNONE 
J065082F07GGTGACGTGGCNONE 
J065128H02GGTGACGTGGCNONE 
J065195C03GGTGACGTGGCNONE 
J090038F07GGTGACGTGGCNONE 
J090048P14GGTGACGTGGCNONE 
J090052C07GGTGACGTGGCNONE 
J090089M12GGTGACGTGGCNONE 
J090097F20GGTGACGTGGCNONE 
J100037H03GGTGACGTGGCNONE 
J100038K01GGTGACGTGGCNONE 
Os03g0820500J065073D04GCCACGTCSimilar to WCOR719. 
Os03g0822300AK060050GCCACGTCACRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
J065198I20GCCACGTCACNONE 
Os03g0837900AK068346GCCACGTCGGCCCAGAStreptomyces cyclase/dehydrase family protein. 
Os03g0852400006-021-C11GACGTGGCNONE 
006-048-D09GACGTGGCNONE 
006-059-C05GACGTGGCNONE 
006-078-E01GACGTGGCNONE 
006-082-H09GACGTGGCNONE 
AK060985GACGTGGCNONE 
AK109338GACGTGGCConserved hypothetical protein. 
Os03g0854800J090007D13CGCCACGTCACNONE 
J090085N22CGCCACGTCACNONE 
Os04g0259800AK111548GACGTGGCConserved hypothetical protein. 
Os04g0275966J065015F20GACGTGGCConserved hypothetical protein. 
J065118M18GACGTGGCNONE 
Os04g0286400009-144-C10GCCACGTCACCNONE 
AK062974GCCACGTCACCHypothetical protein. 
Os04g0313300AK121730GACGTGGCConserved hypothetical protein. 
J033082F07GACGTGGCNONE 
Os04g0367400006-079-G12GACGTGGCNONE 
006-079-G12GACGTGGCNONE 
AK061121GACGTGGCReticulon family protein. 
AK061121GACGTGGCReticulon family protein. 
AK100139GACGTGGCNONE 
AK100139GACGTGGCNONE 
J065009F13GACGTGGCNONE 
J065009F13GACGTGGCNONE 
J065032N11GACGTGGCNONE 
J065032N11GACGTGGCNONE 
J065039P10GACGTGGCNONE 
J065039P10GACGTGGCNONE 
J065124I05GACGTGGCNONE 
J065124I05GACGTGGCNONE 
J065197E16GACGTGGCNONE 
J065197E16GACGTGGCNONE 
Os04g0382300AK071912CGCCACGTCNONE 
AK101795CGCCACGTCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0389800AK109628GCCACGTCSimilar to Acetohydroxyacid synthase. 
Os04g0407900AK064758GACGTGGCSimilar to Cytochrom P450-like protein. 
Os04g0408900009-183-E05GCCACGTCNONE 
AK058627GCCACGTCSimilar to DNA-binding protein S1FA. 
J023014N01GCCACGTCNONE 
J023088K23GCCACGTCNONE 
J065086B17GCCACGTCNONE 
J065095F08GCCACGTCNONE 
J065119N11GCCACGTCNONE 
J100032H17GCCACGTCNONE 
Os04g0414700009-068-G12CGCCACGTCNONE 
009-070-D05CGCCACGTCNONE 
009-141-A08CGCCACGTCNONE 
009-144-A07CGCCACGTCNONE 
009-164-F03CGCCACGTCNONE 
AK058848CGCCACGTCConserved hypothetical protein. 
J013131F19CGCCACGTCNONE 
J013158N18CGCCACGTCNONE 
J023028J24CGCCACGTCNONE 
J023039K24CGCCACGTCNONE 
J065077F17CGCCACGTCNONE 
J065080G08CGCCACGTCNONE 
J065182N04CGCCACGTCNONE 
J065184G24CGCCACGTCNONE 
J065208A07CGCCACGTCNONE 
J065215H12CGCCACGTCNONE 
J075039D21CGCCACGTCNONE 
J075049C05CGCCACGTCNONE 
J075055E15CGCCACGTCNONE 
J075057O12CGCCACGTCNONE 
J075073K23CGCCACGTCNONE 
J075073N15CGCCACGTCNONE 
J075076A15CGCCACGTCNONE 
J075077D02CGCCACGTCNONE 
J075096M18CGCCACGTCNONE 
J075098M24CGCCACGTCNONE 
J075101G13CGCCACGTCNONE 
J075101O07CGCCACGTCNONE 
J075114F04CGCCACGTCNONE 
J075119K17CGCCACGTCNONE 
J075132E19CGCCACGTCNONE 
J075136P20CGCCACGTCNONE 
J075140E11CGCCACGTCNONE 
J075145D03CGCCACGTCNONE 
J075146B08CGCCACGTCNONE 
J075169B13CGCCACGTCNONE 
J075181A18CGCCACGTCNONE 
J075189H21CGCCACGTCNONE 
J075197F20CGCCACGTCNONE 
J075199J08CGCCACGTCNONE 
J080307B22CGCCACGTCNONE 
J090076J18CGCCACGTCNONE 
Os04g0434400014-079-B10GCCACGTCNONE 
AK063725GCCACGTCConserved hypothetical protein. 
Os04g0474600J023064N16CCCACGTGGCCACGTCGlycoside hydrolase, family 1 protein. 
J075175P11CCCACGTGGCCACGTCNONE 
J090080I16CCCACGTGGCCACGTCNONE 
J090089B01CCCACGTGGCCACGTCNONE 
Os04g0479000AK106344CGCCACGTCSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0479800AK121430GCCACGTCCyclin-like F-box domain containing protein. 
J033099N03GCCACGTCNONE 
J090035E10GCCACGTCNONE 
Os04g0502800AK099877GCCACGTCSimilar to Nodulin-like protein. 
J090040C16GCCACGTCNONE 
Os04g0510000AK109180GACGTGGCGConserved hypothetical protein. 
Os04g0530300009-053-E04GACGTGGCNONE 
009-074-E03GACGTGGCNONE 
AK066705GACGTGGCConserved hypothetical protein. 
Os04g0550200AK108473GCCACGTCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0561200AK107862GACGTGGCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J065028J03GACGTGGCNONE 
J065042H13GACGTGGCNONE 
J065079N01GACGTGGCNONE 
J065190N16GACGTGGCNONE 
J065191H22GACGTGGCNONE 
Os04g0583600AK059019CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
J023047G03CGCCACGTCNONE 
J075118B22CGCCACGTCNONE 
J090035A11CGCCACGTCNONE 
J090067I05CGCCACGTCNONE 
J100017K09CGCCACGTCNONE 
Os04g0589200AK068571GCCACGTCConserved hypothetical protein. 
AK102463GCCACGTCNONE 
J075083K10GCCACGTCNONE 
Os04g0608100AK072315GCCACGTCGalactokinase family protein. 
J013132F19GCCACGTCNONE 
J013149D17GCCACGTCNONE 
J023085J15GCCACGTCNONE 
J090029J22GCCACGTCNONE 
Os04g0623100006-042-D10GCCACGTCACNONE 
AK067276GCCACGTCACBromodomain containing protein. 
J013097L22GCCACGTCACNONE 
J013099L18GCCACGTCACNONE 
J023009D13GCCACGTCACNONE 
J023041M21GCCACGTCACNONE 
J090088H12GCCACGTCACNONE 
Os04g0623300AK064902GACGTGGCGSimilar to Flavin-containing monamine oxidase family protein. 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE 
Os04g0631200013-003-B06GACGTGGCGNONE 
AK059277GACGTGGCGSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331GACGTGGCGNONE 
J033024P08GACGTGGCGNONE 
J033041G02GACGTGGCGNONE 
J053075H12GACGTGGCGNONE 
J065016B13GACGTGGCGNONE 
J090075B22GACGTGGCGNONE 
J100084K17GACGTGGCGNONE 
Os04g0677800AK102572GCCACGTCZinc finger, RanBP2-type domain containing protein. 
AK110947GCCACGTCNONE 
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE 
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE 
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE 
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE 
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE 
AB037970TTGGCCCATGGGCCGCCACGTCNONE 
AK061836TTGGCCCATGGGCCGCCACGTCNONE 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AY074786TTGGCCCATGGGCCGCCACGTCNONE 
J013022K21TTGGCCCATGGGCCGCCACGTCNONE 
J013154A03TTGGCCCATGGGCCGCCACGTCNONE 
J023074C02TTGGCCCATGGGCCGCCACGTCNONE 
J023091I19TTGGCCCATGGGCCGCCACGTCNONE 
J023135M05TTGGCCCATGGGCCGCCACGTCNONE 
J065027L11TTGGCCCATGGGCCGCCACGTCNONE 
J065065A08TTGGCCCATGGGCCGCCACGTCNONE 
J065120A08TTGGCCCATGGGCCGCCACGTCNONE 
J065174A05TTGGCCCATGGGCCGCCACGTCNONE 
J065184O22TTGGCCCATGGGCCGCCACGTCNONE 
J065191D07TTGGCCCATGGGCCGCCACGTCNONE 
J065209D04TTGGCCCATGGGCCGCCACGTCNONE 
J075014F11TTGGCCCATGGGCCGCCACGTCNONE 
J075036D03TTGGCCCATGGGCCGCCACGTCNONE 
J075157D23TTGGCCCATGGGCCGCCACGTCNONE 
J080007F15TTGGCCCATGGGCCGCCACGTCNONE 
J080008N12TTGGCCCATGGGCCGCCACGTCNONE 
J080010F22TTGGCCCATGGGCCGCCACGTCNONE 
J080011C19TTGGCCCATGGGCCGCCACGTCNONE 
J080011F12TTGGCCCATGGGCCGCCACGTCNONE 
J080012E11TTGGCCCATGGGCCGCCACGTCNONE 
J080015B12TTGGCCCATGGGCCGCCACGTCNONE 
J080015O16TTGGCCCATGGGCCGCCACGTCNONE 
J080016G24TTGGCCCATGGGCCGCCACGTCNONE 
J080016K13TTGGCCCATGGGCCGCCACGTCNONE 
J080018A02TTGGCCCATGGGCCGCCACGTCNONE 
J080018H03TTGGCCCATGGGCCGCCACGTCNONE 
J080022M01TTGGCCCATGGGCCGCCACGTCNONE 
J080023D20TTGGCCCATGGGCCGCCACGTCNONE 
J080023I01TTGGCCCATGGGCCGCCACGTCNONE 
J080023J05TTGGCCCATGGGCCGCCACGTCNONE 
J080024A09TTGGCCCATGGGCCGCCACGTCNONE 
J080024I09TTGGCCCATGGGCCGCCACGTCNONE 
J080025A10TTGGCCCATGGGCCGCCACGTCNONE 
J080025G04TTGGCCCATGGGCCGCCACGTCNONE 
J080027D21TTGGCCCATGGGCCGCCACGTCNONE 
J080029M05TTGGCCCATGGGCCGCCACGTCNONE 
J080030J01TTGGCCCATGGGCCGCCACGTCNONE 
J080034D10TTGGCCCATGGGCCGCCACGTCNONE 
J080036F18TTGGCCCATGGGCCGCCACGTCNONE 
J080038N11TTGGCCCATGGGCCGCCACGTCNONE 
J080039B07TTGGCCCATGGGCCGCCACGTCNONE 
J080039E01TTGGCCCATGGGCCGCCACGTCNONE 
J080039K11TTGGCCCATGGGCCGCCACGTCNONE 
J080040B09TTGGCCCATGGGCCGCCACGTCNONE 
J080040G11TTGGCCCATGGGCCGCCACGTCNONE 
J080041H08TTGGCCCATGGGCCGCCACGTCNONE 
J080041H19TTGGCCCATGGGCCGCCACGTCNONE 
J080041O20TTGGCCCATGGGCCGCCACGTCNONE 
J080042C15TTGGCCCATGGGCCGCCACGTCNONE 
J080043C16TTGGCCCATGGGCCGCCACGTCNONE 
J080043F18TTGGCCCATGGGCCGCCACGTCNONE 
J080044B17TTGGCCCATGGGCCGCCACGTCNONE 
J080044N10TTGGCCCATGGGCCGCCACGTCNONE 
J080044O07TTGGCCCATGGGCCGCCACGTCNONE 
J080045H15TTGGCCCATGGGCCGCCACGTCNONE 
J080045I03TTGGCCCATGGGCCGCCACGTCNONE 
J080046A05TTGGCCCATGGGCCGCCACGTCNONE 
J080048I06TTGGCCCATGGGCCGCCACGTCNONE 
J080049L04TTGGCCCATGGGCCGCCACGTCNONE 
J080049M09TTGGCCCATGGGCCGCCACGTCNONE 
J080050G11TTGGCCCATGGGCCGCCACGTCNONE 
J080051G20TTGGCCCATGGGCCGCCACGTCNONE 
J080053C09TTGGCCCATGGGCCGCCACGTCNONE 
J080053I05TTGGCCCATGGGCCGCCACGTCNONE 
J080053P18TTGGCCCATGGGCCGCCACGTCNONE 
J080054K10TTGGCCCATGGGCCGCCACGTCNONE 
J080054P14TTGGCCCATGGGCCGCCACGTCNONE 
J080057L05TTGGCCCATGGGCCGCCACGTCNONE 
J080062K11TTGGCCCATGGGCCGCCACGTCNONE 
J080063C19TTGGCCCATGGGCCGCCACGTCNONE 
J080065B03TTGGCCCATGGGCCGCCACGTCNONE 
J080066E15TTGGCCCATGGGCCGCCACGTCNONE 
J080066H05TTGGCCCATGGGCCGCCACGTCNONE 
J080066I05TTGGCCCATGGGCCGCCACGTCNONE 
J080068O11TTGGCCCATGGGCCGCCACGTCNONE 
J080070L22TTGGCCCATGGGCCGCCACGTCNONE 
J080071I12TTGGCCCATGGGCCGCCACGTCNONE 
J080071N20TTGGCCCATGGGCCGCCACGTCNONE 
J080072D10TTGGCCCATGGGCCGCCACGTCNONE 
J080072I10TTGGCCCATGGGCCGCCACGTCNONE 
J080074G03TTGGCCCATGGGCCGCCACGTCNONE 
J080076E23TTGGCCCATGGGCCGCCACGTCNONE 
J080076N03TTGGCCCATGGGCCGCCACGTCNONE 
J080077N23TTGGCCCATGGGCCGCCACGTCNONE 
J080084B13TTGGCCCATGGGCCGCCACGTCNONE 
J080084F07TTGGCCCATGGGCCGCCACGTCNONE 
J080085J15TTGGCCCATGGGCCGCCACGTCNONE 
J080085P20TTGGCCCATGGGCCGCCACGTCNONE 
J080090F21TTGGCCCATGGGCCGCCACGTCNONE 
J080093H16TTGGCCCATGGGCCGCCACGTCNONE 
J080093J01TTGGCCCATGGGCCGCCACGTCNONE 
J080093L04TTGGCCCATGGGCCGCCACGTCNONE 
J080097E24TTGGCCCATGGGCCGCCACGTCNONE 
J090012G04TTGGCCCATGGGCCGCCACGTCNONE 
J090054K05TTGGCCCATGGGCCGCCACGTCNONE 
Os05g0119300004-011-B09GACGTGGCNONE 
006-063-A03GACGTGGCNONE 
006-077-E12GACGTGGCNONE 
006-079-E12GACGTGGCNONE 
006-100-B11GACGTGGCNONE 
009-109-A12GACGTGGCNONE 
009-123-C07GACGTGGCNONE 
009-163-D09GACGTGGCNONE 
009-170-D11GACGTGGCNONE 
009-173-C01GACGTGGCNONE 
009-192-E01GACGTGGCNONE 
011-048-G01GACGTGGCNONE 
AK060883GACGTGGCNONE 
AK068289GACGTGGCNONE 
AK071554GACGTGGCNONE 
AK099495GACGTGGCXYPPX repeat containing protein. 
AY348312GACGTGGCNONE 
J013037L16GACGTGGCNONE 
J013088P04GACGTGGCNONE 
J013099D14GACGTGGCNONE 
J013146E19GACGTGGCNONE 
J013147E18GACGTGGCNONE 
J023104E19GACGTGGCNONE 
J023128O20GACGTGGCNONE 
J023132D16GACGTGGCNONE 
J023143E13GACGTGGCNONE 
J033028F15GACGTGGCNONE 
J033133D24GACGTGGCNONE 
J053091M07GACGTGGCNONE 
J075029L15GACGTGGCNONE 
J075097M12GACGTGGCNONE 
J075103J11GACGTGGCNONE 
J075138J10GACGTGGCNONE 
J075172K18GACGTGGCNONE 
J080001C15GACGTGGCNONE 
J080002M13GACGTGGCNONE 
J080009K01GACGTGGCNONE 
J080010N01GACGTGGCNONE 
J080011D23GACGTGGCNONE 
J080013C13GACGTGGCNONE 
J080013M16GACGTGGCNONE 
J080018J02GACGTGGCNONE 
J080020F03GACGTGGCNONE 
J080020G05GACGTGGCNONE 
J080021D05GACGTGGCNONE 
J080030A19GACGTGGCNONE 
J080031A16GACGTGGCNONE 
J080033J23GACGTGGCNONE 
J080035H07GACGTGGCNONE 
J080039M24GACGTGGCNONE 
J080042B16GACGTGGCNONE 
J080043B03GACGTGGCNONE 
J080045G01GACGTGGCNONE 
J080045K17GACGTGGCNONE 
J080047A09GACGTGGCNONE 
J080047I22GACGTGGCNONE 
J080048M14GACGTGGCNONE 
J080049J02GACGTGGCNONE 
J080052C15GACGTGGCNONE 
J080052E11GACGTGGCNONE 
J080052M22GACGTGGCNONE 
J080056O21GACGTGGCNONE 
J080059J04GACGTGGCNONE 
J080059O17GACGTGGCNONE 
J080064N04GACGTGGCNONE 
J080066A03GACGTGGCNONE 
J080066I22GACGTGGCNONE 
J080069C13GACGTGGCNONE 
J080069J03GACGTGGCNONE 
J080069N04GACGTGGCNONE 
J080071A01GACGTGGCNONE 
J080071C03GACGTGGCNONE 
J080071J02GACGTGGCNONE 
J080080D17GACGTGGCNONE 
J080084O06GACGTGGCNONE 
J080085O20GACGTGGCNONE 
J080086H15GACGTGGCNONE 
J080094K06GACGTGGCNONE 
J080095C05GACGTGGCNONE 
J080095G04GACGTGGCNONE 
J080096F03GACGTGGCNONE 
J080096F20GACGTGGCNONE 
J090004H05GACGTGGCNONE 
J090012P10GACGTGGCNONE 
J090021B09GACGTGGCNONE 
J090034M08GACGTGGCNONE 
J090046G21GACGTGGCNONE 
J090055K24GACGTGGCNONE 
J090055L05GACGTGGCNONE 
J090057H17GACGTGGCNONE 
J090082K21GACGTGGCNONE 
J100022A07GACGTGGCNONE 
J100022M02GACGTGGCNONE 
J100069K11GACGTGGCNONE 
J100086C24GACGTGGCNONE 
Os05g0129400AK102359ATCCGACGTGGCAnkyrin repeat containing protein. 
J033091I05ATCCGACGTGGCNONE 
Os05g0140800AK110652CGCCACGTCSimilar to Dormancy related protein (Fragment). 
J075019K14CGCCACGTCNONE 
J075020O11CGCCACGTCNONE 
J075028P06CGCCACGTCNONE 
J075050A16CGCCACGTCNONE 
J075051F18CGCCACGTCNONE 
J075085K03CGCCACGTCNONE 
J075112P22CGCCACGTCNONE 
J075118I09CGCCACGTCNONE 
J075144H09CGCCACGTCNONE 
J075166I07CGCCACGTCNONE 
J075191J02CGCCACGTCNONE 
J075195I23CGCCACGTCNONE 
Os05g0142400009-025-C05GCCACGTCNONE 
009-128-B02GCCACGTCNONE 
AK062395GCCACGTCConserved hypothetical protein. 
J065177G20GCCACGTCNONE 
J075015F02GCCACGTCNONE 
J100039M05GCCACGTCNONE 
J100058B01GCCACGTCNONE 
J100078E16GCCACGTCNONE 
J100079E02GCCACGTCNONE 
Os05g0148600003-016-C11GCCACGTCNONE 
AK066168GCCACGTCNONE 
AK104336GCCACGTCSimilar to Na+/H+ antiporter. 
AY360145GCCACGTCNONE 
J013055J22GCCACGTCNONE 
J013057M24GCCACGTCNONE 
J013074N03GCCACGTCNONE 
J013158A22GCCACGTCNONE 
J075118H09GCCACGTCNONE 
Os05g0150600011-043-D06GACGTGGCNONE 
AK072977GACGTGGCATP-dependent DNA helicase RecQ family protein. 
AY180331GACGTGGCNONE 
J090053A16GACGTGGCNONE 
Os05g0170200013-081-D01CGCCACGTCNONE 
013-083-D05CGCCACGTCNONE 
AK063609CGCCACGTCNONE 
AK063611CGCCACGTCConserved hypothetical protein. 
AY594285CGCCACGTCNONE 
J100032N15CGCCACGTCNONE 
Os05g0173500012-044-H03GCCACGTCNONE 
AK103535GCCACGTCNONE 
AK105434GCCACGTCConserved hypothetical protein. 
J023014F19GCCACGTCNONE 
J033064J08GCCACGTCNONE 
J033132B04GCCACGTCNONE 
J033133C01GCCACGTCNONE 
J100090A17GCCACGTCNONE 
Os05g0193800AK058865CGCCACGTCNONE 
AK067940CGCCACGTCConserved hypothetical protein. 
J065043K19CGCCACGTCNONE 
J065095O10CGCCACGTCNONE 
J065095O12CGCCACGTCNONE 
J080002K02CGCCACGTCNONE 
J080012L17CGCCACGTCNONE 
J080013J02CGCCACGTCNONE 
J080013O11CGCCACGTCNONE 
J080020A17CGCCACGTCNONE 
J080028E18CGCCACGTCNONE 
J080036P11CGCCACGTCNONE 
J080042E10CGCCACGTCNONE 
J080042L10CGCCACGTCNONE 
J080047B11CGCCACGTCNONE 
J080048N05CGCCACGTCNONE 
J080057E20CGCCACGTCNONE 
J080057K13CGCCACGTCNONE 
J080058L03CGCCACGTCNONE 
J080063H07CGCCACGTCNONE 
J080066L23CGCCACGTCNONE 
J080069G22CGCCACGTCNONE 
J080072E12CGCCACGTCNONE 
J080076D06CGCCACGTCNONE 
J080077A22CGCCACGTCNONE 
J080081A01CGCCACGTCNONE 
J080090M13CGCCACGTCNONE 
J080093G07CGCCACGTCNONE 
J080094O20CGCCACGTCNONE 
J080097F13CGCCACGTCNONE 
Os05g0215700AK107771GACGTGGCGNONE 
AK119724GACGTGGCGConserved hypothetical protein. 
J065013E03GACGTGGCGNONE 
J065157J11GACGTGGCGNONE 
J065166M22GACGTGGCGNONE 
Os05g0292800009-175-B10GCCACGTCNONE 
AK059562GCCACGTCSimilar to One helix protein (OHP). 
J065057G13GCCACGTCNONE 
J065094A01GCCACGTCNONE 
J065144G23GCCACGTCNONE 
J075133N20GCCACGTCNONE 
Os05g0325200J090038J19GCCACGTCCyclin-like domain containing protein. 
Os05g0346300009-033-C06GTGACGTGGCNONE 
009-033-C06GTGACGTGGCNONE 
AF529175GTGACGTGGCNONE 
AF529175GTGACGTGGCNONE 
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7. 
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7. 
AK103081GTGACGTGGCNONE 
AK103081GTGACGTGGCNONE 
AK104191GTGACGTGGCNONE 
AK104191GTGACGTGGCNONE 
J013049B09GTGACGTGGCNONE 
J013049B09GTGACGTGGCNONE 
J023142E24GTGACGTGGCNONE 
J023142E24GTGACGTGGCNONE 
J033052M14GTGACGTGGCNONE 
J033052M14GTGACGTGGCNONE 
J033089N04GTGACGTGGCNONE 
J033089N04GTGACGTGGCNONE 
J033118F01GTGACGTGGCNONE 
J033118F01GTGACGTGGCNONE 
J065054E07GTGACGTGGCNONE 
J065054E07GTGACGTGGCNONE 
J065066L18GTGACGTGGCNONE 
J065066L18GTGACGTGGCNONE 
J065078C21GTGACGTGGCNONE 
J065078C21GTGACGTGGCNONE 
J065127G23GTGACGTGGCNONE 
J065127G23GTGACGTGGCNONE 
J065128N24GTGACGTGGCNONE 
J065128N24GTGACGTGGCNONE 
J065144P17GTGACGTGGCNONE 
J065144P17GTGACGTGGCNONE 
J065147P14GTGACGTGGCNONE 
J065147P14GTGACGTGGCNONE 
J065170E16GTGACGTGGCNONE 
J065170E16GTGACGTGGCNONE 
J065175D17GTGACGTGGCNONE 
J065175D17GTGACGTGGCNONE 
J065176M05GTGACGTGGCNONE 
J065176M05GTGACGTGGCNONE 
J065218G20GTGACGTGGCNONE 
J065218G20GTGACGTGGCNONE 
J090074J12GTGACGTGGCNONE 
J090074J12GTGACGTGGCNONE 
J100019H16GTGACGTGGCNONE 
J100019H16GTGACGTGGCNONE 
J100031N24GTGACGTGGCNONE 
J100031N24GTGACGTGGCNONE 
J100072G08GTGACGTGGCNONE 
J100072G08GTGACGTGGCNONE 
J100086I23GTGACGTGGCNONE 
J100086I23GTGACGTGGCNONE 
Os05g0346400AK058872GCCACGTCACNONE 
AK058872GCCACGTCACNONE 
AK102727GCCACGTCACProtein of unknown function DUF538 family protein. 
AK102727GCCACGTCACProtein of unknown function DUF538 family protein. 
J033105N07GCCACGTCACNONE 
J033105N07GCCACGTCACNONE 
J100077I17GCCACGTCACNONE 
J100077I17GCCACGTCACNONE 
Os05g0357850J065118C17GCCACGTCHypothetical protein. 
J065159C03GCCACGTCNONE 
Os05g0372400AK068781CGCCACGTCLipase, class 3 family protein. 
Os05g0377000Os05g0377000CGCCACGTCSimilar to Acyl carrier protein (ACP). 
Os05g0404400004-002-D12GCCACGTCNONE 
006-041-E06GCCACGTCNONE 
009-059-D02GCCACGTCNONE 
AK065418GCCACGTCConserved hypothetical protein. 
AK104172GCCACGTCNONE 
AK104635GCCACGTCNONE 
J013023J24GCCACGTCNONE 
Os05g0423500015-048-C11CGCCACGTCNONE 
AK066000CGCCACGTCProtein kinase-like domain containing protein. 
J013049L02CGCCACGTCNONE 
Os05g0466600009-088-F09CACGCCACGTCNONE 
009-105-C11CACGCCACGTCNONE 
009-156-C06CACGCCACGTCNONE 
AK119240CACGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0490200016-097-B03GCCACGTCNONE 
AK101147GCCACGTCProtein of unknown function DUF1692 domain containing protein. 
AK105601GCCACGTCNONE 
J033026P06GCCACGTCNONE 
Os05g0495900AK069244GACGTGGCSimilar to Beta-1,3-glucanase precursor (Fragment). 
J013157P10GACGTGGCNONE 
J023031M04GACGTGGCNONE 
J065063H10GACGTGGCNONE 
Os05g0499400AK059489GCCACGTCHaem peroxidase family protein. 
AK068896GCCACGTCNONE 
J013170E20GCCACGTCNONE 
Os05g0499800016-065-G04GTCGCGCGCCACGTCNONE 
AK064392GTCGCGCGCCACGTCNONE 
AK103146GTCGCGCGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J023075J11GTCGCGCGCCACGTCNONE 
J033120I02GTCGCGCGCCACGTCNONE 
Os05g0529300AK102648CGCCACGTCACCSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06GGTGACGTGGCGNONE 
AK063846GGTGACGTGGCGConserved hypothetical protein. 
AK122038GGTGACGTGGCGNONE 
J033113C01GGTGACGTGGCGNONE 
Os05g0539400AK068572CGCCACGTCACTCCACGCCGlycoside hydrolase, family 35 protein. 
J013063P08CGCCACGTCACTCCACGCCNONE 
J013110N24CGCCACGTCACTCCACGCCNONE 
J013156K22CGCCACGTCACTCCACGCCNONE 
J043038A08CGCCACGTCACTCCACGCCNONE 
J090004K18CGCCACGTCACTCCACGCCNONE 
J090085F03CGCCACGTCACTCCACGCCNONE 
Os05g0566400AK061645GCCACGTCACCNONE 
AK099472GCCACGTCACCNONE 
AK100389GCCACGTCACCSimilar to Blast and wounding induced mitogen-activated protein kinase. 
Os05g0566800AK065748CGCCACGTCCold acclimation protein COR413-TM1. 
AY181210CGCCACGTCNONE 
Os05g0571600Os05g0571600GACGTGGCGConserved hypothetical protein. 
Os05g0571800009-157-G07GACGTGGCNONE 
AK063033GACGTGGCConserved hypothetical protein. 
Os05g0574900AK107256GCCACGTCGRAS transcription factor domain containing protein. 
Os05g0588700AK100256GCCACGTCHistone deacetylase interacting domain containing protein. 
J023061J06GCCACGTCNONE 
Os05g0590000014-023-E12GACGTGGCNONE 
AK070159GACGTGGCPeptidase A1, pepsin family protein. 
AK103957GACGTGGCNONE 
J075049G06GACGTGGCNONE 
Os06g0104000AK068490GACGTGGCConserved hypothetical protein. 
Os06g0115300009-165-C05GCCACGTCNONE 
AK058833GCCACGTCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment). 
J065135L09GCCACGTCNONE 
J075002E09GCCACGTCNONE 
J075015K23GCCACGTCNONE 
J075043B06GCCACGTCNONE 
J075057O21GCCACGTCNONE 
J075085L21GCCACGTCNONE 
J075134N20GCCACGTCNONE 
J075155O22GCCACGTCNONE 
J075198N22GCCACGTCNONE 
Os06g0116400006-082-G06ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK058327ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
J065083I24ACATGGGCTCGGCCCAAGCCACGTCNONE 
J100072O18ACATGGGCTCGGCCCAAGCCACGTCNONE 
Os06g0134800014-049-H04CGCCACGTCTCTCCCCCACGCGTNONE 
AK063692CGCCACGTCTCTCCCCCACGCGTGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0136900AK107405GTGACGTGGCCGTGGProtein of unknown function DUF296 domain containing protein. 
Os06g0139700006-052-C07GCCACGTCNONE 
009-009-A08GCCACGTCNONE 
015-020-D09GCCACGTCNONE 
015-087-H06GCCACGTCNONE 
016-078-A03GCCACGTCNONE 
AK067884GCCACGTCNONE 
AK103245GCCACGTCConserved hypothetical protein. 
AK106116GCCACGTCNONE 
AK106220GCCACGTCNONE 
Os06g0171700AK103771GTGACGTGGCGTGCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20GTGACGTGGCGTGNONE 
Os06g0202600J065108E12GCCACGTCNONE 
Os06g0219600AK060429GCCACGTCSimilar to Poly(A)-binding protein II-like. 
AK099019GCCACGTCNONE 
J013118A14GCCACGTCNONE 
Os06g0258900AK067794CGCCACGTCKetose-bisphosphate aldolase, class-II family protein. 
AK099384CGCCACGTCNONE 
Os06g0275500AK111743CACGTGGCGCCACGTCSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0286228AK069113CGCCACGTCCupredoxin domain containing protein. 
Os06g0320500004-013-F05GATCCGACGTGGCCCAATNONE 
006-021-B06GATCCGACGTGGCCCAATNONE 
006-021-D12GATCCGACGTGGCCCAATNONE 
006-022-A12GATCCGACGTGGCCCAATNONE 
006-024-B10GATCCGACGTGGCCCAATNONE 
006-029-F07GATCCGACGTGGCCCAATNONE 
006-029-H12GATCCGACGTGGCCCAATNONE 
006-031-A05GATCCGACGTGGCCCAATNONE 
006-033-C03GATCCGACGTGGCCCAATNONE 
006-036-B12GATCCGACGTGGCCCAATNONE 
006-048-C08GATCCGACGTGGCCCAATNONE 
006-050-F03GATCCGACGTGGCCCAATNONE 
006-051-C12GATCCGACGTGGCCCAATNONE 
006-054-C03GATCCGACGTGGCCCAATNONE 
006-057-D12GATCCGACGTGGCCCAATNONE 
006-067-F01GATCCGACGTGGCCCAATNONE 
006-071-G12GATCCGACGTGGCCCAATNONE 
006-072-G11GATCCGACGTGGCCCAATNONE 
006-072-H01GATCCGACGTGGCCCAATNONE 
006-081-E02GATCCGACGTGGCCCAATNONE 
006-082-A11GATCCGACGTGGCCCAATNONE 
006-084-A04GATCCGACGTGGCCCAATNONE 
006-085-C08GATCCGACGTGGCCCAATNONE 
006-086-D03GATCCGACGTGGCCCAATNONE 
006-088-B05GATCCGACGTGGCCCAATNONE 
006-088-G02GATCCGACGTGGCCCAATNONE 
006-092-G10GATCCGACGTGGCCCAATNONE 
006-094-D11GATCCGACGTGGCCCAATNONE 
006-094-E04GATCCGACGTGGCCCAATNONE 
006-103-G12GATCCGACGTGGCCCAATNONE 
006-106-G08GATCCGACGTGGCCCAATNONE 
006-111-E06GATCCGACGTGGCCCAATNONE 
006-114-C07GATCCGACGTGGCCCAATNONE 
006-115-A04GATCCGACGTGGCCCAATNONE 
006-117-G11GATCCGACGTGGCCCAATNONE 
006-118-G09GATCCGACGTGGCCCAATNONE 
009-010-F03GATCCGACGTGGCCCAATNONE 
009-076-G01GATCCGACGTGGCCCAATNONE 
009-134-E10GATCCGACGTGGCCCAATNONE 
009-193-D07GATCCGACGTGGCCCAATNONE 
AF094776GATCCGACGTGGCCCAATNONE 
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment). 
AK098864GATCCGACGTGGCCCAATNONE 
J013001A03GATCCGACGTGGCCCAATNONE 
J013098P14GATCCGACGTGGCCCAATNONE 
J013127B16GATCCGACGTGGCCCAATNONE 
J013169J24GATCCGACGTGGCCCAATNONE 
J023084H23GATCCGACGTGGCCCAATNONE 
J023093F05GATCCGACGTGGCCCAATNONE 
J033041I05GATCCGACGTGGCCCAATNONE 
J065196G15GATCCGACGTGGCCCAATNONE 
J075019K01GATCCGACGTGGCCCAATNONE 
J075053H16GATCCGACGTGGCCCAATNONE 
J075055M09GATCCGACGTGGCCCAATNONE 
J075099G10GATCCGACGTGGCCCAATNONE 
J075099L23GATCCGACGTGGCCCAATNONE 
J075127I09GATCCGACGTGGCCCAATNONE 
J080001C14GATCCGACGTGGCCCAATNONE 
J080016B11GATCCGACGTGGCCCAATNONE 
J080029C14GATCCGACGTGGCCCAATNONE 
J080029I17GATCCGACGTGGCCCAATNONE 
J080034F13GATCCGACGTGGCCCAATNONE 
J080039E02GATCCGACGTGGCCCAATNONE 
J080040N05GATCCGACGTGGCCCAATNONE 
J080042O17GATCCGACGTGGCCCAATNONE 
J080043N15GATCCGACGTGGCCCAATNONE 
J080056K02GATCCGACGTGGCCCAATNONE 
J080063N15GATCCGACGTGGCCCAATNONE 
J080069H05GATCCGACGTGGCCCAATNONE 
J080070N15GATCCGACGTGGCCCAATNONE 
J080075J22GATCCGACGTGGCCCAATNONE 
J080076F12GATCCGACGTGGCCCAATNONE 
J080086G05GATCCGACGTGGCCCAATNONE 
J090046G07GATCCGACGTGGCCCAATNONE 
J090059H01GATCCGACGTGGCCCAATNONE 
J090099C09GATCCGACGTGGCCCAATNONE 
J100028E12GATCCGACGTGGCCCAATNONE 
J100048J04GATCCGACGTGGCCCAATNONE 
J100054O05GATCCGACGTGGCCCAATNONE 
J100062C09GATCCGACGTGGCCCAATNONE 
J100075C17GATCCGACGTGGCCCAATNONE 
J100075C23GATCCGACGTGGCCCAATNONE 
J100075I23GATCCGACGTGGCCCAATNONE 
Os06g0326700AK101908GCCACGTCDiacylglycerol acyltransferase family protein. 
Os06g0331900AK120017GCCACGTCProtein of unknown function UPF0005 family protein. 
Os06g0353700J065177D24GACGTGGCConserved hypothetical protein. 
Os06g0490000AK105534GCCACGTCSimilar to DIMETHYLADENOSINE TRANSFERASE. 
J090095A09GCCACGTCNONE 
Os06g0537700AK109530GACGTGGCX8 domain containing protein. 
Os06g0557200009-159-B10GCCACGTCNONE 
AK063039GCCACGTCConserved hypothetical protein. 
Os06g0593100AK060274CACGCCACGTCACCSimilar to UDP-galactose/UDP-glucose transporter. 
AK071175CACGCCACGTCACCNONE 
Os06g0604400AK072121CGCCACGTCSimilar to Phospholipase D. 
Os06g0621300AK068751GCCACGTCConserved hypothetical protein. 
J013159I20GCCACGTCNONE 
Os06g0625500006-034-A05GCCACGTCACNONE 
AK058459GCCACGTCACSimilar to Thioredoxin peroxidase. 
AK068955GCCACGTCACNONE 
AK104130GCCACGTCACNONE 
J023003C09GCCACGTCACNONE 
J033043I02GCCACGTCACNONE 
J065063E05GCCACGTCACNONE 
J065190D24GCCACGTCACNONE 
J065198I01GCCACGTCACNONE 
J075107A02GCCACGTCACNONE 
Os06g0634600011-029-F10CGCCACGTCNONE 
011-029-F10CGCCACGTCNONE 
011-057-B11CGCCACGTCNONE 
011-057-B11CGCCACGTCNONE 
AK122074CGCCACGTCProtein of unknown function FAF1 domain containing protein. 
AK122074CGCCACGTCProtein of unknown function FAF1 domain containing protein. 
J033118C24CGCCACGTCNONE 
J033118C24CGCCACGTCNONE 
J033132A01CGCCACGTCNONE 
J033132A01CGCCACGTCNONE 
J065059I05CGCCACGTCNONE 
J065059I05CGCCACGTCNONE 
J100069I04CGCCACGTCNONE 
J100069I04CGCCACGTCNONE 
Os06g0664400Os06g0664400GCCACGTCHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0664400GCCACGTCHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0678200AK059456GACGTGGCNONE 
AK071299GACGTGGCSimilar to Geranyl diphosphate synthase. 
Os06g0696500J080303G16GCCACGTCSimilar to Xyloglycan endo-transglycosylase precursor. 
J080310K14GCCACGTCNONE 
J080317J18GCCACGTCNONE 
J080318F11GCCACGTCNONE 
Os06g0704300AK107008GACGTGGCZinc finger, CCCH-type domain containing protein. 
J065038I12GACGTGGCNONE 
J065079E03GACGTGGCNONE 
J075035B15GACGTGGCNONE 
J090072D21GACGTGGCNONE 
Os06g0704700AK120907CGCCACGTCCACGCCTCNmrA-like family protein. 
AY224493CGCCACGTCCACGCCTCNONE 
Os06g0712800AK121236CGCCACGTCACCSimilar to Ankyrin-like protein. 
Os06g0728700AK111637GACGTGGCGHomeodomain-like containing protein. 
AK119632GACGTGGCGNONE 
J075015J02GACGTGGCGNONE 
J075016L14GACGTGGCGNONE 
J075078O03GACGTGGCGNONE 
J075098O14GACGTGGCGNONE 
J075171L20GACGTGGCGNONE 
Os07g0115300006-039-C05GACGTGGCNONE 
AK061511GACGTGGCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
Os07g0152900009-034-G07CGCCACGTCNONE 
AK062189CGCCACGTCNONE 
AK062433CGCCACGTCNONE 
AK103933CGCCACGTCNONE 
AK120929CGCCACGTCSimilar to Glycolate oxidase (EC 1.1.3.15) (Fragment). 
J013039G04CGCCACGTCNONE 
J013046B19CGCCACGTCNONE 
J013118P12CGCCACGTCNONE 
J013124C14CGCCACGTCNONE 
J013129M06CGCCACGTCNONE 
J013154C03CGCCACGTCNONE 
J013157J12CGCCACGTCNONE 
J013157N21CGCCACGTCNONE 
J023050B06CGCCACGTCNONE 
J065124L23CGCCACGTCNONE 
J065157G04CGCCACGTCNONE 
J065157L13CGCCACGTCNONE 
J065214I21CGCCACGTCNONE 
J080004P17CGCCACGTCNONE 
J080009G20CGCCACGTCNONE 
J080010G21CGCCACGTCNONE 
J080013C05CGCCACGTCNONE 
J080013D14CGCCACGTCNONE 
J080015N16CGCCACGTCNONE 
J080020D13CGCCACGTCNONE 
J080020K23CGCCACGTCNONE 
J080028D21CGCCACGTCNONE 
J080029N23CGCCACGTCNONE 
J080032E20CGCCACGTCNONE 
J080033K16CGCCACGTCNONE 
J080035G12CGCCACGTCNONE 
J080035G23CGCCACGTCNONE 
J080061H23CGCCACGTCNONE 
J080063J06CGCCACGTCNONE 
J080064J09CGCCACGTCNONE 
J080067O13CGCCACGTCNONE 
J080070F23CGCCACGTCNONE 
J080076N06CGCCACGTCNONE 
J080077L15CGCCACGTCNONE 
J080081L01CGCCACGTCNONE 
J080083F16CGCCACGTCNONE 
J080089F16CGCCACGTCNONE 
J080089G06CGCCACGTCNONE 
J080089L14CGCCACGTCNONE 
J080093A07CGCCACGTCNONE 
J080093A11CGCCACGTCNONE 
J080093N16CGCCACGTCNONE 
J080094C09CGCCACGTCNONE 
J080301E18CGCCACGTCNONE 
J080301K03CGCCACGTCNONE 
J080304I22CGCCACGTCNONE 
J080304M17CGCCACGTCNONE 
J080319A12CGCCACGTCNONE 
J090080A21CGCCACGTCNONE 
J100055D23CGCCACGTCNONE 
J100057F17CGCCACGTCNONE 
Os07g0154900009-142-E09GACGTGGCNONE 
009-142-E09GACGTGGCNONE 
AK062969GACGTGGCConserved hypothetical protein. 
AK062969GACGTGGCConserved hypothetical protein. 
Os07g0162600015-024-F04GACGTGGCNONE 
AK105789GACGTGGCNONE 
AK106274GACGTGGCEsterase/lipase/thioesterase domain containing protein. 
J100026E18GACGTGGCNONE 
J100037B07GACGTGGCNONE 
J100090H11GACGTGGCNONE 
Os07g0169600006-027-F04GCCACGTCNONE 
006-043-C10GCCACGTCNONE 
006-070-A04GCCACGTCNONE 
006-081-F03GCCACGTCNONE 
006-104-F02GCCACGTCNONE 
012-006-D12GCCACGTCNONE 
AK060318GCCACGTCNONE 
AK121818GCCACGTC2OG-Fe(II) oxygenase domain containing protein. 
J023065K01GCCACGTCNONE 
J023086G17GCCACGTCNONE 
J023093G16GCCACGTCNONE 
J033024N04GCCACGTCNONE 
J033099A15GCCACGTCNONE 
J033107B14GCCACGTCNONE 
J043026F14GCCACGTCNONE 
J065043P20GCCACGTCNONE 
J075118L16GCCACGTCNONE 
J075162M22GCCACGTCNONE 
J080004K13GCCACGTCNONE 
J080024D10GCCACGTCNONE 
J080037C21GCCACGTCNONE 
J080039M17GCCACGTCNONE 
J080040A03GCCACGTCNONE 
J080044A07GCCACGTCNONE 
J080045I07GCCACGTCNONE 
J080052L06GCCACGTCNONE 
J080053A20GCCACGTCNONE 
J080060L15GCCACGTCNONE 
J080060N22GCCACGTCNONE 
J080062L23GCCACGTCNONE 
J080069B19GCCACGTCNONE 
J080086K15GCCACGTCNONE 
J080089H16GCCACGTCNONE 
J080089I23GCCACGTCNONE 
J080094P07GCCACGTCNONE 
J090032L18GCCACGTCNONE 
J100044E09GCCACGTCNONE 
J100045O03GCCACGTCNONE 
J100066B11GCCACGTCNONE 
J100069J24GCCACGTCNONE 
Os07g0178800AF017356GACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os07g0181000AK066918GCCACGTCACCNONE 
AK070512GCCACGTCACCSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0181500AK072431CGCCACGTCACCProtein of unknown function DUF506, plant family protein. 
Os07g0202400009-155-C12GACGTGGCNONE 
AK063024GACGTGGCConserved hypothetical protein. 
Os07g0240300AK072205GACGTGGCCCCACCTGConserved hypothetical protein. 
AK098977GACGTGGCCCCACCTGNONE 
Os07g0272800AK107279CGCCACGTCHypothetical protein. 
AK107279GCCACGTCHypothetical protein. 
J065124H15CGCCACGTCNONE 
J065124H15GCCACGTCNONE 
Os07g0295000AK071844GACGTGGCMitochondrial substrate carrier family protein. 
AK099295GACGTGGCNONE 
Os07g0421000AK071522GCCACGTCCyclin-like F-box domain containing protein. 
J023099N14GCCACGTCNONE 
J075159O18GCCACGTCNONE 
J075167I11GCCACGTCNONE 
Os07g0435100AB037153GCCACGTCNONE 
AK061383GCCACGTCSimilar to 26S proteasome subunit RPN12. 
AK061408GCCACGTCNONE 
AK101316GCCACGTCNONE 
J023133D07GCCACGTCNONE 
J023136B17GCCACGTCNONE 
J033065M08GCCACGTCNONE 
J033070F05GCCACGTCNONE 
J033070L20GCCACGTCNONE 
J033108J15GCCACGTCNONE 
J053080M19GCCACGTCNONE 
J053091B15GCCACGTCNONE 
J065067J03GCCACGTCNONE 
J065102C02GCCACGTCNONE 
J065135H09GCCACGTCNONE 
J080302K03GCCACGTCNONE 
J090059J11GCCACGTCNONE 
J090074G14GCCACGTCNONE 
J100025F20GCCACGTCNONE 
J100028L08GCCACGTCNONE 
J100049L14GCCACGTCNONE 
J100054O07GCCACGTCNONE 
Os07g0450000009-033-A08CGCCACGTCNONE 
AK063789CGCCACGTCNONE 
AK121702CGCCACGTCSimilar to 60S ribosomal protein L44. 
J033073H17CGCCACGTCNONE 
J065006A02CGCCACGTCNONE 
J065009C05CGCCACGTCNONE 
J065028M04CGCCACGTCNONE 
J065070D07CGCCACGTCNONE 
J065072H17CGCCACGTCNONE 
J065114J23CGCCACGTCNONE 
J065127A02CGCCACGTCNONE 
J065146L07CGCCACGTCNONE 
J065213H17CGCCACGTCNONE 
J065214B07CGCCACGTCNONE 
J100045B16CGCCACGTCNONE 
Os07g0510100AK066776GCCACGTCSimilar to Methionine aminopeptidase-like protein. 
Os07g0535100AK100978GCCACGTCCyclin-like F-box domain containing protein. 
J075005D04GCCACGTCNONE 
J075137I02GCCACGTCNONE 
J075183B17GCCACGTCNONE 
J090084L09GCCACGTCNONE 
J100052C02GCCACGTCNONE 
Os07g0545400009-136-E03CGCCACGTCACCGATCCGNONE 
013-015-G08CGCCACGTCACCGATCCGNONE 
AK059228CGCCACGTCACCGATCCGNONE 
J065040D09CGCCACGTCACCGATCCGNONE 
J065051C19CGCCACGTCACCGATCCGNONE 
J065139B05CGCCACGTCACCGATCCGNONE 
J065160E20CGCCACGTCACCGATCCGNONE 
J065207I17CGCCACGTCACCGATCCGNONE 
J080319M24CGCCACGTCACCGATCCGNONE 
Os07g0562700003-111-G08ATCCGACGTGGCNONE 
004-013-E07ATCCGACGTGGCNONE 
006-021-D03ATCCGACGTGGCNONE 
006-021-D07ATCCGACGTGGCNONE 
006-021-F09ATCCGACGTGGCNONE 
006-023-D01ATCCGACGTGGCNONE 
006-024-F04ATCCGACGTGGCNONE 
006-024-G09ATCCGACGTGGCNONE 
006-024-G11ATCCGACGTGGCNONE 
006-025-A10ATCCGACGTGGCNONE 
006-025-B08ATCCGACGTGGCNONE 
006-025-E10ATCCGACGTGGCNONE 
006-025-F10ATCCGACGTGGCNONE 
006-026-B04ATCCGACGTGGCNONE 
006-026-C08ATCCGACGTGGCNONE 
006-026-D03ATCCGACGTGGCNONE 
006-026-F03ATCCGACGTGGCNONE 
006-026-F08ATCCGACGTGGCNONE 
006-026-F12ATCCGACGTGGCNONE 
006-027-A10ATCCGACGTGGCNONE 
006-027-C03ATCCGACGTGGCNONE 
006-028-C03ATCCGACGTGGCNONE 
006-029-E02ATCCGACGTGGCNONE 
006-029-G05ATCCGACGTGGCNONE 
006-030-A10ATCCGACGTGGCNONE 
006-030-C06ATCCGACGTGGCNONE 
006-030-D03ATCCGACGTGGCNONE 
006-030-D06ATCCGACGTGGCNONE 
006-030-G05ATCCGACGTGGCNONE 
006-031-B10ATCCGACGTGGCNONE 
006-031-D04ATCCGACGTGGCNONE 
006-031-D11ATCCGACGTGGCNONE 
006-031-H09ATCCGACGTGGCNONE 
006-032-C09ATCCGACGTGGCNONE 
006-032-H09ATCCGACGTGGCNONE 
006-033-B02ATCCGACGTGGCNONE 
006-033-B09ATCCGACGTGGCNONE 
006-033-E01ATCCGACGTGGCNONE 
006-033-F06ATCCGACGTGGCNONE 
006-033-G03ATCCGACGTGGCNONE 
006-034-A08ATCCGACGTGGCNONE 
006-034-C09ATCCGACGTGGCNONE 
006-034-F06ATCCGACGTGGCNONE 
006-035-B12ATCCGACGTGGCNONE 
006-035-C12ATCCGACGTGGCNONE 
006-035-H04ATCCGACGTGGCNONE 
006-035-H12ATCCGACGTGGCNONE 
006-036-A05ATCCGACGTGGCNONE 
006-036-A09ATCCGACGTGGCNONE 
006-036-B10ATCCGACGTGGCNONE 
006-036-C03ATCCGACGTGGCNONE 
006-036-E06ATCCGACGTGGCNONE 
006-037-H11ATCCGACGTGGCNONE 
006-038-G01ATCCGACGTGGCNONE 
006-039-B01ATCCGACGTGGCNONE 
006-039-B12ATCCGACGTGGCNONE 
006-039-C02ATCCGACGTGGCNONE 
006-039-E06ATCCGACGTGGCNONE 
006-039-G12ATCCGACGTGGCNONE 
006-040-G07ATCCGACGTGGCNONE 
006-041-H04ATCCGACGTGGCNONE 
006-042-A11ATCCGACGTGGCNONE 
006-042-E07ATCCGACGTGGCNONE 
006-042-F12ATCCGACGTGGCNONE 
006-043-C01ATCCGACGTGGCNONE 
006-045-H12ATCCGACGTGGCNONE 
006-046-A12ATCCGACGTGGCNONE 
006-046-F03ATCCGACGTGGCNONE 
006-047-A07ATCCGACGTGGCNONE 
006-047-A09ATCCGACGTGGCNONE 
006-047-E10ATCCGACGTGGCNONE 
006-047-G12ATCCGACGTGGCNONE 
006-048-B04ATCCGACGTGGCNONE 
006-049-D01ATCCGACGTGGCNONE 
006-049-G02ATCCGACGTGGCNONE 
006-049-G10ATCCGACGTGGCNONE 
006-049-H04ATCCGACGTGGCNONE 
006-050-D05ATCCGACGTGGCNONE 
006-050-F05ATCCGACGTGGCNONE 
006-051-B05ATCCGACGTGGCNONE 
006-051-G12ATCCGACGTGGCNONE 
006-052-D12ATCCGACGTGGCNONE 
006-053-D06ATCCGACGTGGCNONE 
006-054-H02ATCCGACGTGGCNONE 
006-055-A03ATCCGACGTGGCNONE 
006-055-C01ATCCGACGTGGCNONE 
006-055-E07ATCCGACGTGGCNONE 
006-055-H06ATCCGACGTGGCNONE 
006-056-F06ATCCGACGTGGCNONE 
006-057-D03ATCCGACGTGGCNONE 
006-057-D05ATCCGACGTGGCNONE 
006-057-G01ATCCGACGTGGCNONE 
006-058-A03ATCCGACGTGGCNONE 
006-058-B06ATCCGACGTGGCNONE 
006-059-A09ATCCGACGTGGCNONE 
006-059-H11ATCCGACGTGGCNONE 
006-060-A04ATCCGACGTGGCNONE 
006-060-A09ATCCGACGTGGCNONE 
006-060-C11ATCCGACGTGGCNONE 
006-060-D08ATCCGACGTGGCNONE 
006-061-A04ATCCGACGTGGCNONE 
006-061-E01ATCCGACGTGGCNONE 
006-061-G10ATCCGACGTGGCNONE 
006-061-H12ATCCGACGTGGCNONE 
006-062-B07ATCCGACGTGGCNONE 
006-062-G03ATCCGACGTGGCNONE 
006-062-H12ATCCGACGTGGCNONE 
006-063-D05ATCCGACGTGGCNONE 
006-063-E04ATCCGACGTGGCNONE 
006-063-F05ATCCGACGTGGCNONE 
006-063-G05ATCCGACGTGGCNONE 
006-064-B07ATCCGACGTGGCNONE 
006-065-C11ATCCGACGTGGCNONE 
006-065-H02ATCCGACGTGGCNONE 
006-067-C12ATCCGACGTGGCNONE 
006-067-F10ATCCGACGTGGCNONE 
006-068-E02ATCCGACGTGGCNONE 
006-068-G04ATCCGACGTGGCNONE 
006-069-A02ATCCGACGTGGCNONE 
006-071-A07ATCCGACGTGGCNONE 
006-072-F11ATCCGACGTGGCNONE 
006-072-F12ATCCGACGTGGCNONE 
006-073-E12ATCCGACGTGGCNONE 
006-073-F08ATCCGACGTGGCNONE 
006-073-H07ATCCGACGTGGCNONE 
006-074-A07ATCCGACGTGGCNONE 
006-075-A12ATCCGACGTGGCNONE 
006-075-B01ATCCGACGTGGCNONE 
006-075-H10ATCCGACGTGGCNONE 
006-075-H12ATCCGACGTGGCNONE 
006-076-B06ATCCGACGTGGCNONE 
006-077-A09ATCCGACGTGGCNONE 
006-077-D05ATCCGACGTGGCNONE 
006-078-C11ATCCGACGTGGCNONE 
006-078-D12ATCCGACGTGGCNONE 
006-078-E02ATCCGACGTGGCNONE 
006-079-A01ATCCGACGTGGCNONE 
006-079-E02ATCCGACGTGGCNONE 
006-079-F03ATCCGACGTGGCNONE 
006-080-G11ATCCGACGTGGCNONE 
006-081-C02ATCCGACGTGGCNONE 
006-081-C08ATCCGACGTGGCNONE 
006-082-B06ATCCGACGTGGCNONE 
006-082-C11ATCCGACGTGGCNONE 
006-082-H04ATCCGACGTGGCNONE 
006-083-E04ATCCGACGTGGCNONE 
006-083-H12ATCCGACGTGGCNONE 
006-084-C08ATCCGACGTGGCNONE 
006-084-E07ATCCGACGTGGCNONE 
006-084-E10ATCCGACGTGGCNONE 
006-085-E06ATCCGACGTGGCNONE 
006-085-E10ATCCGACGTGGCNONE 
006-086-F06ATCCGACGTGGCNONE 
006-087-D08ATCCGACGTGGCNONE 
006-087-F03ATCCGACGTGGCNONE 
006-087-F10ATCCGACGTGGCNONE 
006-087-G07ATCCGACGTGGCNONE 
006-088-A02ATCCGACGTGGCNONE 
006-089-A04ATCCGACGTGGCNONE 
006-089-B12ATCCGACGTGGCNONE 
006-089-D06ATCCGACGTGGCNONE 
006-089-D10ATCCGACGTGGCNONE 
006-089-H05ATCCGACGTGGCNONE 
006-090-C06ATCCGACGTGGCNONE 
006-091-A03ATCCGACGTGGCNONE 
006-091-E04ATCCGACGTGGCNONE 
006-091-H12ATCCGACGTGGCNONE 
006-092-A08ATCCGACGTGGCNONE 
006-092-F01ATCCGACGTGGCNONE 
006-092-G08ATCCGACGTGGCNONE 
006-093-B12ATCCGACGTGGCNONE 
006-093-D04ATCCGACGTGGCNONE 
006-093-F01ATCCGACGTGGCNONE 
006-094-A08ATCCGACGTGGCNONE 
006-094-F01ATCCGACGTGGCNONE 
006-094-F03ATCCGACGTGGCNONE 
006-095-C12ATCCGACGTGGCNONE 
006-095-E10ATCCGACGTGGCNONE 
006-095-E12ATCCGACGTGGCNONE 
006-095-G06ATCCGACGTGGCNONE 
006-096-B12ATCCGACGTGGCNONE 
006-096-C12ATCCGACGTGGCNONE 
006-096-G02ATCCGACGTGGCNONE 
006-097-D01ATCCGACGTGGCNONE 
006-097-D07ATCCGACGTGGCNONE 
006-097-F04ATCCGACGTGGCNONE 
006-098-C07ATCCGACGTGGCNONE 
006-098-D04ATCCGACGTGGCNONE 
006-099-E06ATCCGACGTGGCNONE 
006-099-F02ATCCGACGTGGCNONE 
006-099-F10ATCCGACGTGGCNONE 
006-100-A07ATCCGACGTGGCNONE 
006-100-B10ATCCGACGTGGCNONE 
006-100-G01ATCCGACGTGGCNONE 
006-100-H06ATCCGACGTGGCNONE 
006-101-D01ATCCGACGTGGCNONE 
006-101-F03ATCCGACGTGGCNONE 
006-102-A12ATCCGACGTGGCNONE 
006-102-B11ATCCGACGTGGCNONE 
006-102-C03ATCCGACGTGGCNONE 
006-102-F11ATCCGACGTGGCNONE 
006-103-A08ATCCGACGTGGCNONE 
006-103-B06ATCCGACGTGGCNONE 
006-103-D01ATCCGACGTGGCNONE 
006-103-F02ATCCGACGTGGCNONE 
006-104-B02ATCCGACGTGGCNONE 
006-104-C01ATCCGACGTGGCNONE 
006-104-F09ATCCGACGTGGCNONE 
006-104-H11ATCCGACGTGGCNONE 
006-105-A03ATCCGACGTGGCNONE 
006-105-D09ATCCGACGTGGCNONE 
006-106-B10ATCCGACGTGGCNONE 
006-107-A06ATCCGACGTGGCNONE 
006-107-C04ATCCGACGTGGCNONE 
006-107-E03ATCCGACGTGGCNONE 
006-107-F05ATCCGACGTGGCNONE 
006-108-C09ATCCGACGTGGCNONE 
006-109-C09ATCCGACGTGGCNONE 
006-109-D10ATCCGACGTGGCNONE 
006-109-E06ATCCGACGTGGCNONE 
006-109-E10ATCCGACGTGGCNONE 
006-110-A06ATCCGACGTGGCNONE 
006-110-C11ATCCGACGTGGCNONE 
006-111-A02ATCCGACGTGGCNONE 
006-111-F02ATCCGACGTGGCNONE 
006-112-A08ATCCGACGTGGCNONE 
006-112-H06ATCCGACGTGGCNONE 
006-113-A08ATCCGACGTGGCNONE 
006-113-B01ATCCGACGTGGCNONE 
006-113-C05ATCCGACGTGGCNONE 
006-113-D01ATCCGACGTGGCNONE 
006-113-D04ATCCGACGTGGCNONE 
006-113-D06ATCCGACGTGGCNONE 
006-113-E09ATCCGACGTGGCNONE 
006-114-F06ATCCGACGTGGCNONE 
006-116-B02ATCCGACGTGGCNONE 
006-117-B07ATCCGACGTGGCNONE 
006-117-G04ATCCGACGTGGCNONE 
006-118-D01ATCCGACGTGGCNONE 
006-118-D12ATCCGACGTGGCNONE 
006-118-F12ATCCGACGTGGCNONE 
006-118-G12ATCCGACGTGGCNONE 
006-119-B08ATCCGACGTGGCNONE 
006-120-E09ATCCGACGTGGCNONE 
006-120-G05ATCCGACGTGGCNONE 
006-120-G10ATCCGACGTGGCNONE 
009-022-D12ATCCGACGTGGCNONE 
009-051-H08ATCCGACGTGGCNONE 
009-065-F05ATCCGACGTGGCNONE 
009-070-A06ATCCGACGTGGCNONE 
009-073-B07ATCCGACGTGGCNONE 
009-092-C10ATCCGACGTGGCNONE 
009-093-D03ATCCGACGTGGCNONE 
009-103-B04ATCCGACGTGGCNONE 
009-106-H08ATCCGACGTGGCNONE 
009-120-B05ATCCGACGTGGCNONE 
009-121-F05ATCCGACGTGGCNONE 
009-122-B04ATCCGACGTGGCNONE 
009-122-D08ATCCGACGTGGCNONE 
009-123-F07ATCCGACGTGGCNONE 
009-125-G02ATCCGACGTGGCNONE 
009-128-F02ATCCGACGTGGCNONE 
009-128-H07ATCCGACGTGGCNONE 
009-131-C06ATCCGACGTGGCNONE 
009-132-F08ATCCGACGTGGCNONE 
009-133-G08ATCCGACGTGGCNONE 
009-134-D09ATCCGACGTGGCNONE 
009-135-F01ATCCGACGTGGCNONE 
009-149-E11ATCCGACGTGGCNONE 
009-153-H04ATCCGACGTGGCNONE 
009-161-E04ATCCGACGTGGCNONE 
009-163-A09ATCCGACGTGGCNONE 
009-163-C05ATCCGACGTGGCNONE 
009-163-E10ATCCGACGTGGCNONE 
009-165-F04ATCCGACGTGGCNONE 
009-166-A07ATCCGACGTGGCNONE 
009-169-G12ATCCGACGTGGCNONE 
009-172-G08ATCCGACGTGGCNONE 
009-179-E06ATCCGACGTGGCNONE 
009-181-F09ATCCGACGTGGCNONE 
009-190-G07ATCCGACGTGGCNONE 
009-191-D01ATCCGACGTGGCNONE 
009-195-G02ATCCGACGTGGCNONE 
AF022738ATCCGACGTGGCNONE 
AK061512ATCCGACGTGGCNONE 
AK068972ATCCGACGTGGCNONE 
AK103926ATCCGACGTGGCNONE 
AK103999ATCCGACGTGGCNONE 
AK104224ATCCGACGTGGCNONE 
AK104465ATCCGACGTGGCNONE 
AK104495ATCCGACGTGGCNONE 
AK109399ATCCGACGTGGCSimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533ATCCGACGTGGCNONE 
AK119545ATCCGACGTGGCNONE 
J013043L10ATCCGACGTGGCNONE 
J013050A09ATCCGACGTGGCNONE 
J023001G03ATCCGACGTGGCNONE 
J023024D14ATCCGACGTGGCNONE 
J023072E11ATCCGACGTGGCNONE 
J023149E18ATCCGACGTGGCNONE 
J033029B16ATCCGACGTGGCNONE 
J065001O21ATCCGACGTGGCNONE 
J065035B04ATCCGACGTGGCNONE 
J065044D18ATCCGACGTGGCNONE 
J065057F12ATCCGACGTGGCNONE 
J065060A11ATCCGACGTGGCNONE 
J065062G15ATCCGACGTGGCNONE 
J065080F13ATCCGACGTGGCNONE 
J065084N12ATCCGACGTGGCNONE 
J065101D02ATCCGACGTGGCNONE 
J065107C07ATCCGACGTGGCNONE 
J065112N24ATCCGACGTGGCNONE 
J065141I16ATCCGACGTGGCNONE 
J065147D05ATCCGACGTGGCNONE 
J065167H02ATCCGACGTGGCNONE 
J065207K23ATCCGACGTGGCNONE 
J075008E16ATCCGACGTGGCNONE 
J075014F03ATCCGACGTGGCNONE 
J075015O17ATCCGACGTGGCNONE 
J075020H20ATCCGACGTGGCNONE 
J075021E22ATCCGACGTGGCNONE 
J075023N13ATCCGACGTGGCNONE 
J075028H10ATCCGACGTGGCNONE 
J075040F20ATCCGACGTGGCNONE 
J075051L23ATCCGACGTGGCNONE 
J075069G16ATCCGACGTGGCNONE 
J075084F24ATCCGACGTGGCNONE 
J075090H09ATCCGACGTGGCNONE 
J075092M21ATCCGACGTGGCNONE 
J075110C10ATCCGACGTGGCNONE 
J075111J12ATCCGACGTGGCNONE 
J075114L04ATCCGACGTGGCNONE 
J075139E02ATCCGACGTGGCNONE 
J075160M10ATCCGACGTGGCNONE 
J075176J03ATCCGACGTGGCNONE 
J075183I17ATCCGACGTGGCNONE 
J075191N10ATCCGACGTGGCNONE 
J075193D07ATCCGACGTGGCNONE 
J075194M16ATCCGACGTGGCNONE 
J075197K04ATCCGACGTGGCNONE 
J080032I11ATCCGACGTGGCNONE 
J080076M11ATCCGACGTGGCNONE 
J080311J08ATCCGACGTGGCNONE 
J080317E05ATCCGACGTGGCNONE 
J090034L08ATCCGACGTGGCNONE 
J100040D19ATCCGACGTGGCNONE 
J100074C11ATCCGACGTGGCNONE 
Os07g0568300AK067784GACGTGGCGNONE 
AK067895GACGTGGCGSimilar to ZF protein (Fragment). 
J013119M01GACGTGGCGNONE 
J013120B09GACGTGGCGNONE 
J013123G12GACGTGGCGNONE 
J023012C12GACGTGGCGNONE 
J023020G17GACGTGGCGNONE 
J023037E23GACGTGGCGNONE 
J033076I01GACGTGGCGNONE 
J033108A07GACGTGGCGNONE 
J033138J02GACGTGGCGNONE 
J075033L09GACGTGGCGNONE 
J075049E02GACGTGGCGNONE 
J075060N23GACGTGGCGNONE 
J075094H13GACGTGGCGNONE 
J075179L18GACGTGGCGNONE 
J080005P09GACGTGGCGNONE 
J080044J03GACGTGGCGNONE 
J080062G20GACGTGGCGNONE 
J080063L23GACGTGGCGNONE 
J080065B16GACGTGGCGNONE 
J080071K09GACGTGGCGNONE 
J080089C23GACGTGGCGNONE 
J090008P21GACGTGGCGNONE 
J090046B22GACGTGGCGNONE 
J090094C19GACGTGGCGNONE 
J090096B19GACGTGGCGNONE 
J100060G03GACGTGGCGNONE 
J100082D16GACGTGGCGNONE 
Os07g0577600006-021-H11CGCCACGTCNONE 
006-022-B11CGCCACGTCNONE 
006-022-D10CGCCACGTCNONE 
006-022-E02CGCCACGTCNONE 
006-022-F03CGCCACGTCNONE 
006-023-C11CGCCACGTCNONE 
006-024-C10CGCCACGTCNONE 
006-024-C12CGCCACGTCNONE 
006-024-G12CGCCACGTCNONE 
006-026-C04CGCCACGTCNONE 
006-026-E05CGCCACGTCNONE 
006-026-E11CGCCACGTCNONE 
006-026-F09CGCCACGTCNONE 
006-026-H05CGCCACGTCNONE 
006-027-D03CGCCACGTCNONE 
006-028-C04CGCCACGTCNONE 
006-029-G10CGCCACGTCNONE 
006-030-A11CGCCACGTCNONE 
006-030-D12CGCCACGTCNONE 
006-031-G05CGCCACGTCNONE 
006-032-H06CGCCACGTCNONE 
006-033-A02CGCCACGTCNONE 
006-033-A06CGCCACGTCNONE 
006-034-B10CGCCACGTCNONE 
006-034-F07CGCCACGTCNONE 
006-035-A08CGCCACGTCNONE 
006-035-F07CGCCACGTCNONE 
006-036-A04CGCCACGTCNONE 
006-036-B04CGCCACGTCNONE 
006-037-D02CGCCACGTCNONE 
006-037-F12CGCCACGTCNONE 
006-037-H12CGCCACGTCNONE 
006-040-G12CGCCACGTCNONE 
006-040-H03CGCCACGTCNONE 
006-040-H06CGCCACGTCNONE 
006-042-B12CGCCACGTCNONE 
006-042-H10CGCCACGTCNONE 
006-044-G09CGCCACGTCNONE 
006-045-C04CGCCACGTCNONE 
006-046-B10CGCCACGTCNONE 
006-047-A05CGCCACGTCNONE 
006-048-D05CGCCACGTCNONE 
006-049-A08CGCCACGTCNONE 
006-050-C07CGCCACGTCNONE 
006-050-H10CGCCACGTCNONE 
006-051-G03CGCCACGTCNONE 
006-052-A01CGCCACGTCNONE 
006-052-A05CGCCACGTCNONE 
006-052-B03CGCCACGTCNONE 
006-052-D10CGCCACGTCNONE 
006-054-D03CGCCACGTCNONE 
006-055-A12CGCCACGTCNONE 
006-055-C05CGCCACGTCNONE 
006-055-F05CGCCACGTCNONE 
006-055-H10CGCCACGTCNONE 
006-056-A02CGCCACGTCNONE 
006-056-D07CGCCACGTCNONE 
006-057-A03CGCCACGTCNONE 
006-057-B06CGCCACGTCNONE 
006-057-H08CGCCACGTCNONE 
006-058-C04CGCCACGTCNONE 
006-058-F06CGCCACGTCNONE 
006-059-C10CGCCACGTCNONE 
006-059-G08CGCCACGTCNONE 
006-060-E10CGCCACGTCNONE 
006-061-B10CGCCACGTCNONE 
006-062-A05CGCCACGTCNONE 
006-062-B04CGCCACGTCNONE 
006-063-A04CGCCACGTCNONE 
006-063-D01CGCCACGTCNONE 
006-063-G12CGCCACGTCNONE 
006-064-D12CGCCACGTCNONE 
006-066-A03CGCCACGTCNONE 
006-066-C03CGCCACGTCNONE 
006-067-A03CGCCACGTCNONE 
006-067-G07CGCCACGTCNONE 
006-068-A06CGCCACGTCNONE 
006-069-D04CGCCACGTCNONE 
006-069-G05CGCCACGTCNONE 
006-070-H08CGCCACGTCNONE 
006-071-A05CGCCACGTCNONE 
006-071-H11CGCCACGTCNONE 
006-072-A07CGCCACGTCNONE 
006-072-B02CGCCACGTCNONE 
006-072-D11CGCCACGTCNONE 
006-072-H12CGCCACGTCNONE 
006-075-G06CGCCACGTCNONE 
006-077-B09CGCCACGTCNONE 
006-078-D01CGCCACGTCNONE 
006-078-D02CGCCACGTCNONE 
006-078-E05CGCCACGTCNONE 
006-078-G07CGCCACGTCNONE 
006-079-C03CGCCACGTCNONE 
006-079-F12CGCCACGTCNONE 
006-079-H01CGCCACGTCNONE 
006-080-D04CGCCACGTCNONE 
006-080-H04CGCCACGTCNONE 
006-081-A10CGCCACGTCNONE 
006-082-G02CGCCACGTCNONE 
006-082-H07CGCCACGTCNONE 
006-083-B03CGCCACGTCNONE 
006-085-A09CGCCACGTCNONE 
006-085-A12CGCCACGTCNONE 
006-085-F07CGCCACGTCNONE 
006-086-B11CGCCACGTCNONE 
006-086-D01CGCCACGTCNONE 
006-086-G04CGCCACGTCNONE 
006-087-E04CGCCACGTCNONE 
006-087-G09CGCCACGTCNONE 
006-088-E11CGCCACGTCNONE 
006-088-G10CGCCACGTCNONE 
006-088-H01CGCCACGTCNONE 
006-089-B04CGCCACGTCNONE 
006-089-D05CGCCACGTCNONE 
006-089-F07CGCCACGTCNONE 
006-089-H07CGCCACGTCNONE 
006-090-B06CGCCACGTCNONE 
006-090-H05CGCCACGTCNONE 
006-091-E11CGCCACGTCNONE 
006-092-H01CGCCACGTCNONE 
006-093-B08CGCCACGTCNONE 
006-093-C07CGCCACGTCNONE 
006-093-F02CGCCACGTCNONE 
006-093-G05CGCCACGTCNONE 
006-093-G06CGCCACGTCNONE 
006-094-D10CGCCACGTCNONE 
006-094-H07CGCCACGTCNONE 
006-095-G03CGCCACGTCNONE 
006-096-A06CGCCACGTCNONE 
006-096-E03CGCCACGTCNONE 
006-097-B03CGCCACGTCNONE 
006-097-D03CGCCACGTCNONE 
006-098-B07CGCCACGTCNONE 
006-098-G05CGCCACGTCNONE 
006-099-F05CGCCACGTCNONE 
006-100-H10CGCCACGTCNONE 
006-100-H12CGCCACGTCNONE 
006-101-A06CGCCACGTCNONE 
006-101-A08CGCCACGTCNONE 
006-101-A12CGCCACGTCNONE 
006-101-D04CGCCACGTCNONE 
006-101-G07CGCCACGTCNONE 
006-102-B12CGCCACGTCNONE 
006-102-E09CGCCACGTCNONE 
006-102-F02CGCCACGTCNONE 
006-103-D09CGCCACGTCNONE 
006-105-D05CGCCACGTCNONE 
006-105-D08CGCCACGTCNONE 
006-106-C07CGCCACGTCNONE 
006-106-F12CGCCACGTCNONE 
006-107-D01CGCCACGTCNONE 
006-109-C05CGCCACGTCNONE 
006-109-C08CGCCACGTCNONE 
006-109-D02CGCCACGTCNONE 
006-111-F03CGCCACGTCNONE 
006-112-C12CGCCACGTCNONE 
006-112-D08CGCCACGTCNONE 
006-113-A01CGCCACGTCNONE 
006-113-B03CGCCACGTCNONE 
006-113-C11CGCCACGTCNONE 
006-113-E07CGCCACGTCNONE 
006-113-F08CGCCACGTCNONE 
006-114-D08CGCCACGTCNONE 
006-114-H08CGCCACGTCNONE 
006-115-A08CGCCACGTCNONE 
006-115-A09CGCCACGTCNONE 
006-115-G05CGCCACGTCNONE 
006-117-B06CGCCACGTCNONE 
006-117-B09CGCCACGTCNONE 
006-117-F11CGCCACGTCNONE 
006-117-G10CGCCACGTCNONE 
006-117-H08CGCCACGTCNONE 
006-118-C06CGCCACGTCNONE 
006-118-G11CGCCACGTCNONE 
006-119-H03CGCCACGTCNONE 
006-120-D01CGCCACGTCNONE 
006-120-D12CGCCACGTCNONE 
006-120-H04CGCCACGTCNONE 
009-022-E12CGCCACGTCNONE 
009-044-H02CGCCACGTCNONE 
009-074-B08CGCCACGTCNONE 
009-145-B08CGCCACGTCNONE 
009-156-D09CGCCACGTCNONE 
009-163-F03CGCCACGTCNONE 
009-193-G03CGCCACGTCNONE 
AF010321CGCCACGTCNONE 
AK060987CGCCACGTCNONE 
AK070051CGCCACGTCNONE 
AK103966CGCCACGTCNONE 
AK104016CGCCACGTCNONE 
AK104127CGCCACGTCNONE 
AK104177CGCCACGTCNONE 
AK104283CGCCACGTCNONE 
AK104608CGCCACGTCNONE 
AK104651CGCCACGTCNONE 
AK119176CGCCACGTCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
J065013J05CGCCACGTCNONE 
J065129D23CGCCACGTCNONE 
J065138E06CGCCACGTCNONE 
J065179N22CGCCACGTCNONE 
J065192A07CGCCACGTCNONE 
J065208G16CGCCACGTCNONE 
J075013K01CGCCACGTCNONE 
J075017B12CGCCACGTCNONE 
J075018O17CGCCACGTCNONE 
J075023H05CGCCACGTCNONE 
J075053L02CGCCACGTCNONE 
J075067I01CGCCACGTCNONE 
J075083D19CGCCACGTCNONE 
J075083G03CGCCACGTCNONE 
J075084F12CGCCACGTCNONE 
J075088K18CGCCACGTCNONE 
J075094A18CGCCACGTCNONE 
J075094I22CGCCACGTCNONE 
J075097E17CGCCACGTCNONE 
J075098I24CGCCACGTCNONE 
J075110K19CGCCACGTCNONE 
J075118G21CGCCACGTCNONE 
J075118J20CGCCACGTCNONE 
J075120G14CGCCACGTCNONE 
J075120H20CGCCACGTCNONE 
J075127H23CGCCACGTCNONE 
J075139M03CGCCACGTCNONE 
J075142E17CGCCACGTCNONE 
J075149N17CGCCACGTCNONE 
J075152A20CGCCACGTCNONE 
J075157N22CGCCACGTCNONE 
J075159K21CGCCACGTCNONE 
J075173B20CGCCACGTCNONE 
J075192N20CGCCACGTCNONE 
J075196A07CGCCACGTCNONE 
J075199N04CGCCACGTCNONE 
J080005P10CGCCACGTCNONE 
J080025I24CGCCACGTCNONE 
J080064D09CGCCACGTCNONE 
J080064N24CGCCACGTCNONE 
J080068B02CGCCACGTCNONE 
J080097K04CGCCACGTCNONE 
J080097K19CGCCACGTCNONE 
J080097N20CGCCACGTCNONE 
J100055P07CGCCACGTCNONE 
Os07g0591400Os07g0591400GACGTGGCGNONE 
Os07g0597625J065130O18GACGTGGCD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065166J07GACGTGGCNONE 
Os07g0606600AK111621GCCACGTCNONE 
AK111621GCCACGTCNONE 
AK112118GCCACGTCSimilar to Nuclear factor Y transcription factor subunit B homolog. 
AK112118GCCACGTCSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22GCCACGTCNONE 
J080301F22GCCACGTCNONE 
Os07g0607800012-042-C02CGCCACGTCNONE 
015-097-B06CGCCACGTCNONE 
AK069010CGCCACGTCNONE 
J013170I18CGCCACGTCNONE 
J090036G23CGCCACGTCNONE 
Os07g0614000015-078-C05GACGTGGCTTGGGCTNONE 
AK069163GACGTGGCTTGGGCTNONE 
AK109489GACGTGGCTTGGGCTStrictosidine synthase family protein. 
J065123D15GACGTGGCTTGGGCTNONE 
J065124L12GACGTGGCTTGGGCTNONE 
J065180F02GACGTGGCTTGGGCTNONE 
J075143N04GACGTGGCTTGGGCTNONE 
J080014B10GACGTGGCTTGGGCTNONE 
J080026L16GACGTGGCTTGGGCTNONE 
J080044H09GACGTGGCTTGGGCTNONE 
J080071M17GACGTGGCTTGGGCTNONE 
Os07g0620800AK063671CGCCACGTCTCCyclin-like domain containing protein. 
Os07g0621201J065152G13GACGTGGCConserved hypothetical protein. 
Os07g0622700AK107120CGCCACGTCEpoxide hydrolase family protein. 
Os07g0657200AB042102GCCACGTCNONE 
AK072927GCCACGTCWD40-like domain containing protein. 
AK100911GCCACGTCNONE 
Os07g0661100Os07g0661100GCCACGTCACGlycosyl transferase, family 4 protein. 
Os07g0673100AK060100CGCCACGTCNONE 
AK103678CGCCACGTCRibosomal protein S8E family protein. 
AK104794CGCCACGTCNONE 
Os07g0674400AK119672GACGTGGCConserved hypothetical protein. 
Os07g0683200013-007-C05CGCCACGTCACNONE 
013-065-B12CGCCACGTCACNONE 
AK068606CGCCACGTCACSimilar to OsNAC6 protein. 
J013157G23CGCCACGTCACNONE 
J065027I23CGCCACGTCACNONE 
J065030M02CGCCACGTCACNONE 
J065056J02CGCCACGTCACNONE 
J065124H04CGCCACGTCACNONE 
J065142K03CGCCACGTCACNONE 
J065142M16CGCCACGTCACNONE 
J065201J05CGCCACGTCACNONE 
J065215H19CGCCACGTCACNONE 
J075195N15CGCCACGTCACNONE 
J090073O17CGCCACGTCACNONE 
J100069P10CGCCACGTCACNONE 
Os08g0117100AK099630GACGTGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013058B07GACGTGGCNONE 
Os08g0128200AK120428GCCACGTCACCConserved hypothetical protein. 
Os08g0150800AK101530TGTGGGCCACGTCSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0155100AK069865CGCCACGTCACGCCTCGCCCMajor sperm protein domain containing protein. 
AK104886CGCCACGTCACGCCTCGCCCNONE 
J013089M01CGCCACGTCACGCCTCGCCCNONE 
J023037M15CGCCACGTCACGCCTCGCCCNONE 
J033068E03CGCCACGTCACGCCTCGCCCNONE 
J090021P19CGCCACGTCACGCCTCGCCCNONE 
Os08g0192200AK064428GCCACGTCHypothetical protein. 
Os08g0206600AK064336CGCCACGTCAICARFT/IMPCHase bienzyme family protein. 
AK102764CGCCACGTCNONE 
Os08g0267900AK107040CGCCACGTCConserved hypothetical protein. 
Os08g0299200009-120-G12GCCACGTCACCNONE 
J075096F13GCCACGTCACCAdenylate cyclase domain containing protein. 
Os08g0379400006-112-H05GACGTGGCNONE 
AK112013GACGTGGCNONE 
J023019N13GACGTGGCNONE 
Os08g0414300AK072217GCCACGTCConserved hypothetical protein. 
J065039C07GCCACGTCNONE 
J065098N11GCCACGTCNONE 
J065120J15GCCACGTCNONE 
J075076H12GCCACGTCNONE 
J075101N16GCCACGTCNONE 
J080010A07GCCACGTCNONE 
J080023C16GCCACGTCNONE 
J080027G22GCCACGTCNONE 
J080053D02GCCACGTCNONE 
J080065E17GCCACGTCNONE 
J080068C15GCCACGTCNONE 
J090061J10GCCACGTCNONE 
Os08g0416100AK070406CGCCACGTCGGATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AY644647CGCCACGTCGGATNONE 
Os08g0416250J075097B22GACGTGGCHypothetical protein. 
J075120J07GACGTGGCNONE 
J075179K03GACGTGGCNONE 
Os08g0431500009-186-D05GCCACGTCNONE 
AK058993GCCACGTCNONE 
AK100797GCCACGTCConserved hypothetical protein. 
J023121F15GCCACGTCNONE 
Os08g0435900003-113-D09CCGTCCGACGTGGCNONE 
003-131-A04CCGTCCGACGTGGCNONE 
006-021-D09CCGTCCGACGTGGCNONE 
006-023-F09CCGTCCGACGTGGCNONE 
006-024-H07CCGTCCGACGTGGCNONE 
006-025-F06CCGTCCGACGTGGCNONE 
006-025-H01CCGTCCGACGTGGCNONE 
006-025-H10CCGTCCGACGTGGCNONE 
006-026-A07CCGTCCGACGTGGCNONE 
006-026-E01CCGTCCGACGTGGCNONE 
006-026-F04CCGTCCGACGTGGCNONE 
006-027-A01CCGTCCGACGTGGCNONE 
006-029-H01CCGTCCGACGTGGCNONE 
006-030-D02CCGTCCGACGTGGCNONE 
006-032-C03CCGTCCGACGTGGCNONE 
006-034-C02CCGTCCGACGTGGCNONE 
006-035-H10CCGTCCGACGTGGCNONE 
006-039-C01CCGTCCGACGTGGCNONE 
006-039-H08CCGTCCGACGTGGCNONE 
006-040-D09CCGTCCGACGTGGCNONE 
006-040-F05CCGTCCGACGTGGCNONE 
006-044-D04CCGTCCGACGTGGCNONE 
006-044-F09CCGTCCGACGTGGCNONE 
006-044-G05CCGTCCGACGTGGCNONE 
006-045-C06CCGTCCGACGTGGCNONE 
006-046-B04CCGTCCGACGTGGCNONE 
006-047-D03CCGTCCGACGTGGCNONE 
006-048-C10CCGTCCGACGTGGCNONE 
006-048-D10CCGTCCGACGTGGCNONE 
006-050-H01CCGTCCGACGTGGCNONE 
006-051-D12CCGTCCGACGTGGCNONE 
006-053-B05CCGTCCGACGTGGCNONE 
006-054-B12CCGTCCGACGTGGCNONE 
006-054-E05CCGTCCGACGTGGCNONE 
006-054-H06CCGTCCGACGTGGCNONE 
006-056-H02CCGTCCGACGTGGCNONE 
006-059-A07CCGTCCGACGTGGCNONE 
006-059-G02CCGTCCGACGTGGCNONE 
006-059-G12CCGTCCGACGTGGCNONE 
006-061-F01CCGTCCGACGTGGCNONE 
006-061-H10CCGTCCGACGTGGCNONE 
006-063-B02CCGTCCGACGTGGCNONE 
006-064-H12CCGTCCGACGTGGCNONE 
006-068-D06CCGTCCGACGTGGCNONE 
006-071-H08CCGTCCGACGTGGCNONE 
006-072-E10CCGTCCGACGTGGCNONE 
006-074-C06CCGTCCGACGTGGCNONE 
006-074-D12CCGTCCGACGTGGCNONE 
006-076-H06CCGTCCGACGTGGCNONE 
006-077-E04CCGTCCGACGTGGCNONE 
006-081-H01CCGTCCGACGTGGCNONE 
006-082-E11CCGTCCGACGTGGCNONE 
006-083-G10CCGTCCGACGTGGCNONE 
006-084-B05CCGTCCGACGTGGCNONE 
006-085-C06CCGTCCGACGTGGCNONE 
006-088-C04CCGTCCGACGTGGCNONE 
006-088-F11CCGTCCGACGTGGCNONE 
006-088-H11CCGTCCGACGTGGCNONE 
006-090-F06CCGTCCGACGTGGCNONE 
006-091-B01CCGTCCGACGTGGCNONE 
006-091-C10CCGTCCGACGTGGCNONE 
006-091-G11CCGTCCGACGTGGCNONE 
006-092-A11CCGTCCGACGTGGCNONE 
006-092-F10CCGTCCGACGTGGCNONE 
006-093-D01CCGTCCGACGTGGCNONE 
006-093-E11CCGTCCGACGTGGCNONE 
006-095-F09CCGTCCGACGTGGCNONE 
006-096-B05CCGTCCGACGTGGCNONE 
006-096-B06CCGTCCGACGTGGCNONE 
006-096-B11CCGTCCGACGTGGCNONE 
006-099-E04CCGTCCGACGTGGCNONE 
006-100-A01CCGTCCGACGTGGCNONE 
006-100-E04CCGTCCGACGTGGCNONE 
006-104-B09CCGTCCGACGTGGCNONE 
006-106-A09CCGTCCGACGTGGCNONE 
006-107-C07CCGTCCGACGTGGCNONE 
006-107-H03CCGTCCGACGTGGCNONE 
006-109-B12CCGTCCGACGTGGCNONE 
006-109-F10CCGTCCGACGTGGCNONE 
006-110-C10CCGTCCGACGTGGCNONE 
006-110-E09CCGTCCGACGTGGCNONE 
006-114-H07CCGTCCGACGTGGCNONE 
006-115-A06CCGTCCGACGTGGCNONE 
006-115-A12CCGTCCGACGTGGCNONE 
006-115-C10CCGTCCGACGTGGCNONE 
006-115-D10CCGTCCGACGTGGCNONE 
006-116-D02CCGTCCGACGTGGCNONE 
006-117-C11CCGTCCGACGTGGCNONE 
006-119-H09CCGTCCGACGTGGCNONE 
009-008-B04CCGTCCGACGTGGCNONE 
009-021-A04CCGTCCGACGTGGCNONE 
009-026-H09CCGTCCGACGTGGCNONE 
009-027-D10CCGTCCGACGTGGCNONE 
009-030-B11CCGTCCGACGTGGCNONE 
009-040-E08CCGTCCGACGTGGCNONE 
009-049-E10CCGTCCGACGTGGCNONE 
009-058-C12CCGTCCGACGTGGCNONE 
009-061-G01CCGTCCGACGTGGCNONE 
009-079-G09CCGTCCGACGTGGCNONE 
009-081-F08CCGTCCGACGTGGCNONE 
009-096-F04CCGTCCGACGTGGCNONE 
009-103-D05CCGTCCGACGTGGCNONE 
009-119-F08CCGTCCGACGTGGCNONE 
009-123-B02CCGTCCGACGTGGCNONE 
009-128-H11CCGTCCGACGTGGCNONE 
009-131-B06CCGTCCGACGTGGCNONE 
009-142-H06CCGTCCGACGTGGCNONE 
009-156-C01CCGTCCGACGTGGCNONE 
009-165-D02CCGTCCGACGTGGCNONE 
009-168-G10CCGTCCGACGTGGCNONE 
009-175-F03CCGTCCGACGTGGCNONE 
009-178-E06CCGTCCGACGTGGCNONE 
009-179-G04CCGTCCGACGTGGCNONE 
009-181-C10CCGTCCGACGTGGCNONE 
009-182-D09CCGTCCGACGTGGCNONE 
009-183-D07CCGTCCGACGTGGCNONE 
AF094775CCGTCCGACGTGGCNONE 
AK060222CCGTCCGACGTGGCSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
AK067712CCGTCCGACGTGGCNONE 
AK067809CCGTCCGACGTGGCNONE 
AK103921CCGTCCGACGTGGCNONE 
AK104416CCGTCCGACGTGGCNONE 
AK104499CCGTCCGACGTGGCNONE 
AY445626CCGTCCGACGTGGCNONE 
J013120H04CCGTCCGACGTGGCNONE 
J013121A03CCGTCCGACGTGGCNONE 
J013127D22CCGTCCGACGTGGCNONE 
J023088A04CCGTCCGACGTGGCNONE 
J023132O20CCGTCCGACGTGGCNONE 
J053026I18CCGTCCGACGTGGCNONE 
J053032G14CCGTCCGACGTGGCNONE 
J053055E21CCGTCCGACGTGGCNONE 
J053070F24CCGTCCGACGTGGCNONE 
J065034E08CCGTCCGACGTGGCNONE 
J065085O17CCGTCCGACGTGGCNONE 
J065156H20CCGTCCGACGTGGCNONE 
J065171C21CCGTCCGACGTGGCNONE 
J065173A20CCGTCCGACGTGGCNONE 
J065173C02CCGTCCGACGTGGCNONE 
J065182N01CCGTCCGACGTGGCNONE 
J075001K11CCGTCCGACGTGGCNONE 
J075002K18CCGTCCGACGTGGCNONE 
J075005P06CCGTCCGACGTGGCNONE 
J075006P21CCGTCCGACGTGGCNONE 
J075008G02CCGTCCGACGTGGCNONE 
J075009D08CCGTCCGACGTGGCNONE 
J075013D09CCGTCCGACGTGGCNONE 
J075013D15CCGTCCGACGTGGCNONE 
J075016F05CCGTCCGACGTGGCNONE 
J075016F18CCGTCCGACGTGGCNONE 
J075016K07CCGTCCGACGTGGCNONE 
J075016M08CCGTCCGACGTGGCNONE 
J075021G21CCGTCCGACGTGGCNONE 
J075025G06CCGTCCGACGTGGCNONE 
J075029M11CCGTCCGACGTGGCNONE 
J075035E01CCGTCCGACGTGGCNONE 
J075038M21CCGTCCGACGTGGCNONE 
J075039G20CCGTCCGACGTGGCNONE 
J075040K18CCGTCCGACGTGGCNONE 
J075041G13CCGTCCGACGTGGCNONE 
J075042O03CCGTCCGACGTGGCNONE 
J075047C01CCGTCCGACGTGGCNONE 
J075047M08CCGTCCGACGTGGCNONE 
J075052L02CCGTCCGACGTGGCNONE 
J075055E24CCGTCCGACGTGGCNONE 
J075056F22CCGTCCGACGTGGCNONE 
J075068B12CCGTCCGACGTGGCNONE 
J075068D01CCGTCCGACGTGGCNONE 
J075069H19CCGTCCGACGTGGCNONE 
J075071J21CCGTCCGACGTGGCNONE 
J075072O06CCGTCCGACGTGGCNONE 
J075075J05CCGTCCGACGTGGCNONE 
J075079E21CCGTCCGACGTGGCNONE 
J075079H05CCGTCCGACGTGGCNONE 
J075081L10CCGTCCGACGTGGCNONE 
J075087D17CCGTCCGACGTGGCNONE 
J075088B07CCGTCCGACGTGGCNONE 
J075088D22CCGTCCGACGTGGCNONE 
J075090E03CCGTCCGACGTGGCNONE 
J075095L09CCGTCCGACGTGGCNONE 
J075098G08CCGTCCGACGTGGCNONE 
J075099M10CCGTCCGACGTGGCNONE 
J075101D01CCGTCCGACGTGGCNONE 
J075102H24CCGTCCGACGTGGCNONE 
J075103A05CCGTCCGACGTGGCNONE 
J075106A15CCGTCCGACGTGGCNONE 
J075106L10CCGTCCGACGTGGCNONE 
J075108H11CCGTCCGACGTGGCNONE 
J075110D12CCGTCCGACGTGGCNONE 
J075114A06CCGTCCGACGTGGCNONE 
J075116G16CCGTCCGACGTGGCNONE 
J075118B13CCGTCCGACGTGGCNONE 
J075119C20CCGTCCGACGTGGCNONE 
J075122F24CCGTCCGACGTGGCNONE 
J075129D14CCGTCCGACGTGGCNONE 
J075132L06CCGTCCGACGTGGCNONE 
J075133E22CCGTCCGACGTGGCNONE 
J075140L09CCGTCCGACGTGGCNONE 
J075140L24CCGTCCGACGTGGCNONE 
J075146J17CCGTCCGACGTGGCNONE 
J075148A09CCGTCCGACGTGGCNONE 
J075152D01CCGTCCGACGTGGCNONE 
J075153L22CCGTCCGACGTGGCNONE 
J075156B08CCGTCCGACGTGGCNONE 
J075158D24CCGTCCGACGTGGCNONE 
J075158H14CCGTCCGACGTGGCNONE 
J075167M07CCGTCCGACGTGGCNONE 
J075172F21CCGTCCGACGTGGCNONE 
J075175J15CCGTCCGACGTGGCNONE 
J075183C13CCGTCCGACGTGGCNONE 
J075190A08CCGTCCGACGTGGCNONE 
J075190E08CCGTCCGACGTGGCNONE 
J075190H21CCGTCCGACGTGGCNONE 
J075194C13CCGTCCGACGTGGCNONE 
J075195E18CCGTCCGACGTGGCNONE 
J075197H09CCGTCCGACGTGGCNONE 
J075199J01CCGTCCGACGTGGCNONE 
J080310L13CCGTCCGACGTGGCNONE 
J080311F02CCGTCCGACGTGGCNONE 
J080311H17CCGTCCGACGTGGCNONE 
J080315M04CCGTCCGACGTGGCNONE 
J080316A09CCGTCCGACGTGGCNONE 
J080319D20CCGTCCGACGTGGCNONE 
J080319L04CCGTCCGACGTGGCNONE 
J090002C14CCGTCCGACGTGGCNONE 
J090031P04CCGTCCGACGTGGCNONE 
J090050E09CCGTCCGACGTGGCNONE 
J100048H01CCGTCCGACGTGGCNONE 
J100089C18CCGTCCGACGTGGCNONE 
Os08g0439900AK110628CGCCACGTCMitochondrial glycoprotein family protein. 
J065118D13CGCCACGTCNONE 
Os08g0441400011-033-F01GACGTGGCNONE 
015-084-B04GACGTGGCNONE 
AK063317GACGTGGCNONE 
AK064141GACGTGGCConserved hypothetical protein. 
J065060F06GACGTGGCNONE 
J075110A22GACGTGGCNONE 
J080307P11GACGTGGCNONE 
J090041E06GACGTGGCNONE 
Os08g0461800012-071-E12CGCCACGTCNONE 
AK066516CGCCACGTCNONE 
AK067364CGCCACGTCConserved hypothetical protein. 
AK098966CGCCACGTCNONE 
Os08g0465300AK108076ATCCGACGTGGCConserved hypothetical protein. 
Os08g0469600009-080-H09GACGTGGCGNONE 
AK062647GACGTGGCGConserved hypothetical protein. 
Os08g0481500J065054C23CGCCACGTCConserved hypothetical protein. 
J065218E06CGCCACGTCNONE 
Os08g0497900AK071174GAGACGTGGCConserved hypothetical protein. 
AK071174GCCACGTCConserved hypothetical protein. 
Os08g0502700AK064774GCCACGTCGGACGGGTGTGGGCCCCACGAAAminotransferase, class V family protein. 
AK065126GCCACGTCGGACGGGTGTGGGCCCCACGAA</