version

Summary of OsREG588 (All List)

OrganismOryza sativa  
IDOsREG588  
SequenceGATCCGAC  
Annotation  
PPDB MotifCCGAC  DRE core, stress response  
PLACE Motif 
Total Entry Count846  

Entry Sequences (846 entries)

LocusGene modelSequenceDescription
Os01g0184000015-008-B06CCGTCGGATCNONE 
AK071130CCGTCGGATCNUC156 family protein. 
AK100604CCGTCGGATCNONE 
Os01g0190400AK064011CCGATCCGACSimilar to Hexokinase. 
AK099119CCGATCCGACNONE 
Os01g0281200AK107209GATCCGACSimilar to Type B-like cyclin (Fragment). 
AY647458GATCCGACNONE 
Os01g0314000015-084-B08GTCGGATCNONE 
AK106418GTCGGATCNONE 
Os01g0505600AK072726GATCCGACFlagellar calcium-binding protein (calflagin) family protein. 
J065021A18GATCCGACNONE 
J065021B17GATCCGACNONE 
J065153G22GATCCGACNONE 
Os01g0571700AK120410CCGTCGGATCNucleic acid-binding, OB-fold domain containing protein. 
Os01g0663400016-054-B01CCGATCCGACGGNONE 
AK072283CCGATCCGACGGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645CCGATCCGACGGNONE 
J065180A21CCGATCCGACGGNONE 
J075026E13CCGATCCGACGGNONE 
J075109M23CCGATCCGACGGNONE 
J075151A02CCGATCCGACGGNONE 
J090004B07CCGATCCGACGGNONE 
J090023O22CCGATCCGACGGNONE 
J090054G09CCGATCCGACGGNONE 
J090058H13CCGATCCGACGGNONE 
J090076G13CCGATCCGACGGNONE 
J100057F11CCGATCCGACGGNONE 
Os01g0686600AK119910GTCGGATCTetratricopeptide-like helical domain containing protein. 
Os01g0736100011-091-H04CCGTCGGATCNONE 
015-004-D10CCGTCGGATCNONE 
AK064298CCGTCGGATCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365CCGTCGGATCNONE 
AK103355CCGTCGGATCNONE 
J033044B20CCGTCGGATCNONE 
J033094G06CCGTCGGATCNONE 
J033111N02CCGTCGGATCNONE 
J033111P10CCGTCGGATCNONE 
J033126K03CCGTCGGATCNONE 
J043034D12CCGTCGGATCNONE 
Os01g0812600Os01g0812600GTCGGATCNSF attachment protein family protein. 
Os01g0830100AK069755GATCCGACGGTGGGGGAGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0844800AK099801GATCCGACGGSimilar to Pumilio RBD (Fragment). 
AK102882GATCCGACGGNONE 
AK103686GATCCGACGGNONE 
Os01g0847900006-030-E09CCGATCCGACNONE 
AK059798CCGATCCGACPrenylated rab acceptor PRA1 family protein. 
AK073643CCGATCCGACNONE 
J065091G23CCGATCCGACNONE 
Os01g0856900AK107570GATCCGACGGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03GATCCGACGNONE 
J075028J03GATCCGACGNONE 
J075052C05GATCCGACGNONE 
J075199J04GATCCGACGNONE 
J090052L20GATCCGACGNONE 
J090075L24GATCCGACGNONE 
Os01g0889400012-011-B10CGTCGGATCNONE 
AB200237CGTCGGATCNONE 
AK071407CGTCGGATCSimilar to LOB domain protein 6 (ASYMMETRIC LEAVES2). 
AK119575CGTCGGATCNONE 
J023089G14CGTCGGATCNONE 
J075028N06CGTCGGATCNONE 
J075121D21CGTCGGATCNONE 
J075122K20CGTCGGATCNONE 
J075176J05CGTCGGATCNONE 
J080025B12CGTCGGATCNONE 
J080040M21CGTCGGATCNONE 
J080041I06CGTCGGATCNONE 
J080047F15CGTCGGATCNONE 
J080067B19CGTCGGATCNONE 
J080068J04CGTCGGATCNONE 
J080068M01CGTCGGATCNONE 
J080077C15CGTCGGATCNONE 
J080079M04CGTCGGATCNONE 
J080306O05CGTCGGATCNONE 
J090004J23CGTCGGATCNONE 
Os01g0900800009-086-C08GATCCGACGNONE 
AK068254GATCCGACGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK105713GATCCGACGNONE 
J053025O10GATCCGACGNONE 
J065063K24GATCCGACGNONE 
J065167N21GATCCGACGNONE 
J100060A20GATCCGACGNONE 
J100079J03GATCCGACGNONE 
J100087D11GATCCGACGNONE 
J100089K10GATCCGACGNONE 
Os01g0917100AK107234CCGTCGGATCConserved hypothetical protein. 
Os01g0966700006-038-E12GATCCGACNONE 
AK061744GATCCGACNONE 
Os01g0972300009-034-G05GTCGGATCCAACGGNONE 
AK062432GTCGGATCCAACGGDVL family protein. 
Os02g0115900AF006825CCGTCGGATCNONE 
AK065743CCGTCGGATCEndosperm lumenal binding protein. 
AK119653CCGTCGGATCNONE 
Os02g0236800014-080-B04GATCCGACGGNONE 
AK068642GATCCGACGGNONE 
AK099886GATCCGACGGSimilar to Peroxidase (EC 1.11.1.7). 
AK104670GATCCGACGGNONE 
Os02g0301400AK121646GTCGGATCThioredoxin-like fold domain containing protein. 
J033028E10GTCGGATCNONE 
J033058J23GTCGGATCNONE 
Os02g0601800AB060276GACGGCCCGGATCCGACCCGCNONE 
AK099539GACGGCCCGGATCCGACCCGCNONE 
AK101873GACGGCCCGGATCCGACCCGCBromodomain containing protein. 
AK106801GACGGCCCGGATCCGACCCGCNONE 
AK121758GACGGCCCGGATCCGACCCGCNONE 
AK121891GACGGCCCGGATCCGACCCGCNONE 
J013059H01GACGGCCCGGATCCGACCCGCNONE 
J013092F08GACGGCCCGGATCCGACCCGCNONE 
J013146J04GACGGCCCGGATCCGACCCGCNONE 
J023001K12GACGGCCCGGATCCGACCCGCNONE 
J023002H16GACGGCCCGGATCCGACCCGCNONE 
J023013B10GACGGCCCGGATCCGACCCGCNONE 
J023081I22GACGGCCCGGATCCGACCCGCNONE 
J023084K19GACGGCCCGGATCCGACCCGCNONE 
J023150E24GACGGCCCGGATCCGACCCGCNONE 
J033023B18GACGGCCCGGATCCGACCCGCNONE 
J033025F18GACGGCCCGGATCCGACCCGCNONE 
J033048P08GACGGCCCGGATCCGACCCGCNONE 
J033060M24GACGGCCCGGATCCGACCCGCNONE 
J033070G06GACGGCCCGGATCCGACCCGCNONE 
J033088P12GACGGCCCGGATCCGACCCGCNONE 
J033105C13GACGGCCCGGATCCGACCCGCNONE 
J043009N18GACGGCCCGGATCCGACCCGCNONE 
J065103G21GACGGCCCGGATCCGACCCGCNONE 
J075039H15GACGGCCCGGATCCGACCCGCNONE 
J090014K10GACGGCCCGGATCCGACCCGCNONE 
J090022N02GACGGCCCGGATCCGACCCGCNONE 
J090033F18GACGGCCCGGATCCGACCCGCNONE 
J090033I04GACGGCCCGGATCCGACCCGCNONE 
J090041F11GACGGCCCGGATCCGACCCGCNONE 
J090045P20GACGGCCCGGATCCGACCCGCNONE 
J090054B01GACGGCCCGGATCCGACCCGCNONE 
J090055M12GACGGCCCGGATCCGACCCGCNONE 
J090071K09GACGGCCCGGATCCGACCCGCNONE 
J090098O16GACGGCCCGGATCCGACCCGCNONE 
J090099P15GACGGCCCGGATCCGACCCGCNONE 
J100050I16GACGGCCCGGATCCGACCCGCNONE 
Os02g0605600016-017-B02GATCCGACGGCCCGNONE 
AK066104GATCCGACGGCCCGLUC7 related family protein. 
J013052G16GATCCGACGGCCCGNONE 
J043022E03GATCCGACGGCCCGNONE 
J065105P10GATCCGACGGCCCGNONE 
Os02g0631000AK068667CCGTCGGATCConserved hypothetical protein. 
J013159L03CCGTCGGATCNONE 
J023119O20CCGTCGGATCNONE 
J090098N20CCGTCGGATCNONE 
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE 
AK070079GATCCGACSimilar to C13 endopeptidase NP1 (Fragment). 
AK101360GTGGCGTGGGCCGTCGGATCNONE 
AY062178GTGGCGTGGGCCGTCGGATCNONE 
J023043E22GTGGCGTGGGCCGTCGGATCNONE 
J033024F05GTGGCGTGGGCCGTCGGATCNONE 
J033035H01GTGGCGTGGGCCGTCGGATCNONE 
J033042J19GTGGCGTGGGCCGTCGGATCNONE 
J033057G18GTGGCGTGGGCCGTCGGATCNONE 
J033111F09GTGGCGTGGGCCGTCGGATCNONE 
J033115L11GTGGCGTGGGCCGTCGGATCNONE 
J033143I16GTGGCGTGGGCCGTCGGATCNONE 
J033143M21GTGGCGTGGGCCGTCGGATCNONE 
J075072B10GTGGCGTGGGCCGTCGGATCNONE 
J075072L04GTGGCGTGGGCCGTCGGATCNONE 
J075088F01GTGGCGTGGGCCGTCGGATCNONE 
J075196H23GTGGCGTGGGCCGTCGGATCNONE 
Os02g0658100AK064728CGTCGGATCNONE 
Os02g0745100012-001-A06GATCCGACNONE 
AK069842GATCCGACSimilar to NOD26-like membrane integral protein ZmNIP2-1. 
J023031E16GATCCGACNONE 
J065089L08GATCCGACNONE 
J100042F04GATCCGACNONE 
J100051L18GATCCGACNONE 
J100057I03GATCCGACNONE 
J100060A19GATCCGACNONE 
J100060N02GATCCGACNONE 
J100062M17GATCCGACNONE 
J100068P18GATCCGACNONE 
J100088O22GATCCGACNONE 
Os02g0760500009-140-F05GATCCGACGGNONE 
AK062958GATCCGACGGSimilar to ER6 protein (Fragment). 
J065057E02GATCCGACGGNONE 
J075060D20GATCCGACGGNONE 
J090090E17GATCCGACGGNONE 
Os02g0762400AK103084CCGTCGGATCGGCyclin-dependent kinase inhibitor family protein. 
Os03g0174300AK067994GTCGGATCExostosin-like family protein. 
Os03g0213600AK100407CCGTCGGATCConserved hypothetical protein. 
Os03g0217900AK119980CCGTCGGATCConserved hypothetical protein. 
J053089K18CCGTCGGATCNONE 
J090058B20CCGTCGGATCNONE 
J090081L09CCGTCGGATCNONE 
Os03g0279200009-097-C06GATCCGACNONE 
013-007-B07GATCCGACNONE 
AK121750GATCCGACSimilar to Histone H2A. 
J033087I02GATCCGACNONE 
J065002G20GATCCGACNONE 
J065102M04GATCCGACNONE 
J065139A02GATCCGACNONE 
J075109D21GATCCGACNONE 
J075191L12GATCCGACNONE 
J090096C03GATCCGACNONE 
J100036C23GATCCGACNONE 
Os03g0323100009-108-G02CGGGTGGGGCGTCGGATCNONE 
AK062803CGGGTGGGGCGTCGGATCHypothetical protein. 
AK070776CGGGTGGGGCGTCGGATCNONE 
Os03g0323200AK067323GATCCGACGCCCCACCCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0335100AK107094CCGATCCGACConserved hypothetical protein. 
Os03g0343500009-042-G06CCGTCGGATCNONE 
009-063-D01CCGTCGGATCNONE 
009-156-H09CCGTCGGATCNONE 
AB117995CCGTCGGATCNONE 
AK058737CCGTCGGATCNONE 
AK059599CCGTCGGATCSimilar to 60S ribosomal protein L22-2. 
AK121502CCGTCGGATCNONE 
J023082D10CCGTCGGATCNONE 
J033022G11CCGTCGGATCNONE 
J075048M16CCGTCGGATCNONE 
J075049O20CCGTCGGATCNONE 
J075082I02CCGTCGGATCNONE 
J075105G01CCGTCGGATCNONE 
J075131K05CCGTCGGATCNONE 
J080002H01CCGTCGGATCNONE 
J080003H01CCGTCGGATCNONE 
J080005G08CCGTCGGATCNONE 
J080011M13CCGTCGGATCNONE 
J080020M02CCGTCGGATCNONE 
J080026N24CCGTCGGATCNONE 
J080028L09CCGTCGGATCNONE 
J080032O14CCGTCGGATCNONE 
J080033J12CCGTCGGATCNONE 
J080035D05CCGTCGGATCNONE 
J080039H01CCGTCGGATCNONE 
J080044B07CCGTCGGATCNONE 
J080044E23CCGTCGGATCNONE 
J080049N11CCGTCGGATCNONE 
J080050A21CCGTCGGATCNONE 
J080055L24CCGTCGGATCNONE 
J080059N20CCGTCGGATCNONE 
J080061F04CCGTCGGATCNONE 
J080078I16CCGTCGGATCNONE 
J080079G24CCGTCGGATCNONE 
J080080K13CCGTCGGATCNONE 
J080083G20CCGTCGGATCNONE 
J080087B08CCGTCGGATCNONE 
J080091L19CCGTCGGATCNONE 
J080094D06CCGTCGGATCNONE 
J090038L06CCGTCGGATCNONE 
J090075H06CCGTCGGATCNONE 
J090081D12CCGTCGGATCNONE 
Os03g0376000AK059565CCGATCCGACemp24/gp25L/p24 family protein. 
Os03g0421800AK099491CCGATCCGACCGTTGVirulence factor, pectin lyase fold family protein. 
J065198F08CCGATCCGACCGTTGNONE 
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39. 
J023106M18CCGATCCGACGGCCCGNONE 
J065178J05CCGATCCGACGGCCCGNONE 
J065196F10CCGATCCGACGGCCCGNONE 
Os03g0633800AK073044GATCCGACGGCCCSimilar to IAA6 (Fragment). 
J065038L22GATCCGACGGCCCNONE 
J065185C13GATCCGACGGCCCNONE 
Os03g0722500AK099926CCGTCGGATCGGGlycoside hydrolase, family 17 protein. 
AK100108CCGTCGGATCGGNONE 
J023004N24CCGTCGGATCGGNONE 
J100018K24CCGTCGGATCGGNONE 
J100032B22CCGTCGGATCGGNONE 
J100036K14CCGTCGGATCGGNONE 
J100043B05CCGTCGGATCGGNONE 
Os03g0745600014-030-E09CGCCACGTCGGATCNONE 
J053057E07CGCCACGTCGGATCNONE 
J075044L08CGCCACGTCGGATCNONE 
J075069C24CGCCACGTCGGATCNONE 
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein. 
J075180G21CGCCACGTCGGATCNONE 
J075189M22CGCCACGTCGGATCNONE 
J075192P11CGCCACGTCGGATCNONE 
Os03g0753500005-012-D10GTCGGATCGGNONE 
016-012-D03GTCGGATCGGNONE 
016-078-D06GTCGGATCGGNONE 
016-079-A05GTCGGATCGGNONE 
AK070136GTCGGATCGGProtein of unknown function DUF1618 domain containing protein. 
AK100468GTCGGATCGGNONE 
AK103935GTCGGATCGGNONE 
J013089F06GTCGGATCGGNONE 
J013111N14GTCGGATCGGNONE 
J023004F15GTCGGATCGGNONE 
J023049P09GTCGGATCGGNONE 
J023084E09GTCGGATCGGNONE 
J023085A02GTCGGATCGGNONE 
J023092H12GTCGGATCGGNONE 
J023109O13GTCGGATCGGNONE 
J033045G16GTCGGATCGGNONE 
J033050A05GTCGGATCGGNONE 
J033060G05GTCGGATCGGNONE 
J033100F08GTCGGATCGGNONE 
J033103M12GTCGGATCGGNONE 
J033105K21GTCGGATCGGNONE 
J033125H09GTCGGATCGGNONE 
J033138H14GTCGGATCGGNONE 
J043012H09GTCGGATCGGNONE 
J090051L22GTCGGATCGGNONE 
J090066M07GTCGGATCGGNONE 
J090070J09GTCGGATCGGNONE 
J090077M02GTCGGATCGGNONE 
J100019P19GTCGGATCGGNONE 
J100024M18GTCGGATCGGNONE 
J100035E21GTCGGATCGGNONE 
J100050C07GTCGGATCGGNONE 
Os03g0753600AK067449CCGTCGGATCChromo domain containing protein. 
J013107L13CCGTCGGATCNONE 
Os03g0758800AJ252135GATCCGACGGNONE 
AJ312906GATCCGACGGNONE 
AK060387GATCCGACGGSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GATCCGACGGNONE 
J023109G09GATCCGACGGNONE 
J033038B14GATCCGACGGNONE 
J043013C09GATCCGACGGNONE 
J053096E21GATCCGACGGNONE 
J065026B08GATCCGACGGNONE 
J065062B16GATCCGACGGNONE 
J065066E03GATCCGACGGNONE 
J065091J12GATCCGACGGNONE 
J065164A06GATCCGACGGNONE 
J075014I20GATCCGACGGNONE 
J075117N07GATCCGACGGNONE 
J075142M03GATCCGACGGNONE 
J075175D04GATCCGACGGNONE 
J075188M01GATCCGACGGNONE 
J075199I20GATCCGACGGNONE 
J090010J12GATCCGACGGNONE 
J090025O16GATCCGACGGNONE 
J090041H05GATCCGACGGNONE 
J090078P07GATCCGACGGNONE 
J100031K10GATCCGACGGNONE 
J100055F23GATCCGACGGNONE 
J100064G05GATCCGACGGNONE 
J100080C24GATCCGACGGNONE 
J100080O07GATCCGACGGNONE 
J100090F01GATCCGACGGNONE 
Os03g0782500AK105637GATCCGACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0800400AK071430GTCGGATCProtein of unknown function DUF1618 domain containing protein. 
J023019H20GTCGGATCNONE 
J023097A10GTCGGATCNONE 
J023100K15GTCGGATCNONE 
J075095I09GTCGGATCNONE 
J090014B19GTCGGATCNONE 
J090072D02GTCGGATCNONE 
J100029E17GTCGGATCNONE 
J100047F04GTCGGATCNONE 
Os03g0825700AK067902GATCCGACSimilar to Defective in exine formation. 
Os03g0830500AK071173GATCCGACSimilar to PGPS/D12. 
J023082F07GATCCGACNONE 
J065024E21GATCCGACNONE 
J065100L04GATCCGACNONE 
Os04g0269900J065139P11CGTCGGATCGGNONE 
J100034P12CGTCGGATCGGNONE 
J100045D21CGTCGGATCGGNONE 
Os04g0401000006-024-G01GATCCGACGGNONE 
009-047-D03GATCCGACGGNONE 
009-078-G04GATCCGACGGNONE 
009-083-C06GATCCGACGGNONE 
009-094-D02GATCCGACGGNONE 
009-129-B02GATCCGACGGNONE 
009-186-E03GATCCGACGGNONE 
AK070581GATCCGACGGNONE 
AK072320GATCCGACGGNONE 
AK106153GATCCGACGGHeavy metal transport/detoxification protein domain containing protein. 
Os04g0484900AK122179GATCCGACGGSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J023093A12GATCCGACGGNONE 
J033024H07GATCCGACGGNONE 
J033149C03GATCCGACGGNONE 
Os04g0491500AK068089GTCGGATCGGNONE 
AK101116GTCGGATCGGTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0530300009-053-E04CGTCGGATCGGNONE 
009-074-E03CGTCGGATCGGNONE 
AK066705CGTCGGATCGGConserved hypothetical protein. 
Os04g0542900AK068610CGACACGTCGGATCConserved hypothetical protein. 
Os04g0576300J065199E10GATCCGACGPseudouridylate synthase TruB, N-terminal domain containing protein. 
Os04g0660100AK109923GATCCGACHelix-loop-helix DNA-binding domain containing protein. 
J065042A13GATCCGACNONE 
J100043N14GATCCGACNONE 
Os05g0127300AK106429CCGATCCGACGCGTCCGTCCGNONE 
AK121766CCGATCCGACGCGTCCGTCCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CCGATCCGACGCGTCCGTCCGNONE 
J100041J04CCGATCCGACGCGTCCGTCCGNONE 
Os05g0146100AK106767GTCGGATCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE 
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein. 
AK103412CCGATCCGACGGCCCAGANONE 
J023045H21CCGATCCGACGGCCCAGANONE 
J033128G01CCGATCCGACGGCCCAGANONE 
J065017O10CCGATCCGACGGCCCAGANONE 
J065032H11CCGATCCGACGGCCCAGANONE 
J065120G09CCGATCCGACGGCCCAGANONE 
Os05g0395300AK066212GATCCGACProtein of unknown function DUF21 domain containing protein. 
Os05g0400700009-099-F02GATCCGACGGNONE 
AK072739GATCCGACGGSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC 2.7.7.6) (RNA polymerase II subunit 5). 
AK103913GATCCGACGGNONE 
J023138C10GATCCGACGGNONE 
Os05g0411600AK101609CGTCGGATCCGACSingle-stranded nucleic acid binding R3H domain containing protein. 
AY224459CGTCGGATCCGACNONE 
J065042L01CGTCGGATCCGACNONE 
J100068I05CGTCGGATCCGACNONE 
J100075L14CGTCGGATCCGACNONE 
Os05g0415600AK065818CCGTCGGATCNONE 
J013042K21CCGTCGGATCNONE 
J013114E15CCGTCGGATCNONE 
J013131H02CCGTCGGATCNONE 
J023041G06CCGTCGGATCNONE 
J100037M21CCGTCGGATCNONE 
Os05g0422900AK073629GATCCGACGConserved hypothetical protein. 
J023126I07GATCCGACGNONE 
J023143K12GATCCGACGNONE 
J033051N08GATCCGACGNONE 
J033128I04GATCCGACGNONE 
J065067M02GATCCGACGNONE 
J080312N05GATCCGACGNONE 
J100032G23GATCCGACGNONE 
Os05g0429700AK069203CGTTGGATGGGGATCCGACGGNONE 
AK103559CGTTGGATGGGGATCCGACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0435800AK067138GTCGGATCSimilar to Subtilisin-like protease. 
J013096L15GTCGGATCNONE 
J023003D11GTCGGATCNONE 
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH. 
Os05g0506000AF031609CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK062012CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK098900CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK122090CCGTCGGATCAGGCCCCGCGTCGCSimilar to MS5-like protein (Fragment). 
J013002B13CCGTCGGATCAGGCCCCGCGTCGCNONE 
J023149G13CCGTCGGATCAGGCCCCGCGTCGCNONE 
J033123O20CCGTCGGATCAGGCCCCGCGTCGCNONE 
J080315O17CCGTCGGATCAGGCCCCGCGTCGCNONE 
Os05g0591400AK120015GATCCGACGGHeat shock protein Hsp70 family protein. 
Os06g0192600AB033535CCGTCGGATCNONE 
AK061876CCGTCGGATC26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7). 
AK070538CCGTCGGATCNONE 
AK100060CCGTCGGATCNONE 
AK103801CCGTCGGATCNONE 
Os06g0308300AK059211CCGTCGGATCGGNONE 
AK101549CCGTCGGATCGGNONE 
AK102553CCGTCGGATCGGSimilar to 65kD microtubule associated protein. 
J090014G18CCGTCGGATCGGNONE 
J090082B01CCGTCGGATCGGNONE 
Os06g0320500004-013-F05GATCCGACGTGGCCCAATNONE 
006-021-B06GATCCGACGTGGCCCAATNONE 
006-021-D12GATCCGACGTGGCCCAATNONE 
006-022-A12GATCCGACGTGGCCCAATNONE 
006-024-B10GATCCGACGTGGCCCAATNONE 
006-029-F07GATCCGACGTGGCCCAATNONE 
006-029-H12GATCCGACGTGGCCCAATNONE 
006-031-A05GATCCGACGTGGCCCAATNONE 
006-033-C03GATCCGACGTGGCCCAATNONE 
006-036-B12GATCCGACGTGGCCCAATNONE 
006-048-C08GATCCGACGTGGCCCAATNONE 
006-050-F03GATCCGACGTGGCCCAATNONE 
006-051-C12GATCCGACGTGGCCCAATNONE 
006-054-C03GATCCGACGTGGCCCAATNONE 
006-057-D12GATCCGACGTGGCCCAATNONE 
006-067-F01GATCCGACGTGGCCCAATNONE 
006-071-G12GATCCGACGTGGCCCAATNONE 
006-072-G11GATCCGACGTGGCCCAATNONE 
006-072-H01GATCCGACGTGGCCCAATNONE 
006-081-E02GATCCGACGTGGCCCAATNONE 
006-082-A11GATCCGACGTGGCCCAATNONE 
006-084-A04GATCCGACGTGGCCCAATNONE 
006-085-C08GATCCGACGTGGCCCAATNONE 
006-086-D03GATCCGACGTGGCCCAATNONE 
006-088-B05GATCCGACGTGGCCCAATNONE 
006-088-G02GATCCGACGTGGCCCAATNONE 
006-092-G10GATCCGACGTGGCCCAATNONE 
006-094-D11GATCCGACGTGGCCCAATNONE 
006-094-E04GATCCGACGTGGCCCAATNONE 
006-103-G12GATCCGACGTGGCCCAATNONE 
006-106-G08GATCCGACGTGGCCCAATNONE 
006-111-E06GATCCGACGTGGCCCAATNONE 
006-114-C07GATCCGACGTGGCCCAATNONE 
006-115-A04GATCCGACGTGGCCCAATNONE 
006-117-G11GATCCGACGTGGCCCAATNONE 
006-118-G09GATCCGACGTGGCCCAATNONE 
009-010-F03GATCCGACGTGGCCCAATNONE 
009-076-G01GATCCGACGTGGCCCAATNONE 
009-134-E10GATCCGACGTGGCCCAATNONE 
009-193-D07GATCCGACGTGGCCCAATNONE 
AF094776GATCCGACGTGGCCCAATNONE 
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment). 
AK098864GATCCGACGTGGCCCAATNONE 
J013001A03GATCCGACGTGGCCCAATNONE 
J013098P14GATCCGACGTGGCCCAATNONE 
J013127B16GATCCGACGTGGCCCAATNONE 
J013169J24GATCCGACGTGGCCCAATNONE 
J023084H23GATCCGACGTGGCCCAATNONE 
J023093F05GATCCGACGTGGCCCAATNONE 
J033041I05GATCCGACGTGGCCCAATNONE 
J065196G15GATCCGACGTGGCCCAATNONE 
J075019K01GATCCGACGTGGCCCAATNONE 
J075053H16GATCCGACGTGGCCCAATNONE 
J075055M09GATCCGACGTGGCCCAATNONE 
J075099G10GATCCGACGTGGCCCAATNONE 
J075099L23GATCCGACGTGGCCCAATNONE 
J075127I09GATCCGACGTGGCCCAATNONE 
J080001C14GATCCGACGTGGCCCAATNONE 
J080016B11GATCCGACGTGGCCCAATNONE 
J080029C14GATCCGACGTGGCCCAATNONE 
J080029I17GATCCGACGTGGCCCAATNONE 
J080034F13GATCCGACGTGGCCCAATNONE 
J080039E02GATCCGACGTGGCCCAATNONE 
J080040N05GATCCGACGTGGCCCAATNONE 
J080042O17GATCCGACGTGGCCCAATNONE 
J080043N15GATCCGACGTGGCCCAATNONE 
J080056K02GATCCGACGTGGCCCAATNONE 
J080063N15GATCCGACGTGGCCCAATNONE 
J080069H05GATCCGACGTGGCCCAATNONE 
J080070N15GATCCGACGTGGCCCAATNONE 
J080075J22GATCCGACGTGGCCCAATNONE 
J080076F12GATCCGACGTGGCCCAATNONE 
J080086G05GATCCGACGTGGCCCAATNONE 
J090046G07GATCCGACGTGGCCCAATNONE 
J090059H01GATCCGACGTGGCCCAATNONE 
J090099C09GATCCGACGTGGCCCAATNONE 
J100028E12GATCCGACGTGGCCCAATNONE 
J100048J04GATCCGACGTGGCCCAATNONE 
J100054O05GATCCGACGTGGCCCAATNONE 
J100062C09GATCCGACGTGGCCCAATNONE 
J100075C17GATCCGACGTGGCCCAATNONE 
J100075C23GATCCGACGTGGCCCAATNONE 
J100075I23GATCCGACGTGGCCCAATNONE 
Os06g0518100AK119810CGTCGGATCConserved hypothetical protein. 
Os06g0560400AK103575CCGATCCGACGTGTCCNONE 
AK108074CCGATCCGACGTGTCCProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0596300AK120303CCGTCGGATCSimilar to Acyl-ACP thioesterase (Fragment). 
Os06g0604400AK072121CCGATCCGACSimilar to Phospholipase D. 
Os06g0697600015-012-D01CACTGACACGTGGATCCGACGNONE 
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein. 
Os06g0698400AK108486GTCGGATCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GATCCGACGGCCCAGATNONE 
J053032B13GATCCGACGGCCCAGATNONE 
X82036GATCCGACGGCCCAGATNONE 
Os06g0730200J065207O22GATCCGACNONE 
Os07g0115500AK108206GATCCGACGGConserved hypothetical protein. 
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GATCCGACGGCCCGGANONE 
J033136G07GATCCGACGGCCCGGANONE 
J065092I12GATCCGACGGCCCGGANONE 
J065132F04GATCCGACGGCCCGGANONE 
J065143I11GATCCGACGGCCCGGANONE 
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE 
006-021-E02GATCCGACGTGGGCCAANONE 
006-025-C06GATCCGACGTGGGCCAANONE 
006-027-H11GATCCGACGTGGGCCAANONE 
006-036-C05GATCCGACGTGGGCCAANONE 
006-046-D07GATCCGACGTGGGCCAANONE 
006-047-A02GATCCGACGTGGGCCAANONE 
006-050-F02GATCCGACGTGGGCCAANONE 
006-053-D07GATCCGACGTGGGCCAANONE 
006-054-E06GATCCGACGTGGGCCAANONE 
006-055-E01GATCCGACGTGGGCCAANONE 
006-055-F01GATCCGACGTGGGCCAANONE 
006-056-H12GATCCGACGTGGGCCAANONE 
006-057-D07GATCCGACGTGGGCCAANONE 
006-074-G10GATCCGACGTGGGCCAANONE 
006-077-C02GATCCGACGTGGGCCAANONE 
006-081-E01GATCCGACGTGGGCCAANONE 
006-089-B08GATCCGACGTGGGCCAANONE 
006-089-C10GATCCGACGTGGGCCAANONE 
006-092-E07GATCCGACGTGGGCCAANONE 
006-096-C11GATCCGACGTGGGCCAANONE 
006-096-H06GATCCGACGTGGGCCAANONE 
006-097-E07GATCCGACGTGGGCCAANONE 
006-098-D03GATCCGACGTGGGCCAANONE 
006-102-C05GATCCGACGTGGGCCAANONE 
006-107-E09GATCCGACGTGGGCCAANONE 
006-110-C09GATCCGACGTGGGCCAANONE 
006-113-C01GATCCGACGTGGGCCAANONE 
006-114-D09GATCCGACGTGGGCCAANONE 
006-115-H06GATCCGACGTGGGCCAANONE 
009-016-G06GATCCGACGTGGGCCAANONE 
009-031-C05GATCCGACGTGGGCCAANONE 
009-060-B05GATCCGACGTGGGCCAANONE 
009-123-H12GATCCGACGTGGGCCAANONE 
009-154-B09GATCCGACGTGGGCCAANONE 
009-172-F07GATCCGACGTGGGCCAANONE 
009-193-A04GATCCGACGTGGGCCAANONE 
AF022732GATCCGACGTGGGCCAANONE 
AF052203GATCCGACGTGGGCCAANONE 
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II. 
AK104722GATCCGACGTGGGCCAANONE 
D49713GATCCGACGTGGGCCAANONE 
J013002J02GATCCGACGTGGGCCAANONE 
J065051O13GATCCGACGTGGGCCAANONE 
J065066J18GATCCGACGTGGGCCAANONE 
J065077G23GATCCGACGTGGGCCAANONE 
J065162C22GATCCGACGTGGGCCAANONE 
J065162G22GATCCGACGTGGGCCAANONE 
J075091B13GATCCGACGTGGGCCAANONE 
J075099J22GATCCGACGTGGGCCAANONE 
J100056O22GATCCGACGTGGGCCAANONE 
J100059E01GATCCGACGTGGGCCAANONE 
J100079F20GATCCGACGTGGGCCAANONE 
Os07g0184800AK059544CCGATCCGACGGSimilar to Variant of histone H1. 
AK099050CCGATCCGACGGNONE 
AK102642CCGATCCGACGGNONE 
AK106132CCGATCCGACGGNONE 
J023037O08CCGATCCGACGGNONE 
J023050M02CCGATCCGACGGNONE 
J023087A10CCGATCCGACGGNONE 
J033027D14CCGATCCGACGGNONE 
J033028N17CCGATCCGACGGNONE 
J033043P10CCGATCCGACGGNONE 
J033051D07CCGATCCGACGGNONE 
J033073M07CCGATCCGACGGNONE 
J033075H01CCGATCCGACGGNONE 
J033084E04CCGATCCGACGGNONE 
J033096D10CCGATCCGACGGNONE 
J033100F04CCGATCCGACGGNONE 
J033114B06CCGATCCGACGGNONE 
J033117C10CCGATCCGACGGNONE 
J033140B21CCGATCCGACGGNONE 
J043034J07CCGATCCGACGGNONE 
J065006F04CCGATCCGACGGNONE 
J065130H16CCGATCCGACGGNONE 
J075020G13CCGATCCGACGGNONE 
J075108M17CCGATCCGACGGNONE 
J080018A06CCGATCCGACGGNONE 
J080037J11CCGATCCGACGGNONE 
J080048F15CCGATCCGACGGNONE 
J080057D16CCGATCCGACGGNONE 
J080069A10CCGATCCGACGGNONE 
J080086L09CCGATCCGACGGNONE 
J080088A17CCGATCCGACGGNONE 
J100046F24CCGATCCGACGGNONE 
Os07g0202450J065010G16GATCCGACGGNONE 
J065085G13GATCCGACGGNONE 
J065117M22GATCCGACGGNONE 
J065147K06GATCCGACGGNONE 
J065207G15GATCCGACGGNONE 
J090089M07GATCCGACGGNONE 
J100064D20GATCCGACGGSimilar to Mitosis protein dim1. 
Os07g0209000AK059111CCGTCGGATCSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319CCGTCGGATCNONE 
Os07g0295200AK059375GATCCGACNONE 
AK102836GATCCGACProtein of unknown function DUF167 family protein. 
J065113A16GATCCGACNONE 
J075066C08GATCCGACNONE 
J075070G15GATCCGACNONE 
J075081H11GATCCGACNONE 
J075190A03GATCCGACNONE 
Os07g0474300AK108961GATCCGACCGTTGGAConserved hypothetical protein. 
Os07g0545400009-136-E03CCGATCCGACGGNONE 
013-015-G08CCGATCCGACGGNONE 
AK059228CCGATCCGACGGNONE 
J065040D09CCGATCCGACGGNONE 
J065051C19CCGATCCGACGGNONE 
J065139B05CCGATCCGACGGNONE 
J065160E20CCGATCCGACGGNONE 
J065207I17CCGATCCGACGGNONE 
J080319M24CCGATCCGACGGNONE 
Os07g0582400003-104-B09GATCCGACNONE 
AK059423GATCCGACNONE 
AK102676GATCCGACNONE 
J065001F09GATCCGACNONE 
J065005K22GATCCGACNONE 
J065006D10GATCCGACNONE 
J065006P17GATCCGACNONE 
J065015G23GATCCGACNONE 
J065020F21GATCCGACNONE 
J065028I05GATCCGACNONE 
J065042N09GATCCGACNONE 
J065043P03GATCCGACNONE 
J065059E15GATCCGACNONE 
J065090I12GATCCGACNONE 
J065130I02GATCCGACNONE 
J065131P05GATCCGACNONE 
J065163I24GATCCGACNONE 
J065168I21GATCCGACNONE 
J065174A12GATCCGACNONE 
J065178K16GATCCGACNONE 
J065182P03GATCCGACNONE 
J065186B07GATCCGACNONE 
J065189M13GATCCGACNONE 
J065208J22GATCCGACNONE 
J065211E11GATCCGACNONE 
J075054E08GATCCGACNONE 
J075067K14GATCCGACNONE 
J075104E20GATCCGACNONE 
J075152M07GATCCGACNONE 
Os07g0586700AK102792CCAGGCCCGGGTCGGATCConserved hypothetical protein. 
Os07g0589000AK069813CCGATCCGACGGCCCGLateral organ boundaries, LOB domain containing protein. 
J023030F23CCGATCCGACGGCCCGNONE 
J065165H21CCGATCCGACGGCCCGNONE 
J065193G01CCGATCCGACGGCCCGNONE 
J075093F03CCGATCCGACGGCCCGNONE 
Os07g0605200AF091458GATCCGACGGNONE 
AF139665GATCCGACGGNONE 
AJ011675GATCCGACGGNONE 
AK064704GATCCGACGGMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15GATCCGACGGNONE 
J090034M06GATCCGACGGNONE 
J090079L24GATCCGACGGNONE 
Os07g0633000Os07g0633000GATCCGACACGTConserved hypothetical protein. 
Os07g0633200AK061338GATCCGACGGSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GATCCGACGGNONE 
J033096E22GATCCGACGGNONE 
J033125D06GATCCGACGGNONE 
J075048C23GATCCGACGGNONE 
J075050G02GATCCGACGGNONE 
J075104J04GATCCGACGGNONE 
J075144N04GATCCGACGGNONE 
Os07g0637400AK067595GTCGGATCSimilar to Novel plant SNARE 12 (AtNPSN12). 
AY740016GTCGGATCNONE 
J013108F08GTCGGATCNONE 
J033071O11GTCGGATCNONE 
J090029K15GTCGGATCNONE 
J100039N22GTCGGATCNONE 
Os08g0101100AK069900CCGTCGGATCHigh mobility group box domain containing protein. 
Os08g0171000AK071278CCGTCGGATCConserved hypothetical protein. 
J023113L21CCGTCGGATCNONE 
Os08g0187700AK099689CGTCGGATCRegulation of nuclear pre-mRNA protein domain containing protein. 
Os08g0430000AK120950GATCCGACGGCCGAGATConserved hypothetical protein. 
Os08g0478500AK099704GATCCGACGGCCCAGAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0540000AK070813GATCCGACGGCCCAGATProtein of unknown function DUF914, eukaryotic family protein. 
J090058N13GATCCGACGGCCCAGATNONE 
Os08g0544800009-168-G01ACGCGTCCTGGGCCGTCGGATCNONE 
011-046-D09ACGCGTCCTGGGCCGTCGGATCNONE 
012-003-C08ACGCGTCCTGGGCCGTCGGATCNONE 
012-042-B06ACGCGTCCTGGGCCGTCGGATCNONE 
013-035-H12ACGCGTCCTGGGCCGTCGGATCNONE 
013-072-A10ACGCGTCCTGGGCCGTCGGATCNONE 
014-010-B11ACGCGTCCTGGGCCGTCGGATCNONE 
014-097-E06ACGCGTCCTGGGCCGTCGGATCNONE 
015-003-E12ACGCGTCCTGGGCCGTCGGATCNONE 
015-040-B04ACGCGTCCTGGGCCGTCGGATCNONE 
AK060536ACGCGTCCTGGGCCGTCGGATCNONE 
AK102666ACGCGTCCTGGGCCGTCGGATCNONE 
AK119660ACGCGTCCTGGGCCGTCGGATCPCF2. 
D87261ACGCGTCCTGGGCCGTCGGATCNONE 
J090049N23ACGCGTCCTGGGCCGTCGGATCNONE 
J090084G06ACGCGTCCTGGGCCGTCGGATCNONE 
Os09g0123100AK103665GATCCGACGGTetratricopeptide-like helical domain containing protein. 
J013104A07GATCCGACGGNONE 
J013130B03GATCCGACGGNONE 
J013151K05GATCCGACGGNONE 
J023036M18GATCCGACGGNONE 
J023064M07GATCCGACGGNONE 
J023084H20GATCCGACGGNONE 
J023139A11GATCCGACGGNONE 
J023148O20GATCCGACGGNONE 
J033027B17GATCCGACGGNONE 
J033029B12GATCCGACGGNONE 
J033067E23GATCCGACGGNONE 
J033069D06GATCCGACGGNONE 
J033093L17GATCCGACGGNONE 
J033098N22GATCCGACGGNONE 
J033112B12GATCCGACGGNONE 
J033115E15GATCCGACGGNONE 
J033127F08GATCCGACGGNONE 
J033128P17GATCCGACGGNONE 
J033135J15GATCCGACGGNONE 
Os09g0240500009-015-D11CCGTCGGATCNONE 
009-039-B12CCGTCGGATCNONE 
AF493793CCGTCGGATCNONE 
AK062451CCGTCGGATCNONE 
AK067676CCGTCGGATCNONE 
AK069796CCGTCGGATCSimilar to Sulfate transporter 4.1, chloroplast precursor (AST82). 
Os09g0258000AK061499GATCCGACCellular retinaldehyde-binding/triple function, N-terminal domain containing protein. 
AK104755GATCCGACNONE 
J053043P09GATCCGACNONE 
Os09g0367900011-030-A03CCGATCCGACGGCCCAGATNONE 
011-030-A03GATCCGACGGNONE 
AK061601CCGATCCGACGGCCCAGATNONE 
AK061601GATCCGACGGNONE 
AK063310CCGATCCGACGGCCCAGATHypothetical protein. 
AK063310GATCCGACGGHypothetical protein. 
J100063G01CCGATCCGACGGCCCAGATNONE 
J100063G01GATCCGACGGNONE 
Os09g0380000AK068230GATCCGACSimilar to Acetyl-CoA synthetase-like protein. 
J013147J22GATCCGACNONE 
J100055P18GATCCGACNONE 
J100072E04GATCCGACNONE 
J100073P09GATCCGACNONE 
J100084G09GATCCGACNONE 
Os09g0480600AK107853GATCCGACGGHypothetical protein. 
Os09g0512900006-066-A10CCGATCCGATCCGACNONE 
AK061814CCGATCCGATCCGACConserved hypothetical protein. 
AK066925CCGATCCGATCCGACNONE 
AK104595CCGATCCGATCCGACNONE 
J013092F14CCGATCCGATCCGACNONE 
J023148N20CCGATCCGATCCGACNONE 
J033131F06CCGATCCGATCCGACNONE 
J053025L20CCGATCCGATCCGACNONE 
J075003B20CCGATCCGATCCGACNONE 
J075019N18CCGATCCGATCCGACNONE 
J075032D10CCGATCCGATCCGACNONE 
J075037G14CCGATCCGATCCGACNONE 
J075098D24CCGATCCGATCCGACNONE 
J075106M13CCGATCCGATCCGACNONE 
J075122N14CCGATCCGATCCGACNONE 
J075146E22CCGATCCGATCCGACNONE 
J075187E06CCGATCCGATCCGACNONE 
J075198I17CCGATCCGATCCGACNONE 
J090023O05CCGATCCGATCCGACNONE 
J100040E10CCGATCCGATCCGACNONE 
J100080P12CCGATCCGATCCGACNONE 
J100088B06CCGATCCGATCCGACNONE 
Os09g0526700011-075-B12GATCCGACGGNONE 
AB097460GATCCGACGGNONE 
AK073610GATCCGACGGSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase). 
AK104977GATCCGACGGNONE 
Os09g0548100009-134-B12GTCGGATCGGNONE 
AK062925GTCGGATCGGHypothetical protein. 
Os09g0558200016-083-C09GATCCGACGNONE 
AK068834GATCCGACGNONE 
AK103673GATCCGACGHomeodomain-like containing protein. 
J013159M18GATCCGACGNONE 
J065022I04GATCCGACGNONE 
J065089B19GATCCGACGNONE 
Os11g0153800009-146-G07GATCCGACGGNONE 
AK058630GATCCGACGGSimilar to Ribosomal protein S25 (40S ribosomal 25S subunit). 
J075071N04GATCCGACGGNONE 
Os11g0536900J100027G18GATCCGACConserved hypothetical protein. 
J100073G12GATCCGACNONE 
Os11g0544700AF464904GTCGGATCNONE 
AK072844GTCGGATCRepressor protein. 
J023143I16GTCGGATCNONE 
Os11g0557700AK071694CCGATCCGACGNONE 
AK107593CCGATCCGACGSAM (and some other nucleotide) binding motif domain containing protein. 
J023108E23CCGATCCGACGNONE 
Os11g0702700016-059-A09GATCCGACNONE 
AK064388GATCCGACHomeodomain-like containing protein. 
AK099346GATCCGACNONE 
J033025L03GATCCGACNONE 
J090067J06GATCCGACNONE 
Os12g0149000AK108734GATCCGACGGConserved hypothetical protein. 
Os12g0210200AF309381CCGATCCGACGNONE 
AK069105CCGATCCGACGSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
J023004I03CCGATCCGACGNONE 
J033069C11CCGATCCGACGNONE 
J065087E20CCGATCCGACGNONE 
J065097G21CCGATCCGACGNONE 
Os12g0457500015-025-F11GATCCGACNONE 
AK073212GATCCGACHypothetical protein. 
Os12g0485500AK071132CGGATCGGATCCGACGGSimilar to HesB/YadR/YfhF family protein. 
AK099510CGGATCGGATCCGACGGNONE 
J065024D15CGGATCGGATCCGACGGNONE 
J075168O15CGGATCGGATCCGACGGNONE 
J075190F06CGGATCGGATCCGACGGNONE 
Os12g0562100AK064831CCGTCGGATCConserved hypothetical protein. 
AK065844CCGTCGGATCNONE 
J013000F11CCGTCGGATCNONE 
Os12g0578200AK105512GATCCGACGGSimilar to Chorismate mutase, chloroplast precursor (EC 5.4.99.5) (CM-1). 
Os12g0602200AK119494GTCGGATCHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.