version

Summary of OsREG586 (All List)

OrganismOryza sativa  
IDOsREG586  
SequenceGACTCGAC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count367  

Entry Sequences (367 entries)

LocusGene modelSequenceDescription
Os01g0286200AK111156GTCGAGTCConserved hypothetical protein. 
Os01g0377700AK059266GTCGAGTCUbiquitin domain containing protein. 
AK107503GTCGAGTCNONE 
J065165L07GTCGAGTCNONE 
J075196J11GTCGAGTCNONE 
Os01g0506200AK073118GACTCGACTetratricopeptide-like helical domain containing protein. 
J065002A07GACTCGACNONE 
J065079J08GACTCGACNONE 
J065167M18GACTCGACNONE 
Os01g0575200015-047-A07GACTCGACTCGACNONE 
AK106333GACTCGACTCGACConserved hypothetical protein. 
J065140I24GACTCGACTCGACNONE 
J080013D19GACTCGACTCGACNONE 
J080034P11GACTCGACTCGACNONE 
J080043J20GACTCGACTCGACNONE 
J080068H05GACTCGACTCGACNONE 
J080070I24GACTCGACTCGACNONE 
J080076D13GACTCGACTCGACNONE 
J080086M10GACTCGACTCGACNONE 
J080086M20GACTCGACTCGACNONE 
J080096B02GACTCGACTCGACNONE 
J080097C23GACTCGACTCGACNONE 
J100050L16GACTCGACTCGACNONE 
Os01g0629400AK063853GACTCGACNONE 
J033034I24GACTCGACNONE 
J033095E13GACTCGACNONE 
J065024B21GACTCGACNONE 
J065194D23GACTCGACNONE 
Os01g0642200009-032-D04GACTCGACNONE 
009-032-G10GACTCGACNONE 
009-124-H08GACTCGACNONE 
009-149-D11GACTCGACNONE 
009-156-E06GACTCGACNONE 
009-165-B07GACTCGACNONE 
009-189-E09GACTCGACNONE 
009-192-H05GACTCGACNONE 
009-194-C05GACTCGACNONE 
AK071521GACTCGACNONE 
AK105174GACTCGACConserved hypothetical protein. 
J023099A13GACTCGACNONE 
J065117K10GACTCGACNONE 
J065130C10GACTCGACNONE 
J075006I15GACTCGACNONE 
J075031C11GACTCGACNONE 
J075059E06GACTCGACNONE 
J075072G07GACTCGACNONE 
J075167B21GACTCGACNONE 
J075183G14GACTCGACNONE 
Os01g0734600012-079-G06GTCGAGTCNONE 
AK065450GTCGAGTCNONE 
AK103129GTCGAGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK119562GTCGAGTCNONE 
J075086F18GTCGAGTCNONE 
J075147G07GTCGAGTCNONE 
Os01g0744300AK102819GTCGAGTCSimilar to Casein kinase-like protein. 
Os01g0757800AK099226GACTCGACNONE 
Os01g0794400AK122041GTGGCGTGACTCGACThioredoxin domain 2 containing protein. 
Os01g0813900AK101729GACTCGACSimilar to ZIGA1 protein (Fragment). 
Os01g0818000AK069848GACTCGACNONE 
AK070194GACTCGACAuxin Efflux Carrier family protein. 
J023041H12GACTCGACNONE 
Os01g0878800AK070438GTCGAGTCNONE 
AK104297GTCGAGTCNONE 
AK105779GTCGAGTCNONE 
Os01g0913800011-060-B02GTCGAGTCNONE 
016-088-H02GTCGAGTCProtein prenyltransferase domain containing protein. 
Os02g0192300Os02g0192300GACTCGACZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0285800AK072177GACTCGACSimilar to GTP-binding protein typA (Tyrosine phosphorylated protein A). 
AK099035GACTCGACNONE 
Os02g0312700AK072956GTCGAGTCATP11 family protein. 
AK102909GTCGAGTCNONE 
J065017G18GTCGAGTCNONE 
J075066A05GTCGAGTCNONE 
Os02g0461900009-042-C04GGTGGGCCCGACTCGACNONE 
AF140492GGTGGGCCCGACTCGACNONE 
AK072619GGTGGGCCCGACTCGACNONE 
AK104969GGTGGGCCCGACTCGACConserved hypothetical protein. 
AK119466GGTGGGCCCGACTCGACNONE 
Os02g0530600012-040-G06GTCGAGTCNONE 
AK105277GTCGAGTCNONE 
J075004K11GTCGAGTCNONE 
J075024O04GTCGAGTCNONE 
J075031K02GTCGAGTCNONE 
J075067K01GTCGAGTCNONE 
J075087G22GTCGAGTCNONE 
J075097A07GTCGAGTCNONE 
J075109O12GTCGAGTCNONE 
J075110K07GTCGAGTCNONE 
J075117C17GTCGAGTCNONE 
J075143O07GTCGAGTCNONE 
J075146F13GTCGAGTCNONE 
J075166I18GTCGAGTCNONE 
J075176N09GTCGAGTCNONE 
J075182F16GTCGAGTCNONE 
Os02g0606200006-050-A05GTCGAGTCNONE 
006-054-D12GTCGAGTCNONE 
006-076-H01GTCGAGTCNONE 
006-097-F10GTCGAGTCNONE 
006-117-H06GTCGAGTCNONE 
AB001885GTCGAGTCZinc finger, B-box domain containing protein. 
AK061044GTCGAGTCNONE 
AK104293GTCGAGTCNONE 
J065168M02GTCGAGTCNONE 
J065198B03GTCGAGTCNONE 
J075053D02GTCGAGTCNONE 
J100074J07GTCGAGTCNONE 
Os02g0628800AK058725GTCGAGTCSimilar to Ubiquitin-like protein 5. 
J043020F23GTCGAGTCNONE 
J043026I04GTCGAGTCNONE 
J053039J09GTCGAGTCNONE 
J053059N02GTCGAGTCNONE 
J053075B03GTCGAGTCNONE 
J065071F14GTCGAGTCNONE 
J065161B08GTCGAGTCNONE 
J065197J09GTCGAGTCNONE 
J075086C09GTCGAGTCNONE 
J075109A22GTCGAGTCNONE 
J075167C02GTCGAGTCNONE 
J090003N10GTCGAGTCNONE 
J100023D11GTCGAGTCNONE 
J100035C10GTCGAGTCNONE 
J100039E07GTCGAGTCNONE 
J100081N03GTCGAGTCNONE 
J100086P11GTCGAGTCNONE 
Os02g0697500006-055-B12GTCGAGTCNONE 
AK105891GTCGAGTCNONE 
Os02g0699800AK108578GACTCGACConserved hypothetical protein. 
AK108578GACTCGACConserved hypothetical protein. 
Os02g0821800014-086-A11GTCGAGTCNONE 
AK071291GTCGAGTCNONE 
J023088O08GTCGAGTCNONE 
J033130D23GTCGAGTCNONE 
Os03g0122300AK068438GACTCGACSimilar to Flavanone 3-hydroxylase-like protein. 
AK071416GACTCGACNONE 
AK104414GACTCGACNONE 
J023078E24GACTCGACNONE 
J023141J19GACTCGACNONE 
J033050K09GACTCGACNONE 
Os03g0146000006-105-H06GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
AK061250GTCGCGTCGCGTCGCGTCGAGTCGAGTCSimilar to RAB1X. 
AK099130GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
J023043D11GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
J043009O17GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
Os03g0227000AK068454GACTCGACSimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0381500AK108125GACTCGACConserved hypothetical protein. 
Os03g0428700AK111273GACTCGACSimilar to Alpha-expansin OsEXPA19. 
Os03g0576900AK064861GACTCGACNONE 
J013000I01GACTCGACNONE 
J013169P21GACTCGACNONE 
J023001P03GACTCGACNONE 
J023009M10GACTCGACNONE 
J023025G11GACTCGACNONE 
J033046B19GACTCGACNONE 
J033149I10GACTCGACNONE 
J090081C04GACTCGACNONE 
Os03g0647400AK073665GTCGAGTCGCK domain containing protein. 
J033051B07GTCGAGTCNONE 
Os03g0725000AK059294GACTCGACNONE 
J043026H11GACTCGACNONE 
J065187O06GACTCGACNONE 
J090066M23GACTCGACNONE 
Os03g0788700AK073842GTCGAGTCBeta-Ig-H3/fasciclin domain containing protein. 
J065002I01GTCGAGTCNONE 
J065045G14GTCGAGTCNONE 
J065192L18GTCGAGTCNONE 
Os03g0802500005-009-E09GACTCGACNONE 
016-058-E03GACTCGACNONE 
AK070731GACTCGACAAA ATPase domain containing protein. 
AK099212GACTCGACNONE 
AK104696GACTCGACNONE 
J013050J10GACTCGACNONE 
J023061A01GACTCGACNONE 
J023088E08GACTCGACNONE 
J033084A02GACTCGACNONE 
J090015G11GACTCGACNONE 
J090075G22GACTCGACNONE 
J100067G24GACTCGACNONE 
Os03g0807000J065099H13GTCGAGTCNONE 
J065102L24GTCGAGTCNONE 
J075033G24GTCGAGTCConserved hypothetical protein. 
Os04g0218600009-123-A05GACTCGACNONE 
AK062873GACTCGACNONE 
AK103472GACTCGACConserved hypothetical protein. 
J090077A20GACTCGACNONE 
Os04g0396800009-077-F11GACTCGACNONE 
AK062632GACTCGACNONE 
Os04g0439100J013026H11GTCGAGTCNONE 
J013097L15GTCGAGTCNONE 
J013112G22GTCGAGTCNONE 
J013160E02GTCGAGTCNONE 
J043026G08GTCGAGTCNONE 
Os04g0461000Os04g0461000GTCGAGTCSimilar to Myb-related transcription factor LBM1. 
Os04g0497000006-097-G07GACTCGACNONE 
AK069136GACTCGACNONE 
AK109382GACTCGACSimilar to Allyl alcohol dehydrogenase. 
J023008C06GACTCGACNONE 
J043007K16GACTCGACNONE 
J065110K06GACTCGACNONE 
J080012F02GACTCGACNONE 
J080020N21GACTCGACNONE 
J080026H09GACTCGACNONE 
J080029D13GACTCGACNONE 
J080034C08GACTCGACNONE 
J080050J07GACTCGACNONE 
Os04g0537800AK103654GTCGAGTCProtein of unknown function DUF26 domain containing protein. 
J023003K20GTCGAGTCNONE 
J023007K15GTCGAGTCNONE 
J023041L14GTCGAGTCNONE 
J033135E09GTCGAGTCNONE 
Os04g0578400AK060559GACTCGACSimilar to Beta-ring hydroxylase (Fragment). 
Os04g0581300009-171-H01GACTCGACNONE 
AK063093GACTCGACSimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0243200009-073-F12GACTCGACNONE 
AK061317GACTCGACSimilar to Ribosomal protein L13. 
J065120F21GACTCGACNONE 
J065185K05GACTCGACNONE 
Os05g0429700AK059651GTCGAGTCNONE 
AK069203GTCGAGTCNONE 
Os05g0490800J065037L19GTCGAGTCGAGTCNONE 
Os05g0529000AK059220GACTCGACProtein of unknown function DUF502 family protein. 
Os06g0114333J075001D01GTCGAGTCCyclin-like F-box domain containing protein. 
J075005L22GTCGAGTCNONE 
J075057K08GTCGAGTCNONE 
J075101P04GTCGAGTCNONE 
J075184J15GTCGAGTCNONE 
Os06g0298400AK066952GACTCGACWW/Rsp5/WWP domain containing protein. 
J013090J20GACTCGACNONE 
J033024J05GACTCGACNONE 
J033033H19GACTCGACNONE 
J033057J15GACTCGACNONE 
J065047L24GACTCGACNONE 
J065198L23GACTCGACNONE 
J065218N03GACTCGACNONE 
J090001F10GACTCGACNONE 
J090025N24GACTCGACNONE 
J090073E16GACTCGACNONE 
Os06g0550800J065058J22GACTCGACConserved hypothetical protein. 
Os06g0667400AK065424GACTCGACConserved hypothetical protein. 
AK065580GACTCGACNONE 
Os06g0683800AK110639GTCGAGTCConserved hypothetical protein. 
Os06g0715500AK059749GACTCGACNONE 
AK060137GACTCGACNONE 
AK100782GACTCGACSimilar to Translocon-associated protein alpha subunit precursor (TRAP-alpha) (Signal sequence receptor alpha subunit) (SSR-alpha). 
Os06g0731800012-049-D10GACTCGACNONE 
AK069288GACTCGACClathrin light chain family protein. 
J023014P04GACTCGACNONE 
J023058N12GACTCGACNONE 
J053035L13GACTCGACNONE 
J065097L21GACTCGACNONE 
J065099F07GACTCGACNONE 
J065144L02GACTCGACNONE 
J065161J11GACTCGACNONE 
J065181N05GACTCGACNONE 
J075087D09GACTCGACNONE 
J075088H19GACTCGACNONE 
J075116E21GACTCGACNONE 
J075147K03GACTCGACNONE 
J090083H22GACTCGACNONE 
J100079M09GACTCGACNONE 
Os07g0206900AK107761GTCGAGTCProtein of unknown function DUF642 family protein. 
Os07g0213400003-104-B01GTCGAGTCNONE 
AK062273GTCGAGTCConserved hypothetical protein. 
J065122P17GTCGAGTCNONE 
J065160A01GTCGAGTCNONE 
J090065M11GTCGAGTCNONE 
Os07g0245100J023048C16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J023110L14CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053023B18CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053031L17CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065035I22CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065043D21CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065072L16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065214I23CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
Os07g0250300AK065043GACTCGACNONE 
AK072884GACTCGACConserved hypothetical protein. 
AK098969GACTCGACNONE 
J013001H21GACTCGACNONE 
J033069M20GACTCGACNONE 
J090056K24GACTCGACNONE 
Os07g0259000AK106951GTCGAGTCCGATCConserved hypothetical protein. 
Os07g0474300AK108961GTCGAGTCConserved hypothetical protein. 
Os07g0539300011-069-B09GACTCGACNONE 
015-087-A02GACTCGACNONE 
AK066237GACTCGACGlycoside hydrolase, family 17 protein. 
AK067528GACTCGACNONE 
J013036D16GACTCGACNONE 
J013058G09GACTCGACNONE 
J013089F23GACTCGACNONE 
J013107E22GACTCGACNONE 
J033032F07GACTCGACNONE 
J033072C24GACTCGACNONE 
J033123M17GACTCGACNONE 
J043009A11GACTCGACNONE 
J043034K14GACTCGACNONE 
J053024L18GACTCGACNONE 
J053078L04GACTCGACNONE 
J100038F06GACTCGACNONE 
J100069E14GACTCGACNONE 
J100078F22GACTCGACNONE 
J100087N21GACTCGACNONE 
Os07g0627300AK063426GTCGAGTCSimilar to Myb-related protein B (B-Myb). 
Os07g0684800013-077-H01GTCGAGTCNONE 
015-030-A10GTCGAGTCNONE 
015-071-F08GTCGAGTCNONE 
015-085-E04GTCGAGTCNONE 
016-037-F05GTCGAGTCNONE 
016-053-E02GTCGAGTCNONE 
016-070-B08GTCGAGTCNONE 
016-092-G08GTCGAGTCNONE 
016-096-E12GTCGAGTCNONE 
AK073876GTCGAGTCSimilar to NAM / CUC2-like protein. 
AK105645GTCGAGTCNONE 
J033072L16GTCGAGTCNONE 
J065208M01GTCGAGTCNONE 
J090087I02GTCGAGTCNONE 
J100028D06GTCGAGTCNONE 
Os08g0136500006-092-G03GACTCGACNONE 
AK061187GACTCGACProtein of unknown function DUF26 domain containing protein. 
J065057C18GACTCGACNONE 
Os08g0416250J075097B22GTCGAGTCHypothetical protein. 
J075120J07GTCGAGTCNONE 
J075179K03GTCGAGTCNONE 
Os08g0432800AK109616GACTCGACSimilar to BHLH transcription activator Ivory seed. 
Os08g0558600006-084-G07GACTCGACNONE 
AK066924GACTCGACLongin domain containing protein. 
AK104800GACTCGACNONE 
J075013M07GACTCGACNONE 
J090027H19GACTCGACNONE 
J090088D21GACTCGACNONE 
J100017O20GACTCGACNONE 
J100035L15GACTCGACNONE 
J100037P06GACTCGACNONE 
Os09g0299000AK069336GACTCGACSimilar to CDPK substrate protein 1. 
J013067B11GACTCGACNONE 
J013132D15GACTCGACNONE 
J023010K22GACTCGACNONE 
J023045F12GACTCGACNONE 
J023128A22GACTCGACNONE 
J033092P14GACTCGACNONE 
J065083M23GACTCGACNONE 
J065107F02GACTCGACNONE 
J075082K07GACTCGACNONE 
Os09g0452400011-055-G09GTCGAGTCNONE 
AK063358GTCGAGTCPeptidase A1, pepsin family protein. 
Os09g0453800AK119212GACTCGACCCGCNONE 
J023081A04GACTCGACCCGCNONE 
J065180G14GACTCGACCCGCNONE 
J100024A17GACTCGACCCGCNONE 
J100030A05GACTCGACCCGCNONE 
J100042I11GACTCGACCCGCNONE 
J100054N05GACTCGACCCGCNONE 
J100075G23GACTCGACCCGCNONE 
Os09g0506000AK073281GTCGAGTCNONE 
AK102346GTCGAGTCNONE 
AK106533GTCGAGTCSimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os09g0535100AK069888GTCGAGTCZinc finger, RING-type domain containing protein. 
J100027B09GTCGAGTCNONE 
J100038A04GTCGAGTCNONE 
J100059F10GTCGAGTCNONE 
Os11g0137500AK070070GTCGAGTCCAACGGTCTranscription factor TFIIE, alpha subunit family protein. 
Os11g0170400AK066519GTCGAGTCConserved hypothetical protein. 
J013039A08GTCGAGTCNONE 
Os12g0564800AK103886GTCGAGTCDisease resistance protein family protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.