version

Summary of OsREG590 (All List)

OrganismOryza sativa  
IDOsREG590  
SequenceGATGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3748  

Entry Sequences (3748 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07GAGGCCCATCANONE 
AK063774GAGGCCCATCATranslocon-associated beta family protein. 
AK099081GAGGCCCATCANONE 
AK099360GAGGCCCATCANONE 
J013096O20GAGGCCCATCANONE 
J023002P14GAGGCCCATCANONE 
J033046F10GAGGCCCATCANONE 
J033084K08GAGGCCCATCANONE 
J065011H22GAGGCCCATCANONE 
J090017O18GAGGCCCATCANONE 
J090047F15GAGGCCCATCANONE 
J090049G20GAGGCCCATCANONE 
Os01g0144600006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
Os01g0147200016-005-F02GGGCCCGGCCCATCANONE 
AK106463GGGCCCGGCCCATCANONE 
AK121921GGGCCCGGCCCATCAIWS1, C-terminal family protein. 
J033098O16GGGCCCGGCCCATCANONE 
J033106E16GGGCCCGGCCCATCANONE 
J043026D12GGGCCCGGCCCATCANONE 
J065070B04GGGCCCGGCCCATCANONE 
J065162L03GGGCCCGGCCCATCANONE 
J065166F01GGGCCCGGCCCATCANONE 
J075030A13GGGCCCGGCCCATCANONE 
J075093O12GGGCCCGGCCCATCANONE 
J075106K15GGGCCCGGCCCATCANONE 
J075107F20GGGCCCGGCCCATCANONE 
J090031F21GGGCCCGGCCCATCANONE 
J090079E17GGGCCCGGCCCATCANONE 
Os01g0155600006-048-F03AGATGGGCCTCNONE 
AK060171AGATGGGCCTCNONE 
AK071635AGATGGGCCTCSimilar to Splicing factor RSZ33. 
J023080A03AGATGGGCCTCNONE 
J023100L15AGATGGGCCTCNONE 
J033075I17AGATGGGCCTCNONE 
J033085O09AGATGGGCCTCNONE 
J033105E15AGATGGGCCTCNONE 
J033132N10AGATGGGCCTCNONE 
J033132P12AGATGGGCCTCNONE 
J033149H12AGATGGGCCTCNONE 
J043026M03AGATGGGCCTCNONE 
J080305J10AGATGGGCCTCNONE 
J080308K03AGATGGGCCTCNONE 
J090023M04AGATGGGCCTCNONE 
J090078F24AGATGGGCCTCNONE 
J100066P05AGATGGGCCTCNONE 
Os01g0172000012-070-G06GGATGGGCCTTNONE 
AK068405GGATGGGCCTTALG3 family protein. 
J013149A07GGATGGGCCTTNONE 
J053047H05GGATGGGCCTTNONE 
J065075N03GGATGGGCCTTNONE 
J065093G22GGATGGGCCTTNONE 
J065130N21GGATGGGCCTTNONE 
J065143P05GGATGGGCCTTNONE 
J065216H07GGATGGGCCTTNONE 
J075013B06GGATGGGCCTTNONE 
J075196M05GGATGGGCCTTNONE 
J100039G24GGATGGGCCTTNONE 
J100041B11GGATGGGCCTTNONE 
J100069A16GGATGGGCCTTNONE 
J100069L12GGATGGGCCTTNONE 
J100074P16GGATGGGCCTTNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0203300015-045-F03ACCGGCCCATCTNONE 
015-045-F03TAGGCCCATCCANONE 
AK106329ACCGGCCCATCTConserved hypothetical protein. 
AK106329TAGGCCCATCCAConserved hypothetical protein. 
Os01g0246100AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0283000AK073165TAGGCCCATCTConserved hypothetical protein. 
J033023G08TAGGCCCATCTNONE 
Os01g0283100004-018-B01AGATGGGCCTANONE 
AK060908AGATGGGCCTANONE 
AK071713AGATGGGCCTASimilar to Ferripyochelin-binding protein-like. 
AK104205AGATGGGCCTANONE 
AK122051AGATGGGCCTANONE 
J023109L19AGATGGGCCTANONE 
Os01g0286000AK109824AGATGGGCCGGGCCCSnf7 family protein. 
Os01g0314300AK073419TAGGCCCATCTUncharacterized domain 2 containing protein. 
AK104939TAGGCCCATCTNONE 
J033044B03TAGGCCCATCTNONE 
J033060E12TAGGCCCATCTNONE 
J043037E21TAGGCCCATCTNONE 
J065019O18TAGGCCCATCTNONE 
J065025P22TAGGCCCATCTNONE 
J065042P06TAGGCCCATCTNONE 
J065074C19TAGGCCCATCTNONE 
J065074E13TAGGCCCATCTNONE 
J065094E05TAGGCCCATCTNONE 
J065108N08TAGGCCCATCTNONE 
J065134L13TAGGCCCATCTNONE 
J065152N24TAGGCCCATCTNONE 
J065162N24TAGGCCCATCTNONE 
J065170P16TAGGCCCATCTNONE 
J065177M20TAGGCCCATCTNONE 
J065187N01TAGGCCCATCTNONE 
J075012N12TAGGCCCATCTNONE 
J075046C17TAGGCCCATCTNONE 
J075055N06TAGGCCCATCTNONE 
J075141H03TAGGCCCATCTNONE 
J075150M11TAGGCCCATCTNONE 
J090005B16TAGGCCCATCTNONE 
J090079L11TAGGCCCATCTNONE 
J100039F16TAGGCCCATCTNONE 
Os01g0328400006-092-H09GCGGCCCATCTNONE 
009-085-A02GCGGCCCATCTNONE 
012-078-B03GCGGCCCATCTNONE 
AK061988GCGGCCCATCTUbiquitin. 
J013073B13GCGGCCCATCTNONE 
J023135L09GCGGCCCATCTNONE 
J023135O07GCGGCCCATCTNONE 
J033027B12GCGGCCCATCTNONE 
J033084P17GCGGCCCATCTNONE 
J065010M05GCGGCCCATCTNONE 
J065021N11GCGGCCCATCTNONE 
J065021N12GCGGCCCATCTNONE 
J065031K11GCGGCCCATCTNONE 
J065072P04GCGGCCCATCTNONE 
J065098D05GCGGCCCATCTNONE 
J065122N23GCGGCCCATCTNONE 
J065129L13GCGGCCCATCTNONE 
J065135N13GCGGCCCATCTNONE 
J065215N10GCGGCCCATCTNONE 
J075120N22GCGGCCCATCTNONE 
J090011G23GCGGCCCATCTNONE 
J090014F06GCGGCCCATCTNONE 
J090040G23GCGGCCCATCTNONE 
J090075I20GCGGCCCATCTNONE 
J090075N01GCGGCCCATCTNONE 
J090089B04GCGGCCCATCTNONE 
J090090F08GCGGCCCATCTNONE 
J090091M17GCGGCCCATCTNONE 
J090094L03GCGGCCCATCTNONE 
J090099L06GCGGCCCATCTNONE 
J100018A18GCGGCCCATCTNONE 
J100027H13GCGGCCCATCTNONE 
J100069C05GCGGCCCATCTNONE 
J100086L10GCGGCCCATCTNONE 
Os01g0513800012-032-E11AGATGGGCCGAANONE 
AK100776AGATGGGCCGAASimilar to Brix domain containing protein 1 homolog. 
J023120C10AGATGGGCCGAANONE 
J033044A22AGATGGGCCGAANONE 
J033048H13AGATGGGCCGAANONE 
J033118F03AGATGGGCCGAANONE 
J065176B05AGATGGGCCGAANONE 
J075026B19AGATGGGCCGAANONE 
J075048I23AGATGGGCCGAANONE 
J075141A19AGATGGGCCGAANONE 
J075148E05AGATGGGCCGAANONE 
J090031M12AGATGGGCCGAANONE 
Os01g0514300AK121086TGATGGGCCTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0582400AK069484TGGATGGGCCGGASimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12TGGATGGGCCGGANONE 
J023036F15TGGATGGGCCGGANONE 
J023095O16TGGATGGGCCGGANONE 
J033102M15TGGATGGGCCGGANONE 
J043013I06TGGATGGGCCGGANONE 
J065083M21TGGATGGGCCGGANONE 
J065176A17TGGATGGGCCGGANONE 
Os01g0618500011-019-D03TGATGGGCCTTNONE 
AK067476TGATGGGCCTTSimilar to RNA helicase (Fragment). 
J013020E19TGATGGGCCTTNONE 
J033046J12TGATGGGCCTTNONE 
J033055D06TGATGGGCCTTNONE 
Os01g0626300016-070-G04TTTTGGGCCCATCANONE 
AK122071TTTTGGGCCCATCASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04TTTTGGGCCCATCANONE 
J033117J08TTTTGGGCCCATCANONE 
J065007O12TTTTGGGCCCATCANONE 
J065020K12TTTTGGGCCCATCANONE 
J065142D24TTTTGGGCCCATCANONE 
J065157K19TTTTGGGCCCATCANONE 
J080307H19TTTTGGGCCCATCANONE 
J080311D16TTTTGGGCCCATCANONE 
J080316C12TTTTGGGCCCATCANONE 
J080316E03TTTTGGGCCCATCANONE 
J100033K16TTTTGGGCCCATCANONE 
J100042J21TTTTGGGCCCATCANONE 
J100051E06TTTTGGGCCCATCANONE 
J100071E22TTTTGGGCCCATCANONE 
Os01g0633200AK069077AGATGGGCCCTSimilar to X1 (Fragment). 
Os01g0633400AK108988TTGGCCCATCGTGGCCCAGTACBS domain containing protein. 
Os01g0661400AK073113TAGGCCCATCTNucleic acid-binding, OB-fold domain containing protein. 
J023014C20TAGGCCCATCTNONE 
J033022G03TAGGCCCATCTNONE 
J065050H15TAGGCCCATCTNONE 
J065059J19TAGGCCCATCTNONE 
J065085I24TAGGCCCATCTNONE 
J065166G12TAGGCCCATCTNONE 
J065182C18TAGGCCCATCTNONE 
Os01g0666500AK102689GAGGCCCATCAConserved hypothetical protein. 
Os01g0674500013-062-A08CCCGGCCCATCCNONE 
AK072815CCCGGCCCATCCNONE 
J023142B02CCCGGCCCATCCNONE 
Os01g0696000AK066735TGGATGGGCCGAAATTTCGGCCCATCANONE 
AK110917TGGATGGGCCGAAATTTCGGCCCATCASimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J013088G11TGGATGGGCCGAAATTTCGGCCCATCANONE 
J013102H08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J033126F08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J065053G13TGGATGGGCCGAAATTTCGGCCCATCANONE 
J075109I06TGGATGGGCCGAAATTTCGGCCCATCANONE 
J100073H07TGGATGGGCCGAAATTTCGGCCCATCANONE 
Os01g0700500AK072715CGGGCCCATCCCytochrome P450 family protein. 
AK119264CGGGCCCATCCNONE 
Os01g0705300AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK102719CACGGCCCATCTConserved hypothetical protein. 
AK103903AGATGGGCCGTGGGCCGTGNONE 
AK103903CACGGCCCATCTNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J013146O16CACGGCCCATCTNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J023024O09CACGGCCCATCTNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033105F22CACGGCCCATCTNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J033150L19CACGGCCCATCTNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J075008G14CACGGCCCATCTNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J090089L03CACGGCCCATCTNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
J100040H18CACGGCCCATCTNONE 
Os01g0705500AK063120AGATGGGCCGTGConserved hypothetical protein. 
AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
J065063M12AGATGGGCCGTGNONE 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065165C11AGATGGGCCGTGNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
Os01g0707300AK059962AGATGGGCCCTNONE 
AK104463AGATGGGCCCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0720500003-129-C07TAGGCCCATCCNONE 
004-015-C03TAGGCCCATCCNONE 
004-016-C06TAGGCCCATCCNONE 
006-022-A02TAGGCCCATCCNONE 
006-022-C04TAGGCCCATCCNONE 
006-022-C05TAGGCCCATCCNONE 
006-026-H07TAGGCCCATCCNONE 
006-028-A10TAGGCCCATCCNONE 
006-028-B01TAGGCCCATCCNONE 
006-030-F02TAGGCCCATCCNONE 
006-031-H01TAGGCCCATCCNONE 
006-046-G10TAGGCCCATCCNONE 
006-049-C03TAGGCCCATCCNONE 
006-050-C08TAGGCCCATCCNONE 
006-051-B12TAGGCCCATCCNONE 
006-051-F11TAGGCCCATCCNONE 
006-053-E07TAGGCCCATCCNONE 
006-055-H07TAGGCCCATCCNONE 
006-056-A12TAGGCCCATCCNONE 
006-060-C01TAGGCCCATCCNONE 
006-060-D10TAGGCCCATCCNONE 
006-063-B05TAGGCCCATCCNONE 
006-063-B09TAGGCCCATCCNONE 
006-071-H09TAGGCCCATCCNONE 
006-081-A08TAGGCCCATCCNONE 
006-082-G12TAGGCCCATCCNONE 
006-084-C09TAGGCCCATCCNONE 
006-085-A04TAGGCCCATCCNONE 
006-086-A02TAGGCCCATCCNONE 
006-086-G11TAGGCCCATCCNONE 
006-087-E07TAGGCCCATCCNONE 
006-090-H01TAGGCCCATCCNONE 
006-092-G11TAGGCCCATCCNONE 
006-093-E01TAGGCCCATCCNONE 
006-095-F02TAGGCCCATCCNONE 
006-097-C08TAGGCCCATCCNONE 
006-098-A01TAGGCCCATCCNONE 
006-100-A10TAGGCCCATCCNONE 
006-109-C10TAGGCCCATCCNONE 
006-112-A11TAGGCCCATCCNONE 
006-112-F09TAGGCCCATCCNONE 
006-113-B08TAGGCCCATCCNONE 
006-113-F01TAGGCCCATCCNONE 
006-115-B01TAGGCCCATCCNONE 
006-116-B11TAGGCCCATCCNONE 
006-118-B05TAGGCCCATCCNONE 
006-118-E04TAGGCCCATCCNONE 
006-119-G08TAGGCCCATCCNONE 
006-120-F04TAGGCCCATCCNONE 
009-078-E06TAGGCCCATCCNONE 
009-097-A11TAGGCCCATCCNONE 
009-115-F02TAGGCCCATCCNONE 
009-135-H12TAGGCCCATCCNONE 
009-145-C06TAGGCCCATCCNONE 
009-187-B03TAGGCCCATCCNONE 
009-197-C08TAGGCCCATCCNONE 
AK058289TAGGCCCATCCNONE 
AK062725TAGGCCCATCCSimilar to Type I chlorophyll a/b-binding protein b (Fragment). 
AK103946TAGGCCCATCCNONE 
AK104176TAGGCCCATCCNONE 
J023055C17TAGGCCCATCCNONE 
J033101K18TAGGCCCATCCNONE 
J075041N01TAGGCCCATCCNONE 
U74295TAGGCCCATCCNONE 
Os01g0749200006-074-H04AAGGCCCATCTNONE 
AK072760AAGGCCCATCTNONE 
AK099041AAGGCCCATCTNONE 
AK104146AAGGCCCATCTSimilar to 50S ribosomal protein L13. 
AK119189AAGGCCCATCTNONE 
Os01g0749400AK064990GGGGCCCATCTCTGTCAGTGGNONE 
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein. 
AK103775GGGGCCCATCTCTGTCAGTGGNONE 
J023001B06GGGGCCCATCTCTGTCAGTGGNONE 
Os01g0749900AK103588TGGATGGGCCGGTProtein of unknown function DUF250 domain containing protein. 
J033090O22TGGATGGGCCGGTNONE 
J033133C05TGGATGGGCCGGTNONE 
J065122N01TGGATGGGCCGGTNONE 
J065188K04TGGATGGGCCGGTNONE 
J090012D18TGGATGGGCCGGTNONE 
J100074N02TGGATGGGCCGGTNONE 
Os01g0754000014-081-F07CCAGGCCCATCTNONE 
AK063730CCAGGCCCATCTConserved hypothetical protein. 
J065219A11CCAGGCCCATCTNONE 
J075136N13CCAGGCCCATCTNONE 
J100051G01CCAGGCCCATCTNONE 
J100053M22CCAGGCCCATCTNONE 
Os01g0764600AK060621TGATGGGCCGGAFosfomycin resistance kinase FomA family protein. 
J013111L18TGATGGGCCGGANONE 
J013134N08TGATGGGCCGGANONE 
Os01g0765600AK108944TGATGGGCCATEF-Hand type domain containing protein. 
Os01g0767100AK109493TGATGGGCCGGCSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0770500AK071653TCGGCCCATCANONE 
AK099603TCGGCCCATCASimilar to ABC transporter ATP-binding protein. 
Os01g0801000AK064082AGATGGGCCATNONE 
AK101426AGATGGGCCATSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE 
006-117-F06TCCGGCCCATCCNONE 
AK061475AGATGGGCCCACACTGACAGNONE 
AK061475TCCGGCCCATCCNONE 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
AK105801TCCGGCCCATCC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17AGATGGGCCCACACTGACAGNONE 
J065168H17TCCGGCCCATCCNONE 
J065211O10AGATGGGCCCACACTGACAGNONE 
J065211O10TCCGGCCCATCCNONE 
Os01g0832200004-009-E08GGTGGGCCCATCANONE 
009-103-F06GGTGGGCCCATCANONE 
AK060017GGTGGGCCCATCANONE 
AK068980GGTGGGCCCATCAConserved hypothetical protein. 
J023085I24GGTGGGCCCATCANONE 
J090016I03GGTGGGCCCATCANONE 
J090078K06GGTGGGCCCATCANONE 
Os01g0865100016-066-A05CCCGGCCCATCNONE 
AK065779CCCGGCCCATCNONE 
AK071410CCCGGCCCATCSimilar to Uricase (Fragment). 
J013039E23CCCGGCCCATCNONE 
J023024I07CCCGGCCCATCNONE 
J065160J15CCCGGCCCATCNONE 
J090052J17CCCGGCCCATCNONE 
Os01g0869000AK067351TTTCGGCCCATCCNONE 
AK121602TTTCGGCCCATCCProtein of unknown function DUF639 family protein. 
Os01g0876500J053026A07CGATGGGCCGTGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17CGATGGGCCGTGNONE 
Os01g0884400AK072566AGATGGGCCCTU box domain containing protein. 
Os01g0889000AK103621CCAGGCCCATCATetratricopeptide-like helical domain containing protein. 
Os01g0896800AK065268GAGGCCCATCANONE 
AK104693GAGGCCCATCAEukaryotic ribosomal protein L5 family protein. 
J013126P09GAGGCCCATCANONE 
J033046N15GAGGCCCATCANONE 
J090008K02GAGGCCCATCANONE 
J090024F15GAGGCCCATCANONE 
J090074I23GAGGCCCATCANONE 
J090093F03GAGGCCCATCANONE 
J090096N02GAGGCCCATCANONE 
Os01g0924000004-020-C09TGATGGGCCGTANONE 
005-014-A06TGATGGGCCGTANONE 
009-085-G12TGATGGGCCGTANONE 
009-123-A08TGATGGGCCGTANONE 
009-134-A05TGATGGGCCGTANONE 
009-137-F06TGATGGGCCGTANONE 
016-016-B08TGATGGGCCGTANONE 
AF050674TGATGGGCCGTANONE 
AK061690TGATGGGCCGTASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797TGATGGGCCGTANONE 
J013040A15TGATGGGCCGTANONE 
J013104L20TGATGGGCCGTANONE 
J013127E12TGATGGGCCGTANONE 
J013158O05TGATGGGCCGTANONE 
J023012E09TGATGGGCCGTANONE 
J023126L23TGATGGGCCGTANONE 
J023143B03TGATGGGCCGTANONE 
J065005B16TGATGGGCCGTANONE 
J065101J15TGATGGGCCGTANONE 
J065105K16TGATGGGCCGTANONE 
J065155K16TGATGGGCCGTANONE 
J065171M17TGATGGGCCGTANONE 
J065182F07TGATGGGCCGTANONE 
J065187D10TGATGGGCCGTANONE 
J065194I24TGATGGGCCGTANONE 
J065207E24TGATGGGCCGTANONE 
J075001C24TGATGGGCCGTANONE 
J075090O10TGATGGGCCGTANONE 
J075095H17TGATGGGCCGTANONE 
J075109M24TGATGGGCCGTANONE 
J075123C18TGATGGGCCGTANONE 
J075148G22TGATGGGCCGTANONE 
J090009B09TGATGGGCCGTANONE 
J090075K17TGATGGGCCGTANONE 
J090081H23TGATGGGCCGTANONE 
J090097H21TGATGGGCCGTANONE 
J100063P14TGATGGGCCGTANONE 
Os01g0929500AK111399TAGGCCCATCCSimilar to Carbonyl reductase-like protein. 
AK120263TAGGCCCATCCNONE 
Os01g0934500AK073211CAGGCCCATCTConserved hypothetical protein. 
Os01g0948300009-023-A03AGATGGGCCTTGNONE 
AK102153AGATGGGCCTTGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24AGATGGGCCTTGNONE 
J023019C13AGATGGGCCTTGNONE 
J023049L21AGATGGGCCTTGNONE 
J023066H02AGATGGGCCTTGNONE 
J033050A07AGATGGGCCTTGNONE 
J033086E01AGATGGGCCTTGNONE 
J033086F11AGATGGGCCTTGNONE 
J090047I04AGATGGGCCTTGNONE 
J100035E10AGATGGGCCTTGNONE 
J100040L06AGATGGGCCTTGNONE 
J100044G21AGATGGGCCTTGNONE 
J100045F13AGATGGGCCTTGNONE 
J100046G12AGATGGGCCTTGNONE 
J100075N10AGATGGGCCTTGNONE 
J100077I01AGATGGGCCTTGNONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0953100AK064981CGGGCCCATCTNONE 
AK068882CGGGCCCATCTProtein of unknown function DUF594 family protein. 
J013001C07CGGGCCCATCTNONE 
J013169K14CGGGCCCATCTNONE 
J033114G07CGGGCCCATCTNONE 
J065035K15CGGGCCCATCTNONE 
J065082E12CGGGCCCATCTNONE 
Os01g0954400003-009-F12CGATGGGCCAGNONE 
012-080-B09CGATGGGCCAGNONE 
AK065709CGATGGGCCAGSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335CGATGGGCCAGNONE 
J013039J02CGATGGGCCAGNONE 
J033081E17CGATGGGCCAGNONE 
J075058B02CGATGGGCCAGNONE 
J075067K19CGATGGGCCAGNONE 
J075120E23CGATGGGCCAGNONE 
J075147I16CGATGGGCCAGNONE 
Os01g0970900011-018-A07TGATGGGCCCATTNONE 
011-022-E12TGATGGGCCCATTNONE 
AK063285TGATGGGCCCATTNONE 
AK101688TGATGGGCCCATTProtein prenyltransferase domain containing protein. 
J100042L01TGATGGGCCCATTNONE 
J100053B11TGATGGGCCCATTNONE 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0103700009-031-C12ATTGGGCCCATCCANONE 
AK062502ATTGGGCCCATCCANONE 
AK102186ATTGGGCCCATCCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17ATTGGGCCCATCCANONE 
J065161I07ATTGGGCCCATCCANONE 
J065184G15ATTGGGCCCATCCANONE 
J075123E02ATTGGGCCCATCCANONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0121200AK070123TGGATGGGCCGTGNONE 
AK121751TGGATGGGCCGTGProtein of unknown function DUF890 family protein. 
Os02g0162500009-181-F03TTGGCCCATCCNONE 
AK058907TTGGCCCATCCNONE 
AK121223TTGGCCCATCCSimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCATCCNONE 
J023136J11TTGGCCCATCCNONE 
J053097J20TTGGCCCATCCNONE 
J053098F01TTGGCCCATCCNONE 
J065065B09TTGGCCCATCCNONE 
J065082M04TTGGCCCATCCNONE 
J065188O05TTGGCCCATCCNONE 
J075057P15TTGGCCCATCCNONE 
J075061J08TTGGCCCATCCNONE 
J075061N15TTGGCCCATCCNONE 
J075131I08TTGGCCCATCCNONE 
J075141H13TTGGCCCATCCNONE 
J080062E14TTGGCCCATCCNONE 
J080062P15TTGGCCCATCCNONE 
J080318G17TTGGCCCATCCNONE 
J080319G19TTGGCCCATCCNONE 
J090001L10TTGGCCCATCCNONE 
J090024I18TTGGCCCATCCNONE 
J090033F24TTGGCCCATCCNONE 
J090036M16TTGGCCCATCCNONE 
J090040I24TTGGCCCATCCNONE 
J090048P06TTGGCCCATCCNONE 
J090049B12TTGGCCCATCCNONE 
J090068C02TTGGCCCATCCNONE 
J090069O04TTGGCCCATCCNONE 
J090084H22TTGGCCCATCCNONE 
J100022L03TTGGCCCATCCNONE 
J100028O14TTGGCCCATCCNONE 
J100028O18TTGGCCCATCCNONE 
J100032A15TTGGCCCATCCNONE 
J100033D21TTGGCCCATCCNONE 
J100034J23TTGGCCCATCCNONE 
J100043K22TTGGCCCATCCNONE 
J100052M22TTGGCCCATCCNONE 
J100053N03TTGGCCCATCCNONE 
J100074N24TTGGCCCATCCNONE 
J100082J10TTGGCCCATCCNONE 
Os02g0165500AK060547TGATGGGCCCCConserved hypothetical protein. 
Os02g0169000AK101628AGATGGGCCAAConserved hypothetical protein. 
Os02g0177500009-106-B06AAATGGGCTGTGGCCCATCGNONE 
AK062715AAATGGGCTGTGGCCCATCGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
J065049F10AAATGGGCTGTGGCCCATCGNONE 
J065063L16AAATGGGCTGTGGCCCATCGNONE 
J065102P06AAATGGGCTGTGGCCCATCGNONE 
J065137A16AAATGGGCTGTGGCCCATCGNONE 
J065212M11AAATGGGCTGTGGCCCATCGNONE 
Os02g0179100AK058557CCAGGCCCATCAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CCAGGCCCATCANONE 
Os02g0186700AK064492CTGGCCCATCAConserved hypothetical protein. 
J065210K09CTGGCCCATCANONE 
J075006A17CTGGCCCATCANONE 
J075108C18CTGGCCCATCANONE 
J075153E08CTGGCCCATCANONE 
Os02g0187600AK069783CGATGGGCCGCANONE 
AK109387CGATGGGCCGCAConserved hypothetical protein. 
J090029C18CGATGGGCCGCANONE 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0193500009-092-G09TCTCGGCCCATCANONE 
AK101237TCTCGGCCCATCAHypothetical protein. 
J033031K13TCTCGGCCCATCANONE 
J033034P12TCTCGGCCCATCANONE 
J080304L19TCTCGGCCCATCANONE 
J100059N21TCTCGGCCCATCANONE 
Os02g0208200J023104K09AGATGGGCCTGANONE 
J033080L20AGATGGGCCTGANONE 
J033105D08AGATGGGCCTGANONE 
J090079N16AGATGGGCCTGANONE 
Os02g0235600009-009-H04AATTGGGCCCATCCANONE 
009-165-G06AATTGGGCCCATCCANONE 
AK120417AATTGGGCCCATCCASimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14AATTGGGCCCATCCANONE 
J023106P11AATTGGGCCCATCCANONE 
J033080L09AATTGGGCCCATCCANONE 
J033123O05AATTGGGCCCATCCANONE 
J065197A18AATTGGGCCCATCCANONE 
J065216P16AATTGGGCCCATCCANONE 
J075017F02AATTGGGCCCATCCANONE 
J075025L16AATTGGGCCCATCCANONE 
J075027P04AATTGGGCCCATCCANONE 
J075039N01AATTGGGCCCATCCANONE 
J075101F24AATTGGGCCCATCCANONE 
J075132J15AATTGGGCCCATCCANONE 
J075164K16AATTGGGCCCATCCANONE 
J075174E19AATTGGGCCCATCCANONE 
J100043C23AATTGGGCCCATCCANONE 
J100067B11AATTGGGCCCATCCANONE 
Os02g0312700AK072956CGATGGGCCGTGATP11 family protein. 
AK102909CGATGGGCCGTGNONE 
J065017G18CGATGGGCCGTGNONE 
J075066A05CGATGGGCCGTGNONE 
Os02g0332200AK067672GAGGCCCATCASimilar to T-complex protein 1 delta subunit. 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0498100009-180-H04ATGGCCCATCGNONE 
AK112058ATGGCCCATCGConserved hypothetical protein. 
Os02g0527300AK101934CTGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11CTGGCCCATCCNONE 
J033073P11CTGGCCCATCCNONE 
Os02g0549600009-119-C10ATATGGGCCCATCANONE 
AK066564ATATGGGCCCATCASimilar to 40S ribosomal protein S10-1. 
J013073I17ATATGGGCCCATCANONE 
J013104F19ATATGGGCCCATCANONE 
J013104K21ATATGGGCCCATCANONE 
J013110E05ATATGGGCCCATCANONE 
J023020L11ATATGGGCCCATCANONE 
J023130D08ATATGGGCCCATCANONE 
J033041D03ATATGGGCCCATCANONE 
J033105K14ATATGGGCCCATCANONE 
J065040N14ATATGGGCCCATCANONE 
J065157A09ATATGGGCCCATCANONE 
J075123A20ATATGGGCCCATCANONE 
J075129F06ATATGGGCCCATCANONE 
J075135E04ATATGGGCCCATCANONE 
J075173A10ATATGGGCCCATCANONE 
J080301E09ATATGGGCCCATCANONE 
J080306D10ATATGGGCCCATCANONE 
J080310M21ATATGGGCCCATCANONE 
J080312M09ATATGGGCCCATCANONE 
J080319J08ATATGGGCCCATCANONE 
J090036L14ATATGGGCCCATCANONE 
J090051D01ATATGGGCCCATCANONE 
J090066K07ATATGGGCCCATCANONE 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0573400Os02g0573400CAAGTGGGCCCATCGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os02g0582600006-041-F11TGGATGGGCCTTNONE 
AK059791TGGATGGGCCTTNONE 
AK102380TGGATGGGCCTTHeavy metal transport/detoxification protein domain containing protein. 
J033092A09TGGATGGGCCTTNONE 
Os02g0634800003-004-F03TCTGGCCCATCTNONE 
AK059694TCTGGCCCATCTUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCTGGCCCATCTNONE 
J053077G20TCTGGCCCATCTNONE 
J075195F14TCTGGCCCATCTNONE 
Os02g0634900006-032-G12AGATGGGCCAGANONE 
006-033-E09AGATGGGCCAGANONE 
006-117-F10AGATGGGCCAGANONE 
006-118-E01AGATGGGCCAGANONE 
013-056-G08AGATGGGCCAGANONE 
AK059769AGATGGGCCAGANONE 
AK068583AGATGGGCCAGANONE 
AK072855AGATGGGCCAGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210AGATGGGCCAGANONE 
J023138P05AGATGGGCCAGANONE 
J023143J07AGATGGGCCAGANONE 
J033022O09AGATGGGCCAGANONE 
J033111L02AGATGGGCCAGANONE 
J033135O03AGATGGGCCAGANONE 
J065005K19AGATGGGCCAGANONE 
J065044C17AGATGGGCCAGANONE 
J065116K09AGATGGGCCAGANONE 
J065119O21AGATGGGCCAGANONE 
J075014L05AGATGGGCCAGANONE 
J075109H16AGATGGGCCAGANONE 
J075117D04AGATGGGCCAGANONE 
Os02g0638000AK103830AGATGGGCCCAGCNONE 
AK106548AGATGGGCCCAGCConserved hypothetical protein. 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
Os02g0665400AK073914TGGATGGGCCGANONE 
AK109787TGGATGGGCCGANONE 
AK120141TGGATGGGCCGASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19TGGATGGGCCGANONE 
J075165B08TGGATGGGCCGANONE 
J075177B03TGGATGGGCCGANONE 
J075191K02TGGATGGGCCGANONE 
J090051I12TGGATGGGCCGANONE 
J090057E21TGGATGGGCCGANONE 
J090058E01TGGATGGGCCGANONE 
J090087C06TGGATGGGCCGANONE 
J100025K07TGGATGGGCCGANONE 
J100026I21TGGATGGGCCGANONE 
J100041E12TGGATGGGCCGANONE 
J100083B01TGGATGGGCCGANONE 
Os02g0679200AK110789AGATGGGCCTCTGGGCCTCTetratricopeptide-like helical domain containing protein. 
Os02g0686300AK066567GTGGCCCATCTConserved hypothetical protein. 
Os02g0697200015-013-B10TGATGGGCCTGATGGGCCTTNONE 
AK059475TGATGGGCCTGATGGGCCTTNONE 
AK102993TGATGGGCCTGATGGGCCTTConserved hypothetical protein. 
J033079I18TGATGGGCCTGATGGGCCTTNONE 
J033082A14TGATGGGCCTGATGGGCCTTNONE 
J065047H08TGATGGGCCTGATGGGCCTTNONE 
J065131M14TGATGGGCCTGATGGGCCTTNONE 
Os02g0743800AK064134GGATGGGCCTTGCS domain containing protein. 
AK111254GGATGGGCCTTGNONE 
Os02g0744100006-070-H12TGATGGGCCTANONE 
006-115-C05TGATGGGCCTANONE 
AK061274TGATGGGCCTASAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0757900006-114-B06AGATGGGCCGANONE 
AK061269AGATGGGCCGASimilar to Poly(A)-binding protein II-like. 
AK071146AGATGGGCCGANONE 
J023081D16AGATGGGCCGANONE 
J043034B17AGATGGGCCGANONE 
J065027M09AGATGGGCCGANONE 
J065043F02AGATGGGCCGANONE 
J065086G05AGATGGGCCGANONE 
J065093A05AGATGGGCCGANONE 
J065109F16AGATGGGCCGANONE 
J065130N09AGATGGGCCGANONE 
J065154D24AGATGGGCCGANONE 
J065199L11AGATGGGCCGANONE 
J075166H22AGATGGGCCGANONE 
Os02g0758000013-065-E04TCGGCCCATCTNONE 
014-002-E03TCGGCCCATCTNONE 
014-004-B07TCGGCCCATCTNONE 
014-038-F03TCGGCCCATCTNONE 
014-072-G02TCGGCCCATCTNONE 
014-078-E02TCGGCCCATCTNONE 
014-081-H11TCGGCCCATCTNONE 
016-060-C11TCGGCCCATCTNONE 
AK064389TCGGCCCATCTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003TCGGCCCATCTNONE 
AK105464TCGGCCCATCTNONE 
J033076P21TCGGCCCATCTNONE 
Os02g0767100011-054-E05AGATGGGCCGAGNONE 
AK063351AGATGGGCCGAGNONE 
AK103640AGATGGGCCGAGConserved hypothetical protein. 
J090022G11AGATGGGCCGAGNONE 
J090072L18AGATGGGCCGAGNONE 
Os02g0767900009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
Os02g0776800AB042415AGATGGGCCGGCCCACCCGNONE 
AB042415GACGGCCCATCANONE 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK072308GACGGCCCATCAReplication protein A 70kDa. 
AK101212AGATGGGCCGGCCCACCCGNONE 
AK101212GACGGCCCATCANONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J033031B02GACGGCCCATCANONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090004E18GACGGCCCATCANONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
J090084C24GACGGCCCATCANONE 
Os02g0782200AK070439TCTGGCCCATCANONE 
AK101869TCTGGCCCATCANOT2/NOT3/NOT5 domain containing protein. 
Os02g0787100Os02g0787100TGATGGGCCTTProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0788500006-024-A02AGATGGGCCGAGNONE 
006-031-G02AGATGGGCCGAGNONE 
006-081-F11AGATGGGCCGAGNONE 
006-082-H05AGATGGGCCGAGNONE 
AK061452AGATGGGCCGAGConserved hypothetical protein. 
AK104117AGATGGGCCGAGNONE 
AK104526AGATGGGCCGAGNONE 
J075024D11AGATGGGCCGAGNONE 
J075056B12AGATGGGCCGAGNONE 
J075108H12AGATGGGCCGAGNONE 
J075156P10AGATGGGCCGAGNONE 
J075197A19AGATGGGCCGAGNONE 
Os02g0794400AK065845AGATGGGCCCCAInitiation factor 3 family protein. 
J013042M03AGATGGGCCCCANONE 
Os02g0803200AK063404AGATGGGCCGGASimilar to 30S ribosomal protein S15. 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0819500AK058926TGATGGGCCAANONE 
Os02g0827900AK099911TGATGGGCCAGCGGCCCATACSimilar to Signal peptidase 18 subunit (Fragment). 
Os02g0830100AK059746TGATGGGCCATNONE 
J013032G02CGATGGGCCCACCACNONE 
J013052O21CGATGGGCCCACCACNONE 
J023078A05CGATGGGCCCACCACNONE 
J033114C07CGATGGGCCCACCACNONE 
J033125M07CGATGGGCCCACCACNONE 
J053045C11CGATGGGCCCACCACNONE 
J100055G05CGATGGGCCCACCACNONE 
J100080J22CGATGGGCCCACCACNONE 
Os02g0832200AK108268TCAGGCCCATCGConserved hypothetical protein. 
AK108268TTGGCCCATCTConserved hypothetical protein. 
J065053F07TCAGGCCCATCGNONE 
J065053F07TTGGCCCATCTNONE 
J065095B09TCAGGCCCATCGNONE 
J065095B09TTGGCCCATCTNONE 
J065137I11TCAGGCCCATCGNONE 
J065137I11TTGGCCCATCTNONE 
J065187O12TCAGGCCCATCGNONE 
J065187O12TTGGCCCATCTNONE 
J075193O05TCAGGCCCATCGNONE 
J075193O05TTGGCCCATCTNONE 
Os03g0108500AK108704CTGGCCCATCGSimilar to 4,4-dimethyl-sterol C4-methyl-oxidase (Fragment). 
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein. 
J013035K10AGAGTGGGCCCATCGTGTCAGTGNONE 
J013050E10AGAGTGGGCCCATCGTGTCAGTGNONE 
J033040C13AGAGTGGGCCCATCGTGTCAGTGNONE 
Os03g0125000006-032-D09CGATGGGCCGAANONE 
006-032-D09TGATGGGCCTANONE 
006-032-D09TGATGGGCCTAAGGCCCAAATNONE 
006-033-B05CGATGGGCCGAANONE 
006-033-B05TGATGGGCCTANONE 
006-033-B05TGATGGGCCTAAGGCCCAAATNONE 
006-048-G06CGATGGGCCGAANONE 
006-048-G06TGATGGGCCTANONE 
006-048-G06TGATGGGCCTAAGGCCCAAATNONE 
006-048-G09CGATGGGCCGAANONE 
006-048-G09TGATGGGCCTANONE 
006-048-G09TGATGGGCCTAAGGCCCAAATNONE 
006-052-D09CGATGGGCCGAANONE 
006-052-D09TGATGGGCCTANONE 
006-052-D09TGATGGGCCTAAGGCCCAAATNONE 
006-072-A04CGATGGGCCGAANONE 
006-072-A04TGATGGGCCTANONE 
006-072-A04TGATGGGCCTAAGGCCCAAATNONE 
006-076-F12CGATGGGCCGAANONE 
006-076-F12TGATGGGCCTANONE 
006-076-F12TGATGGGCCTAAGGCCCAAATNONE 
006-080-B03CGATGGGCCGAANONE 
006-080-B03TGATGGGCCTANONE 
006-080-B03TGATGGGCCTAAGGCCCAAATNONE 
006-092-H03CGATGGGCCGAANONE 
006-092-H03TGATGGGCCTANONE 
006-092-H03TGATGGGCCTAAGGCCCAAATNONE 
006-103-G04CGATGGGCCGAANONE 
006-103-G04TGATGGGCCTANONE 
006-103-G04TGATGGGCCTAAGGCCCAAATNONE 
009-079-E01CGATGGGCCGAANONE 
009-079-E01TGATGGGCCTANONE 
009-079-E01TGATGGGCCTAAGGCCCAAATNONE 
009-150-F03CGATGGGCCGAANONE 
009-150-F03TGATGGGCCTANONE 
009-150-F03TGATGGGCCTAAGGCCCAAATNONE 
AF095708CGATGGGCCGAANONE 
AF095708TGATGGGCCTANONE 
AF095708TGATGGGCCTAAGGCCCAAATNONE 
AK059557CGATGGGCCGAANONE 
AK059557TGATGGGCCTANONE 
AK059557TGATGGGCCTAAGGCCCAAATNONE 
AK070779CGATGGGCCGAASimilar to 50S ribosomal protein L5, chloroplast. 
AK070779TGATGGGCCTASimilar to 50S ribosomal protein L5, chloroplast. 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999CGATGGGCCGAANONE 
AK098999TGATGGGCCTANONE 
AK098999TGATGGGCCTAAGGCCCAAATNONE 
AK104137CGATGGGCCGAANONE 
AK104137TGATGGGCCTANONE 
AK104137TGATGGGCCTAAGGCCCAAATNONE 
J065002D07CGATGGGCCGAANONE 
J065002D07TGATGGGCCTANONE 
J065002D07TGATGGGCCTAAGGCCCAAATNONE 
J065167E24CGATGGGCCGAANONE 
J065167E24TGATGGGCCTANONE 
J065167E24TGATGGGCCTAAGGCCCAAATNONE 
J075199O14CGATGGGCCGAANONE 
J075199O14TGATGGGCCTANONE 
J075199O14TGATGGGCCTAAGGCCCAAATNONE 
J100083L01CGATGGGCCGAANONE 
J100083L01TGATGGGCCTANONE 
J100083L01TGATGGGCCTAAGGCCCAAATNONE 
Os03g0138600Os03g0138600AGATGGGCCATProtein of unknown function DUF810 family protein. 
Os03g0139000006-059-C06TACGGCCCATCTNONE 
009-055-F07TACGGCCCATCTNONE 
AK060973TACGGCCCATCTConserved hypothetical protein. 
AK103850TACGGCCCATCTNONE 
Os03g0145600015-010-B10CGGACGGCCCATCTNONE 
AK106243CGGACGGCCCATCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0168200AK099530TGATGGGCCGTGConserved hypothetical protein. 
Os03g0171700J065192H12GGTGGGCCCATCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0195900J065063O15GGATGGGCCTCNONE 
Os03g0197000AK071163GGACGGCCCATCGConserved hypothetical protein. 
J023079A07GGACGGCCCATCGNONE 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0213800AK103114CGATGGGCCGTTGMitochondrial substrate carrier family protein. 
Os03g0214100AB111916CGGCCCGGCCCATCTNONE 
AF009179CGGCCCGGCCCATCTReplication protein A1. 
AK060582CGGCCCGGCCCATCTNONE 
Os03g0225600AK058500TGATGGGCCAAConserved oligomeric complex COG6 family protein. 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0260100AK066143GAGGCCCATCAConserved hypothetical protein. 
AK066143TGATGGGCCCACAConserved hypothetical protein. 
Os03g0266100AK058507GGGGCCCATCGLIM, zinc-binding domain containing protein. 
J033099G10GGGGCCCATCGNONE 
J065196N19GGGGCCCATCGNONE 
Os03g0279200009-097-C06TTGGCCCATCCNONE 
013-007-B07TTGGCCCATCCNONE 
AK121750TTGGCCCATCCSimilar to Histone H2A. 
J033087I02TTGGCCCATCCNONE 
J065002G20TTGGCCCATCCNONE 
J065102M04TTGGCCCATCCNONE 
J065139A02TTGGCCCATCCNONE 
J075109D21TTGGCCCATCCNONE 
J075191L12TTGGCCCATCCNONE 
J090096C03TTGGCCCATCCNONE 
J100036C23TTGGCCCATCCNONE 
Os03g0282900006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0283300AK070169ATGGCCCATCTConserved hypothetical protein. 
Os03g0292800012-077-B05CAAGGCCCATCCNONE 
AK069970CAAGGCCCATCCSimilar to Ran binding protein 1 homolog. 
J065138F22CAAGGCCCATCCNONE 
Os03g0298800009-079-B10TACGGCCCATCGNONE 
AK103337TACGGCCCATCGSimilar to Spliceosomal protein. 
Os03g0305500AK070638TCCGGCCCATCCAArgininosuccinate lyase domain containing protein. 
Os03g0309800004-019-H07GGATGGGCCGCANONE 
AK060922GGATGGGCCGCANONE 
AK098942GGATGGGCCGCANONE 
AK106141GGATGGGCCGCANONE 
AK111530GGATGGGCCGCANONE 
AK111624GGATGGGCCGCASimilar to PPR2. 
J013024C10GGATGGGCCGCANONE 
J013043D15GGATGGGCCGCANONE 
J013108I11GGATGGGCCGCANONE 
J100058L07GGATGGGCCGCANONE 
J100071I19GGATGGGCCGCANONE 
Os03g0312600AK073391TGATGGGCCAGSimilar to XPA-binding protein 1 (HUSSY-23). 
AK073391TGATGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0333000AK109811TGATGGGCCGAGConserved hypothetical protein. 
J065152D04TGATGGGCCGAGNONE 
J090011B05TGATGGGCCGAGNONE 
Os03g0333100AK101050CTCGGCCCATCAProtein of unknown function DUF663 domain containing protein. 
Os03g0336000AK100067CTCGGCCCATCTProtein prenyltransferase domain containing protein. 
J065161K02CTCGGCCCATCTNONE 
J065162C21CTCGGCCCATCTNONE 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0339100AK111641TGATGGGCCGGGSimilar to PRL1 protein. 
Os03g0349000011-089-G05AGATGGGCCGANONE 
011-089-G05TAGGCCCAGGCCCATCTNONE 
AK099999AGATGGGCCGANucleoporin interacting component family protein. 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
J013134K18AGATGGGCCGANONE 
J013134K18TAGGCCCAGGCCCATCTNONE 
J033024G23AGATGGGCCGANONE 
J033024G23TAGGCCCAGGCCCATCTNONE 
J033098A12AGATGGGCCGANONE 
J033098A12TAGGCCCAGGCCCATCTNONE 
J090001N18AGATGGGCCGANONE 
J090001N18TAGGCCCAGGCCCATCTNONE 
J090058F11AGATGGGCCGANONE 
J090058F11TAGGCCCAGGCCCATCTNONE 
J090065C04AGATGGGCCGANONE 
J090065C04TAGGCCCAGGCCCATCTNONE 
J100067M17AGATGGGCCGANONE 
J100067M17TAGGCCCAGGCCCATCTNONE 
J100083P13AGATGGGCCGANONE 
J100083P13TAGGCCCAGGCCCATCTNONE 
Os03g0360500009-103-B05GGATGGGCCTGGNONE 
AK059166GGATGGGCCTGGNONE 
AK101285GGATGGGCCTGGProtein of unknown function DUF1077 family protein. 
J033061G19GGATGGGCCTGGNONE 
J065169P12GGATGGGCCTGGNONE 
J075104C18GGATGGGCCTGGNONE 
J075166G07GGATGGGCCTGGNONE 
J075170J04GGATGGGCCTGGNONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
Os03g0395000AK073283TTGGCCCATCASimilar to Heme oxygenase 2 (Fragment). 
Os03g0405000AK070839AGATGGGCCCACAReticulon family protein. 
Os03g0411800009-042-G11AGATGGGCCCCCACGTNONE 
AK121551AGATGGGCCCCCACGTSimilar to Metal transport protein. 
AY302059AGATGGGCCCCCACGTNONE 
J013095L05AGATGGGCCCCCACGTNONE 
J033033B06AGATGGGCCCCCACGTNONE 
J033118G11AGATGGGCCCCCACGTNONE 
Os03g0415500AK108435GCGGCCCATCCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GCGGCCCATCCANONE 
J065182P12TGGTGGGCCCTGGCCCATCANONE 
Os03g0442400Os03g0442400CCCGGCCCATCCNONE 
Os03g0606200009-030-E09GAGGCCCATCTNONE 
009-076-H10GAGGCCCATCTNONE 
009-122-H12GAGGCCCATCTNONE 
009-153-F09GAGGCCCATCTNONE 
AB055076GAGGCCCATCTMitochondrial ATP synthase 6 KD subunit. 
AK072384GAGGCCCATCTNONE 
AK107928GAGGCCCATCTNONE 
J023078E13GAGGCCCATCTNONE 
J053031N01GAGGCCCATCTNONE 
J053046K19GAGGCCCATCTNONE 
J053062P07GAGGCCCATCTNONE 
J053091C23GAGGCCCATCTNONE 
J053099N19GAGGCCCATCTNONE 
J065005E06GAGGCCCATCTNONE 
J065030N03GAGGCCCATCTNONE 
J065138O21GAGGCCCATCTNONE 
J065159K03GAGGCCCATCTNONE 
J075030M08GAGGCCCATCTNONE 
J080006E23GAGGCCCATCTNONE 
J080010D10GAGGCCCATCTNONE 
J080016N17GAGGCCCATCTNONE 
J080024N09GAGGCCCATCTNONE 
J080028E23GAGGCCCATCTNONE 
J080035I11GAGGCCCATCTNONE 
J080038D15GAGGCCCATCTNONE 
J080040H08GAGGCCCATCTNONE 
J080043L04GAGGCCCATCTNONE 
J080047C06GAGGCCCATCTNONE 
J080061G04GAGGCCCATCTNONE 
J080066E10GAGGCCCATCTNONE 
J080067P03GAGGCCCATCTNONE 
J080082D07GAGGCCCATCTNONE 
J080089M13GAGGCCCATCTNONE 
J080094O09GAGGCCCATCTNONE 
J080095C24GAGGCCCATCTNONE 
J080309E21GAGGCCCATCTNONE 
J090016G15GAGGCCCATCTNONE 
J090031C20GAGGCCCATCTNONE 
J090033A15GAGGCCCATCTNONE 
J090037L07GAGGCCCATCTNONE 
J090038I10GAGGCCCATCTNONE 
J090072P19GAGGCCCATCTNONE 
J100040J02GAGGCCCATCTNONE 
J100047N05GAGGCCCATCTNONE 
J100048M10GAGGCCCATCTNONE 
J100076C02GAGGCCCATCTNONE 
J100077G23GAGGCCCATCTNONE 
J100080O08GAGGCCCATCTNONE 
J100085C06GAGGCCCATCTNONE 
J100085F16GAGGCCCATCTNONE 
Os03g0626250J075100A11CGGGCCCATCANONE 
J075100A11TTGGCCCATCANONE 
J075134H15CGGGCCCATCANONE 
J075134H15TTGGCCCATCANONE 
J075142J02CGGGCCCATCANONE 
J075142J02TTGGCCCATCANONE 
J075181A14CGGGCCCATCANONE 
J075181A14TTGGCCCATCANONE 
J075192K17CGGGCCCATCANONE 
J075192K17TTGGCCCATCANONE 
J090046B06CGGGCCCATCANONE 
J090046B06TTGGCCCATCANONE 
Os03g0647800003-103-H03GACGGCCCATCTNONE 
006-104-G09GACGGCCCATCTNONE 
AK070243GACGGCCCATCTConserved hypothetical protein. 
J100056F22GACGGCCCATCTNONE 
Os03g0655400009-090-G04CGATGGGCCTTNONE 
009-133-B12CGATGGGCCTTNONE 
009-136-A10CGATGGGCCTTNONE 
009-156-C02CGATGGGCCTTNONE 
009-157-C04CGATGGGCCTTNONE 
009-159-F06CGATGGGCCTTNONE 
009-192-A07CGATGGGCCTTNONE 
009-192-B05CGATGGGCCTTNONE 
011-082-F01CGATGGGCCTTNONE 
013-041-G11CGATGGGCCTTNONE 
013-077-E04CGATGGGCCTTNONE 
014-001-A12CGATGGGCCTTNONE 
015-039-A12CGATGGGCCTTNONE 
016-094-G11CGATGGGCCTTNONE 
AB011368CGATGGGCCTTNONE 
AF010584CGATGGGCCTTSimilar to Water stress induced protein. 
AK059150CGATGGGCCTTNONE 
D26538CGATGGGCCTTNONE 
J065013M08CGATGGGCCTTNONE 
J065021G11CGATGGGCCTTNONE 
J065027K20CGATGGGCCTTNONE 
J065034A02CGATGGGCCTTNONE 
J065040F23CGATGGGCCTTNONE 
J065098G21CGATGGGCCTTNONE 
J065153J21CGATGGGCCTTNONE 
J065163C13CGATGGGCCTTNONE 
J065173C23CGATGGGCCTTNONE 
J065178I22CGATGGGCCTTNONE 
J065198K21CGATGGGCCTTNONE 
J065201H19CGATGGGCCTTNONE 
J065205F11CGATGGGCCTTNONE 
J100080E05CGATGGGCCTTNONE 
Os03g0683700AK065067AGATGGGCCAAProtein of unknown function DUF810 family protein. 
Os03g0685000009-031-F08GGATGGGCCGCNONE 
AK059896GGATGGGCCGCSimilar to Ferredoxin. 
AK098989GGATGGGCCGCNONE 
AK099303GGATGGGCCGCNONE 
J065041E14GGATGGGCCGCNONE 
J065085G22GGATGGGCCGCNONE 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
J013048F08CGATGGGCCTTGGGCTTTNONE 
Os03g0685900009-026-A09CTGGCCCATCANONE 
009-145-C09CTGGCCCATCANONE 
AK062981CTGGCCCATCAConserved hypothetical protein. 
J065001D12CTGGCCCATCANONE 
J065023B10CTGGCCCATCANONE 
J065041E10CTGGCCCATCANONE 
J065046C01CTGGCCCATCANONE 
J065146I22CTGGCCCATCANONE 
J065184F20CTGGCCCATCANONE 
J075011E15CTGGCCCATCANONE 
J075048H17CTGGCCCATCANONE 
J075070H15CTGGCCCATCANONE 
J075133C01CTGGCCCATCANONE 
J075170D02CTGGCCCATCANONE 
J090001G08CTGGCCCATCANONE 
J090026B09CTGGCCCATCANONE 
J100055M03CTGGCCCATCANONE 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0721700AK106706CCAGGCCCATCAProtein of unknown function DUF569 family protein. 
Os03g0725400015-060-D03ATGGCCCATCGNONE 
AK105499ATGGCCCATCGSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860ATGGCCCATCGNONE 
AK112085ATGGCCCATCGNONE 
J100068K06ATGGCCCATCGNONE 
J100073K24ATGGCCCATCGNONE 
J100084M24ATGGCCCATCGNONE 
Os03g0734700AK072060TTCGGCCCATCCMitochondrial substrate carrier family protein. 
AK120533TTCGGCCCATCCNONE 
J043026E20TTCGGCCCATCCNONE 
Os03g0737600014-094-E01GAGGCCCATCTNONE 
AB038234GAGGCCCATCTNONE 
AK101854GAGGCCCATCTCyclin H-1. 
AK105468GAGGCCCATCTNONE 
J033069N12GAGGCCCATCTNONE 
J043017A22GAGGCCCATCTNONE 
J065154A20GAGGCCCATCTNONE 
Os03g0740700011-093-H12CGGGCCGATGGGCCGANONE 
011-093-H12GGCCCGGCCCATCCNONE 
AK102723CGGGCCGATGGGCCGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
AK102723GGCCCGGCCCATCCProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19CGGGCCGATGGGCCGANONE 
J013059N19GGCCCGGCCCATCCNONE 
J013126N16CGGGCCGATGGGCCGANONE 
J013126N16GGCCCGGCCCATCCNONE 
J033105J16CGGGCCGATGGGCCGANONE 
J033105J16GGCCCGGCCCATCCNONE 
J090059D19CGGGCCGATGGGCCGANONE 
J090059D19GGCCCGGCCCATCCNONE 
Os03g0744700AK071178CGATGGGCCGGCConserved hypothetical protein. 
J075006D24CGATGGGCCGGCNONE 
J075165F21CGATGGGCCGGCNONE 
Os03g0769600AK100054ACCGGCCCATCTResB-like family protein. 
Os03g0771500AB028884AGATGGGCCATKnotted1-type homeobox protein OSH43. 
AK107296AGATGGGCCATNONE 
Os03g0774200AK065851AGATGGGCCAGANONE 
AK119532AGATGGGCCAGASimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AGATGGGCCAGANONE 
J023107I03AGATGGGCCAGANONE 
J065156I19AGATGGGCCAGANONE 
J065176L07AGATGGGCCAGANONE 
J100066F15AGATGGGCCAGANONE 
Os03g0784900006-053-H11CGATGGGCCGAGANONE 
009-165-F11CGATGGGCCGAGANONE 
AK060949CGATGGGCCGAGAConserved hypothetical protein. 
AK099097CGATGGGCCGAGANONE 
J023019M19CGATGGGCCGAGANONE 
J065024O11CGATGGGCCGAGANONE 
J065106D20CGATGGGCCGAGANONE 
J065201L15CGATGGGCCGAGANONE 
J075031B04CGATGGGCCGAGANONE 
J075033C19CGATGGGCCGAGANONE 
J075035F11CGATGGGCCGAGANONE 
J075074K14CGATGGGCCGAGANONE 
J075083A22CGATGGGCCGAGANONE 
J075120O10CGATGGGCCGAGANONE 
J075153L20CGATGGGCCGAGANONE 
J075159G02CGATGGGCCGAGANONE 
J080001J18CGATGGGCCGAGANONE 
J080015I03CGATGGGCCGAGANONE 
J080027E23CGATGGGCCGAGANONE 
J080046D24CGATGGGCCGAGANONE 
J080053B17CGATGGGCCGAGANONE 
J080070P07CGATGGGCCGAGANONE 
J080076D18CGATGGGCCGAGANONE 
J080078E13CGATGGGCCGAGANONE 
J080090H03CGATGGGCCGAGANONE 
J100024F19CGATGGGCCGAGANONE 
J100052D15CGATGGGCCGAGANONE 
J100079B14CGATGGGCCGAGANONE 
Os03g0785500AK067718AGATGGGCCGGGCProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0786500016-056-D08AGATGGGCCGANONE 
AK106487AGATGGGCCGASimilar to Glycine-rich protein 2. 
J080001C23AGATGGGCCGANONE 
J080005A02AGATGGGCCGANONE 
J080009A14AGATGGGCCGANONE 
J080009B11AGATGGGCCGANONE 
J080011L03AGATGGGCCGANONE 
J080017E21AGATGGGCCGANONE 
J080018H08AGATGGGCCGANONE 
J080021E11AGATGGGCCGANONE 
J080025O20AGATGGGCCGANONE 
J080026H21AGATGGGCCGANONE 
J080029I10AGATGGGCCGANONE 
J080036L01AGATGGGCCGANONE 
J080038M15AGATGGGCCGANONE 
J080051H09AGATGGGCCGANONE 
J080053E18AGATGGGCCGANONE 
J080054I12AGATGGGCCGANONE 
J080055B14AGATGGGCCGANONE 
J080060L16AGATGGGCCGANONE 
J080067G06AGATGGGCCGANONE 
J080069K14AGATGGGCCGANONE 
J080070N14AGATGGGCCGANONE 
J080071G10AGATGGGCCGANONE 
J080076D08AGATGGGCCGANONE 
J080076O11AGATGGGCCGANONE 
J080078E10AGATGGGCCGANONE 
J080079B15AGATGGGCCGANONE 
J080079K03AGATGGGCCGANONE 
J080079O15AGATGGGCCGANONE 
J080087B18AGATGGGCCGANONE 
Os03g0786700AK067936AATTGGGCCCATCCN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0795900012-092-G05AGATGGGCCGANONE 
015-043-D09AGATGGGCCGANONE 
016-078-G11AGATGGGCCGANONE 
AK068660AGATGGGCCGASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14AGATGGGCCGANONE 
J023001L04AGATGGGCCGANONE 
J053032K11AGATGGGCCGANONE 
J065059E10AGATGGGCCGANONE 
J065095H19AGATGGGCCGANONE 
J065181M06AGATGGGCCGANONE 
J100047D11AGATGGGCCGANONE 
J100068G04AGATGGGCCGANONE 
Os03g0797600006-034-B06TAGGCCCATCANONE 
009-066-A01TAGGCCCATCANONE 
014-035-H08TAGGCCCATCANONE 
AK067446TAGGCCCATCASimilar to Helix-loop-helix protein homolog. 
AK068388TAGGCCCATCANONE 
AK104412TAGGCCCATCANONE 
Os03g0807800AK064984TGATGGGCCTGASimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TGATGGGCCTGANONE 
J065015J20TGATGGGCCTGANONE 
J065122L11TGATGGGCCTGANONE 
J065217E10TGATGGGCCTGANONE 
J075023C02TGATGGGCCTGANONE 
J075102O04TGATGGGCCTGANONE 
J080024G24TGATGGGCCTGANONE 
J080033F02TGATGGGCCTGANONE 
J080047M13TGATGGGCCTGANONE 
J080048A22TGATGGGCCTGANONE 
J080056E06TGATGGGCCTGANONE 
J080064O11TGATGGGCCTGANONE 
Os03g0823500AK058972TAGGCCCATCGTGF-beta receptor, type I/II extracellular region family protein. 
AK099193TAGGCCCATCGNONE 
J023109G05TAGGCCCATCGNONE 
J023114H09TAGGCCCATCGNONE 
J065017L13TAGGCCCATCGNONE 
J065093G04TAGGCCCATCGNONE 
J065218D16TAGGCCCATCGNONE 
J090036G14TAGGCCCATCGNONE 
Os03g0826000AK072695AAGGCCCATCTConserved hypothetical protein. 
Os03g0828100009-088-D04CTGGCCCATCANONE 
009-125-F01CTGGCCCATCANONE 
009-169-C06CTGGCCCATCANONE 
AK059132CTGGCCCATCANONE 
AK062799CTGGCCCATCANONE 
AK099043CTGGCCCATCASimilar to 50S ribosomal protein L18. 
J013146D01CTGGCCCATCANONE 
J065057J16CTGGCCCATCANONE 
Os03g0829100AK072669TCGGCCCATCCASimilar to Soluble epoxide hydrolase. 
J013073C22TCGGCCCATCCANONE 
J033067O15TCGGCCCATCCANONE 
J065021D04TCGGCCCATCCANONE 
J065102E20TCGGCCCATCCANONE 
Os03g0831100AK103115TGATGGGCCTAArmadillo-like helical domain containing protein. 
J033119F15TGATGGGCCTANONE 
J065011M19TGATGGGCCTANONE 
J075019I08TGATGGGCCTANONE 
J075047A01TGATGGGCCTANONE 
J075096P21TGATGGGCCTANONE 
J075121I05TGATGGGCCTANONE 
J075121I07TGATGGGCCTANONE 
J090063F13TGATGGGCCTANONE 
J090068F16TGATGGGCCTANONE 
J090094E14TGATGGGCCTANONE 
Os03g0837300AK111243TTGGCCCATCANONE 
AK121140TTGGCCCATCANicotinate phosphoribosyltransferase and related family protein. 
AY214337TTGGCCCATCANONE 
J023077G12TTGGCCCATCANONE 
J023078M10TTGGCCCATCANONE 
J033031B10TTGGCCCATCANONE 
J033067L18TTGGCCCATCANONE 
J043005P09TTGGCCCATCANONE 
J090013J15TTGGCCCATCANONE 
J090042E10TTGGCCCATCANONE 
J090045A20TTGGCCCATCANONE 
J100022H02TTGGCCCATCANONE 
Os03g0843500AK067985GAGGCCCATCCNONE 
AK101661GAGGCCCATCCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454GAGGCCCATCCNONE 
J080302L23GAGGCCCATCCNONE 
Os03g0846400AK067706CGATGGGCCACNONE 
AK070549CGATGGGCCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0846900016-055-F06CCCGGCCCATCCNONE 
AK059297CCCGGCCCATCCConserved hypothetical protein. 
J090028J16CCCGGCCCATCCNONE 
Os03g0847500AK073859TGATGGGCCTTSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
J033086B08AAGGCCCAGGCCCATCTNONE 
Os03g0852400006-021-C11AGATGGGCCGAAANONE 
006-048-D09AGATGGGCCGAAANONE 
006-059-C05AGATGGGCCGAAANONE 
006-078-E01AGATGGGCCGAAANONE 
006-082-H09AGATGGGCCGAAANONE 
AK060985AGATGGGCCGAAANONE 
AK109338AGATGGGCCGAAAConserved hypothetical protein. 
Os03g0854500012-067-H08AAGGCCCATCCNONE 
AK100430AAGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
AK106118AAGGCCCATCCNONE 
AY344485AAGGCCCATCCNONE 
J023088F14AAGGCCCATCCNONE 
J100041G01AAGGCCCATCCNONE 
J100046N19AAGGCCCATCCNONE 
J100052O08AAGGCCCATCCNONE 
Os03g0856200009-070-B07GACGGCCCATCANONE 
009-135-H05GACGGCCCATCANONE 
J100067D22GACGGCCCATCANONE 
J100067L13GACGGCCCATCANONE 
J100073I07GACGGCCCATCANONE 
J100080D01GACGGCCCATCANONE 
Os03g0857500AK072880TAGGCCCATCGProtein of unknown function DUF303, acetylesterase putative domain containing protein. 
Os04g0218600009-123-A05AAGGCCCAAGGCCCATCCNONE 
AK062873AAGGCCCAAGGCCCATCCNONE 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
J090077A20AAGGCCCAAGGCCCATCCNONE 
Os04g0378200AK103076TGATGGGCCGAGSterile alpha motif SAM domain containing protein. 
J033118E02TGATGGGCCGAGNONE 
J065065F15TGATGGGCCGAGNONE 
J090080I24TGATGGGCCGAGNONE 
Os04g0388900AK063224CAAGGCCCGGCCCATCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CAAGGCCCGGCCCATCANONE 
J065148P22CAAGGCCCGGCCCATCANONE 
J075040G12CAAGGCCCGGCCCATCANONE 
Os04g0397901J065050P16TCGGCCCATCGConserved hypothetical protein. 
Os04g0407300AK101793GACGGCCCATCGNONE 
AK121980GACGGCCCATCGHypothetical protein. 
J033065K23GACGGCCCATCGNONE 
J033108L11GACGGCCCATCGNONE 
Os04g0428900009-068-A06AGATGGGCCAGANONE 
AK061355AGATGGGCCAGASimilar to CSN8. 
AK099153AGATGGGCCAGANONE 
AY336991AGATGGGCCAGANONE 
J023069F08AGATGGGCCAGANONE 
J065112H12AGATGGGCCAGANONE 
J075022F23AGATGGGCCAGANONE 
J090045D23AGATGGGCCAGANONE 
J090067E18AGATGGGCCAGANONE 
J090099H14AGATGGGCCAGANONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0459600006-039-H09AGATGGGCCGCNONE 
AK061516AGATGGGCCGCRan-interacting Mog1 protein family protein. 
J065112J03AGATGGGCCGCNONE 
Os04g0465700016-043-B01AAGGCCCATCANONE 
AK064379AAGGCCCATCARNA dependent RNA polymerase family protein. 
Os04g0486400AJ535489TGATGGGCCTGANONE 
AK103296TGATGGGCCTGARML1 protein. 
J013045L03TGATGGGCCTGANONE 
J013045M03TGATGGGCCTGANONE 
J033034L24TGATGGGCCTGANONE 
J033125B02TGATGGGCCTGANONE 
J075001G08TGATGGGCCTGANONE 
J075011I16TGATGGGCCTGANONE 
J075033M08TGATGGGCCTGANONE 
J075044G01TGATGGGCCTGANONE 
J075047D04TGATGGGCCTGANONE 
J075061J09TGATGGGCCTGANONE 
J075085L07TGATGGGCCTGANONE 
J075087D20TGATGGGCCTGANONE 
J075117A04TGATGGGCCTGANONE 
J075134H06TGATGGGCCTGANONE 
J075184J12TGATGGGCCTGANONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0525000AK067753TGGATGGGCCCATCGConserved hypothetical protein. 
J013118G14TGGATGGGCCCATCGNONE 
J065026J15TGGATGGGCCCATCGNONE 
J065184H21TGGATGGGCCCATCGNONE 
J065186H22TGGATGGGCCCATCGNONE 
J065193D20TGGATGGGCCCATCGNONE 
J075060D12TGGATGGGCCCATCGNONE 
J075179L24TGGATGGGCCCATCGNONE 
Os04g0551300AK103502TGATGGGCCAASimilar to Growth regulator like protein. 
Os04g0551800016-049-G12CAAGGCCCATCANONE 
AK121568CAAGGCCCATCASimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CAAGGCCCATCANONE 
J013111B11CAAGGCCCATCANONE 
J013121H23CAAGGCCCATCANONE 
J023012A17CAAGGCCCATCANONE 
J023092M05CAAGGCCCATCANONE 
J033026P14CAAGGCCCATCANONE 
J033033C10CAAGGCCCATCANONE 
J033033M10CAAGGCCCATCANONE 
J033035C24CAAGGCCCATCANONE 
J033052E19CAAGGCCCATCANONE 
J033140K19CAAGGCCCATCANONE 
J065036F18CAAGGCCCATCANONE 
J065067L12CAAGGCCCATCANONE 
J065095G09CAAGGCCCATCANONE 
J065115B08CAAGGCCCATCANONE 
J065218E24CAAGGCCCATCANONE 
J090002N13CAAGGCCCATCANONE 
J090008B12CAAGGCCCATCANONE 
J090016F24CAAGGCCCATCANONE 
J090019H14CAAGGCCCATCANONE 
J090020G20CAAGGCCCATCANONE 
J090029L18CAAGGCCCATCANONE 
J090057C23CAAGGCCCATCANONE 
J090073H23CAAGGCCCATCANONE 
J090081C16CAAGGCCCATCANONE 
J090081E21CAAGGCCCATCANONE 
J090084L14CAAGGCCCATCANONE 
J090086M01CAAGGCCCATCANONE 
J090089E16CAAGGCCCATCANONE 
J100031P12CAAGGCCCATCANONE 
J100090N23CAAGGCCCATCANONE 
Os04g0559400AK106376AGATGGGCCCCACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0570600AK106747AGATGGGCCAGACytochrome P450 family protein. 
AK106747GCCGGCCCATCCCytochrome P450 family protein. 
J080319G08AGATGGGCCAGANONE 
J080319G08GCCGGCCCATCCNONE 
Os04g0573200AK065277CAAGGCCCATCTNONE 
AK120348CAAGGCCCATCTHeavy metal transport/detoxification protein domain containing protein. 
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein. 
AK103182GGATGGGCCAAGCCCATGTNONE 
AK119612GGATGGGCCAAGCCCATGTNONE 
AK120901GGATGGGCCAAGCCCATGTNONE 
Os04g0574100006-087-B01GGATGGGCCCCGCGTCGCNONE 
AK061150GGATGGGCCCCGCGTCGCNONE 
AK069178GGATGGGCCCCGCGTCGCExostosin-like family protein. 
AK121041GGATGGGCCCCGCGTCGCNONE 
J023008D04GGATGGGCCCCGCGTCGCNONE 
J023052A13GGATGGGCCCCGCGTCGCNONE 
J065046P18GGATGGGCCCCGCGTCGCNONE 
J065105D10GGATGGGCCCCGCGTCGCNONE 
Os04g0581000AK061337TGATGGGCCGGCSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142TGATGGGCCGGCNONE 
Os04g0584100012-063-E01AGATGGGCCTCNONE 
AK105292AGATGGGCCTCConserved hypothetical protein. 
Os04g0592500AK066893ATCTGGGCCCATCCPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ATCTGGGCCCATCCNONE 
Os04g0606800009-159-H11AGATGGGCCCACATGTCAGTGNONE 
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein. 
J033070J06AGATGGGCCCACATGTCAGTGNONE 
J033119D03AGATGGGCCCACATGTCAGTGNONE 
J100043F05AGATGGGCCCACATGTCAGTGNONE 
J100050A01AGATGGGCCCACATGTCAGTGNONE 
Os04g0611300009-006-G08AGATGGGCCGAGATNONE 
009-006-G08TAGGCCCATCANONE 
009-006-G08TTGGCCCATCCANONE 
009-011-C01AGATGGGCCGAGATNONE 
009-011-C01TAGGCCCATCANONE 
009-011-C01TTGGCCCATCCANONE 
009-036-B09AGATGGGCCGAGATNONE 
009-036-B09TAGGCCCATCANONE 
009-036-B09TTGGCCCATCCANONE 
009-116-G09AGATGGGCCGAGATNONE 
009-116-G09TAGGCCCATCANONE 
009-116-G09TTGGCCCATCCANONE 
009-126-E09AGATGGGCCGAGATNONE 
009-126-E09TAGGCCCATCANONE 
009-126-E09TTGGCCCATCCANONE 
009-132-F09AGATGGGCCGAGATNONE 
009-132-F09TAGGCCCATCANONE 
009-132-F09TTGGCCCATCCANONE 
009-151-G07AGATGGGCCGAGATNONE 
009-151-G07TAGGCCCATCANONE 
009-151-G07TTGGCCCATCCANONE 
009-155-C07AGATGGGCCGAGATNONE 
009-155-C07TAGGCCCATCANONE 
009-155-C07TTGGCCCATCCANONE 
009-163-G01AGATGGGCCGAGATNONE 
009-163-G01TAGGCCCATCANONE 
009-163-G01TTGGCCCATCCANONE 
009-169-G08AGATGGGCCGAGATNONE 
009-169-G08TAGGCCCATCANONE 
009-169-G08TTGGCCCATCCANONE 
009-191-B02AGATGGGCCGAGATNONE 
009-191-B02TAGGCCCATCANONE 
009-191-B02TTGGCCCATCCANONE 
009-196-A08AGATGGGCCGAGATNONE 
009-196-A08TAGGCCCATCANONE 
009-196-A08TTGGCCCATCCANONE 
009-198-E07AGATGGGCCGAGATNONE 
009-198-E07TAGGCCCATCANONE 
009-198-E07TTGGCCCATCCANONE 
014-015-F04AGATGGGCCGAGATNONE 
014-015-F04TAGGCCCATCANONE 
014-015-F04TTGGCCCATCCANONE 
015-087-H04AGATGGGCCGAGATNONE 
015-087-H04TAGGCCCATCANONE 
015-087-H04TTGGCCCATCCANONE 
AK062605AGATGGGCCGAGATNONE 
AK062605TAGGCCCATCANONE 
AK062605TTGGCCCATCCANONE 
AK063022AGATGGGCCGAGATConserved hypothetical protein. 
AK063022TAGGCCCATCAConserved hypothetical protein. 
AK063022TTGGCCCATCCAConserved hypothetical protein. 
AK066749AGATGGGCCGAGATNONE 
AK066749TAGGCCCATCANONE 
AK066749TTGGCCCATCCANONE 
AK104924AGATGGGCCGAGATNONE 
AK104924TAGGCCCATCANONE 
AK104924TTGGCCCATCCANONE 
J065002M20AGATGGGCCGAGATNONE 
J065002M20TAGGCCCATCANONE 
J065002M20TTGGCCCATCCANONE 
J065045L23AGATGGGCCGAGATNONE 
J065045L23TAGGCCCATCANONE 
J065045L23TTGGCCCATCCANONE 
J065101E05AGATGGGCCGAGATNONE 
J065101E05TAGGCCCATCANONE 
J065101E05TTGGCCCATCCANONE 
J065140J23AGATGGGCCGAGATNONE 
J065140J23TAGGCCCATCANONE 
J065140J23TTGGCCCATCCANONE 
J065179G11AGATGGGCCGAGATNONE 
J065179G11TAGGCCCATCANONE 
J065179G11TTGGCCCATCCANONE 
J065191B18AGATGGGCCGAGATNONE 
J065191B18TAGGCCCATCANONE 
J065191B18TTGGCCCATCCANONE 
J065192E03AGATGGGCCGAGATNONE 
J065192E03TAGGCCCATCANONE 
J065192E03TTGGCCCATCCANONE 
J065199H21AGATGGGCCGAGATNONE 
J065199H21TAGGCCCATCANONE 
J065199H21TTGGCCCATCCANONE 
J075067F01AGATGGGCCGAGATNONE 
J075067F01TAGGCCCATCANONE 
J075067F01TTGGCCCATCCANONE 
J075089L01AGATGGGCCGAGATNONE 
J075089L01TAGGCCCATCANONE 
J075089L01TTGGCCCATCCANONE 
J075147K22AGATGGGCCGAGATNONE 
J075147K22TAGGCCCATCANONE 
J075147K22TTGGCCCATCCANONE 
J080069G23AGATGGGCCGAGATNONE 
J080069G23TAGGCCCATCANONE 
J080069G23TTGGCCCATCCANONE 
J100053D10AGATGGGCCGAGATNONE 
J100053D10TAGGCCCATCANONE 
J100053D10TTGGCCCATCCANONE 
J100078C10AGATGGGCCGAGATNONE 
J100078C10TAGGCCCATCANONE 
J100078C10TTGGCCCATCCANONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0614500AK100259TGATGGGCCGTCAminotransferase class-III family protein. 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0658600AK064729TACGGCCCATCANONE 
AK119253TACGGCCCATCANucleolar, Nop52 family protein. 
J075132J07TACGGCCCATCANONE 
J075157N21TACGGCCCATCANONE 
Os04g0658800AK111108CTGGCCCATCCConserved hypothetical protein. 
Os04g0670800AK073170GGATGGGCCCTNONE 
Os04g0674350J065104O14AGATGGGCCGCNONE 
J065118J19AGATGGGCCGCNONE 
J065167I12AGATGGGCCGCHypothetical protein. 
Os04g0674400015-042-B08GCGGCCCATCTNONE 
AK102124GCGGCCCATCTSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22GCGGCCCATCTNONE 
J023022I24GCGGCCCATCTNONE 
J023120A15GCGGCCCATCTNONE 
J023123P20GCGGCCCATCTNONE 
J033068P09GCGGCCCATCTNONE 
J033107G22GCGGCCCATCTNONE 
J033116G12GCGGCCCATCTNONE 
J033133F03GCGGCCCATCTNONE 
J033143B20GCGGCCCATCTNONE 
J043006G12GCGGCCCATCTNONE 
J043027M18GCGGCCCATCTNONE 
J043034H17GCGGCCCATCTNONE 
J090091E20GCGGCCCATCTNONE 
J100035H09GCGGCCCATCTNONE 
J100037J04GCGGCCCATCTNONE 
J100047J24GCGGCCCATCTNONE 
J100059G06GCGGCCCATCTNONE 
J100066O12GCGGCCCATCTNONE 
J100074G23GCGGCCCATCTNONE 
J100077M12GCGGCCCATCTNONE 
Os04g0684500AK066014GGATGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0685100AK065262ATGGCCCATCTRibosomal biogenesis regulatory protein family protein. 
J013002J24ATGGCCCATCTNONE 
J013030M11ATGGCCCATCTNONE 
J033139J12ATGGCCCATCTNONE 
J065013D12ATGGCCCATCTNONE 
J065117J01ATGGCCCATCTNONE 
J065143K20ATGGCCCATCTNONE 
J065181E12ATGGCCCATCTNONE 
J065184A17ATGGCCCATCTNONE 
J065193B13ATGGCCCATCTNONE 
J065196H01ATGGCCCATCTNONE 
J075072G17ATGGCCCATCTNONE 
J075077B02ATGGCCCATCTNONE 
J075088A06ATGGCCCATCTNONE 
J075099H13ATGGCCCATCTNONE 
J075111O04ATGGCCCATCTNONE 
J075131F20ATGGCCCATCTNONE 
J075139K01ATGGCCCATCTNONE 
J075194I16ATGGCCCATCTNONE 
Os05g0102900006-056-A01AGATGGGCCTTNONE 
AK061764AGATGGGCCTTNONE 
AK065749AGATGGGCCTTSnf7 family protein. 
AK104101AGATGGGCCTTNONE 
J013042C01AGATGGGCCTTNONE 
J033038P15AGATGGGCCTTNONE 
J065032F16AGATGGGCCTTNONE 
J065039I22AGATGGGCCTTNONE 
J065150F19AGATGGGCCTTNONE 
J075079I21AGATGGGCCTTNONE 
J075082F14AGATGGGCCTTNONE 
J075098G16AGATGGGCCTTNONE 
J075167I08AGATGGGCCTTNONE 
Os05g0111000AK073598CAGGCCCATCTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0118000AK110694TCTGGCCCATCTSRR1 domain containing protein. 
Os05g0121500006-117-B10TCAGGCCCATCCANONE 
009-059-D04TCAGGCCCATCCANONE 
J065066C12TCAGGCCCATCCAConserved hypothetical protein. 
J075013I12TCAGGCCCATCCANONE 
J090046D18TCAGGCCCATCCANONE 
Os05g0123400AK069521CACGGCCCATCAConserved hypothetical protein. 
J023022O05CACGGCCCATCANONE 
Os05g0126200AK059554CCCGGCCCATCTConserved hypothetical protein. 
AK121734CCCGGCCCATCTNONE 
J033084B09CCCGGCCCATCTNONE 
J090010I10CCCGGCCCATCTNONE 
Os05g0128100009-051-B07CTTGGGCCGCCGGCCCATCTNONE 
009-127-B08CTTGGGCCGCCGGCCCATCTNONE 
009-144-H03CTTGGGCCGCCGGCCCATCTNONE 
009-176-B05CTTGGGCCGCCGGCCCATCTNONE 
AK108556CTTGGGCCGCCGGCCCATCTNONE 
AK119308CTTGGGCCGCCGGCCCATCTNONE 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
J023036J15CTTGGGCCGCCGGCCCATCTNONE 
J065122L01CTTGGGCCGCCGGCCCATCTNONE 
J075104P10CTTGGGCCGCCGGCCCATCTNONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0148300009-031-A08AGATGGGCCTGANONE 
AK062421AGATGGGCCTGARibosomal protein S27, mitochondrial family protein. 
Os05g0161400AK105485TGATGGGCCAAPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0182800AK121273TGATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0194550J075140P14GGATGGGCCAGAConserved hypothetical protein. 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0243300AK108395GAGGCCCATCASimilar to 50S ribosomal protein L13. 
J090098J16GAGGCCCATCANONE 
J100042H03GAGGCCCATCANONE 
J100088D02GAGGCCCATCANONE 
Os05g0295800AK070232AAGGCCCATCASimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03AAGGCCCATCANONE 
Os05g0346300009-033-C06GCGGCCCAGCAAGGCCCATCGNONE 
AF529175GCGGCCCAGCAAGGCCCATCGNONE 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
AK103081GCGGCCCAGCAAGGCCCATCGNONE 
AK104191GCGGCCCAGCAAGGCCCATCGNONE 
J013049B09GCGGCCCAGCAAGGCCCATCGNONE 
J023142E24GCGGCCCAGCAAGGCCCATCGNONE 
J033052M14GCGGCCCAGCAAGGCCCATCGNONE 
J033089N04GCGGCCCAGCAAGGCCCATCGNONE 
J033118F01GCGGCCCAGCAAGGCCCATCGNONE 
J065054E07GCGGCCCAGCAAGGCCCATCGNONE 
J065066L18GCGGCCCAGCAAGGCCCATCGNONE 
J065078C21GCGGCCCAGCAAGGCCCATCGNONE 
J065127G23GCGGCCCAGCAAGGCCCATCGNONE 
J065128N24GCGGCCCAGCAAGGCCCATCGNONE 
J065144P17GCGGCCCAGCAAGGCCCATCGNONE 
J065147P14GCGGCCCAGCAAGGCCCATCGNONE 
J065170E16GCGGCCCAGCAAGGCCCATCGNONE 
J065175D17GCGGCCCAGCAAGGCCCATCGNONE 
J065176M05GCGGCCCAGCAAGGCCCATCGNONE 
J065218G20GCGGCCCAGCAAGGCCCATCGNONE 
J090074J12GCGGCCCAGCAAGGCCCATCGNONE 
J100019H16GCGGCCCAGCAAGGCCCATCGNONE 
J100031N24GCGGCCCAGCAAGGCCCATCGNONE 
J100072G08GCGGCCCAGCAAGGCCCATCGNONE 
J100086I23GCGGCCCAGCAAGGCCCATCGNONE 
Os05g0361700AJ575218GCGGCCCATCANONE 
AK100184GCGGCCCATCASimilar to EREBP-2 protein (Fragment). 
AK111676GCGGCCCATCANONE 
J013155B14GCGGCCCATCANONE 
J065073N01GCGGCCCATCANONE 
J065161J12GCGGCCCATCANONE 
J075074A07GCGGCCCATCANONE 
J100029H13GCGGCCCATCANONE 
Os05g0377000Os05g0377000ACCGGCCCATCASimilar to Acyl carrier protein (ACP). 
Os05g0377000GCTGGGCCAGATGGGCCGGASimilar to Acyl carrier protein (ACP). 
Os05g0378900AK103841AGATGGGCCTAConserved hypothetical protein. 
AK103841ATGGCCCATCTConserved hypothetical protein. 
J033148I18AGATGGGCCTANONE 
J033148I18ATGGCCCATCTNONE 
J065085F12AGATGGGCCTANONE 
J065085F12ATGGCCCATCTNONE 
J075041H24AGATGGGCCTANONE 
J075041H24ATGGCCCATCTNONE 
J075180P06AGATGGGCCTANONE 
J075180P06ATGGCCCATCTNONE 
Os05g0379300AK109293GACGGCCCATCTConserved hypothetical protein. 
AK109293TTTCGGCCCATCAConserved hypothetical protein. 
Os05g0406100AK069515TGATGGGCCGCInosine/uridine-preferring nucleoside hydrolase domain containing protein. 
J023019G14TGATGGGCCGCNONE 
Os05g0417200AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0443800AK106590CGATGGGCCTASimilar to Plastid division protein ftsZ1 precursor. 
Os05g0450300AK071191GCGGCCCATCGConserved hypothetical protein. 
J023084G11GCGGCCCATCGNONE 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0458100006-084-A05AGATGGGCCGTGNONE 
009-091-H05AGATGGGCCGTGNONE 
AJ557547AGATGGGCCGTGNONE 
AK059467AGATGGGCCGTGNONE 
AK061127AGATGGGCCGTGNONE 
AK101652AGATGGGCCGTGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AGATGGGCCGTGNONE 
J033057B20AGATGGGCCGTGNONE 
J033087A05AGATGGGCCGTGNONE 
J043009C05AGATGGGCCGTGNONE 
J090009E10AGATGGGCCGTGNONE 
Os05g0480700AK100850GGTTGGGCCCATCTSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11GGTTGGGCCCATCTNONE 
Os05g0481000AK059369TGATGGGCCGAGCN5-related N-acetyltransferase domain containing protein. 
AK068619TGATGGGCCGANONE 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
Os05g0490000011-076-C07AGATGGGCCTTNONE 
015-026-D07AGATGGGCCTTNONE 
015-074-A08AGATGGGCCTTNONE 
AK064335AGATGGGCCTTNONE 
AK101340AGATGGGCCTTKrr1 family protein. 
J033034J18AGATGGGCCTTNONE 
Os05g0499300009-151-H01GGATGGGCCAGNONE 
013-049-G05GGATGGGCCAGNONE 
AK066855GGATGGGCCAGNONE 
AK104950GGATGGGCCAGSimilar to Peroxidase (EC 1.11.1.7). 
D14997GGATGGGCCAGNONE 
Os05g0506000AF031609CGTGTGGCCCATCGNONE 
AK062012CGTGTGGCCCATCGNONE 
AK098900CGTGTGGCCCATCGNONE 
AK122090CGTGTGGCCCATCGSimilar to MS5-like protein (Fragment). 
J013002B13CGTGTGGCCCATCGNONE 
J023149G13CGTGTGGCCCATCGNONE 
J033123O20CGTGTGGCCCATCGNONE 
J080315O17CGTGTGGCCCATCGNONE 
Os05g0526800016-054-G05ATATGGGCTGATGGGCCATNONE 
AK066551ATATGGGCTGATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ATATGGGCTGATGGGCCATNONE 
J013095M02ATATGGGCTGATGGGCCATNONE 
J065195O21ATATGGGCTGATGGGCCATNONE 
Os05g0535200AK070696AGATGGGCCTCCyclin-like F-box domain containing protein. 
J023057L12AGATGGGCCTCNONE 
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE 
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A. 
Os05g0539300Os05g0539300AGATGGGCCGGAProtein of unknown function DUF295 family protein. 
Os05g0541500AK101190TAGGCCCATCACyclin-like F-box domain containing protein. 
AK101190TCAGGCCCATCTCyclin-like F-box domain containing protein. 
AK101531TAGGCCCATCANONE 
AK101531TCAGGCCCATCTNONE 
J033030F10TAGGCCCATCANONE 
J033030F10TCAGGCCCATCTNONE 
Os05g0542900AK102925TGATGGGCCGAVirulence factor, pectin lyase fold family protein. 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0571300AK072262TTGGCCCATCTGGCCCATAConserved hypothetical protein. 
AK109853TTGGCCCATCTGGCCCATANONE 
AK111014TTGGCCCATCTGGCCCATANONE 
Os05g0577200AK069756TGATGGGCCGTGGCarboxylesterase, type B family protein. 
Os05g0587400AK102121TCCGGCCCATCPrefoldin domain containing protein. 
J033084N12TCCGGCCCATCNONE 
Os05g0588200AK109323TCTGGCCCATCCRuvA domain 2-like containing protein. 
Os06g0101000J023143D21TCTGGCCCATCCANONE 
J033027A19TCTGGCCCATCCANONE 
J033131O18TCTGGCCCATCCANONE 
J043040N17TCTGGCCCATCCANONE 
J090007I16TCTGGCCCATCCANONE 
Os06g0103400009-138-H04AAGGCCCATCCNONE 
009-138-H04TAGGCCCATCANONE 
AK067021AAGGCCCATCCNucleic acid-binding, OB-fold domain containing protein. 
AK067021TAGGCCCATCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCATCCNONE 
AK071627TAGGCCCATCANONE 
J080307A01AAGGCCCATCCNONE 
J080307A01TAGGCCCATCANONE 
Os06g0116400006-082-G06ATGGCCCATCANONE 
AK058327ATGGCCCATCANONE 
AK105979ATGGCCCATCAHigh-affinity nickel-transporter family protein. 
J065083I24ATGGCCCATCANONE 
J100072O18ATGGCCCATCANONE 
Os06g0116800AK058985GAGGCCCATCASimilar to GFA2. 
AK120746GAGGCCCATCANONE 
Os06g0140100011-063-A02TGCGGCCCATCTNONE 
AK063371TGCGGCCCATCTLeucine carboxyl methyltransferase family protein. 
Os06g0226600006-083-D04AGATGGGCCGAGANONE 
AK061806AGATGGGCCGAGANONE 
AK102752AGATGGGCCGAGATB2/DP1 and HVA22 related protein family protein. 
J013089J11AGATGGGCCGAGANONE 
J033106M05AGATGGGCCGAGANONE 
J100044M21AGATGGGCCGAGANONE 
J100056E06AGATGGGCCGAGANONE 
J100059F06AGATGGGCCGAGANONE 
Os06g0247800AK102187CCACCAACTCGGCCCATCCSimilar to Dynamin-like protein (Fragment). 
AY224491CCACCAACTCGGCCCATCCNONE 
Os06g0251000J033111L12GCCGGCCCATCANONE 
J043001C08GCCGGCCCATCAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0274200009-090-A02GAGGCCCATCTNONE 
AK073155GAGGCCCATCTSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08GAGGCCCATCTNONE 
J065061C07GAGGCCCATCTNONE 
J065105L08GAGGCCCATCTNONE 
J075013C12GAGGCCCATCTNONE 
J090010N17GAGGCCCATCTNONE 
J090068K07GAGGCCCATCTNONE 
J100058A21GAGGCCCATCTNONE 
J100066C07GAGGCCCATCTNONE 
Os06g0287700AK067966CCAGGCCCATCCSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17CCAGGCCCATCCNONE 
J065038I02CCAGGCCCATCCNONE 
J065214J02CCAGGCCCATCCNONE 
Os06g0329350009-021-B05TGGATGGGCCCACANONE 
009-043-A04TGGATGGGCCCACANONE 
009-051-G06TGGATGGGCCCACANONE 
009-107-D02TGGATGGGCCCACANONE 
009-111-B11TGGATGGGCCCACANONE 
009-118-B02TGGATGGGCCCACANONE 
009-132-A11TGGATGGGCCCACANONE 
009-186-B06TGGATGGGCCCACANONE 
J065044N12TGGATGGGCCCACANONE 
J065097L15TGGATGGGCCCACANONE 
J065219N02TGGATGGGCCCACANONE 
J080009E03TGGATGGGCCCACANONE 
J080020P03TGGATGGGCCCACANONE 
J080024O15TGGATGGGCCCACANONE 
J080030B22TGGATGGGCCCACANONE 
J080032G04TGGATGGGCCCACANONE 
J080045B12TGGATGGGCCCACANONE 
J080048M05TGGATGGGCCCACANONE 
J080051M16TGGATGGGCCCACANONE 
J080053K12TGGATGGGCCCACANONE 
J080056G17TGGATGGGCCCACANONE 
J080068O22TGGATGGGCCCACANONE 
J080074K04TGGATGGGCCCACANONE 
J080075B20TGGATGGGCCCACANONE 
J080077I03TGGATGGGCCCACANONE 
J080081E17TGGATGGGCCCACANONE 
J080082B08TGGATGGGCCCACANONE 
J080084I03TGGATGGGCCCACANONE 
J080092F08TGGATGGGCCCACANONE 
J090086C01TGGATGGGCCCACAConserved hypothetical protein. 
Os06g0499900J065053E01CGATGGGCCGGCCGATGGGCTNONE 
J065078C19CGATGGGCCGGCCGATGGGCTNONE 
J065122P11CGATGGGCCGGCCGATGGGCTNONE 
J065209B15CGATGGGCCGGCCGATGGGCTNONE 
J065218E19CGATGGGCCGGCCGATGGGCTNONE 
Os06g0542300J100050D16TTGGCCCATCAHeavy metal transport/detoxification protein domain containing protein. 
J100052L04TTGGCCCATCANONE 
Os06g0543400AK065374TGATGGGCCTCSimilar to CBL-interacting serine/threonine-protein kinase 11 (EC 2.7.1.37) (SOS2-like protein kinase PKS5) (SOS-interacting protein 4) (SNF1- related kinase 3.22). 
J065019L09TGATGGGCCTCNONE 
J065041F08TGATGGGCCTCNONE 
J065081P20TGATGGGCCTCNONE 
J065087C11TGATGGGCCTCNONE 
J065136F12TGATGGGCCTCNONE 
J065152F17TGATGGGCCTCNONE 
J065152M10TGATGGGCCTCNONE 
J065168F13TGATGGGCCTCNONE 
J065169K12TGATGGGCCTCNONE 
J065171C10TGATGGGCCTCNONE 
J065180B14TGATGGGCCTCNONE 
J090014B17TGATGGGCCTCNONE 
Os06g0547900AK100950CGATGGGCCTTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK100950TACGGCCCATCASimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK100950TTTCGGCCCATCTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665CGATGGGCCTTNONE 
AK105665TACGGCCCATCANONE 
AK105665TTTCGGCCCATCTNONE 
J023139I22CGATGGGCCTTNONE 
J023139I22TACGGCCCATCANONE 
J023139I22TTTCGGCCCATCTNONE 
J090066J10CGATGGGCCTTNONE 
J090066J10TACGGCCCATCANONE 
J090066J10TTTCGGCCCATCTNONE 
Y13437CGATGGGCCTTNONE 
Y13437TACGGCCCATCANONE 
Y13437TTTCGGCCCATCTNONE 
Os06g0560400AK103575GCCGGCCCATCGNONE 
AK108074GCCGGCCCATCGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0573700015-015-F02GGATGGGCCAGNONE 
015-015-F02TTATGGGCCCATCCANONE 
AK106254GGATGGGCCAGConserved hypothetical protein. 
AK106254TTATGGGCCCATCCAConserved hypothetical protein. 
J065172G24GGATGGGCCAGNONE 
J065172G24TTATGGGCCCATCCANONE 
Os06g0581300AK070987TGATGGGCCCTProtein of unknown function DUF1475 family protein. 
AK073185TGATGGGCCCTNONE 
J065209C10TGATGGGCCCTNONE 
J075060B03TGATGGGCCCTNONE 
J075117M08TGATGGGCCCTNONE 
J075126E04TGATGGGCCCTNONE 
J075189G04TGATGGGCCCTNONE 
J075189L16TGATGGGCCCTNONE 
J100061E16TGATGGGCCCTNONE 
Os06g0625500006-034-A05CGGGCCCATCCNONE 
AK058459CGGGCCCATCCSimilar to Thioredoxin peroxidase. 
AK068955CGGGCCCATCCNONE 
AK104130CGGGCCCATCCNONE 
J023003C09CGGGCCCATCCNONE 
J033043I02CGGGCCCATCCNONE 
J065063E05CGGGCCCATCCNONE 
J065190D24CGGGCCCATCCNONE 
J065198I01CGGGCCCATCCNONE 
J075107A02CGGGCCCATCCNONE 
Os06g0647900AK073750CCAGCCCAGATGGGCCACConserved hypothetical protein. 
J033029K17CCAGCCCAGATGGGCCACNONE 
J033070L21CCAGCCCAGATGGGCCACNONE 
Os06g0648200009-150-E06TGGATGGGCCGAGNONE 
014-034-H10TGGATGGGCCGAGNONE 
015-035-E11TGGATGGGCCGAGNONE 
AK063001TGGATGGGCCGAGNONE 
AK063675TGGATGGGCCGAGNONE 
AK106303TGGATGGGCCGAGConserved hypothetical protein. 
Os06g0663600AK100787AGATGGGCCGAGATEndonuclease V family protein. 
AK100787GTGGCCCATCCEndonuclease V family protein. 
Os06g0670100AK102577CTGGCCCATCAHypothetical protein. 
Os06g0678200AK059456CCAGGCCCATCGNONE 
AK071299CCAGGCCCATCGSimilar to Geranyl diphosphate synthase. 
Os06g0681000009-105-G11AGATGGGCCTGNONE 
009-105-G11GGATGGGCCTANONE 
AK062780AGATGGGCCTGConserved hypothetical protein. 
AK062780GGATGGGCCTAConserved hypothetical protein. 
J100021E01AGATGGGCCTGNONE 
J100021E01GGATGGGCCTANONE 
Os06g0688100AK063450AGATGGGCCCTNONE 
AK063450CAGGCCCATCANONE 
AK101144AGATGGGCCCTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
AK101144CAGGCCCATCARNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0708900AK100402TCGGCCCATCAConserved hypothetical protein. 
Os06g0727400AK069558AGATGGGCCAGSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0110800009-107-B11GGCCCGGCCCATCANONE 
AK062792GGCCCGGCCCATCAConserved hypothetical protein. 
J053026P09GGCCCGGCCCATCANONE 
J053074L17GGCCCGGCCCATCANONE 
J065057E24GGCCCGGCCCATCANONE 
J065149B18GGCCCGGCCCATCANONE 
J075002O20GGCCCGGCCCATCANONE 
J090002C13GGCCCGGCCCATCANONE 
Os07g0110900AK058987TGATGGGCCGGGCCConserved hypothetical protein. 
J065032L02TGATGGGCCGGGCCNONE 
J065074H06TGATGGGCCGGGCCNONE 
J065168M23TGATGGGCCGGGCCNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0113200AK108787GGCCCGGCCCATCAConserved hypothetical protein. 
J065090J04GGCCCGGCCCATCANONE 
J065116K24GGCCCGGCCCATCANONE 
J065161F14GGCCCGGCCCATCANONE 
J065203E23GGCCCGGCCCATCANONE 
Os07g0150200009-152-C07AGATGGGCCGGCCCATGTNONE 
009-152-C07CTCGGCCCATCANONE 
009-152-C07TGATGGGCCTCNONE 
AK058680AGATGGGCCGGCCCATGTNONE 
AK058680CTCGGCCCATCANONE 
AK058680TGATGGGCCTCNONE 
AK121635AGATGGGCCGGCCCATGTSimilar to 40S ribosomal protein S12-1. 
AK121635CTCGGCCCATCASimilar to 40S ribosomal protein S12-1. 
AK121635TGATGGGCCTCSimilar to 40S ribosomal protein S12-1. 
J033051C16AGATGGGCCGGCCCATGTNONE 
J033051C16CTCGGCCCATCANONE 
J033051C16TGATGGGCCTCNONE 
J033123H15AGATGGGCCGGCCCATGTNONE 
J033123H15CTCGGCCCATCANONE 
J033123H15TGATGGGCCTCNONE 
J065093I01AGATGGGCCGGCCCATGTNONE 
J065093I01CTCGGCCCATCANONE 
J065093I01TGATGGGCCTCNONE 
J065197C05AGATGGGCCGGCCCATGTNONE 
J065197C05CTCGGCCCATCANONE 
J065197C05TGATGGGCCTCNONE 
J075037B11AGATGGGCCGGCCCATGTNONE 
J075037B11CTCGGCCCATCANONE 
J075037B11TGATGGGCCTCNONE 
J075114B08AGATGGGCCGGCCCATGTNONE 
J075114B08CTCGGCCCATCANONE 
J075114B08TGATGGGCCTCNONE 
J075123N01AGATGGGCCGGCCCATGTNONE 
J075123N01CTCGGCCCATCANONE 
J075123N01TGATGGGCCTCNONE 
J075129O04AGATGGGCCGGCCCATGTNONE 
J075129O04CTCGGCCCATCANONE 
J075129O04TGATGGGCCTCNONE 
J075160H17AGATGGGCCGGCCCATGTNONE 
J075160H17CTCGGCCCATCANONE 
J075160H17TGATGGGCCTCNONE 
J075166H17AGATGGGCCGGCCCATGTNONE 
J075166H17CTCGGCCCATCANONE 
J075166H17TGATGGGCCTCNONE 
J080310F11AGATGGGCCGGCCCATGTNONE 
J080310F11CTCGGCCCATCANONE 
J080310F11TGATGGGCCTCNONE 
J080315P11AGATGGGCCGGCCCATGTNONE 
J080315P11CTCGGCCCATCANONE 
J080315P11TGATGGGCCTCNONE 
J090025A22AGATGGGCCGGCCCATGTNONE 
J090025A22CTCGGCCCATCANONE 
J090025A22TGATGGGCCTCNONE 
Os07g0154300009-070-E08TAGGCCCATCCNONE 
009-077-E01TAGGCCCATCCNONE 
009-196-F05TAGGCCCATCCNONE 
AK105386TAGGCCCATCCConserved hypothetical protein. 
AK122093TAGGCCCATCCNONE 
J033124K14TAGGCCCATCCNONE 
J075006I22TAGGCCCATCCNONE 
J075185G02TAGGCCCATCCNONE 
J090039C02TAGGCCCATCCNONE 
Os07g0169600006-027-F04AGATGGGCCGTTGNONE 
006-043-C10AGATGGGCCGTTGNONE 
006-070-A04AGATGGGCCGTTGNONE 
006-081-F03AGATGGGCCGTTGNONE 
006-104-F02AGATGGGCCGTTGNONE 
012-006-D12AGATGGGCCGTTGNONE 
AK060318AGATGGGCCGTTGNONE 
AK121818AGATGGGCCGTTG2OG-Fe(II) oxygenase domain containing protein. 
J023065K01AGATGGGCCGTTGNONE 
J023086G17AGATGGGCCGTTGNONE 
J023093G16AGATGGGCCGTTGNONE 
J033024N04AGATGGGCCGTTGNONE 
J033099A15AGATGGGCCGTTGNONE 
J033107B14AGATGGGCCGTTGNONE 
J043026F14AGATGGGCCGTTGNONE 
J065043P20AGATGGGCCGTTGNONE 
J075118L16AGATGGGCCGTTGNONE 
J075162M22AGATGGGCCGTTGNONE 
J080004K13AGATGGGCCGTTGNONE 
J080024D10AGATGGGCCGTTGNONE 
J080037C21AGATGGGCCGTTGNONE 
J080039M17AGATGGGCCGTTGNONE 
J080040A03AGATGGGCCGTTGNONE 
J080044A07AGATGGGCCGTTGNONE 
J080045I07AGATGGGCCGTTGNONE 
J080052L06AGATGGGCCGTTGNONE 
J080053A20AGATGGGCCGTTGNONE 
J080060L15AGATGGGCCGTTGNONE 
J080060N22AGATGGGCCGTTGNONE 
J080062L23AGATGGGCCGTTGNONE 
J080069B19AGATGGGCCGTTGNONE 
J080086K15AGATGGGCCGTTGNONE 
J080089H16AGATGGGCCGTTGNONE 
J080089I23AGATGGGCCGTTGNONE 
J080094P07AGATGGGCCGTTGNONE 
J090032L18AGATGGGCCGTTGNONE 
J100044E09AGATGGGCCGTTGNONE 
J100045O03AGATGGGCCGTTGNONE 
J100066B11AGATGGGCCGTTGNONE 
J100069J24AGATGGGCCGTTGNONE 
Os07g0180900006-055-B11GACGGCCCATCTNONE 
006-103-F09GACGGCCCATCTNONE 
011-009-E03GACGGCCCATCTNONE 
011-035-H08GACGGCCCATCTNONE 
014-043-F08GACGGCCCATCTNONE 
AK060711GACGGCCCATCTRibosomal protein L4/L1e family protein. 
AK060963GACGGCCCATCTNONE 
AK104447GACGGCCCATCTNONE 
AK104504GACGGCCCATCTNONE 
AK104629GACGGCCCATCTNONE 
J023003P15GACGGCCCATCTNONE 
J023075H14GACGGCCCATCTNONE 
J033101N17GACGGCCCATCTNONE 
J033132M11GACGGCCCATCTNONE 
J065081C24GACGGCCCATCTNONE 
J080004L10GACGGCCCATCTNONE 
J080009H21GACGGCCCATCTNONE 
J080013F01GACGGCCCATCTNONE 
J080022K24GACGGCCCATCTNONE 
J080023C22GACGGCCCATCTNONE 
J080024M16GACGGCCCATCTNONE 
J080026K06GACGGCCCATCTNONE 
J080030J23GACGGCCCATCTNONE 
J080030L05GACGGCCCATCTNONE 
J080031G03GACGGCCCATCTNONE 
J080033C03GACGGCCCATCTNONE 
J080033D02GACGGCCCATCTNONE 
J080035A11GACGGCCCATCTNONE 
J080035A14GACGGCCCATCTNONE 
J080039E08GACGGCCCATCTNONE 
J080040L15GACGGCCCATCTNONE 
J080040M03GACGGCCCATCTNONE 
J080041L21GACGGCCCATCTNONE 
J080043E09GACGGCCCATCTNONE 
J080048B14GACGGCCCATCTNONE 
J080048O09GACGGCCCATCTNONE 
J080051H01GACGGCCCATCTNONE 
J080052H06GACGGCCCATCTNONE 
J080065K05GACGGCCCATCTNONE 
J080066D10GACGGCCCATCTNONE 
J080066E23GACGGCCCATCTNONE 
J080069F10GACGGCCCATCTNONE 
J080074M06GACGGCCCATCTNONE 
J080075D13GACGGCCCATCTNONE 
J080076G02GACGGCCCATCTNONE 
J080082G15GACGGCCCATCTNONE 
J080082K06GACGGCCCATCTNONE 
J080082P12GACGGCCCATCTNONE 
J080085F01GACGGCCCATCTNONE 
J080090H22GACGGCCCATCTNONE 
J080092D07GACGGCCCATCTNONE 
J080094M03GACGGCCCATCTNONE 
J080094O10GACGGCCCATCTNONE 
J090008I06GACGGCCCATCTNONE 
J100058N20GACGGCCCATCTNONE 
J100060M07GACGGCCCATCTNONE 
J100062M08GACGGCCCATCTNONE 
J100064L07GACGGCCCATCTNONE 
J100073H16GACGGCCCATCTNONE 
J100074C10GACGGCCCATCTNONE 
J100075N06GACGGCCCATCTNONE 
J100087P11GACGGCCCATCTNONE 
J100088B13GACGGCCCATCTNONE 
J100088J16GACGGCCCATCTNONE 
J100088L17GACGGCCCATCTNONE 
J100088O12GACGGCCCATCTNONE 
Os07g0185700012-040-A11AGGGCCCACGGGCCCATCGNONE 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
J065116D10AGGGCCCACGGGCCCATCGNONE 
J065122F20AGGGCCCACGGGCCCATCGNONE 
Os07g0205000009-018-A12AGATGGGCCGGCCCATCGGCCCATCANONE 
AK103963AGATGGGCCGGCCCATCGGCCCATCANONE 
AK121368AGATGGGCCGGCCCATCGGCCCATCANONE 
J023001M20AGATGGGCCGGCCCATCGGCCCATCANONE 
J023125I03AGATGGGCCGGCCCATCGGCCCATCANONE 
J053034L22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065078A21AGATGGGCCGGCCCATCGGCCCATCANONE 
J065089G24AGATGGGCCGGCCCATCGGCCCATCANONE 
J065096G23AGATGGGCCGGCCCATCGGCCCATCANONE 
J065103N06AGATGGGCCGGCCCATCGGCCCATCANONE 
J065146J22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065159K18AGATGGGCCGGCCCATCGGCCCATCANONE 
J065204L04AGATGGGCCGGCCCATCGGCCCATCANONE 
J065207N07AGATGGGCCGGCCCATCGGCCCATCANONE 
J065208E24AGATGGGCCGGCCCATCGGCCCATCANONE 
J075057F19AGATGGGCCGGCCCATCGGCCCATCANONE 
J075058K01AGATGGGCCGGCCCATCGGCCCATCANONE 
J075072H13AGATGGGCCGGCCCATCGGCCCATCANONE 
J080003D08AGATGGGCCGGCCCATCGGCCCATCANONE 
J080025F02AGATGGGCCGGCCCATCGGCCCATCANONE 
Os07g0243200AK121036CCCACTCTTCTCGGCCCATCGSimilar to ADP-glucose pyrophosphorylase large subunit 2 (EC 2.7.7.27) (Fragment). 
D21272CCCACTCTTCTCGGCCCATCGNONE 
Os07g0435400AK111603TTTCGGCCCATCTSimilar to WD40. 
Os07g0448800003-112-B05AAGGCCCATCCANONE 
003-118-A02AAGGCCCATCCANONE 
006-029-E09AAGGCCCATCCANONE 
006-056-F11AAGGCCCATCCANONE 
006-081-F01AAGGCCCATCCANONE 
006-084-H12AAGGCCCATCCANONE 
006-094-A12AAGGCCCATCCANONE 
006-095-C01AAGGCCCATCCANONE 
006-098-F09AAGGCCCATCCANONE 
009-151-B09AAGGCCCATCCANONE 
009-169-C08AAGGCCCATCCANONE 
009-172-F09AAGGCCCATCCANONE 
009-200-H03AAGGCCCATCCANONE 
011-008-B03AAGGCCCATCCANONE 
011-035-C10AAGGCCCATCCANONE 
011-041-G11AAGGCCCATCCANONE 
011-059-H01AAGGCCCATCCANONE 
011-071-D12AAGGCCCATCCANONE 
013-010-E11AAGGCCCATCCANONE 
013-015-B06AAGGCCCATCCANONE 
013-028-A11AAGGCCCATCCANONE 
013-037-A04AAGGCCCATCCANONE 
013-057-B07AAGGCCCATCCANONE 
014-041-D03AAGGCCCATCCANONE 
014-073-G04AAGGCCCATCCANONE 
014-093-D10AAGGCCCATCCANONE 
016-030-F03AAGGCCCATCCANONE 
016-034-B08AAGGCCCATCCANONE 
016-064-D05AAGGCCCATCCANONE 
AB029446AAGGCCCATCCANONE 
AF062393AAGGCCCATCCANONE 
AK072519AAGGCCCATCCAAquaporin. 
AK103938AAGGCCCATCCANONE 
AK103970AAGGCCCATCCANONE 
AK119656AAGGCCCATCCANONE 
J023026N01AAGGCCCATCCANONE 
J023055M16AAGGCCCATCCANONE 
J023063J21AAGGCCCATCCANONE 
J023128K12AAGGCCCATCCANONE 
J065041P10AAGGCCCATCCANONE 
J065134L07AAGGCCCATCCANONE 
J075198L17AAGGCCCATCCANONE 
J090031G17AAGGCCCATCCANONE 
J090032B21AAGGCCCATCCANONE 
J090032D13AAGGCCCATCCANONE 
J090057J22AAGGCCCATCCANONE 
J090062J02AAGGCCCATCCANONE 
J100028J09AAGGCCCATCCANONE 
J100053C06AAGGCCCATCCANONE 
J100056I11AAGGCCCATCCANONE 
J100067E10AAGGCCCATCCANONE 
Os07g0486000AK069343GGATGGGCCAGASimilar to MSH4. 
Os07g0513200015-004-B02TTGGCCCATCANONE 
AK101410TTGGCCCATCANONE 
AK106227TTGGCCCATCANONE 
AK119451TTGGCCCATCAProtein prenyltransferase domain containing protein. 
Os07g0558400003-103-C02TGGGGCCCATCCACCNONE 
003-115-G05TGGGGCCCATCCACCNONE 
006-025-B09TGGGGCCCATCCACCNONE 
006-025-G10TGGGGCCCATCCACCNONE 
006-027-E03TGGGGCCCATCCACCNONE 
006-036-C06TGGGGCCCATCCACCNONE 
006-045-B10TGGGGCCCATCCACCNONE 
006-051-H11TGGGGCCCATCCACCNONE 
006-053-H03TGGGGCCCATCCACCNONE 
006-057-B09TGGGGCCCATCCACCNONE 
006-062-C10TGGGGCCCATCCACCNONE 
006-075-B12TGGGGCCCATCCACCNONE 
006-079-F01TGGGGCCCATCCACCNONE 
006-082-D08TGGGGCCCATCCACCNONE 
006-087-F04TGGGGCCCATCCACCNONE 
006-089-E09TGGGGCCCATCCACCNONE 
006-090-C04TGGGGCCCATCCACCNONE 
006-091-H05TGGGGCCCATCCACCNONE 
006-093-E02TGGGGCCCATCCACCNONE 
006-093-E06TGGGGCCCATCCACCNONE 
006-093-H05TGGGGCCCATCCACCNONE 
006-095-C05TGGGGCCCATCCACCNONE 
006-097-B04TGGGGCCCATCCACCNONE 
006-097-C07TGGGGCCCATCCACCNONE 
006-097-D02TGGGGCCCATCCACCNONE 
006-097-H10TGGGGCCCATCCACCNONE 
006-098-C05TGGGGCCCATCCACCNONE 
006-099-H09TGGGGCCCATCCACCNONE 
006-104-B06TGGGGCCCATCCACCNONE 
006-105-B11TGGGGCCCATCCACCNONE 
006-106-E12TGGGGCCCATCCACCNONE 
006-107-B06TGGGGCCCATCCACCNONE 
006-109-A09TGGGGCCCATCCACCNONE 
006-112-D05TGGGGCCCATCCACCNONE 
006-118-C12TGGGGCCCATCCACCNONE 
006-118-E10TGGGGCCCATCCACCNONE 
006-120-D05TGGGGCCCATCCACCNONE 
006-120-E08TGGGGCCCATCCACCNONE 
009-055-D12TGGGGCCCATCCACCNONE 
009-108-E05TGGGGCCCATCCACCNONE 
009-125-H05TGGGGCCCATCCACCNONE 
009-150-A07TGGGGCCCATCCACCNONE 
009-198-C07TGGGGCCCATCCACCNONE 
AF058796TGGGGCCCATCCACCNONE 
AK058293TGGGGCCCATCCACCNONE 
AK098992TGGGGCCCATCCACCNONE 
AK103924TGGGGCCCATCCACCNONE 
AK104309TGGGGCCCATCCACCNONE 
AK104619TGGGGCCCATCCACCNONE 
AK119534TGGGGCCCATCCACCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13TGGGGCCCATCCACCNONE 
J043039O11TGGGGCCCATCCACCNONE 
J065176D03TGGGGCCCATCCACCNONE 
J075022K10TGGGGCCCATCCACCNONE 
J075065A02TGGGGCCCATCCACCNONE 
J075077D23TGGGGCCCATCCACCNONE 
J075088P15TGGGGCCCATCCACCNONE 
J075125D24TGGGGCCCATCCACCNONE 
J075125H11TGGGGCCCATCCACCNONE 
J075192H21TGGGGCCCATCCACCNONE 
J090080H18TGGGGCCCATCCACCNONE 
Os07g0582400003-104-B09AGATGGGCCCACACGNONE 
AK059423AGATGGGCCCACACGNONE 
AK102676AGATGGGCCCACACGNONE 
J065001F09AGATGGGCCCACACGNONE 
J065005K22AGATGGGCCCACACGNONE 
J065006D10AGATGGGCCCACACGNONE 
J065006P17AGATGGGCCCACACGNONE 
J065015G23AGATGGGCCCACACGNONE 
J065020F21AGATGGGCCCACACGNONE 
J065028I05AGATGGGCCCACACGNONE 
J065042N09AGATGGGCCCACACGNONE 
J065043P03AGATGGGCCCACACGNONE 
J065059E15AGATGGGCCCACACGNONE 
J065090I12AGATGGGCCCACACGNONE 
J065130I02AGATGGGCCCACACGNONE 
J065131P05AGATGGGCCCACACGNONE 
J065163I24AGATGGGCCCACACGNONE 
J065168I21AGATGGGCCCACACGNONE 
J065174A12AGATGGGCCCACACGNONE 
J065178K16AGATGGGCCCACACGNONE 
J065182P03AGATGGGCCCACACGNONE 
J065186B07AGATGGGCCCACACGNONE 
J065189M13AGATGGGCCCACACGNONE 
J065208J22AGATGGGCCCACACGNONE 
J065211E11AGATGGGCCCACACGNONE 
J075054E08AGATGGGCCCACACGNONE 
J075067K14AGATGGGCCCACACGNONE 
J075104E20AGATGGGCCCACACGNONE 
J075152M07AGATGGGCCCACACGNONE 
Os07g0595700003-103-G05CGATGGGCCACACGNONE 
AK108488CGATGGGCCACACGConserved hypothetical protein. 
J065136O05CGATGGGCCACACGNONE 
Os07g0595800011-069-G09CGTGTGGCCCATCGNONE 
AK066349CGTGTGGCCCATCGPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05CGTGTGGCCCATCGNONE 
Os07g0606500AK068811TGATGGGCCTCNONE 
AK121873TGATGGGCCTCNONE 
J013159C05TGATGGGCCTCNONE 
J075158B14TGATGGGCCTCNONE 
Os07g0608400AK109447CGATGGGCCGGGGCCCACCASimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0616900AK071047TGGATGGGCCAAProtein of unknown function DUF500 family protein. 
J013106G03TGGATGGGCCAANONE 
J013124C20TGGATGGGCCAANONE 
J033096D16TGGATGGGCCAANONE 
J043005E08TGGATGGGCCAANONE 
J065197K12TGGATGGGCCAANONE 
J065211I03TGGATGGGCCAANONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0659500AK073537GAGGCCCATCCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
AK073537TGGATGGGCCTANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0668200AK059051CAACGGCCCATCANONE 
AK101682CAACGGCCCATCAConserved hypothetical protein. 
AK102839CAACGGCCCATCANONE 
Os07g0680300009-195-E06TCCGGCCCATCTNONE 
AK063800TCCGGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCCGGCCCATCTNONE 
J075066A20TCCGGCCCATCTNONE 
J075088I17TCCGGCCCATCTNONE 
J075147M19TCCGGCCCATCTNONE 
J075153L02TCCGGCCCATCTNONE 
J080013A21TCCGGCCCATCTNONE 
J080051B13TCCGGCCCATCTNONE 
J080077I24TCCGGCCCATCTNONE 
J080302B14TCCGGCCCATCTNONE 
J080309D22TCCGGCCCATCTNONE 
J100083B16TCCGGCCCATCTNONE 
Os07g0681500AK100010TGATGGGCCAANONE 
Os07g0688300AK068325GGATGGGCCGASimilar to Importin alpha 1. 
AK099611GGATGGGCCGANONE 
Os07g0695100AB189039AGATGGGCCGGATAGGCCCAGANONE 
AB189042AGATGGGCCGGATAGGCCCAGANONE 
AK059514AGATGGGCCGGATAGGCCCAGANONE 
AK066112AGATGGGCCGGATAGGCCCAGACheY-like domain containing protein. 
J013051N02AGATGGGCCGGATAGGCCCAGANONE 
J013127M02AGATGGGCCGGATAGGCCCAGANONE 
J023007I05AGATGGGCCGGATAGGCCCAGANONE 
Os08g0116500009-007-E05AGGGCCCATCTNONE 
009-074-C07AGGGCCCATCTNONE 
009-098-A07AGGGCCCATCTNONE 
009-100-C03AGGGCCCATCTNONE 
009-136-E04AGGGCCCATCTNONE 
009-138-B08AGGGCCCATCTNONE 
009-144-B06AGGGCCCATCTNONE 
009-184-E04AGGGCCCATCTNONE 
009-189-F01AGGGCCCATCTNONE 
013-006-E05AGGGCCCATCTNONE 
013-015-C10AGGGCCCATCTNONE 
013-019-F09AGGGCCCATCTNONE 
013-020-C01AGGGCCCATCTNONE 
013-021-F05AGGGCCCATCTNONE 
013-035-D08AGGGCCCATCTNONE 
013-038-C09AGGGCCCATCTNONE 
013-054-B07AGGGCCCATCTNONE 
013-061-G10AGGGCCCATCTNONE 
013-074-B01AGGGCCCATCTNONE 
013-079-B06AGGGCCCATCTNONE 
013-099-B09AGGGCCCATCTNONE 
013-099-G11AGGGCCCATCTNONE 
014-023-F04AGGGCCCATCTNONE 
014-032-C07AGGGCCCATCTNONE 
014-045-E02AGGGCCCATCTNONE 
014-085-C02AGGGCCCATCTNONE 
014-087-F04AGGGCCCATCTNONE 
014-089-C04AGGGCCCATCTNONE 
014-090-E01AGGGCCCATCTNONE 
014-094-G11AGGGCCCATCTNONE 
014-097-B07AGGGCCCATCTNONE 
015-024-A12AGGGCCCATCTNONE 
015-032-C06AGGGCCCATCTNONE 
016-053-E09AGGGCCCATCTNONE 
016-081-F10AGGGCCCATCTNONE 
AK058240AGGGCCCATCTSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09AGGGCCCATCTNONE 
J023107O19AGGGCCCATCTNONE 
J053029K21AGGGCCCATCTNONE 
J053073P11AGGGCCCATCTNONE 
J053074B04AGGGCCCATCTNONE 
J053078M14AGGGCCCATCTNONE 
J065001E12AGGGCCCATCTNONE 
J065006J12AGGGCCCATCTNONE 
J065015C06AGGGCCCATCTNONE 
J065025D13AGGGCCCATCTNONE 
J065029A04AGGGCCCATCTNONE 
J065031D23AGGGCCCATCTNONE 
J065032E24AGGGCCCATCTNONE 
J065034P16AGGGCCCATCTNONE 
J065043B04AGGGCCCATCTNONE 
J065044A15AGGGCCCATCTNONE 
J065062D18AGGGCCCATCTNONE 
J065079G13AGGGCCCATCTNONE 
J065080A19AGGGCCCATCTNONE 
J065080A20AGGGCCCATCTNONE 
J065089N19AGGGCCCATCTNONE 
J065111O07AGGGCCCATCTNONE 
J065115N15AGGGCCCATCTNONE 
J065131A04AGGGCCCATCTNONE 
J065138H02AGGGCCCATCTNONE 
J065139K10AGGGCCCATCTNONE 
J065144A02AGGGCCCATCTNONE 
J065155J17AGGGCCCATCTNONE 
J065159D18AGGGCCCATCTNONE 
J065159I18AGGGCCCATCTNONE 
J065167H12AGGGCCCATCTNONE 
J065174C22AGGGCCCATCTNONE 
J065184A05AGGGCCCATCTNONE 
J065188M15AGGGCCCATCTNONE 
J065191D23AGGGCCCATCTNONE 
J065203C07AGGGCCCATCTNONE 
J065207C23AGGGCCCATCTNONE 
J065207L16AGGGCCCATCTNONE 
J065212F01AGGGCCCATCTNONE 
J065212F05AGGGCCCATCTNONE 
J075037B07AGGGCCCATCTNONE 
J075042F15AGGGCCCATCTNONE 
J075059J03AGGGCCCATCTNONE 
J075068M18AGGGCCCATCTNONE 
J075079E13AGGGCCCATCTNONE 
J075081F12AGGGCCCATCTNONE 
J075083I05AGGGCCCATCTNONE 
J075123K23AGGGCCCATCTNONE 
J075142F16AGGGCCCATCTNONE 
J075156N03AGGGCCCATCTNONE 
J075162K05AGGGCCCATCTNONE 
J075171E08AGGGCCCATCTNONE 
J075177N03AGGGCCCATCTNONE 
J075182K17AGGGCCCATCTNONE 
J075186K02AGGGCCCATCTNONE 
J075191K05AGGGCCCATCTNONE 
J080011E10AGGGCCCATCTNONE 
J080016M21AGGGCCCATCTNONE 
J080017A17AGGGCCCATCTNONE 
J080031O09AGGGCCCATCTNONE 
J080039G21AGGGCCCATCTNONE 
J080041B01AGGGCCCATCTNONE 
J080050G20AGGGCCCATCTNONE 
J080054A12AGGGCCCATCTNONE 
J080058O08AGGGCCCATCTNONE 
J080061N04AGGGCCCATCTNONE 
J080064L23AGGGCCCATCTNONE 
J080064P05AGGGCCCATCTNONE 
J080069I17AGGGCCCATCTNONE 
J080070E07AGGGCCCATCTNONE 
J080071B20AGGGCCCATCTNONE 
J080074L08AGGGCCCATCTNONE 
J080076N08AGGGCCCATCTNONE 
J080081A14AGGGCCCATCTNONE 
J080081J17AGGGCCCATCTNONE 
J080085N14AGGGCCCATCTNONE 
J080090B09AGGGCCCATCTNONE 
J080097L11AGGGCCCATCTNONE 
J080306H13AGGGCCCATCTNONE 
J080307H13AGGGCCCATCTNONE 
J080311F12AGGGCCCATCTNONE 
J080316L23AGGGCCCATCTNONE 
J080318H02AGGGCCCATCTNONE 
J090016L15AGGGCCCATCTNONE 
J090019I02AGGGCCCATCTNONE 
J090031G21AGGGCCCATCTNONE 
J090066C15AGGGCCCATCTNONE 
J100032I02AGGGCCCATCTNONE 
J100032N07AGGGCCCATCTNONE 
J100032N16AGGGCCCATCTNONE 
J100041P21AGGGCCCATCTNONE 
J100048M04AGGGCCCATCTNONE 
J100048M14AGGGCCCATCTNONE 
J100063B08AGGGCCCATCTNONE 
J100088E20AGGGCCCATCTNONE 
J100090I08AGGGCCCATCTNONE 
Os08g0117400006-086-A09TGATGGGCCTGNONE 
006-086-A09TGATGGGCCTGANONE 
006-103-C02TGATGGGCCTGNONE 
006-103-C02TGATGGGCCTGANONE 
AK059891TGATGGGCCTGSimilar to Calmodulin 1 (Fragment). 
AK059891TGATGGGCCTGASimilar to Calmodulin 1 (Fragment). 
AK103863TGATGGGCCTGNONE 
AK103863TGATGGGCCTGANONE 
AY224521TGATGGGCCTGNONE 
AY224521TGATGGGCCTGANONE 
J033149E23TGATGGGCCTGNONE 
J033149E23TGATGGGCCTGANONE 
J065062E05TGATGGGCCTGNONE 
J065062E05TGATGGGCCTGANONE 
J065083O05TGATGGGCCTGNONE 
J065083O05TGATGGGCCTGANONE 
J065116D14TGATGGGCCTGNONE 
J065116D14TGATGGGCCTGANONE 
J065158F16TGATGGGCCTGNONE 
J065158F16TGATGGGCCTGANONE 
J065179N16TGATGGGCCTGNONE 
J065179N16TGATGGGCCTGANONE 
J065206N23TGATGGGCCTGNONE 
J065206N23TGATGGGCCTGANONE 
Os08g0124000011-023-G08TGATGGGCCACNONE 
AK063293TGATGGGCCACSimilar to Resistance protein candidate (Fragment). 
AK067378TGATGGGCCACNONE 
J090067O21TGATGGGCCACNONE 
Os08g0129200014-040-E08TGATGGGCCGANONE 
AK070034TGATGGGCCGANONE 
AK101577TGATGGGCCGASimilar to Cold shock protein-1. 
J065137A09TGATGGGCCGANONE 
J100062K14TGATGGGCCGANONE 
Os08g0130500006-024-B12AGCCCAATAAGGCCCATCTNONE 
006-032-F11AGCCCAATAAGGCCCATCTNONE 
006-047-B12AGCCCAATAAGGCCCATCTNONE 
006-058-H06AGCCCAATAAGGCCCATCTNONE 
006-062-D07AGCCCAATAAGGCCCATCTNONE 
006-083-F11AGCCCAATAAGGCCCATCTNONE 
006-084-A11AGCCCAATAAGGCCCATCTNONE 
006-096-F12AGCCCAATAAGGCCCATCTNONE 
006-105-A04AGCCCAATAAGGCCCATCTNONE 
006-110-D11AGCCCAATAAGGCCCATCTNONE 
011-022-D11AGCCCAATAAGGCCCATCTNONE 
AK064857AGCCCAATAAGGCCCATCT60S acidic ribosomal protein P0. 
D21130AGCCCAATAAGGCCCATCTNONE 
J013000H12AGCCCAATAAGGCCCATCTNONE 
J013024M17AGCCCAATAAGGCCCATCTNONE 
J013028H09AGCCCAATAAGGCCCATCTNONE 
J013045N22AGCCCAATAAGGCCCATCTNONE 
J013092K19AGCCCAATAAGGCCCATCTNONE 
J013106L12AGCCCAATAAGGCCCATCTNONE 
J013107A03AGCCCAATAAGGCCCATCTNONE 
J013109E12AGCCCAATAAGGCCCATCTNONE 
J013114N08AGCCCAATAAGGCCCATCTNONE 
J013120J12AGCCCAATAAGGCCCATCTNONE 
J013121E21AGCCCAATAAGGCCCATCTNONE 
J013135P20AGCCCAATAAGGCCCATCTNONE 
J023006J08AGCCCAATAAGGCCCATCTNONE 
J023014L16AGCCCAATAAGGCCCATCTNONE 
J023020N03AGCCCAATAAGGCCCATCTNONE 
J023027M24AGCCCAATAAGGCCCATCTNONE 
J023029D18AGCCCAATAAGGCCCATCTNONE 
J023030A14AGCCCAATAAGGCCCATCTNONE 
J023041G23AGCCCAATAAGGCCCATCTNONE 
J023049H05AGCCCAATAAGGCCCATCTNONE 
J023060I23AGCCCAATAAGGCCCATCTNONE 
J023099D07AGCCCAATAAGGCCCATCTNONE 
J023104A20AGCCCAATAAGGCCCATCTNONE 
J023105F18AGCCCAATAAGGCCCATCTNONE 
J023112D21AGCCCAATAAGGCCCATCTNONE 
J023122M18AGCCCAATAAGGCCCATCTNONE 
J023139J20AGCCCAATAAGGCCCATCTNONE 
J023149L20AGCCCAATAAGGCCCATCTNONE 
J023150G04AGCCCAATAAGGCCCATCTNONE 
J033036G02AGCCCAATAAGGCCCATCTNONE 
J033045P13AGCCCAATAAGGCCCATCTNONE 
J033046A22AGCCCAATAAGGCCCATCTNONE 
J033086H16AGCCCAATAAGGCCCATCTNONE 
J033087D07AGCCCAATAAGGCCCATCTNONE 
J033089M14AGCCCAATAAGGCCCATCTNONE 
J033095F14AGCCCAATAAGGCCCATCTNONE 
J033108M01AGCCCAATAAGGCCCATCTNONE 
J033117A17AGCCCAATAAGGCCCATCTNONE 
J033122F03AGCCCAATAAGGCCCATCTNONE 
J033126A04AGCCCAATAAGGCCCATCTNONE 
J033144D13AGCCCAATAAGGCCCATCTNONE 
J033145D13AGCCCAATAAGGCCCATCTNONE 
J043022M09AGCCCAATAAGGCCCATCTNONE 
J053025I11AGCCCAATAAGGCCCATCTNONE 
J053027K06AGCCCAATAAGGCCCATCTNONE 
J053029D15AGCCCAATAAGGCCCATCTNONE 
J053048I22AGCCCAATAAGGCCCATCTNONE 
J053055I01AGCCCAATAAGGCCCATCTNONE 
J053079P07AGCCCAATAAGGCCCATCTNONE 
J053090J23AGCCCAATAAGGCCCATCTNONE 
J053094C24AGCCCAATAAGGCCCATCTNONE 
J065023F18AGCCCAATAAGGCCCATCTNONE 
J065029I12AGCCCAATAAGGCCCATCTNONE 
J065044B18AGCCCAATAAGGCCCATCTNONE 
J065045C07AGCCCAATAAGGCCCATCTNONE 
J065063K22AGCCCAATAAGGCCCATCTNONE 
J065093D11AGCCCAATAAGGCCCATCTNONE 
J065096P09AGCCCAATAAGGCCCATCTNONE 
J065099N04AGCCCAATAAGGCCCATCTNONE 
J065103K24AGCCCAATAAGGCCCATCTNONE 
J065110H12AGCCCAATAAGGCCCATCTNONE 
J065132F24AGCCCAATAAGGCCCATCTNONE 
J065157K16AGCCCAATAAGGCCCATCTNONE 
J065185D11AGCCCAATAAGGCCCATCTNONE 
J065202E16AGCCCAATAAGGCCCATCTNONE 
J065217D07AGCCCAATAAGGCCCATCTNONE 
J075053I19AGCCCAATAAGGCCCATCTNONE 
J075055L24AGCCCAATAAGGCCCATCTNONE 
J075056H24AGCCCAATAAGGCCCATCTNONE 
J075070D02AGCCCAATAAGGCCCATCTNONE 
J075084O15AGCCCAATAAGGCCCATCTNONE 
J075090F24AGCCCAATAAGGCCCATCTNONE 
J075135E03AGCCCAATAAGGCCCATCTNONE 
J075174A01AGCCCAATAAGGCCCATCTNONE 
J075188F05AGCCCAATAAGGCCCATCTNONE 
J075192C17AGCCCAATAAGGCCCATCTNONE 
J080001B02AGCCCAATAAGGCCCATCTNONE 
J080001C08AGCCCAATAAGGCCCATCTNONE 
J080002D15AGCCCAATAAGGCCCATCTNONE 
J080002I03AGCCCAATAAGGCCCATCTNONE 
J080003E24AGCCCAATAAGGCCCATCTNONE 
J080004M10AGCCCAATAAGGCCCATCTNONE 
J080005C18AGCCCAATAAGGCCCATCTNONE 
J080006A12AGCCCAATAAGGCCCATCTNONE 
J080006F04AGCCCAATAAGGCCCATCTNONE 
J080006M11AGCCCAATAAGGCCCATCTNONE 
J080008J11AGCCCAATAAGGCCCATCTNONE 
J080008J22AGCCCAATAAGGCCCATCTNONE 
J080009F14AGCCCAATAAGGCCCATCTNONE 
J080010B12AGCCCAATAAGGCCCATCTNONE 
J080010G14AGCCCAATAAGGCCCATCTNONE 
J080010N07AGCCCAATAAGGCCCATCTNONE 
J080011D04AGCCCAATAAGGCCCATCTNONE 
J080011G10AGCCCAATAAGGCCCATCTNONE 
J080011O19AGCCCAATAAGGCCCATCTNONE 
J080013K23AGCCCAATAAGGCCCATCTNONE 
J080013M09AGCCCAATAAGGCCCATCTNONE 
J080013N12AGCCCAATAAGGCCCATCTNONE 
J080013O15AGCCCAATAAGGCCCATCTNONE 
J080014C13AGCCCAATAAGGCCCATCTNONE 
J080014D21AGCCCAATAAGGCCCATCTNONE 
J080014F08AGCCCAATAAGGCCCATCTNONE 
J080014N08AGCCCAATAAGGCCCATCTNONE 
J080014P19AGCCCAATAAGGCCCATCTNONE 
J080015L09AGCCCAATAAGGCCCATCTNONE 
J080015P15AGCCCAATAAGGCCCATCTNONE 
J080018P10AGCCCAATAAGGCCCATCTNONE 
J080020C06AGCCCAATAAGGCCCATCTNONE 
J080022C14AGCCCAATAAGGCCCATCTNONE 
J080022E01AGCCCAATAAGGCCCATCTNONE 
J080022P04AGCCCAATAAGGCCCATCTNONE 
J080022P10AGCCCAATAAGGCCCATCTNONE 
J080023B20AGCCCAATAAGGCCCATCTNONE 
J080023G19AGCCCAATAAGGCCCATCTNONE 
J080024N15AGCCCAATAAGGCCCATCTNONE 
J080025E11AGCCCAATAAGGCCCATCTNONE 
J080025G24AGCCCAATAAGGCCCATCTNONE 
J080026B01AGCCCAATAAGGCCCATCTNONE 
J080026B05AGCCCAATAAGGCCCATCTNONE 
J080027L17AGCCCAATAAGGCCCATCTNONE 
J080028K02AGCCCAATAAGGCCCATCTNONE 
J080029L23AGCCCAATAAGGCCCATCTNONE 
J080030D08AGCCCAATAAGGCCCATCTNONE 
J080031C03AGCCCAATAAGGCCCATCTNONE 
J080031K02AGCCCAATAAGGCCCATCTNONE 
J080032C16AGCCCAATAAGGCCCATCTNONE 
J080033F10AGCCCAATAAGGCCCATCTNONE 
J080033G12AGCCCAATAAGGCCCATCTNONE 
J080033K03AGCCCAATAAGGCCCATCTNONE 
J080034B03AGCCCAATAAGGCCCATCTNONE 
J080034N21AGCCCAATAAGGCCCATCTNONE 
J080034O03AGCCCAATAAGGCCCATCTNONE 
J080035G10AGCCCAATAAGGCCCATCTNONE 
J080038E14AGCCCAATAAGGCCCATCTNONE 
J080039A19AGCCCAATAAGGCCCATCTNONE 
J080039G10AGCCCAATAAGGCCCATCTNONE 
J080039J01AGCCCAATAAGGCCCATCTNONE 
J080039J09AGCCCAATAAGGCCCATCTNONE 
J080040F07AGCCCAATAAGGCCCATCTNONE 
J080040H18AGCCCAATAAGGCCCATCTNONE 
J080041E08AGCCCAATAAGGCCCATCTNONE 
J080041E16AGCCCAATAAGGCCCATCTNONE 
J080041L08AGCCCAATAAGGCCCATCTNONE 
J080042A07AGCCCAATAAGGCCCATCTNONE 
J080044E02AGCCCAATAAGGCCCATCTNONE 
J080045K03AGCCCAATAAGGCCCATCTNONE 
J080046O03AGCCCAATAAGGCCCATCTNONE 
J080047F08AGCCCAATAAGGCCCATCTNONE 
J080048H01AGCCCAATAAGGCCCATCTNONE 
J080048I05AGCCCAATAAGGCCCATCTNONE 
J080048N06AGCCCAATAAGGCCCATCTNONE 
J080050A07AGCCCAATAAGGCCCATCTNONE 
J080050B04AGCCCAATAAGGCCCATCTNONE 
J080050E21AGCCCAATAAGGCCCATCTNONE 
J080051J01AGCCCAATAAGGCCCATCTNONE 
J080051K02AGCCCAATAAGGCCCATCTNONE 
J080051L02AGCCCAATAAGGCCCATCTNONE 
J080052C20AGCCCAATAAGGCCCATCTNONE 
J080052I22AGCCCAATAAGGCCCATCTNONE 
J080052J21AGCCCAATAAGGCCCATCTNONE 
J080052K22AGCCCAATAAGGCCCATCTNONE 
J080055A05AGCCCAATAAGGCCCATCTNONE 
J080055I12AGCCCAATAAGGCCCATCTNONE 
J080056A21AGCCCAATAAGGCCCATCTNONE 
J080056N11AGCCCAATAAGGCCCATCTNONE 
J080057D02AGCCCAATAAGGCCCATCTNONE 
J080058H21AGCCCAATAAGGCCCATCTNONE 
J080058P16AGCCCAATAAGGCCCATCTNONE 
J080059M03AGCCCAATAAGGCCCATCTNONE 
J080059N17AGCCCAATAAGGCCCATCTNONE 
J080060F13AGCCCAATAAGGCCCATCTNONE 
J080060H06AGCCCAATAAGGCCCATCTNONE 
J080060J03AGCCCAATAAGGCCCATCTNONE 
J080060O09AGCCCAATAAGGCCCATCTNONE 
J080060P22AGCCCAATAAGGCCCATCTNONE 
J080061F06AGCCCAATAAGGCCCATCTNONE 
J080061H21AGCCCAATAAGGCCCATCTNONE 
J080061O13AGCCCAATAAGGCCCATCTNONE 
J080062J07AGCCCAATAAGGCCCATCTNONE 
J080063A08AGCCCAATAAGGCCCATCTNONE 
J080063F19AGCCCAATAAGGCCCATCTNONE 
J080063O18AGCCCAATAAGGCCCATCTNONE 
J080065D15AGCCCAATAAGGCCCATCTNONE 
J080066E13AGCCCAATAAGGCCCATCTNONE 
J080068L01AGCCCAATAAGGCCCATCTNONE 
J080068P07AGCCCAATAAGGCCCATCTNONE 
J080069I21AGCCCAATAAGGCCCATCTNONE 
J080070M04AGCCCAATAAGGCCCATCTNONE 
J080071E01AGCCCAATAAGGCCCATCTNONE 
J080071J08AGCCCAATAAGGCCCATCTNONE 
J080071M23AGCCCAATAAGGCCCATCTNONE 
J080072A03AGCCCAATAAGGCCCATCTNONE 
J080072G18AGCCCAATAAGGCCCATCTNONE 
J080075A04AGCCCAATAAGGCCCATCTNONE 
J080075E19AGCCCAATAAGGCCCATCTNONE 
J080075P18AGCCCAATAAGGCCCATCTNONE 
J080076N11AGCCCAATAAGGCCCATCTNONE 
J080077A11AGCCCAATAAGGCCCATCTNONE 
J080077D22AGCCCAATAAGGCCCATCTNONE 
J080077H18AGCCCAATAAGGCCCATCTNONE 
J080077L03AGCCCAATAAGGCCCATCTNONE 
J080078D02AGCCCAATAAGGCCCATCTNONE 
J080078L05AGCCCAATAAGGCCCATCTNONE 
J080078N20AGCCCAATAAGGCCCATCTNONE 
J080079I20AGCCCAATAAGGCCCATCTNONE 
J080081D04AGCCCAATAAGGCCCATCTNONE 
J080082A07AGCCCAATAAGGCCCATCTNONE 
J080082E24AGCCCAATAAGGCCCATCTNONE 
J080084A22AGCCCAATAAGGCCCATCTNONE 
J080084E15AGCCCAATAAGGCCCATCTNONE 
J080084G06AGCCCAATAAGGCCCATCTNONE 
J080086A05AGCCCAATAAGGCCCATCTNONE 
J080086F09AGCCCAATAAGGCCCATCTNONE 
J080087B11AGCCCAATAAGGCCCATCTNONE 
J080087H12AGCCCAATAAGGCCCATCTNONE 
J080088I05AGCCCAATAAGGCCCATCTNONE 
J080088N08AGCCCAATAAGGCCCATCTNONE 
J080088P07AGCCCAATAAGGCCCATCTNONE 
J080089A09AGCCCAATAAGGCCCATCTNONE 
J080089D21AGCCCAATAAGGCCCATCTNONE 
J080089F24AGCCCAATAAGGCCCATCTNONE 
J080089H22AGCCCAATAAGGCCCATCTNONE 
J080089I04AGCCCAATAAGGCCCATCTNONE 
J080090D01AGCCCAATAAGGCCCATCTNONE 
J080091F09AGCCCAATAAGGCCCATCTNONE 
J080091G18AGCCCAATAAGGCCCATCTNONE 
J080091L24AGCCCAATAAGGCCCATCTNONE 
J080091M12AGCCCAATAAGGCCCATCTNONE 
J080091N12AGCCCAATAAGGCCCATCTNONE 
J080093A15AGCCCAATAAGGCCCATCTNONE 
J080093C08AGCCCAATAAGGCCCATCTNONE 
J080093I08AGCCCAATAAGGCCCATCTNONE 
J080093P21AGCCCAATAAGGCCCATCTNONE 
J080094E18AGCCCAATAAGGCCCATCTNONE 
J080094F15AGCCCAATAAGGCCCATCTNONE 
J080094J21AGCCCAATAAGGCCCATCTNONE 
J080095A09AGCCCAATAAGGCCCATCTNONE 
J080096G05AGCCCAATAAGGCCCATCTNONE 
J080096K07AGCCCAATAAGGCCCATCTNONE 
J080097M17AGCCCAATAAGGCCCATCTNONE 
J080097P21AGCCCAATAAGGCCCATCTNONE 
J080302B15AGCCCAATAAGGCCCATCTNONE 
J080306J15AGCCCAATAAGGCCCATCTNONE 
J080306O13AGCCCAATAAGGCCCATCTNONE 
J080307C15AGCCCAATAAGGCCCATCTNONE 
J080307I04AGCCCAATAAGGCCCATCTNONE 
J080307L05AGCCCAATAAGGCCCATCTNONE 
J080308F11AGCCCAATAAGGCCCATCTNONE 
J080311C04AGCCCAATAAGGCCCATCTNONE 
J080311I07AGCCCAATAAGGCCCATCTNONE 
J080312C01AGCCCAATAAGGCCCATCTNONE 
J080312O08AGCCCAATAAGGCCCATCTNONE 
J080315F14AGCCCAATAAGGCCCATCTNONE 
J080318K13AGCCCAATAAGGCCCATCTNONE 
J080319A17AGCCCAATAAGGCCCATCTNONE 
J090001I01AGCCCAATAAGGCCCATCTNONE 
J090002O18AGCCCAATAAGGCCCATCTNONE 
J090007A08AGCCCAATAAGGCCCATCTNONE 
J090007F22AGCCCAATAAGGCCCATCTNONE 
J090008D09AGCCCAATAAGGCCCATCTNONE 
J090008L07AGCCCAATAAGGCCCATCTNONE 
J090008O08AGCCCAATAAGGCCCATCTNONE 
J090012N11AGCCCAATAAGGCCCATCTNONE 
J090013M05AGCCCAATAAGGCCCATCTNONE 
J090020E08AGCCCAATAAGGCCCATCTNONE 
J090020O20AGCCCAATAAGGCCCATCTNONE 
J090021I10AGCCCAATAAGGCCCATCTNONE 
J090023D07AGCCCAATAAGGCCCATCTNONE 
J090023K22AGCCCAATAAGGCCCATCTNONE 
J090023O08AGCCCAATAAGGCCCATCTNONE 
J090028D21AGCCCAATAAGGCCCATCTNONE 
J090029H14AGCCCAATAAGGCCCATCTNONE 
J090029L12AGCCCAATAAGGCCCATCTNONE 
J090030C05AGCCCAATAAGGCCCATCTNONE 
J090031D18AGCCCAATAAGGCCCATCTNONE 
J090032G10AGCCCAATAAGGCCCATCTNONE 
J090034J22AGCCCAATAAGGCCCATCTNONE 
J090034K16AGCCCAATAAGGCCCATCTNONE 
J090036D10AGCCCAATAAGGCCCATCTNONE 
J090037N17AGCCCAATAAGGCCCATCTNONE 
J090043P17AGCCCAATAAGGCCCATCTNONE 
J090044L20AGCCCAATAAGGCCCATCTNONE 
J090045N16AGCCCAATAAGGCCCATCTNONE 
J090048K03AGCCCAATAAGGCCCATCTNONE 
J090048K10AGCCCAATAAGGCCCATCTNONE 
J090049O07AGCCCAATAAGGCCCATCTNONE 
J090055H23AGCCCAATAAGGCCCATCTNONE 
J090056G12AGCCCAATAAGGCCCATCTNONE 
J090056G16AGCCCAATAAGGCCCATCTNONE 
J090059B16AGCCCAATAAGGCCCATCTNONE 
J090066H21AGCCCAATAAGGCCCATCTNONE 
J090067D22AGCCCAATAAGGCCCATCTNONE 
J090072M07AGCCCAATAAGGCCCATCTNONE 
J090073J21AGCCCAATAAGGCCCATCTNONE 
J090075A15AGCCCAATAAGGCCCATCTNONE 
J090079J09AGCCCAATAAGGCCCATCTNONE 
J090080L07AGCCCAATAAGGCCCATCTNONE 
J090084A03AGCCCAATAAGGCCCATCTNONE 
J090085B07AGCCCAATAAGGCCCATCTNONE 
J090088H11AGCCCAATAAGGCCCATCTNONE 
J090090J12AGCCCAATAAGGCCCATCTNONE 
J090091I21AGCCCAATAAGGCCCATCTNONE 
J090091L02AGCCCAATAAGGCCCATCTNONE 
J090093G18AGCCCAATAAGGCCCATCTNONE 
J090094D23AGCCCAATAAGGCCCATCTNONE 
J090098L19AGCCCAATAAGGCCCATCTNONE 
J100017I22AGCCCAATAAGGCCCATCTNONE 
J100018F08AGCCCAATAAGGCCCATCTNONE 
J100018G19AGCCCAATAAGGCCCATCTNONE 
J100019B05AGCCCAATAAGGCCCATCTNONE 
J100019J18AGCCCAATAAGGCCCATCTNONE 
J100019L04AGCCCAATAAGGCCCATCTNONE 
J100023M06AGCCCAATAAGGCCCATCTNONE 
J100024J23AGCCCAATAAGGCCCATCTNONE 
J100024P09AGCCCAATAAGGCCCATCTNONE 
J100027I05AGCCCAATAAGGCCCATCTNONE 
J100029G03AGCCCAATAAGGCCCATCTNONE 
J100029K08AGCCCAATAAGGCCCATCTNONE 
J100031J17AGCCCAATAAGGCCCATCTNONE 
J100037L16AGCCCAATAAGGCCCATCTNONE 
J100038C05AGCCCAATAAGGCCCATCTNONE 
J100039D19AGCCCAATAAGGCCCATCTNONE 
J100041L02AGCCCAATAAGGCCCATCTNONE 
J100045B08AGCCCAATAAGGCCCATCTNONE 
J100045B15AGCCCAATAAGGCCCATCTNONE 
J100047G07AGCCCAATAAGGCCCATCTNONE 
J100047P19AGCCCAATAAGGCCCATCTNONE 
J100048I15AGCCCAATAAGGCCCATCTNONE 
J100049M16AGCCCAATAAGGCCCATCTNONE 
J100049P18AGCCCAATAAGGCCCATCTNONE 
J100050E21AGCCCAATAAGGCCCATCTNONE 
J100051N02AGCCCAATAAGGCCCATCTNONE 
J100052M02AGCCCAATAAGGCCCATCTNONE 
J100055M24AGCCCAATAAGGCCCATCTNONE 
J100056K11AGCCCAATAAGGCCCATCTNONE 
J100059F20AGCCCAATAAGGCCCATCTNONE 
J100059J15AGCCCAATAAGGCCCATCTNONE 
J100068C19AGCCCAATAAGGCCCATCTNONE 
J100068G06AGCCCAATAAGGCCCATCTNONE 
J100069N02AGCCCAATAAGGCCCATCTNONE 
J100073N04AGCCCAATAAGGCCCATCTNONE 
J100074B05AGCCCAATAAGGCCCATCTNONE 
J100080P13AGCCCAATAAGGCCCATCTNONE 
J100083P09AGCCCAATAAGGCCCATCTNONE 
J100084B11AGCCCAATAAGGCCCATCTNONE 
J100085B07AGCCCAATAAGGCCCATCTNONE 
J100086O20AGCCCAATAAGGCCCATCTNONE 
J100087B02AGCCCAATAAGGCCCATCTNONE 
J100089B14AGCCCAATAAGGCCCATCTNONE 
Os08g0132600AK068578AAGGCCCATCAConserved hypothetical protein. 
AK105651AAGGCCCATCANONE 
Os08g0137250J075030L12GTGGCCCATCTNONE 
J075037O21GTGGCCCATCTNONE 
J075078E23GTGGCCCATCTNONE 
J075079C23GTGGCCCATCTNONE 
J075092K02GTGGCCCATCTNONE 
J075108M04GTGGCCCATCTNONE 
J075112N13GTGGCCCATCTNONE 
J075132M13GTGGCCCATCTNONE 
J075146E07GTGGCCCATCTNONE 
J075159F16GTGGCCCATCTNONE 
J075166M12GTGGCCCATCTNONE 
J075185B10GTGGCCCATCTNONE 
J075193J10GTGGCCCATCTNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0195400006-057-E04CGATGGGCCGTCNONE 
006-060-B10CGATGGGCCGTCNONE 
AK070464CGATGGGCCGTCConserved hypothetical protein. 
AK104389CGATGGGCCGTCNONE 
AK106140CGATGGGCCGTCNONE 
J023013G08CGATGGGCCGTCNONE 
J023054K19CGATGGGCCGTCNONE 
J023089D18CGATGGGCCGTCNONE 
J023092K05CGATGGGCCGTCNONE 
J033025A08CGATGGGCCGTCNONE 
J033067P12CGATGGGCCGTCNONE 
J033098A10CGATGGGCCGTCNONE 
J065219L04CGATGGGCCGTCNONE 
J090021P06CGATGGGCCGTCNONE 
J090062M05CGATGGGCCGTCNONE 
J090079F15CGATGGGCCGTCNONE 
J100041H19CGATGGGCCGTCNONE 
Os08g0206600AK064336TTGGCCCATCTAICARFT/IMPCHase bienzyme family protein. 
AK102764TTGGCCCATCTNONE 
Os08g0243600AB110183CGATGGGCCTCNONE 
AK101443CGATGGGCCTCHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0416400AK064144GCCCAGTAAGGCCCATCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0447200AK067377GCCCGGCCCATCTGGCCCSGT1 family protein. 
J013106M17GCCCGGCCCATCTGGCCCNONE 
J033133D18GCCCGGCCCATCTGGCCCNONE 
J033140B09GCCCGGCCCATCTGGCCCNONE 
J100028I17GCCCGGCCCATCTGGCCCNONE 
J100086C22GCCCGGCCCATCTGGCCCNONE 
Os08g0469500AK109599TAGGCCCATCAConserved hypothetical protein. 
Os08g0471900015-099-E10ACAGCCCAACAAGGCCCATCGNONE 
015-099-E10TCTGGCCCATCANONE 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
AK069434TCTGGCCCATCAZinc finger, ZPR1-type domain containing protein. 
Os08g0484700J065041E01TCGGCCCATCGHomeodomain-like containing protein. 
Os08g0490300011-064-F08AGATGGGCCGGCCCACGAANONE 
015-050-C06AGATGGGCCGGCCCACGAANONE 
AK066895AGATGGGCCGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22AGATGGGCCGGCCCACGAANONE 
J090060F02AGATGGGCCGGCCCACGAANONE 
Os08g0494300AK066150AGTGGGCCCATCCAvon Willebrand factor, type A domain containing protein. 
Os08g0517600009-066-H05TCCGGCCCATCTNONE 
AK073374TCCGGCCCATCTNONE 
AK105385TCCGGCCCATCTSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07TCCGGCCCATCTNONE 
J075004A12TCCGGCCCATCTNONE 
J075062F16TCCGGCCCATCTNONE 
J075115K05TCCGGCCCATCTNONE 
J075116H09TCCGGCCCATCTNONE 
Os08g0517900015-019-D06GAGGCCCATCTNONE 
AK064304GAGGCCCATCTSimilar to 30S ribosomal protein S16. 
Os08g0521400006-047-C11AGATGGGCCATNONE 
016-014-E07AGATGGGCCATNONE 
AK070148AGATGGGCCATNONE 
AK101704AGATGGGCCATZinc finger, RanBP2-type domain containing protein. 
AK105045AGATGGGCCATNONE 
J013108K14AGATGGGCCATNONE 
J013129E16AGATGGGCCATNONE 
J013159M23AGATGGGCCATNONE 
J023041G22AGATGGGCCATNONE 
J033060G13AGATGGGCCATNONE 
J033060J15AGATGGGCCATNONE 
J065120J24AGATGGGCCATNONE 
J065160I01AGATGGGCCATNONE 
J065179A16AGATGGGCCATNONE 
J065189K04AGATGGGCCATNONE 
J090032O15AGATGGGCCATNONE 
J090045A18AGATGGGCCATNONE 
J090060B21AGATGGGCCATNONE 
J090086F23AGATGGGCCATNONE 
J090098O22AGATGGGCCATNONE 
J100018K20AGATGGGCCATNONE 
J100048P22AGATGGGCCATNONE 
J100052I06AGATGGGCCATNONE 
Os08g0522500006-026-A04ACCGGCCCATCTNONE 
006-037-B02ACCGGCCCATCTNONE 
006-047-E11ACCGGCCCATCTNONE 
015-049-E10ACCGGCCCATCTNONE 
AK060080ACCGGCCCATCTNONE 
AK102814ACCGGCCCATCTNONE 
AK104718ACCGGCCCATCTNONE 
AK106190ACCGGCCCATCTGlycoside hydrolase, family 19 protein. 
J013068H02ACCGGCCCATCTNONE 
J033108M05ACCGGCCCATCTNONE 
J033116M13ACCGGCCCATCTNONE 
J065211H04ACCGGCCCATCTNONE 
J075195H03ACCGGCCCATCTNONE 
J075195I24ACCGGCCCATCTNONE 
Os08g0527400AK119389TTGGCCCATCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
AK119389TTGGCCCATCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0540500AK106511TGATGGGCCTASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0546300AK064717TGATGGGCCGTTTConserved hypothetical protein. 
AK119794TGATGGGCCGTTTNONE 
D10982TGATGGGCCGTTTNONE 
J080044B21TGATGGGCCGTTTNONE 
Os08g0548300AK073266TGATGGGCCGTTTZinc finger, RING-type domain containing protein. 
J013030C19TGATGGGCCGTTTNONE 
J033029A20TGATGGGCCGTTTNONE 
J033050L14TGATGGGCCGTTTNONE 
J033058F03TGATGGGCCGTTTNONE 
J033110K01TGATGGGCCGTTTNONE 
J033123D21TGATGGGCCGTTTNONE 
Os08g0549300009-008-F01AAACGGCCCATCCNONE 
009-033-G10AAACGGCCCATCCNONE 
AK120938AAACGGCCCATCCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420AAACGGCCCATCCNONE 
J023037A21AAACGGCCCATCCNONE 
J023066D20AAACGGCCCATCCNONE 
J033099K13AAACGGCCCATCCNONE 
J065116C14AAACGGCCCATCCNONE 
J075009K15AAACGGCCCATCCNONE 
J075071P13AAACGGCCCATCCNONE 
J075080D18AAACGGCCCATCCNONE 
J075124F24AAACGGCCCATCCNONE 
J075198F23AAACGGCCCATCCNONE 
J080006B15AAACGGCCCATCCNONE 
J090078H13AAACGGCCCATCCNONE 
J090089J09AAACGGCCCATCCNONE 
J100017A03AAACGGCCCATCCNONE 
J100023G03AAACGGCCCATCCNONE 
Os08g0550100AB070258CGATGGGCCTGANONE 
AK061287CGATGGGCCTGASimilar to 26S proteasome subunit RPN3a. 
Os08g0554000AK111661AGATGGGCCGGGCCGTAWD-40 repeat containing protein. 
AK112044AGATGGGCCGGGCCGTANONE 
J013039N12AGATGGGCCGGGCCGTANONE 
J013134D02AGATGGGCCGGGCCGTANONE 
J013153B06AGATGGGCCGGGCCGTANONE 
J033044L16AGATGGGCCGGGCCGTANONE 
J033073P14AGATGGGCCGGGCCGTANONE 
Os08g0564100AK063258TGATGGGCCGTCSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0115500006-023-A12CGATGGGCCCATGTNONE 
006-042-G01CGATGGGCCCATGTNONE 
AK061717CGATGGGCCCATGTCBS domain containing protein. 
AK065986CGATGGGCCCATGTNONE 
J013043C13CGATGGGCCCATGTNONE 
J013111D13CGATGGGCCCATGTNONE 
J023114K12CGATGGGCCCATGTNONE 
J065102N18CGATGGGCCCATGTNONE 
Os09g0120033AK069069TCTGGCCCATCTConserved hypothetical protein. 
Os09g0329800AK069775CGGGCCGATGGGCCAGGCCCConserved hypothetical protein. 
Os09g0329900Os09g0329900CGGGCCGATGGGCCAGGCCCNONE 
Os09g0342000AK111440AGATGGGCCGACyclin-like F-box domain containing protein. 
Os09g0370300AK108199TAGGCCCATCASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0395400AK109221TAGGCCCATAAGGATGGGCCGTAConserved hypothetical protein. 
J075009I06TAGGCCCATAAGGATGGGCCGTANONE 
Os09g0416400J075067A16GGCCCGGCCCATCAConserved hypothetical protein. 
J075104N21GGCCCGGCCCATCANONE 
J075106F04GGCCCGGCCCATCANONE 
J075131F08GGCCCGGCCCATCANONE 
Os09g0458700J065112J22TCTGGCCCATCTCalcium-binding EF-hand domain containing protein. 
J065207F05TCTGGCCCATCTNONE 
Os09g0468900AK120990TCGGCCCATCAGGCCCACGTConserved hypothetical protein. 
J013123P13TCGGCCCATCAGGCCCACGTNONE 
J023013I09TCGGCCCATCAGGCCCACGTNONE 
J023023G08TCGGCCCATCAGGCCCACGTNONE 
J023043E08TCGGCCCATCAGGCCCACGTNONE 
J033124D24TCGGCCCATCAGGCCCACGTNONE 
J065047I07TCGGCCCATCAGGCCCACGTNONE 
J065093C16TCGGCCCATCAGGCCCACGTNONE 
J090088O03TCGGCCCATCAGGCCCACGTNONE 
J100032M21TCGGCCCATCAGGCCCACGTNONE 
Os09g0477700AK121644AGATGGGCCGCConserved hypothetical protein. 
Os09g0498100015-046-G11TCAGGCCCATCANONE 
AK064108TCAGGCCCATCASimilar to 30S ribosomal protein S16. 
J065040H21TCAGGCCCATCANONE 
J065062F05TCAGGCCCATCANONE 
J065147B17TCAGGCCCATCANONE 
J075098J22TCAGGCCCATCANONE 
Os09g0498600AK066995GGGGCCCATCCNONE 
Os09g0501100009-126-C12GAGGCCCATCTNONE 
AK063752GAGGCCCATCTSimilar to 60S ribosomal protein L32A. 
AK099282GAGGCCCATCTNONE 
J023130H04GAGGCCCATCTNONE 
J075013C11GAGGCCCATCTNONE 
J075060E07GAGGCCCATCTNONE 
J075106K07GAGGCCCATCTNONE 
J075124L15GAGGCCCATCTNONE 
J075161D15GAGGCCCATCTNONE 
J080311I18GAGGCCCATCTNONE 
J080315G08GAGGCCCATCTNONE 
J080316F09GAGGCCCATCTNONE 
J080318B05GAGGCCCATCTNONE 
J100052O18GAGGCCCATCTNONE 
J100064D07GAGGCCCATCTNONE 
Os09g0512900006-066-A10TTCGGCCCATCTNONE 
AK061814TTCGGCCCATCTConserved hypothetical protein. 
AK066925TTCGGCCCATCTNONE 
AK104595TTCGGCCCATCTNONE 
J013092F14TTCGGCCCATCTNONE 
J023148N20TTCGGCCCATCTNONE 
J033131F06TTCGGCCCATCTNONE 
J053025L20TTCGGCCCATCTNONE 
J075003B20TTCGGCCCATCTNONE 
J075019N18TTCGGCCCATCTNONE 
J075032D10TTCGGCCCATCTNONE 
J075037G14TTCGGCCCATCTNONE 
J075098D24TTCGGCCCATCTNONE 
J075106M13TTCGGCCCATCTNONE 
J075122N14TTCGGCCCATCTNONE 
J075146E22TTCGGCCCATCTNONE 
J075187E06TTCGGCCCATCTNONE 
J075198I17TTCGGCCCATCTNONE 
J090023O05TTCGGCCCATCTNONE 
J100040E10TTCGGCCCATCTNONE 
J100080P12TTCGGCCCATCTNONE 
J100088B06TTCGGCCCATCTNONE 
Os09g0517800012-034-H10AGATGGGCCTTNONE 
012-034-H10CCACGGCCTGGATGGGCCCACGTNONE 
AK121391AGATGGGCCTTCyclin-like F-box domain containing protein. 
AK121391CCACGGCCTGGATGGGCCCACGTCyclin-like F-box domain containing protein. 
J023129D04AGATGGGCCTTNONE 
J023129D04CCACGGCCTGGATGGGCCCACGTNONE 
J043012D11AGATGGGCCTTNONE 
J043012D11CCACGGCCTGGATGGGCCCACGTNONE 
Os09g0525500AK107918TACGGCCCATCTYY1 protein precursor. 
D50575TACGGCCCATCTNONE 
Os09g0538200009-076-A07TCGGCCCATCCANONE 
AB032061TCGGCCCATCCAProteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
J065184D10TCGGCCCATCCANONE 
J075134I16TCGGCCCATCCANONE 
J100031G24TCGGCCCATCCANONE 
Os09g0542200006-092-A09AGATGGGCCCAAATNONE 
AK064887AGATGGGCCCAAATThioredoxin fold domain containing protein. 
AK104804AGATGGGCCCAAATNONE 
J013000K12AGATGGGCCCAAATNONE 
J013170A19AGATGGGCCCAAATNONE 
J033103B02AGATGGGCCCAAATNONE 
J065196J20AGATGGGCCCAAATNONE 
J075037H17AGATGGGCCCAAATNONE 
J075069H14AGATGGGCCCAAATNONE 
J075071C16AGATGGGCCCAAATNONE 
J075095N02AGATGGGCCCAAATNONE 
J075136N03AGATGGGCCCAAATNONE 
J075192L16AGATGGGCCCAAATNONE 
J100057N23AGATGGGCCCAAATNONE 
J100060O07AGATGGGCCCAAATNONE 
J100062F10AGATGGGCCCAAATNONE 
J100077I08AGATGGGCCCAAATNONE 
J100086B07AGATGGGCCCAAATNONE 
J100088L14AGATGGGCCCAAATNONE 
Os09g0552300AK111721CTGGCCCATCTProtein kinase-like domain containing protein. 
J043013E21CTGGCCCATCTNONE 
Os09g0554000J065123C23TTATGGGCTTATGGCCCATCASimilar to Mitochondrial phosphate transporter. 
Os11g0104400D78505TGCGGCCCATCCASimilar to W-3 fatty acid desaturase (Fragment). 
J013109G14TGCGGCCCATCCANONE 
J075027J03TGCGGCCCATCCANONE 
J090006L16TGCGGCCCATCCANONE 
J090021A01TGCGGCCCATCCANONE 
J090049M01TGCGGCCCATCCANONE 
J090084O20TGCGGCCCATCCANONE 
Os11g0106700006-055-F11CCACGTGTGGCCCATCCNONE 
006-099-D08CCACGTGTGGCCCATCCNONE 
009-155-A12CCACGTGTGGCCCATCCNONE 
AF519570CCACGTGTGGCCCATCCNONE 
AK059354CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0109900011-064-B04CAAGTGGGCCCATCGCTGGGCCTCNONE 
AK063961CAAGTGGGCCCATCGCTGGGCCTCDouble-stranded RNA binding domain containing protein. 
AK121852CAAGTGGGCCCATCGCTGGGCCTCNONE 
J065183M14CAAGTGGGCCCATCGCTGGGCCTCNONE 
Os11g0116400AK059833TGATGGGCCGCSimilar to Elongation factor P (EF-P). 
Os11g0130500J065119D16GAGGCCCATCTAGGCCCATANONE 
J065169E14GAGGCCCATCTAGGCCCATACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TTATGGGCCTAGATGGGCCTCConserved hypothetical protein. 
J065192M10TTATGGGCCTAGATGGGCCTCNONE 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
Os11g0182400016-077-B04TGATGGGCCTANONE 
AK112089TGATGGGCCTACyclin-like F-box domain containing protein. 
Os11g0199600AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein. 
AK120040TCATGGGCCCATCACCGGCCCACANONE 
J023047I06TCATGGGCCCATCACCGGCCCACANONE 
J033064L23TCATGGGCCCATCACCGGCCCACANONE 
J033117I01TCATGGGCCCATCACCGGCCCACANONE 
J033123I18