version

Summary of OsREG587 (All List)

OrganismOryza sativa  
IDOsREG587  
SequenceGAGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2727  

Entry Sequences (2727 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07GAGGCCCATCANONE 
AK063774GAGGCCCATCATranslocon-associated beta family protein. 
AK099081GAGGCCCATCANONE 
AK099360GAGGCCCATCANONE 
J013096O20GAGGCCCATCANONE 
J023002P14GAGGCCCATCANONE 
J033046F10GAGGCCCATCANONE 
J033084K08GAGGCCCATCANONE 
J065011H22GAGGCCCATCANONE 
J090017O18GAGGCCCATCANONE 
J090047F15GAGGCCCATCANONE 
J090049G20GAGGCCCATCANONE 
Os01g0132700J065063N10AGTGGGCCTCSurfeit locus 5 family protein. 
J065164N24AGTGGGCCTCNONE 
J065167H04AGTGGGCCTCNONE 
J065187N12AGTGGGCCTCNONE 
Os01g0155600006-048-F03AGATGGGCCTCNONE 
AK060171AGATGGGCCTCNONE 
AK071635AGATGGGCCTCSimilar to Splicing factor RSZ33. 
J023080A03AGATGGGCCTCNONE 
J023100L15AGATGGGCCTCNONE 
J033075I17AGATGGGCCTCNONE 
J033085O09AGATGGGCCTCNONE 
J033105E15AGATGGGCCTCNONE 
J033132N10AGATGGGCCTCNONE 
J033132P12AGATGGGCCTCNONE 
J033149H12AGATGGGCCTCNONE 
J043026M03AGATGGGCCTCNONE 
J080305J10AGATGGGCCTCNONE 
J080308K03AGATGGGCCTCNONE 
J090023M04AGATGGGCCTCNONE 
J090078F24AGATGGGCCTCNONE 
J100066P05AGATGGGCCTCNONE 
Os01g0172000012-070-G06GGGCCGGAGGCCCATGANONE 
AK068405GGGCCGGAGGCCCATGAALG3 family protein. 
J013149A07GGGCCGGAGGCCCATGANONE 
J053047H05GGGCCGGAGGCCCATGANONE 
J065075N03GGGCCGGAGGCCCATGANONE 
J065093G22GGGCCGGAGGCCCATGANONE 
J065130N21GGGCCGGAGGCCCATGANONE 
J065143P05GGGCCGGAGGCCCATGANONE 
J065216H07GGGCCGGAGGCCCATGANONE 
J075013B06GGGCCGGAGGCCCATGANONE 
J075196M05GGGCCGGAGGCCCATGANONE 
J100039G24GGGCCGGAGGCCCATGANONE 
J100041B11GGGCCGGAGGCCCATGANONE 
J100069A16GGGCCGGAGGCCCATGANONE 
J100069L12GGGCCGGAGGCCCATGANONE 
J100074P16GGGCCGGAGGCCCATGANONE 
Os01g0179901J075009I05GAGGCCCATTGGGCCGAAANONE 
J075058D09GAGGCCCATTGGGCCGAAANONE 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
Os01g0184000015-008-B06GAGGCCCATTNONE 
AK071130GAGGCCCATTNUC156 family protein. 
AK100604GAGGCCCATTNONE 
J075155H07GAGGCCCATTNONE 
J100047O19GAGGCCCATTNONE 
J100074A09GAGGCCCATTNONE 
Os01g0184800AK073377GAGGCCCAAAAPhosducin family protein. 
AK102544GAGGCCCAAAANONE 
J023047L21GAGGCCCAAAANONE 
J023135I09GAGGCCCAAAANONE 
J033028G17GAGGCCCAAAANONE 
J065164L07GAGGCCCAAAANONE 
J065193F22GAGGCCCAAAANONE 
J075035I10GAGGCCCAAAANONE 
J075168H15GAGGCCCAAAANONE 
Os01g0201000J080015E02TCTGGGCCTCHypothetical protein. 
Os01g0222700012-011-E01GAGGCCCACGTNONE 
AK068883GAGGCCCACGTNONE 
AK101946GAGGCCCACGTZinc finger, BED-type predicted domain containing protein. 
J033075C16GAGGCCCACGTNONE 
J043013D08GAGGCCCACGTNONE 
J065089G19GAGGCCCACGTNONE 
J065197K19GAGGCCCACGTNONE 
J075161L21GAGGCCCACGTNONE 
Os01g0229100006-113-G08ACGTGGGCCTCNONE 
006-113-G08GAGGCCCATTANONE 
011-075-E08ACGTGGGCCTCNONE 
011-075-E08GAGGCCCATTANONE 
AK061285ACGTGGGCCTCNONE 
AK061285GAGGCCCATTANONE 
AK070838ACGTGGGCCTCTetratricopeptide-like helical domain containing protein. 
AK070838GAGGCCCATTATetratricopeptide-like helical domain containing protein. 
J013059F08ACGTGGGCCTCNONE 
J013059F08GAGGCCCATTANONE 
J013059G08ACGTGGGCCTCNONE 
J013059G08GAGGCCCATTANONE 
J013059G09ACGTGGGCCTCNONE 
J013059G09GAGGCCCATTANONE 
J013069M12ACGTGGGCCTCNONE 
J013069M12GAGGCCCATTANONE 
J013105A19ACGTGGGCCTCNONE 
J013105A19GAGGCCCATTANONE 
J013149F07ACGTGGGCCTCNONE 
J013149F07GAGGCCCATTANONE 
J023073J07ACGTGGGCCTCNONE 
J023073J07GAGGCCCATTANONE 
J023130F24ACGTGGGCCTCNONE 
J023130F24GAGGCCCATTANONE 
J023147J08ACGTGGGCCTCNONE 
J023147J08GAGGCCCATTANONE 
J033028F13ACGTGGGCCTCNONE 
J033028F13GAGGCCCATTANONE 
J033115A16ACGTGGGCCTCNONE 
J033115A16GAGGCCCATTANONE 
J033135F02ACGTGGGCCTCNONE 
J033135F02GAGGCCCATTANONE 
J065031G16ACGTGGGCCTCNONE 
J065031G16GAGGCCCATTANONE 
J065058A09ACGTGGGCCTCNONE 
J065058A09GAGGCCCATTANONE 
J065089N15ACGTGGGCCTCNONE 
J065089N15GAGGCCCATTANONE 
J065130I09ACGTGGGCCTCNONE 
J065130I09GAGGCCCATTANONE 
J065191P09ACGTGGGCCTCNONE 
J065191P09GAGGCCCATTANONE 
J065197P14ACGTGGGCCTCNONE 
J065197P14GAGGCCCATTANONE 
J080306D15ACGTGGGCCTCNONE 
J080306D15GAGGCCCATTANONE 
J080308M06ACGTGGGCCTCNONE 
J080308M06GAGGCCCATTANONE 
J080315A03ACGTGGGCCTCNONE 
J080315A03GAGGCCCATTANONE 
J080315N11ACGTGGGCCTCNONE 
J080315N11GAGGCCCATTANONE 
J090046E14ACGTGGGCCTCNONE 
J090046E14GAGGCCCATTANONE 
J090058G09ACGTGGGCCTCNONE 
J090058G09GAGGCCCATTANONE 
J090077H05ACGTGGGCCTCNONE 
J090077H05GAGGCCCATTANONE 
J090087O20ACGTGGGCCTCNONE 
J090087O20GAGGCCCATTANONE 
Os01g0229200AK066024GAGGCCCACGTVHS domain containing protein. 
AK066024TAATGGGCCTCVHS domain containing protein. 
Os01g0277500AK066984AGTTGGGCTCTTGGGCCTCSimilar to Dof3 gene (Fragment). 
J013074F19AGTTGGGCTCTTGGGCCTCNONE 
J013091E10AGTTGGGCTCTTGGGCCTCNONE 
J023077C19AGTTGGGCTCTTGGGCCTCNONE 
J033068A02AGTTGGGCTCTTGGGCCTCNONE 
J065137O05AGTTGGGCTCTTGGGCCTCNONE 
Os01g0283000AK073165GAGGCCCACTConserved hypothetical protein. 
J033023G08GAGGCCCACTNONE 
Os01g0283100004-018-B01AGTGGGCCTCNONE 
AK060908AGTGGGCCTCNONE 
AK071713AGTGGGCCTCSimilar to Ferripyochelin-binding protein-like. 
AK104205AGTGGGCCTCNONE 
AK122051AGTGGGCCTCNONE 
J023109L19AGTGGGCCTCNONE 
Os01g0299400AK107814GAGGCCCACAASterile alpha motif homology domain containing protein. 
J065112H10GAGGCCCACAANONE 
Os01g0533900AK101194GAGGCCCAAACSimilar to Multidrug resistance protein 1 homolog. 
Os01g0546900AK073801GAGGCCCAACCTranscription factor jumonji/aspartyl beta-hydroxylase domain containing protein. 
Os01g0618500011-019-D03GAGGCCCACTACGGCCCACCTNONE 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
J013020E19GAGGCCCACTACGGCCCACCTNONE 
J033046J12GAGGCCCACTACGGCCCACCTNONE 
J033055D06GAGGCCCACTACGGCCCACCTNONE 
Os01g0626300016-070-G04GAGGCCCACNONE 
AK122071GAGGCCCACSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04GAGGCCCACNONE 
J033117J08GAGGCCCACNONE 
J065007O12GAGGCCCACNONE 
J065020K12GAGGCCCACNONE 
J065142D24GAGGCCCACNONE 
J065157K19GAGGCCCACNONE 
J080307H19GAGGCCCACNONE 
J080311D16GAGGCCCACNONE 
J080316C12GAGGCCCACNONE 
J080316E03GAGGCCCACNONE 
J100033K16GAGGCCCACNONE 
J100042J21GAGGCCCACNONE 
J100051E06GAGGCCCACNONE 
J100071E22GAGGCCCACNONE 
Os01g0642900009-109-F01GAGGCCCAAAANONE 
AK063836GAGGCCCAAAASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560GAGGCCCAAAANONE 
J033043K18GAGGCCCAAAANONE 
J100023C05GAGGCCCAAAANONE 
J100038C15GAGGCCCAAAANONE 
J100039C23GAGGCCCAAAANONE 
Os01g0662600009-056-E10GAGGCCCAGTANONE 
AK062234GAGGCCCAGTANONE 
AK098887GAGGCCCAGTANONE 
AK099656GAGGCCCAGTANONE 
AK119723GAGGCCCAGTASimilar to NifU-like protein. 
J013001K01GAGGCCCAGTANONE 
J013090F20GAGGCCCAGTANONE 
J013119A14GAGGCCCAGTANONE 
J013121P12GAGGCCCAGTANONE 
J033132I15GAGGCCCAGTANONE 
J075023F22GAGGCCCAGTANONE 
J075023M13GAGGCCCAGTANONE 
J100024D10GAGGCCCAGTANONE 
J100024N01GAGGCCCAGTANONE 
J100026H09GAGGCCCAGTANONE 
J100027H07GAGGCCCAGTANONE 
J100045K07GAGGCCCAGTANONE 
J100057K18GAGGCCCAGTANONE 
J100085C22GAGGCCCAGTANONE 
Os01g0666500AK102689GAGGCCCATCAConserved hypothetical protein. 
Os01g0695200015-090-F01GAGGCCCAAAANONE 
AK064145GAGGCCCAAAAProtein of unknown function DUF266, plant family protein. 
J065163N10GAGGCCCAAAANONE 
J100051F21GAGGCCCAAAANONE 
Os01g0738600AK073479GAGGCCCAAACENTH/VHS domain containing protein. 
AK120616GAGGCCCAAACNONE 
J013046M12GAGGCCCAAACNONE 
J013152B11GAGGCCCAAACNONE 
J023007A09GAGGCCCAAACNONE 
J023007N03GAGGCCCAAACNONE 
J023042A01GAGGCCCAAACNONE 
J023059P06GAGGCCCAAACNONE 
J023113A05GAGGCCCAAACNONE 
J033044K11GAGGCCCAAACNONE 
J033082E04GAGGCCCAAACNONE 
J090033B13GAGGCCCAAACNONE 
J090062H08GAGGCCCAAACNONE 
J100086G23GAGGCCCAAACNONE 
Os01g0757200AB092485GAGGCCCACCCNONE 
AK060666GAGGCCCACCCNONE 
AK060714GAGGCCCACCCNONE 
AK099350GAGGCCCACCCNONE 
AK101713GAGGCCCACCCSimilar to GA 2-oxidase 4. 
Os01g0757700AK102734CCACTGACAGTGGGCCTCConserved hypothetical protein. 
J033106B06CCACTGACAGTGGGCCTCNONE 
J065025B07CCACTGACAGTGGGCCTCNONE 
J065025B08CCACTGACAGTGGGCCTCNONE 
J065033E12CCACTGACAGTGGGCCTCNONE 
J065197B01CCACTGACAGTGGGCCTCNONE 
Os01g0794900AK106644GAGGCCCAGGConserved hypothetical protein. 
Os01g0834700AK101559GAGGCCCAGCCZinc finger, CCCH-type domain containing protein. 
AK106074GAGGCCCAGCCNONE 
Os01g0839300AK064685GAGGCCCACTGGGCCGAAASimilar to 50S ribosomal protein L17. 
J065060I21GAGGCCCACTGGGCCGAAANONE 
Os01g0850400AJ575220GGGCCGAGAGGCCCACGCGNONE 
AK108582GGGCCGAGAGGCCCACGCGSimilar to MYBY1 protein (Fragment). 
Os01g0857700006-045-F05GAGGCCCATGANONE 
AK066959GAGGCCCATGASimilar to G10. 
AK099794GAGGCCCATGANONE 
J013093N15GAGGCCCATGANONE 
J023105B19GAGGCCCATGANONE 
Os01g0876500J053026A07GAGGCCCATTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17GAGGCCCATTTNONE 
Os01g0885200AK059113TCTGGGCCTCNONE 
Os01g0888700AK073376GAGGCCCATAAProtein of unknown function RIO1 family protein. 
J033030B16GAGGCCCATAANONE 
J033098D06GAGGCCCATAANONE 
J033112A12GAGGCCCATAANONE 
J043003L24GAGGCCCATAANONE 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
Os01g0889800003-107-A06GAAGCCCATGGGCCTCNONE 
005-016-H12GAAGCCCATGGGCCTCNONE 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK104708GAAGCCCATGGGCCTCNONE 
J013035D13GAAGCCCATGGGCCTCNONE 
J013068K01GAAGCCCATGGGCCTCNONE 
J023042J18GAAGCCCATGGGCCTCNONE 
J053023F13GAAGCCCATGGGCCTCNONE 
J053026M13GAAGCCCATGGGCCTCNONE 
J053033N15GAAGCCCATGGGCCTCNONE 
J053035I16GAAGCCCATGGGCCTCNONE 
J053039A11GAAGCCCATGGGCCTCNONE 
J053039K22GAAGCCCATGGGCCTCNONE 
J053043B08GAAGCCCATGGGCCTCNONE 
J053068K09GAAGCCCATGGGCCTCNONE 
J053082D11GAAGCCCATGGGCCTCNONE 
J053092N12GAAGCCCATGGGCCTCNONE 
J053099A19GAAGCCCATGGGCCTCNONE 
J065027F17GAAGCCCATGGGCCTCNONE 
J065039B13GAAGCCCATGGGCCTCNONE 
J065139N16GAAGCCCATGGGCCTCNONE 
J065205B22GAAGCCCATGGGCCTCNONE 
Os01g0894700009-177-F04GAGGCCCAGCNONE 
AK067623GAGGCCCAGCConserved hypothetical protein. 
AK104876GAGGCCCAGCNONE 
J013095G01GAGGCCCAGCNONE 
J013108L20GAGGCCCAGCNONE 
J013120P13GAGGCCCAGCNONE 
Os01g0896800AK065268GAGGCCCATCANONE 
AK104693GAGGCCCATCAEukaryotic ribosomal protein L5 family protein. 
J013126P09GAGGCCCATCANONE 
J033046N15GAGGCCCATCANONE 
J090008K02GAGGCCCATCANONE 
J090024F15GAGGCCCATCANONE 
J090074I23GAGGCCCATCANONE 
J090093F03GAGGCCCATCANONE 
J090096N02GAGGCCCATCANONE 
Os01g0908400009-140-E01GAGGCCCATTTNONE 
AK062957GAGGCCCATTTConserved hypothetical protein. 
AK099301GAGGCCCATTTNONE 
J065123M13GAGGCCCATTTNONE 
J075020O14GAGGCCCATTTNONE 
J075136L21GAGGCCCATTTNONE 
Os01g0915800AK103859AAATGGGCCTCSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20AAATGGGCCTCNONE 
J090056H03AAATGGGCCTCNONE 
J090058L14AAATGGGCCTCNONE 
J090058P16AAATGGGCCTCNONE 
J090076C19AAATGGGCCTCNONE 
J100086P14AAATGGGCCTCNONE 
Os01g0918200009-034-H02GAGGCCCAGGNONE 
AK062434GAGGCCCAGGSimilar to Ubiquitin-like protein SMT3. 
AK103092GAGGCCCAGGNONE 
J065093P18GAGGCCCAGGNONE 
J065137C15GAGGCCCAGGNONE 
J065156G01GAGGCCCAGGNONE 
J065206H16GAGGCCCAGGNONE 
J065209D03GAGGCCCAGGNONE 
J075073K05GAGGCCCAGGNONE 
J075099B17GAGGCCCAGGNONE 
J075166N04GAGGCCCAGGNONE 
Os01g0920000AK069967GAGGCCCACTCBS domain containing protein. 
Os01g0934500AK073211GAGGCCCACGAAConserved hypothetical protein. 
Os01g0948100AK111411GAGGCCCATGAERCC4 domain containing protein. 
J090089O16GAGGCCCATGANONE 
Os01g0958100AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os01g0962600009-104-A04GAGGCCCAGANONE 
009-104-A04GAGGCCCATGTNONE 
AK073846GAGGCCCAGASimilar to 40S ribosomal protein S10-1. 
AK073846GAGGCCCATGTSimilar to 40S ribosomal protein S10-1. 
J033070I05GAGGCCCAGANONE 
J033070I05GAGGCCCATGTNONE 
J065079N18GAGGCCCAGANONE 
J065079N18GAGGCCCATGTNONE 
J065122H12GAGGCCCAGANONE 
J065122H12GAGGCCCATGTNONE 
J065197O14GAGGCCCAGANONE 
J065197O14GAGGCCCATGTNONE 
Os01g0966200009-079-H11GAGGCCCAGTANONE 
009-124-G10GAGGCCCAGTANONE 
AK058564GAGGCCCAGTAProtein of unknown function YGGT family protein. 
AK098935GAGGCCCAGTANONE 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os01g0976800J065105P05GAGGCCCAGCZinc finger, GATA-type domain containing protein. 
J065189M03GAGGCCCAGCNONE 
Os02g0121200AK070123GAGGCCCATGTNONE 
AK121751GAGGCCCATGTProtein of unknown function DUF890 family protein. 
Os02g0135600AK069843GAGGCCCAAGConserved hypothetical protein. 
J023034H09GAGGCCCAAGNONE 
J033090D08GAGGCCCAAGNONE 
J100025N07GAGGCCCAAGNONE 
J100075G18GAGGCCCAAGNONE 
Os02g0135700AK100570CTTGGGCCTCDNA polymerase V family protein. 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0178400009-151-B08TTGGCCCACGAGGCCCATAANONE 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
AK121516TTGGCCCACGAGGCCCATAANONE 
J033026A17TTGGCCCACGAGGCCCATAANONE 
J065011K14TTGGCCCACGAGGCCCATAANONE 
J065056D01TTGGCCCACGAGGCCCATAANONE 
J065061L22TTGGCCCACGAGGCCCATAANONE 
J065076M01TTGGCCCACGAGGCCCATAANONE 
J075092E14TTGGCCCACGAGGCCCATAANONE 
Os02g0180100005-013-B11GAGGCCCAACCNONE 
AK067359GAGGCCCAACCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700GAGGCCCAACCNONE 
J013090O22GAGGCCCAACCNONE 
J013099P19GAGGCCCAACCNONE 
J090041M21GAGGCCCAACCNONE 
J090049C14GAGGCCCAACCNONE 
Os02g0186700AK064492GAGGCCCAAATConserved hypothetical protein. 
J065210K09GAGGCCCAAATNONE 
J075006A17GAGGCCCAAATNONE 
J075108C18GAGGCCCAAATNONE 
J075153E08GAGGCCCAAATNONE 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0189100AK111066GAGGCCCATATConserved hypothetical protein. 
J053061N01GAGGCCCATATNONE 
J053088H13GAGGCCCATATNONE 
J065038F12GAGGCCCATATNONE 
J065083I18GAGGCCCATATNONE 
J065085A17GAGGCCCATATNONE 
J065110G06GAGGCCCATATNONE 
J065117J19GAGGCCCATATNONE 
J065120D21GAGGCCCATATNONE 
J065121C23GAGGCCCATATNONE 
J065174E03GAGGCCCATATNONE 
J075182G01GAGGCCCATATNONE 
J080302D10GAGGCCCATATNONE 
J080309F08GAGGCCCATATNONE 
J080310H15GAGGCCCATATNONE 
Os02g0220600AK103901GAGGCCCAGANONE 
J013058O03GAGGCCCAGANONE 
J013124E21GAGGCCCAGANONE 
J023023L03GAGGCCCAGANONE 
J023023L21GAGGCCCAGANONE 
J023061N01GAGGCCCAGANONE 
J023065O09GAGGCCCAGANONE 
J023106J17GAGGCCCAGANONE 
J023119N08GAGGCCCAGANONE 
J033058A19GAGGCCCAGANONE 
J033098O13GAGGCCCAGANONE 
J033100M18GAGGCCCAGANONE 
J033125A21GAGGCCCAGANONE 
J033148C12GAGGCCCAGANONE 
J043017F03GAGGCCCAGANONE 
J043032J02GAGGCCCAGANONE 
J053047N10GAGGCCCAGANONE 
J053089P04GAGGCCCAGANONE 
J065051K09GAGGCCCAGANONE 
J065064H24GAGGCCCAGANONE 
J090001L06GAGGCCCAGANONE 
J090017C24GAGGCCCAGANONE 
J090058G15GAGGCCCAGANONE 
J090058H23GAGGCCCAGANONE 
J090061G20GAGGCCCAGANONE 
J090069N23GAGGCCCAGANONE 
J090071A08GAGGCCCAGANONE 
J090074A08GAGGCCCAGANONE 
J090077B15GAGGCCCAGANONE 
J090081K06GAGGCCCAGANONE 
J090083I05GAGGCCCAGANONE 
J090091O22GAGGCCCAGANONE 
J090097L10GAGGCCCAGANONE 
J100026B11GAGGCCCAGANONE 
J100044M01GAGGCCCAGANONE 
J100046F10GAGGCCCAGANONE 
J100051K14GAGGCCCAGANONE 
J100060D22GAGGCCCAGANONE 
J100060H18GAGGCCCAGANONE 
J100070I06GAGGCCCAGANONE 
J100071C04GAGGCCCAGANONE 
J100078M13GAGGCCCAGANONE 
J100080E17GAGGCCCAGANONE 
J100083I09GAGGCCCAGANONE 
Os02g0241100Os02g0241100GAGGCCCATGTProtein kinase-like domain containing protein. 
Os02g0266500AK100307GGTTGGGCCTCSimilar to RASPBERRY3. 
Os02g0287000006-107-B10AAATGGGCCTCNONE 
006-120-E07AAATGGGCCTCNONE 
AF052503AAATGGGCCTCNONE 
AK059647AAATGGGCCTCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131AAATGGGCCTCNONE 
J023048M05AAATGGGCCTCNONE 
J033107L10AAATGGGCCTCNONE 
J065019A12AAATGGGCCTCNONE 
J065064J21AAATGGGCCTCNONE 
J065071D15AAATGGGCCTCNONE 
J065094L12AAATGGGCCTCNONE 
J065095L06AAATGGGCCTCNONE 
J065097J11AAATGGGCCTCNONE 
J065099M08AAATGGGCCTCNONE 
J065104D01AAATGGGCCTCNONE 
J065107L02AAATGGGCCTCNONE 
J065110D14AAATGGGCCTCNONE 
J065135J07AAATGGGCCTCNONE 
J065137C16AAATGGGCCTCNONE 
J065150C07AAATGGGCCTCNONE 
J065165I10AAATGGGCCTCNONE 
J065189F07AAATGGGCCTCNONE 
J065205L22AAATGGGCCTCNONE 
J065214C09AAATGGGCCTCNONE 
J065217G17AAATGGGCCTCNONE 
J075029E17AAATGGGCCTCNONE 
J075054O16AAATGGGCCTCNONE 
J075068N23AAATGGGCCTCNONE 
J075135N18AAATGGGCCTCNONE 
J075152G09AAATGGGCCTCNONE 
J075162D10AAATGGGCCTCNONE 
J075164F11AAATGGGCCTCNONE 
J080036L12AAATGGGCCTCNONE 
J080049K18AAATGGGCCTCNONE 
J080060P03AAATGGGCCTCNONE 
J080062G16AAATGGGCCTCNONE 
J080062G21AAATGGGCCTCNONE 
J080064N07AAATGGGCCTCNONE 
J080075I22AAATGGGCCTCNONE 
J080086F20AAATGGGCCTCNONE 
J080087G07AAATGGGCCTCNONE 
J080088I06AAATGGGCCTCNONE 
J080302B20AAATGGGCCTCNONE 
J080303L14AAATGGGCCTCNONE 
J080309O12AAATGGGCCTCNONE 
J080317F12AAATGGGCCTCNONE 
J080317P18AAATGGGCCTCNONE 
J090013L15AAATGGGCCTCNONE 
J090043N04AAATGGGCCTCNONE 
J090085G01AAATGGGCCTCNONE 
J090085G19AAATGGGCCTCNONE 
Os02g0304800Os02g0304800GAGGCCCAAProtein prenyltransferase domain containing protein. 
Os02g0332200AK067672GAGGCCCATCASimilar to T-complex protein 1 delta subunit. 
Os02g0467700AK121672GAGGCCCATGTGlycosyltransferase 28, C-terminal domain containing protein. 
J033068B18GAGGCCCATGTNONE 
J080035D09GAGGCCCATGTNONE 
J080039E21GAGGCCCATGTNONE 
J080054N01GAGGCCCATGTNONE 
J080071C12GAGGCCCATGTNONE 
Os02g0526500006-107-D09AAATGGGCCTCNONE 
Os02g0533800009-149-F12GAGGCCCAAACNONE 
013-058-H02GAGGCCCAAACNONE 
014-017-G07GAGGCCCAAACNONE 
014-028-F04GAGGCCCAAACNONE 
014-050-G04GAGGCCCAAACNONE 
014-095-F04GAGGCCCAAACNONE 
014-099-C08GAGGCCCAAACNONE 
016-046-F05GAGGCCCAAACNONE 
AK121139GAGGCCCAAACConserved hypothetical protein. 
J013104A14GAGGCCCAAACNONE 
J023077F13GAGGCCCAAACNONE 
J023145I11GAGGCCCAAACNONE 
J065033D14GAGGCCCAAACNONE 
J065079I15GAGGCCCAAACNONE 
J065104E21GAGGCCCAAACNONE 
J065128E06GAGGCCCAAACNONE 
J065174F07GAGGCCCAAACNONE 
J065195B12GAGGCCCAAACNONE 
J065207B12GAGGCCCAAACNONE 
J080304M24GAGGCCCAAACNONE 
J090040A13GAGGCCCAAACNONE 
J090054B18GAGGCCCAAACNONE 
J100037A06GAGGCCCAAACNONE 
J100042F24GAGGCCCAAACNONE 
J100043N23GAGGCCCAAACNONE 
J100044H14GAGGCCCAAACNONE 
J100056K24GAGGCCCAAACNONE 
J100063O22GAGGCCCAAACNONE 
J100071G05GAGGCCCAAACNONE 
J100078G15GAGGCCCAAACNONE 
Os02g0533900AB062681GTTTGGGCCTCNONE 
AK061722GTTTGGGCCTCNONE 
AK106147GTTTGGGCCTCNONE 
AK121892GTTTGGGCCTCSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0537700006-053-C10GAGGCCCAGANONE 
006-055-F06GAGGCCCAGANONE 
006-059-E11GAGGCCCAGANONE 
006-088-G01GAGGCCCAGANONE 
006-088-G12GAGGCCCAGANONE 
009-094-G12GAGGCCCAGANONE 
009-181-C07GAGGCCCAGANONE 
AK068919GAGGCCCAGASimilar to 2-cys peroxiredoxin BAS1, chloroplast precursor (EC 1.11.1.15) (Thiol- specific antioxidant protein) (Fragment). 
AK104703GAGGCCCAGANONE 
J013070I22GAGGCCCAGANONE 
J013169M13GAGGCCCAGANONE 
J013170F14GAGGCCCAGANONE 
J023010P12GAGGCCCAGANONE 
J023095B04GAGGCCCAGANONE 
J090043L04GAGGCCCAGANONE 
Os02g0543000009-061-H02GAGGCCCAAACNONE 
009-123-H02GAGGCCCAAACNONE 
009-192-D09GAGGCCCAAACNONE 
009-197-F06GAGGCCCAAACNONE 
AK060261GAGGCCCAAACNONE 
AK062319GAGGCCCAAACABA/WDS induced protein family protein. 
AK062880GAGGCCCAAACNONE 
AK063217GAGGCCCAAACNONE 
AK066415GAGGCCCAAACNONE 
J065084L15GAGGCCCAAACNONE 
J065207N17GAGGCCCAAACNONE 
J075088J03GAGGCCCAAACNONE 
J100024G08GAGGCCCAAACNONE 
J100027P19GAGGCCCAAACNONE 
J100052E02GAGGCCCAAACNONE 
J100055B02GAGGCCCAAACNONE 
Os02g0555000015-020-G02CCGTGGGCCTCNONE 
AK065270CCGTGGGCCTCNONE 
AK121253CCGTGGGCCTCProtein of unknown function, ATP binding family protein. 
J013002L01CCGTGGGCCTCNONE 
J023060A02CCGTGGGCCTCNONE 
J023101O11CCGTGGGCCTCNONE 
J023140A15CCGTGGGCCTCNONE 
J033042H19CCGTGGGCCTCNONE 
J033046C02CCGTGGGCCTCNONE 
J033080N19CCGTGGGCCTCNONE 
J065026I02CCGTGGGCCTCNONE 
J065040C18CCGTGGGCCTCNONE 
J090004I16CCGTGGGCCTCNONE 
Os02g0562300AK073250GAGGCCCATGACalmodulin binding protein-like family protein. 
Os02g0578400Os02g0578400GAGGCCCAAATPhotosystem II oxygen evolving complex protein PsbQ family protein. 
Os02g0595700006-057-E01CCTGGGCCTCNONE 
006-082-F10CCTGGGCCTCNONE 
006-087-C10CCTGGGCCTCNONE 
006-091-H03CCTGGGCCTCNONE 
006-094-A11CCTGGGCCTCNONE 
AF145053CCTGGGCCTCNONE 
AK064937CCTGGGCCTCNONE 
AK066858CCTGGGCCTCNONE 
AK104785CCTGGGCCTCNONE 
AK119587CCTGGGCCTCChloroplast translational elongation factor Tu. 
J013000P03CCTGGGCCTCNONE 
Os02g0614600AK058581TCGTGGGCCTCNONE 
Os02g0618700AK070657GAGGCCCATTTLung seven transmembrane receptor family protein. 
J023056H15GAGGCCCATTTNONE 
Os02g0622400005-010-C04TACTGGGCCTCNONE 
AK061679TACTGGGCCTCConserved hypothetical protein. 
J013058H01TACTGGGCCTCNONE 
J013095D07TACTGGGCCTCNONE 
J023054G05TACTGGGCCTCNONE 
J023093A17TACTGGGCCTCNONE 
J023146P16TACTGGGCCTCNONE 
J033089D16TACTGGGCCTCNONE 
J033099G12TACTGGGCCTCNONE 
J033131N10TACTGGGCCTCNONE 
J053073J04TACTGGGCCTCNONE 
J053074P03TACTGGGCCTCNONE 
J053075M06TACTGGGCCTCNONE 
J053088K13TACTGGGCCTCNONE 
J090039F18TACTGGGCCTCNONE 
J090045M03TACTGGGCCTCNONE 
Os02g0651500AK066333GAGGCCCACTNONE 
AK121865GAGGCCCACTHypothetical protein. 
J090038J11GAGGCCCACTNONE 
Os02g0655700AK101068AAATGGGCCTCAmino acid/polyamine transporter I family protein. 
J013026C06AAATGGGCCTCNONE 
J033023I17AAATGGGCCTCNONE 
Os02g0661300016-077-C09GAGGCCCACCTNONE 
AK106503GAGGCCCACCTConserved hypothetical protein. 
Os02g0666800AK101444TAATGGGCCTCProtein of unknown function DUF788 family protein. 
J033039F09TAATGGGCCTCNONE 
J065041E15TAATGGGCCTCNONE 
J075087I24TAATGGGCCTCNONE 
J100079A10TAATGGGCCTCNONE 
Os02g0677300006-102-D12GAGGCCCAGAGCGGCCCACTNONE 
AK060550GAGGCCCAGAGCGGCCCACTNONE 
AK106041GAGGCCCAGAGCGGCCCACTSimilar to CRT/DRE binding factor 1. 
Os02g0679200AK110789AGATGGGCCTCTGGGCCTCTetratricopeptide-like helical domain containing protein. 
Os02g0689700AK063776GAGGCCCAACCRibosomal protein L18P/L5E family protein. 
Os02g0705100012-046-E01GAGGCCCATTNONE 
AK063491GAGGCCCATTEpoxide hydrolase family protein. 
J065184H07GAGGCCCATTNONE 
Os02g0767100011-054-E05ACATGGGCCTCNONE 
AK063351ACATGGGCCTCNONE 
AK103640ACATGGGCCTCConserved hypothetical protein. 
J090022G11ACATGGGCCTCNONE 
J090072L18ACATGGGCCTCNONE 
Os02g0772500AK100349GAGGCCCAATAProtein prenyltransferase domain containing protein. 
J023082M21GAGGCCCAATANONE 
J065047H11GAGGCCCAATANONE 
J065055F20GAGGCCCAATANONE 
J065082I22GAGGCCCAATANONE 
J100074B04GAGGCCCAATANONE 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
Os02g0793000AK070242GAGGCCCACGANONE 
AK099173GAGGCCCACGANONE 
AK105863GAGGCCCACGAZinc finger, CCCH-type domain containing protein. 
Os02g0795900012-075-B04GAGGCCCACGAANONE 
AK105305GAGGCCCACGAASimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21GAGGCCCACGAANONE 
Os02g0798700AK101070GAGGCCCATTTNeurochondrin family protein. 
AK103079GAGGCCCATTTNONE 
J090045L09GAGGCCCATTTNONE 
Os02g0804300006-046-D12GAGGCCCATGANONE 
AK060165GAGGCCCATGANONE 
AK067584GAGGCCCATGASAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12GAGGCCCATGANONE 
J023098C22GAGGCCCATGANONE 
J033123P06GAGGCCCATGANONE 
J065060N24GAGGCCCATGANONE 
J065069H22GAGGCCCATGANONE 
J065155N20GAGGCCCATGANONE 
J065170K07GAGGCCCATGANONE 
J090033D12GAGGCCCATGANONE 
Os02g0814300AK111376GAGGCCCAAATCytochrome c, monohaem domain containing protein. 
J065063I24GAGGCCCAAATNONE 
Os02g0816700009-132-E07GAGGCCCAATTNONE 
AK059572GAGGCCCAATTConserved hypothetical protein. 
Os02g0816800013-089-A09AATTGGGCCTCNONE 
AK102271AATTGGGCCTCNAD-dependent epimerase/dehydratase family protein. 
J013105O04AATTGGGCCTCNONE 
J013124I08AATTGGGCCTCNONE 
J023002E08AATTGGGCCTCNONE 
J023025C01AATTGGGCCTCNONE 
J023037O12AATTGGGCCTCNONE 
J023049N06AATTGGGCCTCNONE 
J023069G18AATTGGGCCTCNONE 
J033029M02AATTGGGCCTCNONE 
J033037L22AATTGGGCCTCNONE 
J033089A08AATTGGGCCTCNONE 
J033103L07AATTGGGCCTCNONE 
J033125L19AATTGGGCCTCNONE 
J090008N20AATTGGGCCTCNONE 
J090041F23AATTGGGCCTCNONE 
J090092H16AATTGGGCCTCNONE 
Os02g0819700AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os02g0820700006-025-E04TAATGGGCCTCNONE 
006-052-F06TAATGGGCCTCNONE 
006-082-A05TAATGGGCCTCNONE 
006-089-B06TAATGGGCCTCNONE 
AK060869TAATGGGCCTCSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365TAATGGGCCTCNONE 
AK103008TAATGGGCCTCNONE 
AK104724TAATGGGCCTCNONE 
J013049H21TAATGGGCCTCNONE 
J043027N22TAATGGGCCTCNONE 
J075031I15TAATGGGCCTCNONE 
J075132D23TAATGGGCCTCNONE 
Os02g0824400AK121390GAGGCCCAATTConserved hypothetical protein. 
J023128P21GAGGCCCAATTNONE 
J053097O16GAGGCCCAATTNONE 
J065012I02GAGGCCCAATTNONE 
J065049C06GAGGCCCAATTNONE 
J065051H02GAGGCCCAATTNONE 
J065069A13GAGGCCCAATTNONE 
J065082E04GAGGCCCAATTNONE 
J065102N09GAGGCCCAATTNONE 
J065157O10GAGGCCCAATTNONE 
J065188N23GAGGCCCAATTNONE 
J065190J11GAGGCCCAATTNONE 
J065202M09GAGGCCCAATTNONE 
Os02g0824700009-023-E06ATTTGGGCCTCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18ATTTGGGCCTCNONE 
J065017H21ATTTGGGCCTCNONE 
J065052N02ATTTGGGCCTCNONE 
J065053M01ATTTGGGCCTCNONE 
J065064B14ATTTGGGCCTCNONE 
J065146K22ATTTGGGCCTCNONE 
Os03g0117100005-014-F09GAGGCCCAATANONE 
006-027-C07GAGGCCCAATANONE 
006-036-G11GAGGCCCAATANONE 
006-038-H10GAGGCCCAATANONE 
006-044-D08GAGGCCCAATANONE 
006-105-H12GAGGCCCAATANONE 
009-190-G08GAGGCCCAATANONE 
AK070213GAGGCCCAATAPeroxisomal biogenesis factor 11 family protein. 
AK104570GAGGCCCAATANONE 
AK104706GAGGCCCAATANONE 
J013055H24GAGGCCCAATANONE 
J023044I05GAGGCCCAATANONE 
J075111G05GAGGCCCAATANONE 
J080002K23GAGGCCCAATANONE 
J080002N12GAGGCCCAATANONE 
J080004B01GAGGCCCAATANONE 
J080007H19GAGGCCCAATANONE 
J080008M18GAGGCCCAATANONE 
J080011D18GAGGCCCAATANONE 
J080012J01GAGGCCCAATANONE 
J080018C19GAGGCCCAATANONE 
J080022C20GAGGCCCAATANONE 
J080022I05GAGGCCCAATANONE 
J080022M12GAGGCCCAATANONE 
J080023P03GAGGCCCAATANONE 
J080025A05GAGGCCCAATANONE 
J080029C02GAGGCCCAATANONE 
J080036H08GAGGCCCAATANONE 
J080039P12GAGGCCCAATANONE 
J080040H05GAGGCCCAATANONE 
J080045I23GAGGCCCAATANONE 
J080057O04GAGGCCCAATANONE 
J080059K18GAGGCCCAATANONE 
J080061E04GAGGCCCAATANONE 
J080062C20GAGGCCCAATANONE 
J080062F10GAGGCCCAATANONE 
J080062L05GAGGCCCAATANONE 
J080068L06GAGGCCCAATANONE 
J080069N09GAGGCCCAATANONE 
J080071M14GAGGCCCAATANONE 
J080072K17GAGGCCCAATANONE 
J080080A09GAGGCCCAATANONE 
J080086A18GAGGCCCAATANONE 
J080088O14GAGGCCCAATANONE 
J080089O04GAGGCCCAATANONE 
J080092G21GAGGCCCAATANONE 
J080094K09GAGGCCCAATANONE 
Os03g0126300AK061256GCTGGGCCTCNONE 
AK061961GCTGGGCCTCNONE 
AY346336GCTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17GCTGGGCCTCNONE 
J090023H12GCTGGGCCTCNONE 
Os03g0127000AK068479TGTGGGCCTCConserved hypothetical protein. 
J013152D10TGTGGGCCTCNONE 
J075167I20TGTGGGCCTCNONE 
J090067O04TGTGGGCCTCNONE 
Os03g0143000AK073102TTGTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24TTGTGGGCCTCNONE 
Os03g0152800AK066205CATGGGCCTCProtein kinase-like domain containing protein. 
AK100518CATGGGCCTCNONE 
Os03g0195900J065063O15GAGGCCCATGANONE 
J065063O15GGATGGGCCTCNONE 
Os03g0198400AK059522ATTGGGCCTCNONE 
AK103101ATTGGGCCTCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19ATTGGGCCTCNONE 
J075036K08ATTGGGCCTCNONE 
J075040J23ATTGGGCCTCNONE 
J075041H18ATTGGGCCTCNONE 
J075053H18ATTGGGCCTCNONE 
J075055K15ATTGGGCCTCNONE 
J075111K03ATTGGGCCTCNONE 
J075125B22ATTGGGCCTCNONE 
J075195L10ATTGGGCCTCNONE 
Os03g0213800AK103114ATCTGGGCCTCMitochondrial substrate carrier family protein. 
Os03g0249900AK058379GAGGCCCATGTConserved hypothetical protein. 
Os03g0255500AK102392ATTTGGGCCTCSimilar to Phosphoenolpyruvate carboxykinase 4 (EC 4.1.1.49) (Fragment). 
Os03g0260100AK066143GAGGCCCATCAConserved hypothetical protein. 
Os03g0261500AK061995ATTTGGGCCTCNONE 
J013044K20ATTTGGGCCTCNONE 
J033113A11ATTTGGGCCTCNONE 
J100032O18ATTTGGGCCTCNONE 
J100037K21ATTTGGGCCTCNONE 
Os03g0284600AK110712GAGGCCCAAGThioredoxin fold domain containing protein. 
Os03g0287900009-074-B07ATATGGGCCTCNONE 
014-027-E07ATATGGGCCTCNONE 
AK063663ATATGGGCCTCSimilar to Protein disulfide isomerase. 
J065009N21ATATGGGCCTCNONE 
Os03g0288400Os03g0288400GAGGCCCATTGGCCCAATAConserved hypothetical protein. 
Os03g0288900AK100329GAGGCCCAGATConserved hypothetical protein. 
J023080H15GAGGCCCAGATNONE 
J033136I21GAGGCCCAGATNONE 
J065036A16GAGGCCCAGATNONE 
J065186A16GAGGCCCAGATNONE 
J065187B08GAGGCCCAGATNONE 
J065202E24GAGGCCCAGATNONE 
Os03g0308900AK064183GAGGCCCAAAConserved hypothetical protein. 
AK064183GAGGCCCATGAConserved hypothetical protein. 
Os03g0322600009-180-H12GAGGCCCAAAANONE 
AK067222GAGGCCCAAAAHypothetical protein. 
J065017H05GAGGCCCAAAANONE 
J065118G12GAGGCCCAAAANONE 
J065175F07GAGGCCCAAAANONE 
J065175N14GAGGCCCAAAANONE 
Os03g0324800AK059868GAGGCCCAAATNONE 
AK071431GAGGCCCAAATHypothetical protein. 
Os03g0331600009-025-C11TATGGGCCTCNONE 
AK063782TATGGGCCTCConserved hypothetical protein. 
Os03g0342900006-032-D01CACGTGGGCCTCNONE 
006-033-E10CACGTGGGCCTCNONE 
006-051-G06CACGTGGGCCTCNONE 
006-053-E05CACGTGGGCCTCNONE 
006-056-B05CACGTGGGCCTCNONE 
006-058-F04CACGTGGGCCTCNONE 
006-059-E05CACGTGGGCCTCNONE 
006-060-F10CACGTGGGCCTCNONE 
006-104-D12CACGTGGGCCTCNONE 
009-129-C12CACGTGGGCCTCNONE 
AK060136CACGTGGGCCTCNONE 
AK060980CACGTGGGCCTCNONE 
AK064815CACGTGGGCCTCDormancyauxin associated family protein. 
AK104244CACGTGGGCCTCNONE 
AK104391CACGTGGGCCTCNONE 
AK104590CACGTGGGCCTCNONE 
AK104744CACGTGGGCCTCNONE 
AK106100CACGTGGGCCTCNONE 
J013000E10CACGTGGGCCTCNONE 
J075027O22CACGTGGGCCTCNONE 
J075052J03CACGTGGGCCTCNONE 
J075066E15CACGTGGGCCTCNONE 
J075095C17CACGTGGGCCTCNONE 
J075118N05CACGTGGGCCTCNONE 
J075187K22CACGTGGGCCTCNONE 
J090026L04CACGTGGGCCTCNONE 
J090059G16CACGTGGGCCTCNONE 
J100055P20CACGTGGGCCTCNONE 
J100062A10CACGTGGGCCTCNONE 
J100068G20CACGTGGGCCTCNONE 
Os03g0343500009-042-G06GAGGCCCAATANONE 
009-063-D01GAGGCCCAATANONE 
009-156-H09GAGGCCCAATANONE 
AB117995GAGGCCCAATANONE 
AK058737GAGGCCCAATANONE 
AK059599GAGGCCCAATASimilar to 60S ribosomal protein L22-2. 
AK121502GAGGCCCAATANONE 
J023082D10GAGGCCCAATANONE 
J033022G11GAGGCCCAATANONE 
J075048M16GAGGCCCAATANONE 
J075049O20GAGGCCCAATANONE 
J075082I02GAGGCCCAATANONE 
J075105G01GAGGCCCAATANONE 
J075131K05GAGGCCCAATANONE 
J080002H01GAGGCCCAATANONE 
J080003H01GAGGCCCAATANONE 
J080005G08GAGGCCCAATANONE 
J080011M13GAGGCCCAATANONE 
J080020M02GAGGCCCAATANONE 
J080026N24GAGGCCCAATANONE 
J080028L09GAGGCCCAATANONE 
J080032O14GAGGCCCAATANONE 
J080033J12GAGGCCCAATANONE 
J080035D05GAGGCCCAATANONE 
J080039H01GAGGCCCAATANONE 
J080044B07GAGGCCCAATANONE 
J080044E23GAGGCCCAATANONE 
J080049N11GAGGCCCAATANONE 
J080050A21GAGGCCCAATANONE 
J080055L24GAGGCCCAATANONE 
J080059N20GAGGCCCAATANONE 
J080061F04GAGGCCCAATANONE 
J080078I16GAGGCCCAATANONE 
J080079G24GAGGCCCAATANONE 
J080080K13GAGGCCCAATANONE 
J080083G20GAGGCCCAATANONE 
J080087B08GAGGCCCAATANONE 
J080091L19GAGGCCCAATANONE 
J080094D06GAGGCCCAATANONE 
J090038L06GAGGCCCAATANONE 
J090075H06GAGGCCCAATANONE 
J090081D12GAGGCCCAATANONE 
Os03g0363350Os03g0363350GTATGGGCCATGAGGCCCAACAProtein of unknown function DUF455 family protein. 
Os03g0381500AK108125TCATGGGCCTCATGGGCCTCConserved hypothetical protein. 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J023030J03TATTGGGCTTCCATGGGCCTCNONE 
Os03g0580200AK107849GAGGCCCAGGLipolytic enzyme, G-D-S-L family protein. 
Os03g0598200AK068322TTTTGGGCCTCNop14-like protein family protein. 
Os03g0606200009-030-E09GAGGCCCATCTNONE 
009-076-H10GAGGCCCATCTNONE 
009-122-H12GAGGCCCATCTNONE 
009-153-F09GAGGCCCATCTNONE 
AB055076GAGGCCCATCTMitochondrial ATP synthase 6 KD subunit. 
AK072384GAGGCCCATCTNONE 
AK107928GAGGCCCATCTNONE 
J023078E13GAGGCCCATCTNONE 
J053031N01GAGGCCCATCTNONE 
J053046K19GAGGCCCATCTNONE 
J053062P07GAGGCCCATCTNONE 
J053091C23GAGGCCCATCTNONE 
J053099N19GAGGCCCATCTNONE 
J065005E06GAGGCCCATCTNONE 
J065030N03GAGGCCCATCTNONE 
J065138O21GAGGCCCATCTNONE 
J065159K03GAGGCCCATCTNONE 
J075030M08GAGGCCCATCTNONE 
J080006E23GAGGCCCATCTNONE 
J080010D10GAGGCCCATCTNONE 
J080016N17GAGGCCCATCTNONE 
J080024N09GAGGCCCATCTNONE 
J080028E23GAGGCCCATCTNONE 
J080035I11GAGGCCCATCTNONE 
J080038D15GAGGCCCATCTNONE 
J080040H08GAGGCCCATCTNONE 
J080043L04GAGGCCCATCTNONE 
J080047C06GAGGCCCATCTNONE 
J080061G04GAGGCCCATCTNONE 
J080066E10GAGGCCCATCTNONE 
J080067P03GAGGCCCATCTNONE 
J080082D07GAGGCCCATCTNONE 
J080089M13GAGGCCCATCTNONE 
J080094O09GAGGCCCATCTNONE 
J080095C24GAGGCCCATCTNONE 
J080309E21GAGGCCCATCTNONE 
J090016G15GAGGCCCATCTNONE 
J090031C20GAGGCCCATCTNONE 
J090033A15GAGGCCCATCTNONE 
J090037L07GAGGCCCATCTNONE 
J090038I10GAGGCCCATCTNONE 
J090072P19GAGGCCCATCTNONE 
J100040J02GAGGCCCATCTNONE 
J100047N05GAGGCCCATCTNONE 
J100048M10GAGGCCCATCTNONE 
J100076C02GAGGCCCATCTNONE 
J100077G23GAGGCCCATCTNONE 
J100080O08GAGGCCCATCTNONE 
J100085C06GAGGCCCATCTNONE 
J100085F16GAGGCCCATCTNONE 
Os03g0626800015-067-B09GGGTGGGCTGTTCGTGGGCCTCNONE 
AK111916GGGTGGGCTGTTCGTGGGCCTCNONE 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
J075016C21GGGTGGGCTGTTCGTGGGCCTCNONE 
Os03g0639700AK099587GAGGCCCATTTSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0646100AK100526CCATGGGCCTCGCCCSimilar to Plastid division protein ftsZ1 precursor. 
Os03g0651700006-061-B11GAGGCCCAAGNONE 
AK059828GAGGCCCAAGConserved hypothetical protein. 
Os03g0687800AK106820GAGGCCCAATAConserved hypothetical protein. 
Os03g0712600015-008-G03TACTGGGCCTCNONE 
AK103705TACTGGGCCTCHypothetical protein. 
J033136N14TACTGGGCCTCNONE 
Os03g0727100AK068587GAGGCCCAACTConserved hypothetical protein. 
J013153F04GAGGCCCAACTNONE 
J065165J09GAGGCCCAACTNONE 
Os03g0736600AK060375ACTGGGCCTCTCCGCConserved hypothetical protein. 
Os03g0737600014-094-E01GAGGCCCATCTNONE 
AB038234GAGGCCCATCTNONE 
AK101854GAGGCCCATCTCyclin H-1. 
AK105468GAGGCCCATCTNONE 
J033069N12GAGGCCCATCTNONE 
J043017A22GAGGCCCATCTNONE 
J065154A20GAGGCCCATCTNONE 
Os03g0743200J065049G14TGTTGGGCCTCNONE 
J065158O18TGTTGGGCCTCNONE 
Os03g0746600AK069559GAGGCCCAATWD40-like domain containing protein. 
J023141K22GAGGCCCAATNONE 
Os03g0747700AK058795TCTGGGCCTCConserved hypothetical protein. 
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE 
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0761200011-038-H02GAGGCCCACGTNONE 
015-055-D12GAGGCCCACGTNONE 
016-032-B01GAGGCCCACGTNONE 
AK064205GAGGCCCACGTNONE 
AK101534GAGGCCCACGTAnkyrin repeat containing protein. 
J075033L23GAGGCCCACGTNONE 
J075046K09GAGGCCCACGTNONE 
J075134K18GAGGCCCACGTNONE 
J075157I10GAGGCCCACGTNONE 
Os03g0765000AK073918GAGGCCCACACSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
J053100E14TATTGGGCCACATGGGCCTCNONE 
J075111A12TATTGGGCCACATGGGCCTCNONE 
Os03g0785500AK067718GAGGCCCAGATProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0786000AK061286TATGGGCCTCConserved hypothetical protein. 
AK073187TATGGGCCTCNONE 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0833700011-060-A10GAGGCCCACGAANONE 
AK121918GAGGCCCACGAARNA 3'-terminal phosphate cyclase family protein. 
Os03g0834000AB080084GAGGCCCATTTFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AB088391GAGGCCCATTTNONE 
AK062149GAGGCCCATTTNONE 
AK069540GAGGCCCATTTNONE 
J013047J01GAGGCCCATTTNONE 
J023019F12GAGGCCCATTTNONE 
J043004H21GAGGCCCATTTNONE 
Os03g0843400009-195-F11TAATGGGCCTCNONE 
AK061198TAATGGGCCTCSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076TAATGGGCCTCNONE 
Os03g0843500AK067985GAGGCCCATCCNONE 
AK101661GAGGCCCATCCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454GAGGCCCATCCNONE 
J080302L23GAGGCCCATCCNONE 
Os03g0848100J013028M09GAGGCCCAAACNONE 
J065080L17GAGGCCCAAACNONE 
J065083C11GAGGCCCAAACNONE 
Os03g0851900AK102145TTTTGGGCCTCAFG1-like ATPase family protein. 
J033086B08TTTTGGGCCTCNONE 
Os03g0854000009-186-C03GAGGCCCATGNONE 
AK061374GAGGCCCATGProtein of unknown function UPF0131 family protein. 
J065138B11GAGGCCCATGNONE 
Os03g0859550J065092L21CGTGGGGGCTCAGCTGGGCCTCConserved hypothetical protein. 
Os04g0117800Os04g0117800AATTGGGCCTCAmidase family protein. 
Os04g0170500AK103323GAGGCCCAGCHypothetical protein. 
Os04g0370600AK103855AATGGGCCAGGAGGCCCAGG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein. 
J023115N20AATGGGCCAGGAGGCCCAGGNONE 
J033148N10AATGGGCCAGGAGGCCCAGGNONE 
J090031L24AATGGGCCAGGAGGCCCAGGNONE 
J090089F12AATGGGCCAGGAGGCCCAGGNONE 
Os04g0388900AK063224GAGGCCCAAASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19GAGGCCCAAANONE 
J065148P22GAGGCCCAAANONE 
J075040G12GAGGCCCAAANONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0440000AK073064TATTGGGCCTCNONE 
AK101691TATTGGGCCTCConserved hypothetical protein. 
AK102407TATTGGGCCTCNONE 
Os04g0445200009-034-A06CAAGTGGGCCTCNONE 
009-034-A06GAGGCCCAAATNONE 
AK062427CAAGTGGGCCTCProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK062427GAGGCCCAAATProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720CAAGTGGGCCTCNONE 
AK119720GAGGCCCAAATNONE 
J065022E20CAAGTGGGCCTCNONE 
J065022E20GAGGCCCAAATNONE 
J065062D16CAAGTGGGCCTCNONE 
J065062D16GAGGCCCAAATNONE 
J065081I02CAAGTGGGCCTCNONE 
J065081I02GAGGCCCAAATNONE 
J065087C10CAAGTGGGCCTCNONE 
J065087C10GAGGCCCAAATNONE 
J065116N16CAAGTGGGCCTCNONE 
J065116N16GAGGCCCAAATNONE 
J065132F10CAAGTGGGCCTCNONE 
J065132F10GAGGCCCAAATNONE 
J065140F18CAAGTGGGCCTCNONE 
J065140F18GAGGCCCAAATNONE 
J065143M22CAAGTGGGCCTCNONE 
J065143M22GAGGCCCAAATNONE 
J065158K17CAAGTGGGCCTCNONE 
J065158K17GAGGCCCAAATNONE 
J065162D07CAAGTGGGCCTCNONE 
J065162D07GAGGCCCAAATNONE 
J065207H19CAAGTGGGCCTCNONE 
J065207H19GAGGCCCAAATNONE 
J075155B20CAAGTGGGCCTCNONE 
J075155B20GAGGCCCAAATNONE 
J075167E24CAAGTGGGCCTCNONE 
J075167E24GAGGCCCAAATNONE 
J075178B19CAAGTGGGCCTCNONE 
J075178B19GAGGCCCAAATNONE 
J080301D22CAAGTGGGCCTCNONE 
J080301D22GAGGCCCAAATNONE 
J080301J15CAAGTGGGCCTCNONE 
J080301J15GAGGCCCAAATNONE 
J080308J02CAAGTGGGCCTCNONE 
J080308J02GAGGCCCAAATNONE 
Os04g0457700J075145N15TTTGGGCCTCGCGCGCConserved hypothetical protein. 
Os04g0466100AK064543TGTTGGGCCTCSimilar to Cell division protein FtsH-like protein. 
Os04g0475300AK066351TATTGGGCTTTGAGGCCCATAConserved hypothetical protein. 
J065138J21TATTGGGCTTTGAGGCCCATANONE 
Os04g0502900AK059306GAGGCCCACCCGEF-Hand type domain containing protein. 
AK099122GAGGCCCACCCGNONE 
Os04g0528100009-090-G06CCATGGGCCTCNONE 
009-168-C11CCATGGGCCTCNONE 
AK065957CCATGGGCCTCConserved hypothetical protein. 
J013039G20CCATGGGCCTCNONE 
J013044D08CCATGGGCCTCNONE 
J065013L14CCATGGGCCTCNONE 
J065143H08CCATGGGCCTCNONE 
J065146C14CCATGGGCCTCNONE 
J065149K22CCATGGGCCTCNONE 
J065156B18CCATGGGCCTCNONE 
J065201A04CCATGGGCCTCNONE 
J065209A04CCATGGGCCTCNONE 
Os04g0555900009-154-G03GAGGCCCATTANONE 
AK063168GAGGCCCATTAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11GAGGCCCATTANONE 
Os04g0564600009-038-A02AACTGGGCCTCNONE 
AK105145AACTGGGCCTCNONE 
AK120614AACTGGGCCTCSimilar to HMG1 protein. 
J013102D16AACTGGGCCTCNONE 
J013151P06AACTGGGCCTCNONE 
J033082C11AACTGGGCCTCNONE 
J065073N13AACTGGGCCTCNONE 
J065142E11AACTGGGCCTCNONE 
J065187I19AACTGGGCCTCNONE 
J065204K02AACTGGGCCTCNONE 
J090089P22AACTGGGCCTCNONE 
J100060B16AACTGGGCCTCNONE 
Os04g0581300009-171-H01ATATGGGCCTCNONE 
AK063093ATATGGGCCTCSimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0584100012-063-E01AGATGGGCCTCNONE 
AK105292AGATGGGCCTCConserved hypothetical protein. 
Os04g0585600006-117-A02GAGGCCCATTNONE 
AK106073GAGGCCCATTConserved hypothetical protein. 
J053089I23GAGGCCCATTNONE 
J065112K06GAGGCCCATTNONE 
J065128D09GAGGCCCATTNONE 
J100038D09GAGGCCCATTNONE 
Os04g0589200AK068571GAGGCCCAATCGTGGGCConserved hypothetical protein. 
AK102463GAGGCCCAATCGTGGGCNONE 
J075083K10GAGGCCCAATCGTGGGCNONE 
Os04g0589600011-100-F04GAGGCCCAATNONE 
AK061833GAGGCCCAATGlycosyl transferase, group 1 domain containing protein. 
AK098964GAGGCCCAATNONE 
AK100053GAGGCCCAATNONE 
Os04g0597900J065038C09GAGGCCCATTANONE 
J065059G21GAGGCCCATTANONE 
J065079G06GAGGCCCATTAConserved hypothetical protein. 
Os04g0610500006-115-C07TATGGGCCTCNONE 
AK066289TATGGGCCTCPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817TATGGGCCTCNONE 
J013096N09TATGGGCCTCNONE 
J023054I11TATGGGCCTCNONE 
J023121P20TATGGGCCTCNONE 
J053039O20TATGGGCCTCNONE 
J053071L20TATGGGCCTCNONE 
J053088H23TATGGGCCTCNONE 
J053096J03TATGGGCCTCNONE 
Os04g0631200013-003-B06GAGGCCCAAGNONE 
AK059277GAGGCCCAAGSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331GAGGCCCAAGNONE 
J033024P08GAGGCCCAAGNONE 
J033041G02GAGGCCCAAGNONE 
J053075H12GAGGCCCAAGNONE 
J065016B13GAGGCCCAAGNONE 
J090075B22GAGGCCCAAGNONE 
J100084K17GAGGCCCAAGNONE 
Os04g0636400006-064-G07GAGGCCCATTANONE 
006-097-D05GAGGCCCATTANONE 
AK061848GAGGCCCATTASimilar to Senescence-associated protein 6. 
AK099573GAGGCCCATTANONE 
J013035J20GAGGCCCATTANONE 
Os04g0639100009-158-D03CGCGTGGGCCTCNONE 
AK063036CGCGTGGGCCTCConserved hypothetical protein. 
J075045D14CGCGTGGGCCTCNONE 
J075047L16CGCGTGGGCCTCNONE 
J075048D20CGCGTGGGCCTCNONE 
J075056E20CGCGTGGGCCTCNONE 
J075074E14CGCGTGGGCCTCNONE 
J075108F16CGCGTGGGCCTCNONE 
J075143L19CGCGTGGGCCTCNONE 
J075146L07CGCGTGGGCCTCNONE 
J075158I04CGCGTGGGCCTCNONE 
J075172B20CGCGTGGGCCTCNONE 
J090061M08CGCGTGGGCCTCNONE 
Os04g0665700013-084-D06GAGGCCCAAAGCCCAACTNONE 
AK121951GAGGCCCAAAGCCCAACTZinc finger, CCCH-type domain containing protein. 
J013020L20GAGGCCCAAAGCCCAACTNONE 
J033034K12GAGGCCCAAAGCCCAACTNONE 
J033107K04GAGGCCCAAAGCCCAACTNONE 
J065044C03GAGGCCCAAAGCCCAACTNONE 
J065103I10GAGGCCCAAAGCCCAACTNONE 
J065106P15GAGGCCCAAAGCCCAACTNONE 
J075061O20GAGGCCCAAAGCCCAACTNONE 
J075091P11GAGGCCCAAAGCCCAACTNONE 
J075095A18GAGGCCCAAAGCCCAACTNONE 
J075117C22GAGGCCCAAAGCCCAACTNONE 
J075166B22GAGGCCCAAAGCCCAACTNONE 
J075198L04GAGGCCCAAAGCCCAACTNONE 
J090032K13GAGGCCCAAAGCCCAACTNONE 
J090045E22GAGGCCCAAAGCCCAACTNONE 
Os04g0670800AK073170GAGGCCCACGGNONE 
Os04g0691700015-036-C06ATTGGGCCTCNONE 
AK106305ATTGGGCCTCSimilar to Autoimmune regulator (Autoimmune polyendocrinopathy candidiasis ectodermal dystrophy protein) (APECED protein). 
Os05g0110700AK102486GAGGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12GAGGCCCAATANONE 
Os05g0129400AK102359ACTGGGCCTCAnkyrin repeat containing protein. 
J033091I05ACTGGGCCTCNONE 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
Os05g0193800AK058865TCATGGGCCTCNONE 
AK067940TCATGGGCCTCConserved hypothetical protein. 
J065043K19TCATGGGCCTCNONE 
J065095O10TCATGGGCCTCNONE 
J065095O12TCATGGGCCTCNONE 
J080002K02TCATGGGCCTCNONE 
J080012L17TCATGGGCCTCNONE 
J080013J02TCATGGGCCTCNONE 
J080013O11TCATGGGCCTCNONE 
J080020A17TCATGGGCCTCNONE 
J080028E18TCATGGGCCTCNONE 
J080036P11TCATGGGCCTCNONE 
J080042E10TCATGGGCCTCNONE 
J080042L10TCATGGGCCTCNONE 
J080047B11TCATGGGCCTCNONE 
J080048N05TCATGGGCCTCNONE 
J080057E20TCATGGGCCTCNONE 
J080057K13TCATGGGCCTCNONE 
J080058L03TCATGGGCCTCNONE 
J080063H07TCATGGGCCTCNONE 
J080066L23TCATGGGCCTCNONE 
J080069G22TCATGGGCCTCNONE 
J080072E12TCATGGGCCTCNONE 
J080076D06TCATGGGCCTCNONE 
J080077A22TCATGGGCCTCNONE 
J080081A01TCATGGGCCTCNONE 
J080090M13TCATGGGCCTCNONE 
J080093G07TCATGGGCCTCNONE 
J080094O20TCATGGGCCTCNONE 
J080097F13TCATGGGCCTCNONE 
Os05g0243300AK108395GAGGCCCATCASimilar to 50S ribosomal protein L13. 
J090098J16GAGGCCCATCANONE 
J100042H03GAGGCCCATCANONE 
J100088D02GAGGCCCATCANONE 
Os05g0327000014-005-A12GAGGCCCATTANONE 
AK064059GAGGCCCATTACyclin-like domain containing protein. 
AK101588GAGGCCCATTANONE 
J033051A05GAGGCCCATTANONE 
J065106E02GAGGCCCATTANONE 
J065183D01GAGGCCCATTANONE 
Os05g0344200006-022-E04CCGTGGGCCTCNONE 
006-080-D01CCGTGGGCCTCNONE 
009-021-D03CCGTGGGCCTCNONE 
009-026-A10CCGTGGGCCTCNONE 
009-054-B12CCGTGGGCCTCNONE 
009-059-H03CCGTGGGCCTCNONE 
009-077-C02CCGTGGGCCTCNONE 
009-095-H12CCGTGGGCCTCNONE 
009-106-B08CCGTGGGCCTCNONE 
009-138-D10CCGTGGGCCTCNONE 
009-140-G06CCGTGGGCCTCNONE 
009-146-E09CCGTGGGCCTCNONE 
009-161-F04CCGTGGGCCTCNONE 
009-176-F05CCGTGGGCCTCNONE 
013-047-C03CCGTGGGCCTCNONE 
013-052-E07CCGTGGGCCTCNONE 
013-054-G04CCGTGGGCCTCNONE 
013-095-D10CCGTGGGCCTCNONE 
014-003-D06CCGTGGGCCTCNONE 
014-020-C09CCGTGGGCCTCNONE 
014-043-E01CCGTGGGCCTCNONE 
014-080-G09CCGTGGGCCTCNONE 
014-081-H05CCGTGGGCCTCNONE 
AK060058CCGTGGGCCTCConserved hypothetical protein. 
AK098850CCGTGGGCCTCNONE 
AK104716CCGTGGGCCTCNONE 
AK119727CCGTGGGCCTCNONE 
J013000G04CCGTGGGCCTCNONE 
J013155L11CCGTGGGCCTCNONE 
J033138J22CCGTGGGCCTCNONE 
J065112E22CCGTGGGCCTCNONE 
J065124M06CCGTGGGCCTCNONE 
J065130M01CCGTGGGCCTCNONE 
J065137I03CCGTGGGCCTCNONE 
J065157O12CCGTGGGCCTCNONE 
J065171B12CCGTGGGCCTCNONE 
J075003O16CCGTGGGCCTCNONE 
J075026G12CCGTGGGCCTCNONE 
J075032K07CCGTGGGCCTCNONE 
J075070I11CCGTGGGCCTCNONE 
J075093K06CCGTGGGCCTCNONE 
J075148C12CCGTGGGCCTCNONE 
J075148L08CCGTGGGCCTCNONE 
J075152G13CCGTGGGCCTCNONE 
J075177G07CCGTGGGCCTCNONE 
J100026I09CCGTGGGCCTCNONE 
J100083L11CCGTGGGCCTCNONE 
J100086F04CCGTGGGCCTCNONE 
Os05g0349000AK070681CCATGGGCGTTGGGCCTCConserved hypothetical protein. 
AK120753CCATGGGCGTTGGGCCTCNONE 
J023006K02CCATGGGCGTTGGGCCTCNONE 
J023063E02CCATGGGCGTTGGGCCTCNONE 
J043003J19CCATGGGCGTTGGGCCTCNONE 
Os05g0367100AK108334TAATGGGCCTCConserved hypothetical protein. 
Os05g0386800009-185-E02GAGGCCCAACTNONE 
AK062748GAGGCCCAACTNONE 
Os05g0397700AK067298GAGGCCCACTGGGCCGTGSecY protein family protein. 
Os05g0400600AK072045GAGGCCCATGACobalt transport protein family protein. 
Os05g0400700009-099-F02GAGGCCCAAGNONE 
AK072739GAGGCCCAAGSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC 2.7.7.6) (RNA polymerase II subunit 5). 
AK103913GAGGCCCAAGNONE 
J023138C10GAGGCCCAAGNONE 
Os05g0440100015-006-F06GAGGCCCACCANONE 
015-076-D04GAGGCCCACCANONE 
AK073094GAGGCCCACCANONE 
AK102786GAGGCCCACCAHistone deacetylase superfamily protein. 
J033107M16GAGGCCCACCANONE 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0446900AK101748CTTGGGCCTCTGGGCCTAGlycoside hydrolase, starch-binding domain containing protein. 
Os05g0470800011-027-A06GAGGCCCATGGGCCATNONE 
011-027-A06TTGTGGGCCTCNONE 
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein. 
AK069780TTGTGGGCCTCBacterial surface antigen (D15) family protein. 
J023007A20GAGGCCCATGGGCCATNONE 
J023007A20TTGTGGGCCTCNONE 
J023028F19GAGGCCCATGGGCCATNONE 
J023028F19TTGTGGGCCTCNONE 
J023081E20GAGGCCCATGGGCCATNONE 
J023081E20TTGTGGGCCTCNONE 
J023089D13GAGGCCCATGGGCCATNONE 
J023089D13TTGTGGGCCTCNONE 
J023115D18GAGGCCCATGGGCCATNONE 
J023115D18TTGTGGGCCTCNONE 
J033087E22GAGGCCCATGGGCCATNONE 
J033087E22TTGTGGGCCTCNONE 
J033143O14GAGGCCCATGGGCCATNONE 
J033143O14TTGTGGGCCTCNONE 
Os05g0477300009-016-A12ATTGGGCCTCCAGCCCACGANONE 
009-029-B06ATTGGGCCTCCAGCCCACGANONE 
009-166-G04ATTGGGCCTCCAGCCCACGANONE 
013-016-C08ATTGGGCCTCCAGCCCACGANONE 
016-091-E10ATTGGGCCTCCAGCCCACGANONE 
AK061933ATTGGGCCTCCAGCCCACGANONE 
AK098982ATTGGGCCTCCAGCCCACGANONE 
AK119683ATTGGGCCTCCAGCCCACGANONE 
AK119693ATTGGGCCTCCAGCCCACGANONE 
AK119797ATTGGGCCTCCAGCCCACGANONE 
AK121584ATTGGGCCTCCAGCCCACGARibosomal protein S26E family protein. 
J013063C18ATTGGGCCTCCAGCCCACGANONE 
J013129B12ATTGGGCCTCCAGCCCACGANONE 
J013152K23ATTGGGCCTCCAGCCCACGANONE 
J023013K21ATTGGGCCTCCAGCCCACGANONE 
J023077O13ATTGGGCCTCCAGCCCACGANONE 
J023085D23ATTGGGCCTCCAGCCCACGANONE 
J033029G14ATTGGGCCTCCAGCCCACGANONE 
J033037F24ATTGGGCCTCCAGCCCACGANONE 
J033040H08ATTGGGCCTCCAGCCCACGANONE 
J033064J24ATTGGGCCTCCAGCCCACGANONE 
J033085C06ATTGGGCCTCCAGCCCACGANONE 
J033123P10ATTGGGCCTCCAGCCCACGANONE 
J033127K23ATTGGGCCTCCAGCCCACGANONE 
J033147D24ATTGGGCCTCCAGCCCACGANONE 
J075064E05ATTGGGCCTCCAGCCCACGANONE 
J090026B03ATTGGGCCTCCAGCCCACGANONE 
J100050M11ATTGGGCCTCCAGCCCACGANONE 
Os05g0481000AK059369GAGGCCCATAAGCN5-related N-acetyltransferase domain containing protein. 
AK068619GAGGCCCATAANONE 
Os05g0490000011-076-C07CCTGGGCCTCNONE 
015-026-D07CCTGGGCCTCNONE 
015-074-A08CCTGGGCCTCNONE 
AK064335CCTGGGCCTCNONE 
AK101340CCTGGGCCTCKrr1 family protein. 
J033034J18CCTGGGCCTCNONE 
Os05g0498400009-129-A03GAGGCCCAAGNONE 
009-192-D10GAGGCCCAAGNONE 
009-194-D06GAGGCCCAAGNONE 
AK058219GAGGCCCAAGSimilar to Protein translation factor SUI1. 
AK070301GAGGCCCAAGNONE 
J043038N18GAGGCCCAAGNONE 
J065027A13GAGGCCCAAGNONE 
J075040J15GAGGCCCAAGNONE 
J075165B14GAGGCCCAAGNONE 
Os05g0512500009-036-D05GTGGTGGGCCTCNONE 
AK062441GTGGTGGGCCTCCT20 family protein. 
J080003C10GTGGTGGGCCTCNONE 
J080046G11GTGGTGGGCCTCNONE 
Os05g0519400AK072976GAGGCCCATAASimilar to N-ethylmaleimide sensitive factor NSF (Fragment). 
Os05g0528200009-146-C01GAGGCCCAAACNONE 
AK062985GAGGCCCAAACSimilar to 50S ribosomal protein L20. 
Os05g0535200AK070696AGATGGGCCTCCyclin-like F-box domain containing protein. 
J023057L12AGATGGGCCTCNONE 
Os05g0540100AB021666GAGGCCCAACTNONE 
AK060623GAGGCCCAACTNONE 
AK103819GAGGCCCAACTFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0547850009-102-F03GAGGCCCAGATNONE 
013-076-H08GAGGCCCAGATNONE 
AK058330GAGGCCCAGATNONE 
AK122158GAGGCCCAGATDNA-binding TFAR19-related protein family protein. 
AY626826GAGGCCCAGATNONE 
J043012O19GAGGCCCAGATNONE 
J043038O15GAGGCCCAGATNONE 
J053094L06GAGGCCCAGATNONE 
Os05g0558000015-029-G05GAGGCCCAATANONE 
AK073857GAGGCCCAATARibosomal protein L1 family protein. 
J033074P11GAGGCCCAATANONE 
J090060I16GAGGCCCAATANONE 
Os05g0565200004-015-E06GAGGCCCAACCNONE 
004-015-E06TATTGGGCCTCNONE 
AK067090GAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090TATTGGGCCTCSimilar to Urease accessory protein G. 
AK104200GAGGCCCAACCNONE 
AK104200TATTGGGCCTCNONE 
AK104368GAGGCCCAACCNONE 
AK104368TATTGGGCCTCNONE 
Os05g0567500AK073046AAATGGGCCTCNONE 
AK121133AAATGGGCCTCDNA glycosylase family protein. 
J023075P20AAATGGGCCTCNONE 
Os05g0591400AK120015GAGGCCCAAATHeat shock protein Hsp70 family protein. 
Os06g0113600016-067-E03ATTTGGGCCTCCCATGGGCCATNONE 
AK062095ATTTGGGCCTCCCATGGGCCATNONE 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCTCCCATGGGCCATNONE 
J013022O19ATTTGGGCCTCCCATGGGCCATNONE 
J023045P05ATTTGGGCCTCCCATGGGCCATNONE 
J033031K01ATTTGGGCCTCCCATGGGCCATNONE 
J033034I09ATTTGGGCCTCCCATGGGCCATNONE 
J033041O04ATTTGGGCCTCCCATGGGCCATNONE 
J033071K03ATTTGGGCCTCCCATGGGCCATNONE 
J033075K16ATTTGGGCCTCCCATGGGCCATNONE 
J033097M01ATTTGGGCCTCCCATGGGCCATNONE 
J033099M22ATTTGGGCCTCCCATGGGCCATNONE 
J033108N15ATTTGGGCCTCCCATGGGCCATNONE 
J033121D18ATTTGGGCCTCCCATGGGCCATNONE 
J033125O06ATTTGGGCCTCCCATGGGCCATNONE 
J033139M16ATTTGGGCCTCCCATGGGCCATNONE 
J033145P18ATTTGGGCCTCCCATGGGCCATNONE 
J033149D05ATTTGGGCCTCCCATGGGCCATNONE 
Os06g0116800AK058985GAGGCCCATCASimilar to GFA2. 
AK120746GAGGCCCATCANONE 
Os06g0136000AK060303AATGGGCCTCSimilar to Hypersensitive-induced reaction protein 4. 
AK102678AATGGGCCTCNONE 
J075185K19AATGGGCCTCNONE 
J090028C16AATGGGCCTCNONE 
J090099N12AATGGGCCTCNONE 
J100070O10AATGGGCCTCNONE 
Os06g0140400AK059116GGCTGGGCCTCNONE 
AK102692GGCTGGGCCTCSimilar to HAHB-6 (Fragment). 
AY554033GGCTGGGCCTCNONE 
J033103D12GGCTGGGCCTCNONE 
Os06g0178900011-082-D06GAGGCCCATGTNONE 
AK066933GAGGCCCATGTVacuolar H+-pyrophosphatase (EC 3.6.1.1) (Ovp2). 
D45384GAGGCCCATGTNONE 
J013025O19GAGGCCCATGTNONE 
J013067J23GAGGCCCATGTNONE 
J013119G12GAGGCCCATGTNONE 
J013119I17GAGGCCCATGTNONE 
J013132B18GAGGCCCATGTNONE 
J023108D14GAGGCCCATGTNONE 
J033034C17GAGGCCCATGTNONE 
J033088E10GAGGCCCATGTNONE 
J065013C19GAGGCCCATGTNONE 
J065047E17GAGGCCCATGTNONE 
J090004E24GAGGCCCATGTNONE 
J090008I11GAGGCCCATGTNONE 
J090011F12GAGGCCCATGTNONE 
J090014D19GAGGCCCATGTNONE 
J090030B11GAGGCCCATGTNONE 
J090038J24GAGGCCCATGTNONE 
J090045I05GAGGCCCATGTNONE 
J090046C11GAGGCCCATGTNONE 
J090046F19GAGGCCCATGTNONE 
J090048G03GAGGCCCATGTNONE 
J090050A14GAGGCCCATGTNONE 
J090051B15GAGGCCCATGTNONE 
J090052E04GAGGCCCATGTNONE 
J090052L10GAGGCCCATGTNONE 
J090071O13GAGGCCCATGTNONE 
J090075F03GAGGCCCATGTNONE 
J090080I15GAGGCCCATGTNONE 
J090088B04GAGGCCCATGTNONE 
J100029D12GAGGCCCATGTNONE 
J100032D14GAGGCCCATGTNONE 
J100037J15GAGGCCCATGTNONE 
J100045D01GAGGCCCATGTNONE 
J100045K04GAGGCCCATGTNONE 
J100053M07GAGGCCCATGTNONE 
J100056F04GAGGCCCATGTNONE 
J100056L21GAGGCCCATGTNONE 
J100073N11GAGGCCCATGTNONE 
J100076O13GAGGCCCATGTNONE 
Os06g0181500AK068950CCTGGGCCTCNONE 
AK100878CCTGGGCCTCSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3). 
J023001P16CCTGGGCCTCNONE 
Os06g0199300J065045H01ACGTGGGCCTCNONE 
J075177C22ACGTGGGCCTCNONE 
J080068H06ACGTGGGCCTCNONE 
J090048F01ACGTGGGCCTCNONE 
J100066F17ACGTGGGCCTCNONE 
Os06g0210200012-084-E04GCTGGGCTGGTTGGGCCTCNONE 
AK060502GCTGGGCTGGTTGGGCCTCNONE 
AK069709GCTGGGCTGGTTGGGCCTCN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23GCTGGGCTGGTTGGGCCTCNONE 
J023056O05GCTGGGCTGGTTGGGCCTCNONE 
J033075N06GCTGGGCTGGTTGGGCCTCNONE 
J065099C14GCTGGGCTGGTTGGGCCTCNONE 
J065158C17GCTGGGCTGGTTGGGCCTCNONE 
J065214B02GCTGGGCTGGTTGGGCCTCNONE 
J075026E10GCTGGGCTGGTTGGGCCTCNONE 
J075066J06GCTGGGCTGGTTGGGCCTCNONE 
J075121I06GCTGGGCTGGTTGGGCCTCNONE 
J075124L08GCTGGGCTGGTTGGGCCTCNONE 
J100055D09GCTGGGCTGGTTGGGCCTCNONE 
J100055E04GCTGGGCTGGTTGGGCCTCNONE 
J100077L12GCTGGGCTGGTTGGGCCTCNONE 
Os06g0215100J090029F19GAGGCCCAGCProtein of unknown function DUF1645 family protein. 
Os06g0216800AK068112GAGGCCCACASimilar to Cyclophilin-40 (Expressed protein). 
J013134M21GAGGCCCACANONE 
J033127L12GAGGCCCACANONE 
J090060B08GAGGCCCACANONE 
Os06g0274200009-090-A02GAGGCCCATCTNONE 
AK073155GAGGCCCATCTSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08GAGGCCCATCTNONE 
J065061C07GAGGCCCATCTNONE 
J065105L08GAGGCCCATCTNONE 
J075013C12GAGGCCCATCTNONE 
J090010N17GAGGCCCATCTNONE 
J090068K07GAGGCCCATCTNONE 
J100058A21GAGGCCCATCTNONE 
J100066C07GAGGCCCATCTNONE 
Os06g0543400AK065374TGATGGGCCTCSimilar to CBL-interacting serine/threonine-protein kinase 11 (EC 2.7.1.37) (SOS2-like protein kinase PKS5) (SOS-interacting protein 4) (SNF1- related kinase 3.22). 
J065019L09TGATGGGCCTCNONE 
J065041F08TGATGGGCCTCNONE 
J065081P20TGATGGGCCTCNONE 
J065087C11TGATGGGCCTCNONE 
J065136F12TGATGGGCCTCNONE 
J065152F17TGATGGGCCTCNONE 
J065152M10TGATGGGCCTCNONE 
J065168F13TGATGGGCCTCNONE 
J065169K12TGATGGGCCTCNONE 
J065171C10TGATGGGCCTCNONE 
J065180B14TGATGGGCCTCNONE 
J090014B17TGATGGGCCTCNONE 
Os06g0555500016-056-B08GAGGCCCACCANONE 
AK102375GAGGCCCACCANONE 
AK106546GAGGCCCACCAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08GAGGCCCACCANONE 
J033091P04GAGGCCCACCANONE 
J090082P16GAGGCCCACCANONE 
Os06g0583500J013034M04TTGGCCCATGAGGCCCATANONE 
J013169I02TTGGCCCATGAGGCCCATANONE 
J023024B09TTGGCCCATGAGGCCCATANONE 
J023132L02TTGGCCCATGAGGCCCATANONE 
J033026C23TTGGCCCATGAGGCCCATANONE 
J033094E23TTGGCCCATGAGGCCCATANONE 
J033101D23TTGGCCCATGAGGCCCATANONE 
J033125B15TTGGCCCATGAGGCCCATANONE 
J033144I11TTGGCCCATGAGGCCCATANONE 
J033145E13TTGGCCCATGAGGCCCATANONE 
J033145I11TTGGCCCATGAGGCCCATANONE 
J065022M23TTGGCCCATGAGGCCCATANONE 
J065043I24TTGGCCCATGAGGCCCATANONE 
J065053G06TTGGCCCATGAGGCCCATANONE 
J065088K03TTGGCCCATGAGGCCCATANONE 
J065121L09TTGGCCCATGAGGCCCATANONE 
J065143M08TTGGCCCATGAGGCCCATANONE 
J065146H02TTGGCCCATGAGGCCCATANONE 
J065206M03TTGGCCCATGAGGCCCATANONE 
J075004L13TTGGCCCATGAGGCCCATANONE 
J075005L17TTGGCCCATGAGGCCCATANONE 
J075007G18TTGGCCCATGAGGCCCATANONE 
J075027E20TTGGCCCATGAGGCCCATANONE 
J075029A19TTGGCCCATGAGGCCCATANONE 
J075041C15TTGGCCCATGAGGCCCATANONE 
J075046M05TTGGCCCATGAGGCCCATANONE 
J075066P21TTGGCCCATGAGGCCCATANONE 
J075069E07TTGGCCCATGAGGCCCATANONE 
J075107P21TTGGCCCATGAGGCCCATANONE 
J075123F03TTGGCCCATGAGGCCCATANONE 
J075124E07TTGGCCCATGAGGCCCATANONE 
J075140J22TTGGCCCATGAGGCCCATANONE 
J075160N03TTGGCCCATGAGGCCCATANONE 
Os06g0625500006-034-A05TACTGGGCCTCNONE 
AK058459TACTGGGCCTCSimilar to Thioredoxin peroxidase. 
AK068955TACTGGGCCTCNONE 
AK104130TACTGGGCCTCNONE 
J023003C09TACTGGGCCTCNONE 
J033043I02TACTGGGCCTCNONE 
J065063E05TACTGGGCCTCNONE 
J065190D24TACTGGGCCTCNONE 
J065198I01TACTGGGCCTCNONE 
J075107A02TACTGGGCCTCNONE 
Os06g0667400AK065424GAGGCCCAACAConserved hypothetical protein. 
AK065580GAGGCCCAACANONE 
Os06g0670100AK102577GAGGCCCAAACHypothetical protein. 
Os06g0682800011-092-E01GAGGCCCATTTNONE 
AK064816GAGGCCCATTTZinc finger, CCCH-type domain containing protein. 
J013000E13GAGGCCCATTTNONE 
J013035J22GAGGCCCATTTNONE 
J013045M06GAGGCCCATTTNONE 
J013120A07GAGGCCCATTTNONE 
J033144H15GAGGCCCATTTNONE 
J033145H15GAGGCCCATTTNONE 
J033145N16GAGGCCCATTTNONE 
J090019J02GAGGCCCATTTNONE 
Os06g0683200AK060024GAGGCCCATTTSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432GAGGCCCATTTNONE 
J023002B12GAGGCCCATTTNONE 
J023054E10GAGGCCCATTTNONE 
J023123F19GAGGCCCATTTNONE 
J065035K13GAGGCCCATTTNONE 
J065129P09GAGGCCCATTTNONE 
J065184B14GAGGCCCATTTNONE 
Os06g0709300AK108588GAGGCCCAATFAR1 domain containing protein. 
Os06g0715400012-007-C01GAGGCCCAAGGCCCATACNONE 
012-038-G03GAGGCCCAAGGCCCATACNONE 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
AK073963GAGGCCCAAGGCCCATACNONE 
J023085J06GAGGCCCAAGGCCCATACNONE 
J033073I09GAGGCCCAAGGCCCATACNONE 
J080316N15GAGGCCCAAGGCCCATACNONE 
J090062N15GAGGCCCAAGGCCCATACNONE 
Os06g0716800014-028-E06GAGGCCCAAGNONE 
016-046-F04GAGGCCCAAGNONE 
AK071639GAGGCCCAAGEukaryotic transcription factor, DNA-binding domain containing protein. 
AK103968GAGGCCCAAGNONE 
J023099K10GAGGCCCAAGNONE 
J065036H06GAGGCCCAAGNONE 
J065049K01GAGGCCCAAGNONE 
J065060N02GAGGCCCAAGNONE 
J065204C12GAGGCCCAAGNONE 
J065213P15GAGGCCCAAGNONE 
J080001K17GAGGCCCAAGNONE 
J080006L04GAGGCCCAAGNONE 
J080008A10GAGGCCCAAGNONE 
J080008E16GAGGCCCAAGNONE 
J080010L22GAGGCCCAAGNONE 
J080011N22GAGGCCCAAGNONE 
J080014K12GAGGCCCAAGNONE 
J080018F08GAGGCCCAAGNONE 
J080018N02GAGGCCCAAGNONE 
J080021N10GAGGCCCAAGNONE 
J080029B02GAGGCCCAAGNONE 
J080030D07GAGGCCCAAGNONE 
J080032A16GAGGCCCAAGNONE 
J080034M13GAGGCCCAAGNONE 
J080038F06GAGGCCCAAGNONE 
J080039K15GAGGCCCAAGNONE 
J080042M20GAGGCCCAAGNONE 
J080048N14GAGGCCCAAGNONE 
J080050F23GAGGCCCAAGNONE 
J080051C22GAGGCCCAAGNONE 
J080053B19GAGGCCCAAGNONE 
J080056J19GAGGCCCAAGNONE 
J080056K05GAGGCCCAAGNONE 
J080060C09GAGGCCCAAGNONE 
J080060K21GAGGCCCAAGNONE 
J080065J17GAGGCCCAAGNONE 
J080067A16GAGGCCCAAGNONE 
J080075I03GAGGCCCAAGNONE 
J080076D21GAGGCCCAAGNONE 
J080078G16GAGGCCCAAGNONE 
J080085K15GAGGCCCAAGNONE 
J080089C14GAGGCCCAAGNONE 
J080091N22GAGGCCCAAGNONE 
J080094N12GAGGCCCAAGNONE 
J090032N05GAGGCCCAAGNONE 
Os07g0112600AK109561CACGTGGGCCTCConserved hypothetical protein. 
Os07g0121000AK072975GGGCCGAAGAGGCCCACTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J023148M03GGGCCGAAGAGGCCCACTTGNONE 
Os07g0122300015-004-G08CTTGGGCCTCTGTGGGCTTGNONE 
AK103212CTTGGGCCTCTGTGGGCTTGNONE 
AK119295CTTGGGCCTCTGTGGGCTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09CTTGGGCCTCTGTGGGCTTGNONE 
J090007P13CTTGGGCCTCTGTGGGCTTGNONE 
Os07g0124500012-092-F01GAGGCCCAACTNONE 
012-092-F01GAGGCCCATTTNONE 
AK070529GAGGCCCAACTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK070529GAGGCCCATTTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000GAGGCCCAACTNONE 
AK101000GAGGCCCATTTNONE 
J090007O11GAGGCCCAACTNONE 
J090007O11GAGGCCCATTTNONE 
J090010E02GAGGCCCAACTNONE 
J090010E02GAGGCCCATTTNONE 
J090078C04GAGGCCCAACTNONE 
J090078C04GAGGCCCATTTNONE 
Os07g0150200009-152-C07GAGGCCCAATTNONE 
009-152-C07TGATGGGCCTCNONE 
AK058680GAGGCCCAATTNONE 
AK058680TGATGGGCCTCNONE 
AK121635GAGGCCCAATTSimilar to 40S ribosomal protein S12-1. 
AK121635TGATGGGCCTCSimilar to 40S ribosomal protein S12-1. 
J033051C16GAGGCCCAATTNONE 
J033051C16TGATGGGCCTCNONE 
J033123H15GAGGCCCAATTNONE 
J033123H15TGATGGGCCTCNONE 
J065093I01GAGGCCCAATTNONE 
J065093I01TGATGGGCCTCNONE 
J065197C05GAGGCCCAATTNONE 
J065197C05TGATGGGCCTCNONE 
J075037B11GAGGCCCAATTNONE 
J075037B11TGATGGGCCTCNONE 
J075114B08GAGGCCCAATTNONE 
J075114B08TGATGGGCCTCNONE 
J075123N01GAGGCCCAATTNONE 
J075123N01TGATGGGCCTCNONE 
J075129O04GAGGCCCAATTNONE 
J075129O04TGATGGGCCTCNONE 
J075160H17GAGGCCCAATTNONE 
J075160H17TGATGGGCCTCNONE 
J075166H17GAGGCCCAATTNONE 
J075166H17TGATGGGCCTCNONE 
J080310F11GAGGCCCAATTNONE 
J080310F11TGATGGGCCTCNONE 
J080315P11GAGGCCCAATTNONE 
J080315P11TGATGGGCCTCNONE 
J090025A22GAGGCCCAATTNONE 
J090025A22TGATGGGCCTCNONE 
Os07g0170900015-094-H05CGTGTGGGTCTGGGCCTCNONE 
AK106442CGTGTGGGTCTGGGCCTCConserved hypothetical protein. 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0191700AK066389GAGGCCCAGASimilar to AT.I.24-9 protein (Fragment). 
AK103768GAGGCCCAGANONE 
Os07g0202100AK101736TAATGGGCCTCSimilar to ATP-dependent RNA helicase ded1. 
Os07g0223100006-044-G07GAGGCCCACGGNONE 
006-071-E10GAGGCCCACGGNONE 
006-077-A04GAGGCCCACGGNONE 
009-162-H05GAGGCCCACGGNONE 
J023050M10GAGGCCCACGGNONE 
J023055F05GAGGCCCACGGNONE 
J023060I11GAGGCCCACGGNONE 
J023101M01GAGGCCCACGGNONE 
J065059J21GAGGCCCACGGNONE 
J065087I18GAGGCCCACGGNONE 
J065113L17GAGGCCCACGGNONE 
J065123E19GAGGCCCACGGNONE 
J065137O04GAGGCCCACGGNONE 
J065217M03GAGGCCCACGGNONE 
J090012O14GAGGCCCACGGNONE 
J090014C13GAGGCCCACGGNONE 
J090060C24GAGGCCCACGGNONE 
J100037H14GAGGCCCACGGNONE 
J100060E10GAGGCCCACGGNONE 
J100067L04GAGGCCCACGGNONE 
J100075G09GAGGCCCACGGNONE 
J100077C15GAGGCCCACGGNONE 
Os07g0225100016-021-E05AACTGGGCCTCNONE 
AK064193AACTGGGCCTCAromatic amino acid permease family protein. 
Os07g0300900AK061941GCGTGGGCCTCSimilar to Lysine-sensitive aspartate kinase. 
AK102162GCGTGGGCCTCNONE 
Os07g0418000AK060294GAGGCCCACANONE 
AK065942GAGGCCCACAConserved hypothetical protein. 
AK105006GAGGCCCACANONE 
J013047M02GAGGCCCACANONE 
J023074D13GAGGCCCACANONE 
J053045I08GAGGCCCACANONE 
J075048C07GAGGCCCACANONE 
Os07g0435100AB037153ACGTGGGCCTCNONE 
AK061383ACGTGGGCCTCSimilar to 26S proteasome subunit RPN12. 
AK061408ACGTGGGCCTCNONE 
AK101316ACGTGGGCCTCNONE 
J023133D07ACGTGGGCCTCNONE 
J023136B17ACGTGGGCCTCNONE 
J033065M08ACGTGGGCCTCNONE 
J033070F05ACGTGGGCCTCNONE 
J033070L20ACGTGGGCCTCNONE 
J033108J15ACGTGGGCCTCNONE 
J053080M19ACGTGGGCCTCNONE 
J053091B15ACGTGGGCCTCNONE 
J065067J03ACGTGGGCCTCNONE 
J065102C02ACGTGGGCCTCNONE 
J065135H09ACGTGGGCCTCNONE 
J080302K03ACGTGGGCCTCNONE 
J090059J11ACGTGGGCCTCNONE 
J090074G14ACGTGGGCCTCNONE 
J100025F20ACGTGGGCCTCNONE 
J100028L08ACGTGGGCCTCNONE 
J100049L14ACGTGGGCCTCNONE 
J100054O07ACGTGGGCCTCNONE 
Os07g0435400AK111603TAATGGGCCTCSimilar to WD40. 
Os07g0479200005-017-H08GAGGCCCAAANONE 
005-017-H08GAGGCCCACGCNONE 
AK058326GAGGCCCAAASimilar to SL15-like (Fragment). 
AK058326GAGGCCCACGCSimilar to SL15-like (Fragment). 
J013092A08GAGGCCCAAANONE 
J013092A08GAGGCCCACGCNONE 
J033139E04GAGGCCCAAANONE 
J033139E04GAGGCCCACGCNONE 
J043016M16GAGGCCCAAANONE 
J043016M16GAGGCCCACGCNONE 
J053050O18GAGGCCCAAANONE 
J053050O18GAGGCCCACGCNONE 
J053098B03GAGGCCCAAANONE 
J053098B03GAGGCCCACGCNONE 
J065068G10GAGGCCCAAANONE 
J065068G10GAGGCCCACGCNONE 
J065091I17GAGGCCCAAANONE 
J065091I17GAGGCCCACGCNONE 
J065109A03GAGGCCCAAANONE 
J065109A03GAGGCCCACGCNONE 
J065168B17GAGGCCCAAANONE 
J065168B17GAGGCCCACGCNONE 
J065177A05GAGGCCCAAANONE 
J065177A05GAGGCCCACGCNONE 
J065180J01GAGGCCCAAANONE 
J065180J01GAGGCCCACGCNONE 
J075006F13GAGGCCCAAANONE 
J075006F13GAGGCCCACGCNONE 
J075022J03GAGGCCCAAANONE 
J075022J03GAGGCCCACGCNONE 
J075024N09GAGGCCCAAANONE 
J075024N09GAGGCCCACGCNONE 
J075114B12GAGGCCCAAANONE 
J075114B12GAGGCCCACGCNONE 
J080023M06GAGGCCCAAANONE 
J080023M06GAGGCCCACGCNONE 
J080081N24GAGGCCCAAANONE 
J080081N24GAGGCCCACGCNONE 
J090060N07GAGGCCCAAANONE 
J090060N07GAGGCCCACGCNONE 
Os07g0515700AK103117TAATGGGCCTCAnkyrin repeat containing protein. 
Os07g0529600006-066-F05GAGGCCCATACNONE 
009-049-D10GAGGCCCATACNONE 
009-180-A06GAGGCCCATACNONE 
013-001-E04GAGGCCCATACNONE 
013-011-G03GAGGCCCATACNONE 
013-015-D04GAGGCCCATACNONE 
013-016-B02GAGGCCCATACNONE 
013-021-B11GAGGCCCATACNONE 
013-021-F07GAGGCCCATACNONE 
013-022-B02GAGGCCCATACNONE 
013-029-D10GAGGCCCATACNONE 
013-029-E04GAGGCCCATACNONE 
013-032-A07GAGGCCCATACNONE 
013-035-D07GAGGCCCATACNONE 
013-036-B03GAGGCCCATACNONE 
013-036-B10GAGGCCCATACNONE 
013-037-F08GAGGCCCATACNONE 
013-040-B02GAGGCCCATACNONE 
013-040-B10GAGGCCCATACNONE 
013-041-D07GAGGCCCATACNONE 
013-044-H10GAGGCCCATACNONE 
013-046-C06GAGGCCCATACNONE 
013-047-E03GAGGCCCATACNONE 
013-051-E06GAGGCCCATACNONE 
013-055-B07GAGGCCCATACNONE 
013-055-H04GAGGCCCATACNONE 
013-057-G06GAGGCCCATACNONE 
013-060-E04GAGGCCCATACNONE 
013-062-C07GAGGCCCATACNONE 
013-064-B11GAGGCCCATACNONE 
013-065-A09GAGGCCCATACNONE 
013-065-H03GAGGCCCATACNONE 
013-066-C07GAGGCCCATACNONE 
013-069-B03GAGGCCCATACNONE 
013-070-B08GAGGCCCATACNONE 
013-074-A03GAGGCCCATACNONE 
013-082-B08GAGGCCCATACNONE 
013-083-C10GAGGCCCATACNONE 
013-088-H12GAGGCCCATACNONE 
013-089-A10GAGGCCCATACNONE 
013-089-H06GAGGCCCATACNONE 
013-091-B09GAGGCCCATACNONE 
013-095-D09GAGGCCCATACNONE 
013-099-D03GAGGCCCATACNONE 
014-008-H04GAGGCCCATACNONE 
014-015-D12GAGGCCCATACNONE 
014-017-H12GAGGCCCATACNONE 
014-040-C05GAGGCCCATACNONE 
014-045-D07GAGGCCCATACNONE 
014-053-B03GAGGCCCATACNONE 
014-073-B05GAGGCCCATACNONE 
014-098-F10GAGGCCCATACNONE 
AB110170GAGGCCCATACNONE 
AK064916GAGGCCCATACNONE 
AK099918GAGGCCCATACSimilar to Thiazole biosynthetic enzyme 1-1, chloroplast precursor. 
J013000M17GAGGCCCATACNONE 
J013039J16GAGGCCCATACNONE 
J013055B12GAGGCCCATACNONE 
J013059A13GAGGCCCATACNONE 
J013060H05GAGGCCCATACNONE 
J013067A05GAGGCCCATACNONE 
J013071H11GAGGCCCATACNONE 
J013075I24GAGGCCCATACNONE 
J013102B09GAGGCCCATACNONE 
J013123E11GAGGCCCATACNONE 
J013123I22GAGGCCCATACNONE 
J013123L17GAGGCCCATACNONE 
J013156A11GAGGCCCATACNONE 
J013158K17GAGGCCCATACNONE 
J013160E19GAGGCCCATACNONE 
J023022F22GAGGCCCATACNONE 
J023045D15GAGGCCCATACNONE 
J023063E21GAGGCCCATACNONE 
J023078H19GAGGCCCATACNONE 
J023107E18GAGGCCCATACNONE 
J023107O16GAGGCCCATACNONE 
J023108B07GAGGCCCATACNONE 
J023113M14GAGGCCCATACNONE 
J023122K02GAGGCCCATACNONE 
J023134I12GAGGCCCATACNONE 
J033024O07GAGGCCCATACNONE 
J033045E09GAGGCCCATACNONE 
J033050O12GAGGCCCATACNONE 
J033052B16GAGGCCCATACNONE 
J033052F10GAGGCCCATACNONE 
J033052L07GAGGCCCATACNONE 
J033055D16GAGGCCCATACNONE 
J033093C13GAGGCCCATACNONE 
J033107I04GAGGCCCATACNONE 
J033122D23GAGGCCCATACNONE 
J043029H01GAGGCCCATACNONE 
J053043E04GAGGCCCATACNONE 
J053059G17GAGGCCCATACNONE 
J053069L11GAGGCCCATACNONE 
J053095I18GAGGCCCATACNONE 
J065035I11GAGGCCCATACNONE 
J065087P10GAGGCCCATACNONE 
J065124B14GAGGCCCATACNONE 
J065198E12GAGGCCCATACNONE 
J065210N22GAGGCCCATACNONE 
J065210P16GAGGCCCATACNONE 
J080309H11GAGGCCCATACNONE 
J080316C05GAGGCCCATACNONE 
J090039D18GAGGCCCATACNONE 
J090053F06GAGGCCCATACNONE 
J090084D01GAGGCCCATACNONE 
J090085K24GAGGCCCATACNONE 
J090096C10GAGGCCCATACNONE 
J090097N18GAGGCCCATACNONE 
J100045M09GAGGCCCATACNONE 
Os07g0537500AK111734GAGGCCCATTProtein of unknown function DUF26 domain containing protein. 
Os07g0564000AK069806AGTTGGGCCTCConserved hypothetical protein. 
Os07g0586500AK072668GAGGCCCAGANONE 
AK120683GAGGCCCAGASimilar to SUMO activating enzyme 2. 
J065033L18GAGGCCCAGANONE 
J065038H20GAGGCCCAGANONE 
J065045M20GAGGCCCAGANONE 
J065046E10GAGGCCCAGANONE 
J065055A10GAGGCCCAGANONE 
J065098P14GAGGCCCAGANONE 
J065156B19GAGGCCCAGANONE 
J065195P22GAGGCCCAGANONE 
J075002O06GAGGCCCAGANONE 
J075003D13GAGGCCCAGANONE 
J075004K05GAGGCCCAGANONE 
J075010C10GAGGCCCAGANONE 
J075011C14GAGGCCCAGANONE 
J075026E16GAGGCCCAGANONE 
J075041L23GAGGCCCAGANONE 
J075044C21GAGGCCCAGANONE 
J075071M16GAGGCCCAGANONE 
J075076O13GAGGCCCAGANONE 
J075080G12GAGGCCCAGANONE 
J075091A03GAGGCCCAGANONE 
J075091A21GAGGCCCAGANONE 
J075106K17GAGGCCCAGANONE 
J075120G20GAGGCCCAGANONE 
J075125H10GAGGCCCAGANONE 
J075129E05GAGGCCCAGANONE 
J075143B18GAGGCCCAGANONE 
J075153P22GAGGCCCAGANONE 
J075156A12GAGGCCCAGANONE 
J075156E19GAGGCCCAGANONE 
J075159E16GAGGCCCAGANONE 
J075165E16GAGGCCCAGANONE 
J075174L21GAGGCCCAGANONE 
J075176N06GAGGCCCAGANONE 
J075176N13GAGGCCCAGANONE 
J075179L20GAGGCCCAGANONE 
J075186P20GAGGCCCAGANONE 
J090044I17GAGGCCCAGANONE 
J090051K13GAGGCCCAGANONE 
Os07g0595700003-103-G05GAGGCCCAATTNONE 
AK108488GAGGCCCAATTConserved hypothetical protein. 
J065136O05GAGGCCCAATTNONE 
Os07g0595800011-069-G09AATTGGGCCTCNONE 
AK066349AATTGGGCCTCPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05AATTGGGCCTCNONE 
Os07g0606500AK068811TGATGGGCCTCNONE 
AK121873TGATGGGCCTCNONE 
J013159C05TGATGGGCCTCNONE 
J075158B14TGATGGGCCTCNONE 
Os07g0606900011-039-F09GAGGCCCACCTNONE 
011-058-E11GAGGCCCACCTNONE 
012-014-C08GAGGCCCACCTNONE 
012-062-H02GAGGCCCACCTNONE 
012-067-G01GAGGCCCACCTNONE 
015-029-A08GAGGCCCACCTNONE 
015-039-H09GAGGCCCACCTNONE 
015-044-A09GAGGCCCACCTNONE 
015-047-G10GAGGCCCACCTNONE 
015-065-C04GAGGCCCACCTNONE 
015-067-C10GAGGCCCACCTNONE 
015-078-H10GAGGCCCACCTNONE 
015-084-A06GAGGCCCACCTNONE 
016-050-F01GAGGCCCACCTNONE 
016-059-E11GAGGCCCACCTNONE 
016-059-F04GAGGCCCACCTHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GAGGCCCACCTNONE 
J065170E01GAGGCCCACCTNONE 
J075122G11GAGGCCCACCTNONE 
Os07g0631300009-145-C11AATTGGGCATTGGGCCTCNONE 
AK063855AATTGGGCATTGGGCCTCConserved hypothetical protein. 
J043012K22AATTGGGCATTGGGCCTCNONE 
J043020D08AATTGGGCATTGGGCCTCNONE 
J065015L18AATTGGGCATTGGGCCTCNONE 
J065021G12AATTGGGCATTGGGCCTCNONE 
J065021H11AATTGGGCATTGGGCCTCNONE 
J065042D02AATTGGGCATTGGGCCTCNONE 
J065067O21AATTGGGCATTGGGCCTCNONE 
J065078J12AATTGGGCATTGGGCCTCNONE 
J065094B22AATTGGGCATTGGGCCTCNONE 
J065106N18AATTGGGCATTGGGCCTCNONE 
J065150G13AATTGGGCATTGGGCCTCNONE 
J065157K08AATTGGGCATTGGGCCTCNONE 
J065164B05AATTGGGCATTGGGCCTCNONE 
J065172G19AATTGGGCATTGGGCCTCNONE 
J065173F12AATTGGGCATTGGGCCTCNONE 
J065174D16AATTGGGCATTGGGCCTCNONE 
J065185B02AATTGGGCATTGGGCCTCNONE 
J065207B14AATTGGGCATTGGGCCTCNONE 
J065207J19AATTGGGCATTGGGCCTCNONE 
J065212L20AATTGGGCATTGGGCCTCNONE 
J100053C03AATTGGGCATTGGGCCTCNONE 
Os07g0633800AK103878TATTGGGCCTCConserved hypothetical protein. 
J033025K08TATTGGGCCTCNONE 
J033026N04TATTGGGCCTCNONE 
J090062M09TATTGGGCCTCNONE 
J090087F04TATTGGGCCTCNONE 
Os07g0639800AK074012ATCTGGGCCTCSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK074012GAGGCCCACGASimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592ATCTGGGCCTCNONE 
AK104592GAGGCCCACGANONE 
AK104739ATCTGGGCCTCNONE 
AK104739GAGGCCCACGANONE 
Os07g0659500AK073537GAGGCCCATCCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0667400AK073297AGTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22AGTGGGCCTCNONE 
J033122B17AGTGGGCCTCNONE 
J065017H12AGTGGGCCTCNONE 
J065106D19AGTGGGCCTCNONE 
J065196J16AGTGGGCCTCNONE 
J090084F01AGTGGGCCTCNONE 
Os07g0673100AK060100GAGGCCCAAGNONE 
AK060100GAGGCCCATATNONE 
AK103678GAGGCCCAAGRibosomal protein S8E family protein. 
AK103678GAGGCCCATATRibosomal protein S8E family protein. 
AK104794GAGGCCCAAGNONE 
AK104794GAGGCCCATATNONE 
Os07g0681600AK073504AACTGGGCCTCATP-dependent DNA helicase RecQ family protein. 
Os08g0109300AK061825CTTGGGCCTCNONE 
AK066688CTTGGGCCTCSimilar to Adenylate kinase, chloroplast (EC 2.7.4.3) (ATP-AMP transphosphorylase). 
J023013L12CTTGGGCCTCNONE 
Os08g0110200AK068841GAGGCCCATATSimilar to Fertility restorer. 
J090071I18GAGGCCCATATNONE 
Os08g0112800009-113-D03GAGGCCCAAANONE 
AK121176GAGGCCCAAARickettsia 17 kDa surface antigen family protein. 
J023083C18GAGGCCCAAANONE 
J033074M10GAGGCCCAAANONE 
J033097G10GAGGCCCAAANONE 
J065090F05GAGGCCCAAANONE 
J090001J03GAGGCCCAAANONE 
J090044F23GAGGCCCAAANONE 
J090078H09GAGGCCCAAANONE 
J100088G23GAGGCCCAAANONE 
Os08g0116500009-007-E05GAGGCCCACGATCCGGCCCAAGNONE 
009-074-C07GAGGCCCACGATCCGGCCCAAGNONE 
009-098-A07GAGGCCCACGATCCGGCCCAAGNONE 
009-100-C03GAGGCCCACGATCCGGCCCAAGNONE 
009-136-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-138-B08GAGGCCCACGATCCGGCCCAAGNONE 
009-144-B06GAGGCCCACGATCCGGCCCAAGNONE 
009-184-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-189-F01GAGGCCCACGATCCGGCCCAAGNONE 
013-006-E05GAGGCCCACGATCCGGCCCAAGNONE 
013-015-C10GAGGCCCACGATCCGGCCCAAGNONE 
013-019-F09GAGGCCCACGATCCGGCCCAAGNONE 
013-020-C01GAGGCCCACGATCCGGCCCAAGNONE 
013-021-F05GAGGCCCACGATCCGGCCCAAGNONE 
013-035-D08GAGGCCCACGATCCGGCCCAAGNONE 
013-038-C09GAGGCCCACGATCCGGCCCAAGNONE 
013-054-B07GAGGCCCACGATCCGGCCCAAGNONE 
013-061-G10GAGGCCCACGATCCGGCCCAAGNONE 
013-074-B01GAGGCCCACGATCCGGCCCAAGNONE 
013-079-B06GAGGCCCACGATCCGGCCCAAGNONE 
013-099-B09GAGGCCCACGATCCGGCCCAAGNONE 
013-099-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-023-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-032-C07GAGGCCCACGATCCGGCCCAAGNONE 
014-045-E02GAGGCCCACGATCCGGCCCAAGNONE 
014-085-C02GAGGCCCACGATCCGGCCCAAGNONE 
014-087-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-089-C04GAGGCCCACGATCCGGCCCAAGNONE 
014-090-E01GAGGCCCACGATCCGGCCCAAGNONE 
014-094-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-097-B07GAGGCCCACGATCCGGCCCAAGNONE 
015-024-A12GAGGCCCACGATCCGGCCCAAGNONE 
015-032-C06GAGGCCCACGATCCGGCCCAAGNONE 
016-053-E09GAGGCCCACGATCCGGCCCAAGNONE 
016-081-F10GAGGCCCACGATCCGGCCCAAGNONE 
AK058240GAGGCCCACGATCCGGCCCAAGSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09GAGGCCCACGATCCGGCCCAAGNONE 
J023107O19GAGGCCCACGATCCGGCCCAAGNONE 
J053029K21GAGGCCCACGATCCGGCCCAAGNONE 
J053073P11GAGGCCCACGATCCGGCCCAAGNONE 
J053074B04GAGGCCCACGATCCGGCCCAAGNONE 
J053078M14GAGGCCCACGATCCGGCCCAAGNONE 
J065001E12GAGGCCCACGATCCGGCCCAAGNONE 
J065006J12GAGGCCCACGATCCGGCCCAAGNONE 
J065015C06GAGGCCCACGATCCGGCCCAAGNONE 
J065025D13GAGGCCCACGATCCGGCCCAAGNONE 
J065029A04GAGGCCCACGATCCGGCCCAAGNONE 
J065031D23GAGGCCCACGATCCGGCCCAAGNONE 
J065032E24GAGGCCCACGATCCGGCCCAAGNONE 
J065034P16GAGGCCCACGATCCGGCCCAAGNONE 
J065043B04GAGGCCCACGATCCGGCCCAAGNONE 
J065044A15GAGGCCCACGATCCGGCCCAAGNONE 
J065062D18GAGGCCCACGATCCGGCCCAAGNONE 
J065079G13GAGGCCCACGATCCGGCCCAAGNONE 
J065080A19GAGGCCCACGATCCGGCCCAAGNONE 
J065080A20GAGGCCCACGATCCGGCCCAAGNONE 
J065089N19GAGGCCCACGATCCGGCCCAAGNONE 
J065111O07GAGGCCCACGATCCGGCCCAAGNONE 
J065115N15GAGGCCCACGATCCGGCCCAAGNONE 
J065131A04GAGGCCCACGATCCGGCCCAAGNONE 
J065138H02GAGGCCCACGATCCGGCCCAAGNONE 
J065139K10GAGGCCCACGATCCGGCCCAAGNONE 
J065144A02GAGGCCCACGATCCGGCCCAAGNONE 
J065155J17GAGGCCCACGATCCGGCCCAAGNONE 
J065159D18GAGGCCCACGATCCGGCCCAAGNONE 
J065159I18GAGGCCCACGATCCGGCCCAAGNONE 
J065167H12GAGGCCCACGATCCGGCCCAAGNONE 
J065174C22GAGGCCCACGATCCGGCCCAAGNONE 
J065184A05GAGGCCCACGATCCGGCCCAAGNONE 
J065188M15GAGGCCCACGATCCGGCCCAAGNONE 
J065191D23GAGGCCCACGATCCGGCCCAAGNONE 
J065203C07GAGGCCCACGATCCGGCCCAAGNONE 
J065207C23GAGGCCCACGATCCGGCCCAAGNONE 
J065207L16GAGGCCCACGATCCGGCCCAAGNONE 
J065212F01GAGGCCCACGATCCGGCCCAAGNONE 
J065212F05GAGGCCCACGATCCGGCCCAAGNONE 
J075037B07GAGGCCCACGATCCGGCCCAAGNONE 
J075042F15GAGGCCCACGATCCGGCCCAAGNONE 
J075059J03GAGGCCCACGATCCGGCCCAAGNONE 
J075068M18GAGGCCCACGATCCGGCCCAAGNONE 
J075079E13GAGGCCCACGATCCGGCCCAAGNONE 
J075081F12GAGGCCCACGATCCGGCCCAAGNONE 
J075083I05GAGGCCCACGATCCGGCCCAAGNONE 
J075123K23GAGGCCCACGATCCGGCCCAAGNONE 
J075142F16GAGGCCCACGATCCGGCCCAAGNONE 
J075156N03GAGGCCCACGATCCGGCCCAAGNONE 
J075162K05GAGGCCCACGATCCGGCCCAAGNONE 
J075171E08GAGGCCCACGATCCGGCCCAAGNONE 
J075177N03GAGGCCCACGATCCGGCCCAAGNONE 
J075182K17GAGGCCCACGATCCGGCCCAAGNONE 
J075186K02GAGGCCCACGATCCGGCCCAAGNONE 
J075191K05GAGGCCCACGATCCGGCCCAAGNONE 
J080011E10GAGGCCCACGATCCGGCCCAAGNONE 
J080016M21GAGGCCCACGATCCGGCCCAAGNONE 
J080017A17GAGGCCCACGATCCGGCCCAAGNONE 
J080031O09GAGGCCCACGATCCGGCCCAAGNONE 
J080039G21GAGGCCCACGATCCGGCCCAAGNONE 
J080041B01GAGGCCCACGATCCGGCCCAAGNONE 
J080050G20GAGGCCCACGATCCGGCCCAAGNONE 
J080054A12GAGGCCCACGATCCGGCCCAAGNONE 
J080058O08GAGGCCCACGATCCGGCCCAAGNONE 
J080061N04GAGGCCCACGATCCGGCCCAAGNONE 
J080064L23GAGGCCCACGATCCGGCCCAAGNONE 
J080064P05GAGGCCCACGATCCGGCCCAAGNONE 
J080069I17GAGGCCCACGATCCGGCCCAAGNONE 
J080070E07GAGGCCCACGATCCGGCCCAAGNONE 
J080071B20GAGGCCCACGATCCGGCCCAAGNONE 
J080074L08GAGGCCCACGATCCGGCCCAAGNONE 
J080076N08GAGGCCCACGATCCGGCCCAAGNONE 
J080081A14GAGGCCCACGATCCGGCCCAAGNONE 
J080081J17GAGGCCCACGATCCGGCCCAAGNONE 
J080085N14GAGGCCCACGATCCGGCCCAAGNONE 
J080090B09GAGGCCCACGATCCGGCCCAAGNONE 
J080097L11GAGGCCCACGATCCGGCCCAAGNONE 
J080306H13GAGGCCCACGATCCGGCCCAAGNONE 
J080307H13GAGGCCCACGATCCGGCCCAAGNONE 
J080311F12GAGGCCCACGATCCGGCCCAAGNONE 
J080316L23GAGGCCCACGATCCGGCCCAAGNONE 
J080318H02GAGGCCCACGATCCGGCCCAAGNONE 
J090016L15GAGGCCCACGATCCGGCCCAAGNONE 
J090019I02GAGGCCCACGATCCGGCCCAAGNONE 
J090031G21GAGGCCCACGATCCGGCCCAAGNONE 
J090066C15GAGGCCCACGATCCGGCCCAAGNONE 
J100032I02GAGGCCCACGATCCGGCCCAAGNONE 
J100032N07GAGGCCCACGATCCGGCCCAAGNONE 
J100032N16GAGGCCCACGATCCGGCCCAAGNONE 
J100041P21GAGGCCCACGATCCGGCCCAAGNONE 
J100048M04GAGGCCCACGATCCGGCCCAAGNONE 
J100048M14GAGGCCCACGATCCGGCCCAAGNONE 
J100063B08GAGGCCCACGATCCGGCCCAAGNONE 
J100088E20GAGGCCCACGATCCGGCCCAAGNONE 
J100090I08GAGGCCCACGATCCGGCCCAAGNONE 
Os08g0126700AK111805GAGGCCCAGGNONE 
AK111902GAGGCCCAGGZinc finger, CCCH-type domain containing protein. 
Os08g0139100006-027-E12AATTGGGCCTCNONE 
006-089-E06AATTGGGCCTCNONE 
006-113-G02AATTGGGCCTCNONE 
AK061429AATTGGGCCTCNONE 
AK099590AATTGGGCCTCSimilar to DAG protein, chloroplast precursor. 
AK104727AATTGGGCCTCNONE 
J013043H11AATTGGGCCTCNONE 
J013049N13AATTGGGCCTCNONE 
J065079F01AATTGGGCCTCNONE 
J065122N24AATTGGGCCTCNONE 
J065142J24AATTGGGCCTCNONE 
J065193N03AATTGGGCCTCNONE 
J075041I21AATTGGGCCTCNONE 
J075145E04AATTGGGCCTCNONE 
Os08g0230000014-096-F01GAGGCCCAACANONE 
AK067127GAGGCCCAACAConserved hypothetical protein. 
J013096C05GAGGCCCAACANONE 
J100032D12GAGGCCCAACANONE 
Os08g0243600AB110183CGATGGGCCTCNONE 
AK101443CGATGGGCCTCHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0363000015-090-A07TAATGGGCCTCCGGCCCGGTNONE 
AK103677TAATGGGCCTCCGGCCCGGTNONE 
AK106532TAATGGGCCTCCGGCCCGGTProtein of unknown function DUF295 family protein. 
J033136B21TAATGGGCCTCCGGCCCGGTNONE 
J033136E01TAATGGGCCTCCGGCCCGGTNONE 
J043029N11TAATGGGCCTCCGGCCCGGTNONE 
J065071G13TAATGGGCCTCCGGCCCGGTNONE 
J065105J22TAATGGGCCTCCGGCCCGGTNONE 
J075084B18TAATGGGCCTCCGGCCCGGTNONE 
Os08g0390700009-094-H10GGGCTGGGCCTCNONE 
AK062714GGGCTGGGCCTCSimilar to 2-oxoglutarate-dependent oxygenase. 
Os08g0450800AK102479GAGGCCCATGTPhosphatidylinositol-4-phosphate 5-kinase family protein. 
Os08g0474600J075102L06GAGGCCCACGGNONE 
J075103J21GAGGCCCACGGNONE 
Os08g0517900015-019-D06GAGGCCCACCTNONE 
015-019-D06GAGGCCCATCTNONE 
AK064304GAGGCCCACCTSimilar to 30S ribosomal protein S16. 
AK064304GAGGCCCATCTSimilar to 30S ribosomal protein S16. 
Os08g0535600AK121683GAGGCCCACAZinc finger, Tim10/DDP-type family protein. 
J065077E05GAGGCCCACANONE 
J075088M24GAGGCCCACANONE 
J075140B03GAGGCCCACANONE 
J090014B14GAGGCCCACANONE 
Os09g0120033AK069069CTTGGGCCTCConserved hypothetical protein. 
Os09g0309500J100027L22GAGGCCCACCACConserved hypothetical protein. 
Os09g0363700AK103667ACATGGGCCTCConserved hypothetical protein. 
J075001L14ACATGGGCCTCNONE 
J075049M23ACATGGGCCTCNONE 
J075051I04ACATGGGCCTCNONE 
J075073L04ACATGGGCCTCNONE 
J075077E03ACATGGGCCTCNONE 
J075083J11ACATGGGCCTCNONE 
J075094J22ACATGGGCCTCNONE 
J075112E08ACATGGGCCTCNONE 
J075137J23ACATGGGCCTCNONE 
J075192E02ACATGGGCCTCNONE 
J100039K04ACATGGGCCTCNONE 
Os09g0395600015-050-D12GAGGCCCAGGNONE 
015-089-A12GAGGCCCAGGNONE 
016-076-D03GAGGCCCAGGNONE 
AK060495GAGGCCCAGGConcanavalin A-like lectin/glucanase domain containing protein. 
AK122079GAGGCCCAGGNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0434200AK062015ACTGGGCCTCNONE 
AK103447ACTGGGCCTCZinc finger, RING-type domain containing protein. 
Os09g0467400AK066610GAGGCCCATGAProtein of unknown function DUF6, transmembrane domain containing protein. 
Os09g0474501J065129D17GAGGCCCACCAConserved hypothetical protein. 
Os09g0495200AK102989ATTGGGCCTCConserved hypothetical protein. 
J075062H18ATTGGGCCTCNONE 
J075098G06ATTGGGCCTCNONE 
Os09g0497400AK058354TAATGGGCCTCNONE 
AK068677TAATGGGCCTCProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19TAATGGGCCTCNONE 
J023011D22TAATGGGCCTCNONE 
J023081K05TAATGGGCCTCNONE 
J033060O14TAATGGGCCTCNONE 
J075020I08TAATGGGCCTCNONE 
J075034J03TAATGGGCCTCNONE 
J075049M15TAATGGGCCTCNONE 
J075065K02TAATGGGCCTCNONE 
J075099L06TAATGGGCCTCNONE 
Os09g0501100009-126-C12GAGGCCCATCTNONE 
009-126-C12GAGGCCCATGGNONE 
AK063752GAGGCCCATCTSimilar to 60S ribosomal protein L32A. 
AK063752GAGGCCCATGGSimilar to 60S ribosomal protein L32A. 
AK099282GAGGCCCATCTNONE 
AK099282GAGGCCCATGGNONE 
J023130H04GAGGCCCATCTNONE 
J023130H04GAGGCCCATGGNONE 
J075013C11GAGGCCCATCTNONE 
J075013C11GAGGCCCATGGNONE 
J075060E07GAGGCCCATCTNONE 
J075060E07GAGGCCCATGGNONE 
J075106K07GAGGCCCATCTNONE 
J075106K07GAGGCCCATGGNONE 
J075124L15GAGGCCCATCTNONE 
J075124L15GAGGCCCATGGNONE 
J075161D15GAGGCCCATCTNONE 
J075161D15GAGGCCCATGGNONE 
J080311I18GAGGCCCATCTNONE 
J080311I18GAGGCCCATGGNONE 
J080315G08GAGGCCCATCTNONE 
J080315G08GAGGCCCATGGNONE 
J080316F09GAGGCCCATCTNONE 
J080316F09GAGGCCCATGGNONE 
J080318B05GAGGCCCATCTNONE 
J080318B05GAGGCCCATGGNONE 
J100052O18GAGGCCCATCTNONE 
J100052O18GAGGCCCATGGNONE 
J100064D07GAGGCCCATCTNONE 
J100064D07GAGGCCCATGGNONE 
Os09g0509400AK062054CATGGGCCTCNONE 
J013034G01CATGGGCCTCNONE 
J013039F05CATGGGCCTCNONE 
J023072B20CATGGGCCTCNONE 
J023128J02CATGGGCCTCNONE 
J023138C17CATGGGCCTCNONE 
J023148O15CATGGGCCTCNONE 
J033082O11CATGGGCCTCNONE 
J043027A06CATGGGCCTCNONE 
J043031L05CATGGGCCTCNONE 
J065193J11CATGGGCCTCNONE 
J090012L20CATGGGCCTCNONE 
J090046D03CATGGGCCTCNONE 
Os09g0510000AK121614GCAGCCCACTTGTTGGGCCTCConserved hypothetical protein. 
J033043O11GCAGCCCACTTGTTGGGCCTCNONE 
J065113F04GCAGCCCACTTGTTGGGCCTCNONE 
J080044D13GCAGCCCACTTGTTGGGCCTCNONE 
Os09g0516300AK065222ATCTGGGCCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0521700014-005-C08GCGGGTCGCTGGGCCTCNONE 
AK063628GCGGGTCGCTGGGCCTCSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507GCGGGTCGCTGGGCCTCNONE 
Os09g0522800015-033-B12GAGGCCCAACCNONE 
015-083-G12GAGGCCCAACCNONE 
AK070906GAGGCCCAACCProtein of unknown function DUF1618 domain containing protein. 
J023065L17GAGGCCCAACCNONE 
J090090P20GAGGCCCAACCNONE 
Os09g0525500AK107918GAGGCCCAGGYY1 protein precursor. 
D50575GAGGCCCAGGNONE 
Os09g0535300AK071211AGTGGGCCTCXAP5 protein family protein. 
Os09g0540600AK101798TAATGGGCTAATGGGCCTCNONE 
AK103397TAATGGGCTAATGGGCCTCSimilar to WD-40 repeat protein MSI1. 
Os09g0563800AK068364TTATGGGCCTCConserved hypothetical protein. 
J075156H12TTATGGGCCTCNONE 
Os09g0567000012-071-E09TACTGGGCCTCNONE 
013-099-E05TACTGGGCCTCNONE 
AK065613TACTGGGCCTCConserved hypothetical protein. 
J013026M04TACTGGGCCTCNONE 
J023103F04TACTGGGCCTCNONE 
J033119N04TACTGGGCCTCNONE 
J065011I19TACTGGGCCTCNONE 
J065042A10TACTGGGCCTCNONE 
J100023F16TACTGGGCCTCNONE 
Os09g0569400AK063384ATATGGGCCTCBeta-lactamase-like domain containing protein. 
AK070608ATATGGGCCTCNONE 
Os09g0572900AK069270TCGTGGGCCTCTCGGCCCAAGSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399CTTGGGCCGAGAGGCCCACGAProtein prenyltransferase domain containing protein. 
Os11g0107500005-005-H05GAGGCCCAANONE 
009-118-E10GAGGCCCAANONE 
009-180-A04GAGGCCCAANONE 
AK121033GAGGCCCAAMacrophage migration inhibitory factor family protein. 
J013070C02GAGGCCCAANONE 
J013132P08GAGGCCCAANONE 
J023050K24GAGGCCCAANONE 
J053064N21GAGGCCCAANONE 
J053070L15GAGGCCCAANONE 
J053099E18GAGGCCCAANONE 
J065032A09GAGGCCCAANONE 
J065035L22GAGGCCCAANONE 
J065134D23GAGGCCCAANONE 
J065161L19GAGGCCCAANONE 
J065210K04GAGGCCCAANONE 
J075150A22GAGGCCCAANONE 
J090019C11GAGGCCCAANONE 
J090057N06GAGGCCCAANONE 
J090084D03GAGGCCCAANONE 
J090098L16GAGGCCCAANONE 
J100021H05GAGGCCCAANONE 
J100021N11GAGGCCCAANONE 
J100052B12GAGGCCCAANONE 
J100083N17GAGGCCCAANONE 
J100089D22GAGGCCCAANONE 
Os11g0109900011-064-B04CAAGTGGGCCCATCGCTGGGCCTCNONE 
AK063961CAAGTGGGCCCATCGCTGGGCCTCDouble-stranded RNA binding domain containing protein. 
AK121852CAAGTGGGCCCATCGCTGGGCCTCNONE 
J065183M14CAAGTGGGCCCATCGCTGGGCCTCNONE 
Os11g0130500J065119D16GAGGCCCATCTAGGCCCATANONE 
J065169E14GAGGCCCATCTAGGCCCATACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TTATGGGCCTAGATGGGCCTCConserved hypothetical protein. 
J065192M10TTATGGGCCTAGATGGGCCTCNONE 
Os11g0132700AK103286TTGTGGGCCTCCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
Os11g0145400009-117-C07GAGGCCCATAGCCCATCGSimilar to Ubiquitin-like protein 5. 
009-189-E08GAGGCCCATAGCCCATCGNONE 
J023127F18GAGGCCCATAGCCCATCGNONE 
J065071G10GAGGCCCATAGCCCATCGNONE 
J065118J21GAGGCCCATAGCCCATCGNONE 
J065184P05GAGGCCCATAGCCCATCGNONE 
J080301B06GAGGCCCATAGCCCATCGNONE 
J080303C06GAGGCCCATAGCCCATCGNONE 
J080304F18GAGGCCCATAGCCCATCGNONE 
J080308D02GAGGCCCATAGCCCATCGNONE 
J080309H09GAGGCCCATAGCCCATCGNONE 
J080311O09GAGGCCCATAGCCCATCGNONE 
J080311O15GAGGCCCATAGCCCATCGNONE 
J080312N11GAGGCCCATAGCCCATCGNONE 
J080313G04GAGGCCCATAGCCCATCGNONE 
J080313I06GAGGCCCATAGCCCATCGNONE 
J100077F22GAGGCCCATAGCCCATCGNONE 
Os11g0156200AK100124GAGGCCCAAATPeptidase S28 family protein. 
Os11g0163500AK101154GAGGCCCAATAHomeodomain-like containing protein. 
Os11g0181900011-064-E11AATGGGCCTCNONE 
016-031-C07AATGGGCCTCNONE 
AK063374AATGGGCCTCPrefoldin domain containing protein. 
J065083K20AATGGGCCTCNONE 
Os11g0216400Os11g0216400GAGGCCCACCTProteinase inhibitor, propeptide domain containing protein. 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0585100AK107496GAGGCCCATACConserved hypothetical protein. 
J065184E24GAGGCCCATACNONE 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0595200009-005-A06ATGGGCCTCNONE 
AK071115ATGGGCCTCNONE 
AK106159ATGGGCCTCPAP fibrillin family protein. 
AY387683ATGGGCCTCNONE 
AY387684ATGGGCCTCNONE 
J065166K17ATGGGCCTCNONE 
Os11g0615700AB026561CCATGGGCCTCNONE 
AK059521CCATGGGCCTCNONE 
AK103487CCATGGGCCTCProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14CCATGGGCCTCNONE 
J065044A11CCATGGGCCTCNONE 
J065090I02CCATGGGCCTCNONE 
J065104I09CCATGGGCCTCNONE 
J065187J10CCATGGGCCTCNONE 
J075024E07CCATGGGCCTCNONE 
J075025O13CCATGGGCCTCNONE 
J090062N12CCATGGGCCTCNONE 
J090087G06CCATGGGCCTCNONE 
J090098K11CCATGGGCCTCNONE 
Os11g0644750009-018-E07CTTGGGCCTCNONE 
009-075-B11CTTGGGCCTCNONE 
009-098-C10CTTGGGCCTCNONE 
AK062734CTTGGGCCTCPlant disease resistance response protein family protein. 
Os11g0657200AK059959GTTTGGGCCTC2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07GAGGCCCAAACNONE 
AK062752GAGGCCCAAACSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0704700AK102518TGGTGGGCCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023012E06TGGTGGGCCTCNONE 
J023022M10TGGTGGGCCTCNONE 
J023086E15TGGTGGGCCTCNONE 
J033022B08TGGTGGGCCTCNONE 
J033091K11TGGTGGGCCTCNONE 
J033095N01TGGTGGGCCTCNONE 
J090020H24TGGTGGGCCTCNONE 
Os12g0131300J090086B06TCGTGGGCCTCHypothetical protein. 
Os12g0133600AK103096GAGGCCCATGTConserved hypothetical protein. 
J033118M03GAGGCCCATGTNONE 
Os12g0136200AK068700GAGGCCCATCANONE 
AK069493GAGGCCCATCAWD40-like domain containing protein. 
Os12g0150100009-047-B11GAGGCCCATAANONE 
AK105075GAGGCCCATAASimilar to 60S ribosomal protein L26A. 
J013067G22GAGGCCCATAANONE 
J033103F08GAGGCCCATAANONE 
J065029P11GAGGCCCATAANONE 
J065043B18GAGGCCCATAANONE 
J065123E16GAGGCCCATAANONE 
J065141O20GAGGCCCATAANONE 
J065161O04GAGGCCCATAANONE 
J065201M07GAGGCCCATAANONE 
J075058I23GAGGCCCATAANONE 
J075172J08GAGGCCCATAANONE 
J100040L13GAGGCCCATAANONE 
Os12g0156400012-065-D02AATTGGGCCTCNONE 
AK072086AATTGGGCCTCNONE 
AK099278AATTGGGCCTCDcp1-like decapping family protein. 
J013063H09AATTGGGCCTCNONE 
J023125D09AATTGGGCCTCNONE 
J023149G21AATTGGGCCTCNONE 
J033064E07AATTGGGCCTCNONE 
J033093C07AATTGGGCCTCNONE 
J033107E06AATTGGGCCTCNONE 
J075172A11AATTGGGCCTCNONE 
J090009E07AATTGGGCCTCNONE 
J090023F13AATTGGGCCTCNONE 
J090071N18AATTGGGCCTCNONE 
Os12g0167900005-004-A06GAGGCCCAGTNONE 
006-024-H01GAGGCCCAGTNONE 
006-044-H12GAGGCCCAGTNONE 
006-053-B08GAGGCCCAGTNONE 
015-080-F12GAGGCCCAGTNONE 
AK060925GAGGCCCAGT60S ribosomal protein L3. 
D10403GAGGCCCAGTNONE 
D12630GAGGCCCAGTNONE 
J013046A17GAGGCCCAGTNONE 
J013048A16GAGGCCCAGTNONE 
J013057L14GAGGCCCAGTNONE 
J023058G08GAGGCCCAGTNONE 
J023058I08GAGGCCCAGTNONE 
J023078E17GAGGCCCAGTNONE 
J023087E03GAGGCCCAGTNONE 
J023097D18GAGGCCCAGTNONE 
J023141E14GAGGCCCAGTNONE 
J023150P21GAGGCCCAGTNONE 
J033045K05GAGGCCCAGTNONE 
J033071G03GAGGCCCAGTNONE 
J033071I15GAGGCCCAGTNONE 
J033136D08GAGGCCCAGTNONE 
J043012M21GAGGCCCAGTNONE 
J043015C13GAGGCCCAGTNONE 
J053031L19GAGGCCCAGTNONE 
J053050C01GAGGCCCAGTNONE 
J053055I20GAGGCCCAGTNONE 
J053074B18GAGGCCCAGTNONE 
J053091I08GAGGCCCAGTNONE 
J053097N01GAGGCCCAGTNONE 
J065058A02GAGGCCCAGTNONE 
J065141H11GAGGCCCAGTNONE 
J075019D10GAGGCCCAGTNONE 
J075078G18GAGGCCCAGTNONE 
J075094C12GAGGCCCAGTNONE 
J075165H12GAGGCCCAGTNONE 
J090011E05GAGGCCCAGTNONE 
J090021H18GAGGCCCAGTNONE 
J090027N07GAGGCCCAGTNONE 
J090035F04GAGGCCCAGTNONE 
J090050F21GAGGCCCAGTNONE 
J090051M02GAGGCCCAGTNONE 
J090060F21GAGGCCCAGTNONE 
J090075G15GAGGCCCAGTNONE 
J090092P11GAGGCCCAGTNONE 
J090097B18GAGGCCCAGTNONE 
J100019C17GAGGCCCAGTNONE 
J100022O04GAGGCCCAGTNONE 
J100034G13GAGGCCCAGTNONE 
J100048A13GAGGCCCAGTNONE 
J100050P18GAGGCCCAGTNONE 
J100054B21GAGGCCCAGTNONE 
J100062L01GAGGCCCAGTNONE 
J100065E11GAGGCCCAGTNONE 
J100074P09GAGGCCCAGTNONE 
J100086E10GAGGCCCAGTNONE 
Os12g0223300006-037-D03GAGGCCCAAGNONE 
006-037-D03GAGGCCCAAGNONE 
AJ429043GAGGCCCAAGNONE 
AJ429043GAGGCCCAAGNONE 
AK060133GAGGCCCAAGSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK060133GAGGCCCAAGSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GAGGCCCAAGNONE 
AK073017GAGGCCCAAGNONE 
J065085K05GAGGCCCAAGNONE 
J065085K05GAGGCCCAAGNONE 
J075053C01GAGGCCCAAGNONE 
J075053C01GAGGCCCAAGNONE 
J075055O06GAGGCCCAAGNONE 
J075055O06GAGGCCCAAGNONE 
J075073B01GAGGCCCAAGNONE 
J075073B01GAGGCCCAAGNONE 
J075089M07GAGGCCCAAGNONE 
J075089M07GAGGCCCAAGNONE 
J075095E16GAGGCCCAAGNONE 
J075095E16GAGGCCCAAGNONE 
J075112O19GAGGCCCAAGNONE 
J075112O19GAGGCCCAAGNONE 
J075143A11GAGGCCCAAGNONE 
J075143A11GAGGCCCAAGNONE 
J075173D24GAGGCCCAAGNONE 
J075173D24GAGGCCCAAGNONE 
J075199G18GAGGCCCAAGNONE 
J075199G18GAGGCCCAAGNONE 
J090030N06GAGGCCCAAGNONE 
J090030N06GAGGCCCAAGNONE 
J100052H12GAGGCCCAAGNONE 
J100052H12GAGGCCCAAGNONE 
J100079F09GAGGCCCAAGNONE 
J100079F09GAGGCCCAAGNONE 
Os12g0242500J065129F10AGTGACACGTGGGCCTCNONE 
J090032G12AGTGACACGTGGGCCTCConserved hypothetical protein. 
Os12g0403800AK059940ACGTGGGCCTCACGTGGGNONE 
AK064189ACGTGGGCCTCACGTGGGExoribonuclease domain containing protein. 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0508300009-006-G07GAGGCCCAACTNONE 
009-133-E05GAGGCCCAACTNONE 
009-137-F10GAGGCCCAACTNONE 
014-024-A06GAGGCCCAACTNONE 
AK059123GAGGCCCAACTRibosomal protein S14 family protein. 
J100088E22GAGGCCCAACTNONE 
Os12g0556100J065083C21TACTGGGCCTCDrought induced 19 family protein. 
J065124M18TACTGGGCCTCNONE 
J100032P22TACTGGGCCTCNONE 
J100048N01TACTGGGCCTCNONE 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0572400016-084-F04ACATGGGCCTCNONE 
016-084-F04GAGGCCCATGTNONE 
AK065531ACATGGGCCTCSimilar to SC35-like splicing factor SCL30, 30 kD. 
AK065531GAGGCCCATGTSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03ACATGGGCCTCNONE 
J013025H03GAGGCCCATGTNONE 
J013034H02ACATGGGCCTCNONE 
J013034H02GAGGCCCATGTNONE 
J033117N05ACATGGGCCTCNONE 
J033117N05GAGGCCCATGTNONE 
J065027L09ACATGGGCCTCNONE 
J065027L09GAGGCCCATGTNONE 
J065037D09ACATGGGCCTCNONE 
J065037D09GAGGCCCATGTNONE 
J065197I09ACATGGGCCTCNONE 
J065197I09GAGGCCCATGTNONE 
J090045C01ACATGGGCCTCNONE 
J090045C01GAGGCCCATGTNONE 
J100031E11ACATGGGCCTCNONE 
J100031E11GAGGCCCATGTNONE 
Os12g0580600AK108584TCTGGGCCTCConserved hypothetical protein. 
Os12g0597500AK101904CAGGTGGGCCTCNONE 
AK101904CCAGCCCATGGGCCTCNONE 
AK103799CAGGTGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
AK103799CCAGCCCATGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CAGGTGGGCCTCNONE 
J065206A02CCAGCCCATGGGCCTCNONE 
J100078O15CAGGTGGGCCTCNONE 
J100078O15CCAGCCCATGGGCCTCNONE 
Os12g0611000AK111837CATGGGCCTCSimilar to Zinc-finger protein Lsd1. 
Os12g0615500015-060-B05TATGGGCCTCNONE 
AK100235TATGGGCCTCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.