version

Summary of OsREG591 (All List)

OrganismOryza sativa  
IDOsREG591  
SequenceGCAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1242  

Entry Sequences (1242 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07GCAGCCCAGCCCAGNONE 
AK063774GCAGCCCAGCCCAGTranslocon-associated beta family protein. 
AK099081GCAGCCCAGCCCAGNONE 
AK099360GCAGCCCAGCCCAGNONE 
J013096O20GCAGCCCAGCCCAGNONE 
J023002P14GCAGCCCAGCCCAGNONE 
J033046F10GCAGCCCAGCCCAGNONE 
J033084K08GCAGCCCAGCCCAGNONE 
J065011H22GCAGCCCAGCCCAGNONE 
J090017O18GCAGCCCAGCCCAGNONE 
J090047F15GCAGCCCAGCCCAGNONE 
J090049G20GCAGCCCAGCCCAGNONE 
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein. 
AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0242200AK107468GCAGCCCATGZinc finger, C2H2-type domain containing protein. 
Os01g0348700009-125-H02GCAGCCCACCANONE 
009-125-H02GCAGCCCAGTTNONE 
009-156-F08GCAGCCCACCANONE 
009-156-F08GCAGCCCAGTTNONE 
009-177-A11GCAGCCCACCANONE 
009-177-A11GCAGCCCAGTTNONE 
009-195-D02GCAGCCCACCANONE 
009-195-D02GCAGCCCAGTTNONE 
013-040-B06GCAGCCCACCANONE 
013-040-B06GCAGCCCAGTTNONE 
013-051-B09GCAGCCCACCANONE 
013-051-B09GCAGCCCAGTTNONE 
AK120842GCAGCCCACCASimilar to 60S ribosomal protein L23a (L25). 
AK120842GCAGCCCAGTTSimilar to 60S ribosomal protein L23a (L25). 
J013071O22GCAGCCCACCANONE 
J013071O22GCAGCCCAGTTNONE 
J023022J07GCAGCCCACCANONE 
J023022J07GCAGCCCAGTTNONE 
J033028J08GCAGCCCACCANONE 
J033028J08GCAGCCCAGTTNONE 
J033109M11GCAGCCCACCANONE 
J033109M11GCAGCCCAGTTNONE 
J043022K15GCAGCCCACCANONE 
J043022K15GCAGCCCAGTTNONE 
J043031N11GCAGCCCACCANONE 
J043031N11GCAGCCCAGTTNONE 
J053023I10GCAGCCCACCANONE 
J053023I10GCAGCCCAGTTNONE 
J053045F16GCAGCCCACCANONE 
J053045F16GCAGCCCAGTTNONE 
J053054F22GCAGCCCACCANONE 
J053054F22GCAGCCCAGTTNONE 
J053094P15GCAGCCCACCANONE 
J053094P15GCAGCCCAGTTNONE 
J065048F01GCAGCCCACCANONE 
J065048F01GCAGCCCAGTTNONE 
J075012F16GCAGCCCACCANONE 
J075012F16GCAGCCCAGTTNONE 
J075089C09GCAGCCCACCANONE 
J075089C09GCAGCCCAGTTNONE 
J075179J20GCAGCCCACCANONE 
J075179J20GCAGCCCAGTTNONE 
J080305E19GCAGCCCACCANONE 
J080305E19GCAGCCCAGTTNONE 
J080309B21GCAGCCCACCANONE 
J080309B21GCAGCCCAGTTNONE 
J090017L05GCAGCCCACCANONE 
J090017L05GCAGCCCAGTTNONE 
J090058B11GCAGCCCACCANONE 
J090058B11GCAGCCCAGTTNONE 
Os01g0373400AK110973GCTGGGCTGCHomeodomain-like containing protein. 
Os01g0531500004-017-G06CGTGTGGGCTGCNONE 
006-022-B04CGTGTGGGCTGCNONE 
006-084-A07CGTGTGGGCTGCNONE 
012-031-G11CGTGTGGGCTGCNONE 
AK059992CGTGTGGGCTGCNONE 
AK104379CGTGTGGGCTGCNONE 
AK106208CGTGTGGGCTGCDienelactone hydrolase domain containing protein. 
J013058J10CGTGTGGGCTGCNONE 
J013153A15CGTGTGGGCTGCNONE 
J033044K14CGTGTGGGCTGCNONE 
Os01g0559200AK102611GCAGCCCAGTAConserved hypothetical protein. 
J033099D01GCAGCCCAGTANONE 
J043003D13GCAGCCCAGTANONE 
J090030B01GCAGCCCAGTANONE 
J090044A12GCAGCCCAGTANONE 
Os01g0580300AK063468GCAGCCCAATConserved hypothetical protein. 
Os01g0581300AK066182TCCGGCCCATAGCAGCCCATATSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TCCGGCCCATAGCAGCCCATATNONE 
Os01g0626300016-070-G04GCAGCCCAATANONE 
AK122071GCAGCCCAATASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04GCAGCCCAATANONE 
J033117J08GCAGCCCAATANONE 
J065007O12GCAGCCCAATANONE 
J065020K12GCAGCCCAATANONE 
J065142D24GCAGCCCAATANONE 
J065157K19GCAGCCCAATANONE 
J080307H19GCAGCCCAATANONE 
J080311D16GCAGCCCAATANONE 
J080316C12GCAGCCCAATANONE 
J080316E03GCAGCCCAATANONE 
J100033K16GCAGCCCAATANONE 
J100042J21GCAGCCCAATANONE 
J100051E06GCAGCCCAATANONE 
J100071E22GCAGCCCAATANONE 
Os01g0661400AK073113TGGGCTGCNucleic acid-binding, OB-fold domain containing protein. 
J023014C20TGGGCTGCNONE 
J033022G03TGGGCTGCNONE 
J065050H15TGGGCTGCNONE 
J065059J19TGGGCTGCNONE 
J065085I24TGGGCTGCNONE 
J065166G12TGGGCTGCNONE 
J065182C18TGGGCTGCNONE 
Os01g0680400AK067914GCAGCCCACCAAGCCCTAFII28-like protein family protein. 
J065039K13GCAGCCCACCAAGCCCNONE 
J065042K22GCAGCCCACCAAGCCCNONE 
J080016E23GCAGCCCACCAAGCCCNONE 
J080064E22GCAGCCCACCAAGCCCNONE 
Os01g0686800006-098-B12AATGGGCTGCNONE 
006-098-B12GCAGCCCATTTNONE 
006-113-H04AATGGGCTGCNONE 
006-113-H04GCAGCCCATTTNONE 
AK060428AATGGGCTGCNONE 
AK060428GCAGCCCATTTNONE 
AK098877AATGGGCTGCNONE 
AK098877GCAGCCCATTTNONE 
AK098893AATGGGCTGCNONE 
AK098893GCAGCCCATTTNONE 
AK121587AATGGGCTGCGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
AK121587GCAGCCCATTTGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231AATGGGCTGCNONE 
D38231GCAGCCCATTTNONE 
J013001E12AATGGGCTGCNONE 
J013001E12GCAGCCCATTTNONE 
J013001N15AATGGGCTGCNONE 
J013001N15GCAGCCCATTTNONE 
J013098G22AATGGGCTGCNONE 
J013098G22GCAGCCCATTTNONE 
J023004P15AATGGGCTGCNONE 
J023004P15GCAGCCCATTTNONE 
J023014D09AATGGGCTGCNONE 
J023014D09GCAGCCCATTTNONE 
J023020G09AATGGGCTGCNONE 
J023020G09GCAGCCCATTTNONE 
J023034A19AATGGGCTGCNONE 
J023034A19GCAGCCCATTTNONE 
J023050I11AATGGGCTGCNONE 
J023050I11GCAGCCCATTTNONE 
J023079D13AATGGGCTGCNONE 
J023079D13GCAGCCCATTTNONE 
J023091B11AATGGGCTGCNONE 
J023091B11GCAGCCCATTTNONE 
J023099M03AATGGGCTGCNONE 
J023099M03GCAGCCCATTTNONE 
J023101H20AATGGGCTGCNONE 
J023101H20GCAGCCCATTTNONE 
J023106P14AATGGGCTGCNONE 
J023106P14GCAGCCCATTTNONE 
J023111F19AATGGGCTGCNONE 
J023111F19GCAGCCCATTTNONE 
J023132C22AATGGGCTGCNONE 
J023132C22GCAGCCCATTTNONE 
J023139O03AATGGGCTGCNONE 
J023139O03GCAGCCCATTTNONE 
J023146O10AATGGGCTGCNONE 
J023146O10GCAGCCCATTTNONE 
J033022G16AATGGGCTGCNONE 
J033022G16GCAGCCCATTTNONE 
J033030C10AATGGGCTGCNONE 
J033030C10GCAGCCCATTTNONE 
J033032G18AATGGGCTGCNONE 
J033032G18GCAGCCCATTTNONE 
J033034N09AATGGGCTGCNONE 
J033034N09GCAGCCCATTTNONE 
J033037K24AATGGGCTGCNONE 
J033037K24GCAGCCCATTTNONE 
J033038B22AATGGGCTGCNONE 
J033038B22GCAGCCCATTTNONE 
J033061E06AATGGGCTGCNONE 
J033061E06GCAGCCCATTTNONE 
J033065F08AATGGGCTGCNONE 
J033065F08GCAGCCCATTTNONE 
J033065I24AATGGGCTGCNONE 
J033065I24GCAGCCCATTTNONE 
J033069L01AATGGGCTGCNONE 
J033069L01GCAGCCCATTTNONE 
J033086N21AATGGGCTGCNONE 
J033086N21GCAGCCCATTTNONE 
J033102I06AATGGGCTGCNONE 
J033102I06GCAGCCCATTTNONE 
J033111N07AATGGGCTGCNONE 
J033111N07GCAGCCCATTTNONE 
J033118K11AATGGGCTGCNONE 
J033118K11GCAGCCCATTTNONE 
J033125D08AATGGGCTGCNONE 
J033125D08GCAGCCCATTTNONE 
J033129P22AATGGGCTGCNONE 
J033129P22GCAGCCCATTTNONE 
J033131L12AATGGGCTGCNONE 
J033131L12GCAGCCCATTTNONE 
J033139D08AATGGGCTGCNONE 
J033139D08GCAGCCCATTTNONE 
J033141J08AATGGGCTGCNONE 
J033141J08GCAGCCCATTTNONE 
J043024B14AATGGGCTGCNONE 
J043024B14GCAGCCCATTTNONE 
J053048G19AATGGGCTGCNONE 
J053048G19GCAGCCCATTTNONE 
J065023B15AATGGGCTGCNONE 
J065023B15GCAGCCCATTTNONE 
J065082C15AATGGGCTGCNONE 
J065082C15GCAGCCCATTTNONE 
J065087D24AATGGGCTGCNONE 
J065087D24GCAGCCCATTTNONE 
J065122D11AATGGGCTGCNONE 
J065122D11GCAGCCCATTTNONE 
J065128P13AATGGGCTGCNONE 
J065128P13GCAGCCCATTTNONE 
J065149I19AATGGGCTGCNONE 
J065149I19GCAGCCCATTTNONE 
J065154E16AATGGGCTGCNONE 
J065154E16GCAGCCCATTTNONE 
J065156K21AATGGGCTGCNONE 
J065156K21GCAGCCCATTTNONE 
J065166H09AATGGGCTGCNONE 
J065166H09GCAGCCCATTTNONE 
J065169F24AATGGGCTGCNONE 
J065169F24GCAGCCCATTTNONE 
J065194I16AATGGGCTGCNONE 
J065194I16GCAGCCCATTTNONE 
J065213M20AATGGGCTGCNONE 
J065213M20GCAGCCCATTTNONE 
J075020F19AATGGGCTGCNONE 
J075020F19GCAGCCCATTTNONE 
J075051J16AATGGGCTGCNONE 
J075051J16GCAGCCCATTTNONE 
J075093C18AATGGGCTGCNONE 
J075093C18GCAGCCCATTTNONE 
J075119H02AATGGGCTGCNONE 
J075119H02GCAGCCCATTTNONE 
J075120J11AATGGGCTGCNONE 
J075120J11GCAGCCCATTTNONE 
J075173A15AATGGGCTGCNONE 
J075173A15GCAGCCCATTTNONE 
J080302B05AATGGGCTGCNONE 
J080302B05GCAGCCCATTTNONE 
J080304G10AATGGGCTGCNONE 
J080304G10GCAGCCCATTTNONE 
J080305E13AATGGGCTGCNONE 
J080305E13GCAGCCCATTTNONE 
J080315L11AATGGGCTGCNONE 
J080315L11GCAGCCCATTTNONE 
J090005H15AATGGGCTGCNONE 
J090005H15GCAGCCCATTTNONE 
J090021C24AATGGGCTGCNONE 
J090021C24GCAGCCCATTTNONE 
J090025H24AATGGGCTGCNONE 
J090025H24GCAGCCCATTTNONE 
J090025M11AATGGGCTGCNONE 
J090025M11GCAGCCCATTTNONE 
J090026C22AATGGGCTGCNONE 
J090026C22GCAGCCCATTTNONE 
J090027H15AATGGGCTGCNONE 
J090027H15GCAGCCCATTTNONE 
J090034B17AATGGGCTGCNONE 
J090034B17GCAGCCCATTTNONE 
J090045G11AATGGGCTGCNONE 
J090045G11GCAGCCCATTTNONE 
J090048H02AATGGGCTGCNONE 
J090048H02GCAGCCCATTTNONE 
J090051N04AATGGGCTGCNONE 
J090051N04GCAGCCCATTTNONE 
J090052I06AATGGGCTGCNONE 
J090052I06GCAGCCCATTTNONE 
J090054L17AATGGGCTGCNONE 
J090054L17GCAGCCCATTTNONE 
J090060M22AATGGGCTGCNONE 
J090060M22GCAGCCCATTTNONE 
J090075N17AATGGGCTGCNONE 
J090075N17GCAGCCCATTTNONE 
J090079K13AATGGGCTGCNONE 
J090079K13GCAGCCCATTTNONE 
J090086H08AATGGGCTGCNONE 
J090086H08GCAGCCCATTTNONE 
J090094N20AATGGGCTGCNONE 
J090094N20GCAGCCCATTTNONE 
J100021F03AATGGGCTGCNONE 
J100021F03GCAGCCCATTTNONE 
J100031M01AATGGGCTGCNONE 
J100031M01GCAGCCCATTTNONE 
J100033I18AATGGGCTGCNONE 
J100033I18GCAGCCCATTTNONE 
J100034P07AATGGGCTGCNONE 
J100034P07GCAGCCCATTTNONE 
J100043M16AATGGGCTGCNONE 
J100043M16GCAGCCCATTTNONE 
J100046J12AATGGGCTGCNONE 
J100046J12GCAGCCCATTTNONE 
J100055F09AATGGGCTGCNONE 
J100055F09GCAGCCCATTTNONE 
J100057D19AATGGGCTGCNONE 
J100057D19GCAGCCCATTTNONE 
J100060O10AATGGGCTGCNONE 
J100060O10GCAGCCCATTTNONE 
J100064G09AATGGGCTGCNONE 
J100064G09GCAGCCCATTTNONE 
J100077F24AATGGGCTGCNONE 
J100077F24GCAGCCCATTTNONE 
J100080E12AATGGGCTGCNONE 
J100080E12GCAGCCCATTTNONE 
J100089J04AATGGGCTGCNONE 
J100089J04GCAGCCCATTTNONE 
Os01g0700500AK072715GCAGCCCATGGCytochrome P450 family protein. 
AK119264GCAGCCCATGGNONE 
Os01g0708600AK111377GCAGCCCAGCTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07GCAGCCCAGCNONE 
J065007E03GCAGCCCAGCNONE 
J065015A13GCAGCCCAGCNONE 
J065093J17GCAGCCCAGCNONE 
J065116C09GCAGCCCAGCNONE 
J065120E04GCAGCCCAGCNONE 
J065197I17GCAGCCCAGCNONE 
J065208L13GCAGCCCAGCNONE 
J065213P07GCAGCCCAGCNONE 
J075056K07GCAGCCCAGCNONE 
J090036L08GCAGCCCAGCNONE 
Os01g0749200006-074-H04TGTGGGCTGCAAAGCCCAGCNONE 
AK072760TGTGGGCTGCAAAGCCCAGCNONE 
AK099041TGTGGGCTGCAAAGCCCAGCNONE 
AK104146TGTGGGCTGCAAAGCCCAGCSimilar to 50S ribosomal protein L13. 
AK119189TGTGGGCTGCAAAGCCCAGCNONE 
Os01g0810000AK102143GTTTGGGCTGGGCTGCNONE 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0823500016-059-D03GCAGCCCACACNONE 
AK064237GCAGCCCACACProtein of unknown function DUF623, plant domain containing protein. 
Os01g0840100006-095-C03GGTTGGGCTGCNONE 
011-075-F07GGTTGGGCTGCNONE 
012-010-A08GGTTGGGCTGCNONE 
012-035-A09GGTTGGGCTGCNONE 
014-010-B01GGTTGGGCTGCNONE 
014-011-H07GGTTGGGCTGCNONE 
014-040-F03GGTTGGGCTGCNONE 
014-077-C11GGTTGGGCTGCNONE 
014-078-C11GGTTGGGCTGCNONE 
014-097-A10GGTTGGGCTGCNONE 
014-097-D02GGTTGGGCTGCNONE 
014-100-D02GGTTGGGCTGCNONE 
015-012-H01GGTTGGGCTGCNONE 
015-049-G07GGTTGGGCTGCNONE 
015-066-C09GGTTGGGCTGCNONE 
016-033-C09GGTTGGGCTGCHeat shock protein Hsp70 family protein. 
016-084-F08GGTTGGGCTGCNONE 
J023037O13GGTTGGGCTGCNONE 
J033116B07GGTTGGGCTGCNONE 
J033121N13GGTTGGGCTGCNONE 
J065057F16GGTTGGGCTGCNONE 
J065112D05GGTTGGGCTGCNONE 
J065157G17GGTTGGGCTGCNONE 
J090014O03GGTTGGGCTGCNONE 
J090015K13GGTTGGGCTGCNONE 
J090021I21GGTTGGGCTGCNONE 
J090048D02GGTTGGGCTGCNONE 
J090054D14GGTTGGGCTGCNONE 
J090060J03GGTTGGGCTGCNONE 
J090063G01GGTTGGGCTGCNONE 
J090063H04GGTTGGGCTGCNONE 
J090063L13GGTTGGGCTGCNONE 
J090074E03GGTTGGGCTGCNONE 
J090096A03GGTTGGGCTGCNONE 
J090096I11GGTTGGGCTGCNONE 
J090099E16GGTTGGGCTGCNONE 
J100050G20GGTTGGGCTGCNONE 
Os01g0867600AK102226CTGGGCTGCSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0869300AK059347GCAGCCCACTTGConserved hypothetical protein. 
Os01g0878000006-045-H09TGTGGGCTGCNONE 
006-078-F07TGTGGGCTGCNONE 
016-050-A09TGTGGGCTGCNONE 
AK060162TGTGGGCTGCConserved hypothetical protein. 
AK061119TGTGGGCTGCNONE 
AK104289TGTGGGCTGCNONE 
Os01g0948300009-023-A03GCAGCCCAGCNONE 
AK102153GCAGCCCAGCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24GCAGCCCAGCNONE 
J023019C13GCAGCCCAGCNONE 
J023049L21GCAGCCCAGCNONE 
J023066H02GCAGCCCAGCNONE 
J033050A07GCAGCCCAGCNONE 
J033086E01GCAGCCCAGCNONE 
J033086F11GCAGCCCAGCNONE 
J090047I04GCAGCCCAGCNONE 
J100035E10GCAGCCCAGCNONE 
J100040L06GCAGCCCAGCNONE 
J100044G21GCAGCCCAGCNONE 
J100045F13GCAGCCCAGCNONE 
J100046G12GCAGCCCAGCNONE 
J100075N10GCAGCCCAGCNONE 
J100077I01GCAGCCCAGCNONE 
Os01g0976700AK068121CCATGGGCTGCNONE 
AK100571CCATGGGCTGCSimilar to Protein phosphatase 2C-like protein. 
Os02g0103700009-031-C12CTGGGCTGCNONE 
AK062502CTGGGCTGCNONE 
AK102186CTGGGCTGCSimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17CTGGGCTGCNONE 
J065161I07CTGGGCTGCNONE 
J065184G15CTGGGCTGCNONE 
J075123E02CTGGGCTGCNONE 
Os02g0158900AK108324GCAGCCCATGSimilar to SNF4. 
Os02g0192300Os02g0192300GCAGCCCACACGZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0452800J043024P15TTGTGGGCTGCConserved hypothetical protein. 
Os02g0510200AK058963ATTTGGGCTGCNONE 
Os02g0517333AK105573GCAGCCCACGANONE 
AK111331GCAGCCCACGAConserved hypothetical protein. 
Os02g0597300AK064487GCAGCCCAGHypothetical protein. 
Os02g0616600AK106681CTTGGGCTGCCGGCCCAGCConserved hypothetical protein. 
J065062G16CTTGGGCTGCCGGCCCAGCNONE 
Os02g0655300006-024-H05GCAGCCCACGANONE 
006-032-G04GCAGCCCACGANONE 
006-045-F03GCAGCCCACGANONE 
006-076-D04GCAGCCCACGANONE 
006-086-C09GCAGCCCACGANONE 
006-104-C07GCAGCCCACGANONE 
AK061544GCAGCCCACGANONE 
AK103778GCAGCCCACGANONE 
AK106107GCAGCCCACGANONE 
AK120006GCAGCCCACGANONE 
AY363174GCAGCCCACGASimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21GCAGCCCACGANONE 
J065021C16GCAGCCCACGANONE 
J065182F01GCAGCCCACGANONE 
J075063I18GCAGCCCACGANONE 
J075151E01GCAGCCCACGANONE 
J075198K18GCAGCCCACGANONE 
J090026M06GCAGCCCACGANONE 
J090081H02GCAGCCCACGANONE 
J100061E20GCAGCCCACGANONE 
Os02g0661900006-030-G12GCAGCCCAGATNONE 
AK061447GCAGCCCAGATSimilar to Vesicle-associated membrane protein-associated protein B/C (VAMP- associated protein B/C) (VAMP-B/VAMP-C) (VAP-B/VAP-C). Splice isoform 2. 
AK068742GCAGCCCAGATNONE 
J075046K13GCAGCCCAGATNONE 
J075139O08GCAGCCCAGATNONE 
J075149I16GCAGCCCAGATNONE 
Os02g0700100AK102954TTTTGGGCTGCSimilar to WD-repeat protein. 
Os02g0732900AK065796GCAGCCCATTACGGCCCProtein of unknown function DUF794, plant family protein. 
AK104342GCAGCCCATTACGGCCCNONE 
Os02g0753200AK067176GCAGCCCAGCCConserved hypothetical protein. 
J013097D23GCAGCCCAGCCNONE 
J065085J01GCAGCCCAGCCNONE 
J065152L23GCAGCCCAGCCNONE 
J065162F18GCAGCCCAGCCNONE 
J075002K17GCAGCCCAGCCNONE 
J075047D24GCAGCCCAGCCNONE 
J075064A01GCAGCCCAGCCNONE 
J075075C09GCAGCCCAGCCNONE 
J075088M01GCAGCCCAGCCNONE 
J075130K03GCAGCCCAGCCNONE 
J075146K03GCAGCCCAGCCNONE 
J090049F07GCAGCCCAGCCNONE 
Os02g0762400AK103084GCAGCCCAACGGCCCyclin-dependent kinase inhibitor family protein. 
Os02g0774300AK065228GCAGCCCAACASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0791800AK066282CATGGGCTGCNONE 
AK099697CATGGGCTGCWD-40 repeat containing protein. 
AY445625CATGGGCTGCNONE 
J053065H07CATGGGCTGCNONE 
J065108P05CATGGGCTGCNONE 
J065154P22CATGGGCTGCNONE 
J100037P04CATGGGCTGCNONE 
J100068K05CATGGGCTGCNONE 
Os02g0794700003-103-F03CTTGGGCTGCNONE 
003-129-E08CTTGGGCTGCNONE 
006-086-A10CTTGGGCTGCNONE 
AK058513CTTGGGCTGCSimilar to Cytosol aminopeptidase (EC 3.4.11.1) (Leucine aminopeptidase) (LAP) (Leucyl aminopeptidase) (Proline aminopeptidase) (EC 3.4.11.5) (Prolyl aminopeptidase). 
AK104150CTTGGGCTGCNONE 
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein. 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os03g0106200AK120128GTGTGGGCTGCConserved hypothetical protein. 
Os03g0108700003-131-E01GCAGCCCAGCCCAGCCNONE 
AK105115GCAGCCCAGCCCAGCCConserved hypothetical protein. 
AY224538GCAGCCCAGCCCAGCCNONE 
J065029A19GCAGCCCAGCCCAGCCNONE 
J065109N11GCAGCCCAGCCCAGCCNONE 
Os03g0145600015-010-B10GCAGCCCANONE 
AK106243GCAGCCCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0182800003-126-E06GCAGCCCACANONE 
AJ304840GCAGCCCACANONE 
AK073133GCAGCCCACANONE 
AY323478GCAGCCCACASimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13GCAGCCCACANONE 
J033028C22GCAGCCCACANONE 
J033042J03GCAGCCCACANONE 
J065022E13GCAGCCCACANONE 
J065208N24GCAGCCCACANONE 
J100034B17GCAGCCCACANONE 
J100035J21GCAGCCCACANONE 
J100039L16GCAGCCCACANONE 
J100040A02GCAGCCCACANONE 
J100051L11GCAGCCCACANONE 
J100064F07GCAGCCCACANONE 
J100070J12GCAGCCCACANONE 
Os03g0197400AK071413GCAGCCCAGCCCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905GCAGCCCAGCCCNONE 
J053023D18GCAGCCCAGCCCNONE 
Os03g0220100006-023-B05GCAGCCCAACNONE 
006-034-F08GCAGCCCAACNONE 
006-093-A02GCAGCCCAACNONE 
006-093-A06GCAGCCCAACNONE 
011-078-E04GCAGCCCAACNONE 
012-092-C04GCAGCCCAACNONE 
AK066587GCAGCCCAACSimilar to Very-long-chain fatty acid condensing enzyme CUT1. 
AK104714GCAGCCCAACNONE 
AK106150GCAGCCCAACNONE 
J013067C12GCAGCCCAACNONE 
J013074H08GCAGCCCAACNONE 
J013124K13GCAGCCCAACNONE 
J065007A03GCAGCCCAACNONE 
J065037H21GCAGCCCAACNONE 
J065081F03GCAGCCCAACNONE 
J090074C06GCAGCCCAACNONE 
Os03g0228200AK059414CTGGGCTGCConserved hypothetical protein. 
Os03g0249900AK058379GCAGCCCAATAConserved hypothetical protein. 
Os03g0284000Os03g0284000CTTGGGCCGTGCTTGGGCTGCConserved hypothetical protein. 
Os03g0299900AK069075CGCGTGGGCTGCSimilar to Plastid aminotransferase (Fragment). 
AY338235CGCGTGGGCTGCNONE 
J053077F07CGCGTGGGCTGCNONE 
Os03g0336000AK100067GCAGCCCATATProtein prenyltransferase domain containing protein. 
J065161K02GCAGCCCATATNONE 
J065162C21GCAGCCCATATNONE 
Os03g0388000009-082-H03TGTTGGGCTGCNONE 
AK062658TGTTGGGCTGCNONE 
Os03g0388500AK070350ATTGGGCTGCSimilar to Anther ethylene-upregulated protein ER1 (Fragment). 
Os03g0390400009-175-E06GCAGCCCAGNONE 
013-040-G01GCAGCCCAGNONE 
014-050-G05GCAGCCCAGNONE 
AB025187GCAGCCCAGSimilar to Cytochrome c oxidase subunit 6b. 
AK120174GCAGCCCAGNONE 
J013033A17GCAGCCCAGNONE 
J023028J08GCAGCCCAGNONE 
J023061N05GCAGCCCAGNONE 
J023077A03GCAGCCCAGNONE 
J023086E01GCAGCCCAGNONE 
J033022A08GCAGCCCAGNONE 
J033040F24GCAGCCCAGNONE 
J075073I24GCAGCCCAGNONE 
J075081H01GCAGCCCAGNONE 
J075175N19GCAGCCCAGNONE 
J100025M03GCAGCCCAGNONE 
J100036J06GCAGCCCAGNONE 
J100045O18GCAGCCCAGNONE 
J100062G15GCAGCCCAGNONE 
J100090N19GCAGCCCAGNONE 
Os03g0438000AK119977GCAGCCCACGGConserved hypothetical protein. 
Os03g0566800AK103270GCAGCCCAACTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18GCAGCCCAACTNONE 
J023136P06GCAGCCCAACTNONE 
J033081A22GCAGCCCAACTNONE 
J033109N12GCAGCCCAACTNONE 
J033124H10GCAGCCCAACTNONE 
J033141B09GCAGCCCAACTNONE 
J090026G23GCAGCCCAACTNONE 
J090077J20GCAGCCCAACTNONE 
Os03g0576900AK064861CTTGGGCTGCNONE 
J013000I01CTTGGGCTGCNONE 
J013169P21CTTGGGCTGCNONE 
J023001P03CTTGGGCTGCNONE 
J023009M10CTTGGGCTGCNONE 
J023025G11CTTGGGCTGCNONE 
J033046B19CTTGGGCTGCNONE 
J033149I10CTTGGGCTGCNONE 
J090081C04CTTGGGCTGCNONE 
Os03g0578300014-071-F09TGTGGGCTGCNONE 
J065098N06TGTGGGCTGCNONE 
J065129D09TGTGGGCTGCNONE 
J075018K16TGTGGGCTGCNONE 
J075106D12TGTGGGCTGCNONE 
J075106D18TGTGGGCTGCNONE 
J075139J02TGTGGGCTGCNONE 
J075170G09TGTGGGCTGCNONE 
J080317I24TGTGGGCTGCNONE 
J080319E11TGTGGGCTGCNONE 
Os03g0588700Os03g0588700GCAGCCCACGCGConserved hypothetical protein. 
Os03g0633800AK073044CATGGGCTGCSimilar to IAA6 (Fragment). 
J065038L22CATGGGCTGCNONE 
J065185C13CATGGGCTGCNONE 
Os03g0639700AK099587ATCTGGGCTGCSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
AK099587GCAGCCCACASimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0684400AK100086GCAGCCCACCCMg2+ transporter protein, CorA-like family protein. 
Os03g0703300016-074-H01GCAGCCCACCTGNONE 
AK073831GCAGCCCACCTGCalponin-like actin-binding domain containing protein. 
Os03g0712800AK063913GCAGCCCACACACACACCSimilar to Glutamine synthetase root isozyme 2 (EC 6.3.1.2) (Glutamate--ammonia ligase). 
AK099290GCAGCCCACACACACACCNONE 
J023127P21GCAGCCCACACACACACCNONE 
Os03g0722000AK069866GCAGCCCATCCANONE 
Os03g0746400AK063445TGATGGGCTGCProtein prenyltransferase domain containing protein. 
AK070923TGATGGGCTGCNONE 
J065008K24TGATGGGCTGCNONE 
Os03g0786500016-056-D08GCAGCCCANONE 
AK106487GCAGCCCASimilar to Glycine-rich protein 2. 
J080001C23GCAGCCCANONE 
J080005A02GCAGCCCANONE 
J080009A14GCAGCCCANONE 
J080009B11GCAGCCCANONE 
J080011L03GCAGCCCANONE 
J080017E21GCAGCCCANONE 
J080018H08GCAGCCCANONE 
J080021E11GCAGCCCANONE 
J080025O20GCAGCCCANONE 
J080026H21GCAGCCCANONE 
J080029I10GCAGCCCANONE 
J080036L01GCAGCCCANONE 
J080038M15GCAGCCCANONE 
J080051H09GCAGCCCANONE 
J080053E18GCAGCCCANONE 
J080054I12GCAGCCCANONE 
J080055B14GCAGCCCANONE 
J080060L16GCAGCCCANONE 
J080067G06GCAGCCCANONE 
J080069K14GCAGCCCANONE 
J080070N14GCAGCCCANONE 
J080071G10GCAGCCCANONE 
J080076D08GCAGCCCANONE 
J080076O11GCAGCCCANONE 
J080078E10GCAGCCCANONE 
J080079B15GCAGCCCANONE 
J080079K03GCAGCCCANONE 
J080079O15GCAGCCCANONE 
J080087B18GCAGCCCANONE 
Os03g0822100AK101094TGCGGGCCTTGGGCTGTGGGCTGCSimilar to Transposase (Fragment). 
J033024N05TGCGGGCCTTGGGCTGTGGGCTGCNONE 
Os03g0822900AK099787ATATGGGCTGCZinc finger, BED-type predicted domain containing protein. 
J013042C24ATATGGGCTGCNONE 
J013096O21ATATGGGCTGCNONE 
J023109I23ATATGGGCTGCNONE 
J033106N09ATATGGGCTGCNONE 
J033107H03ATATGGGCTGCNONE 
J033118G03ATATGGGCTGCNONE 
J033145I24ATATGGGCTGCNONE 
J065138D15ATATGGGCTGCNONE 
J065140L13ATATGGGCTGCNONE 
J065179M13ATATGGGCTGCNONE 
J065200F05ATATGGGCTGCNONE 
J075104F20ATATGGGCTGCNONE 
J075143A15ATATGGGCTGCNONE 
J075197J11ATATGGGCTGCNONE 
Os03g0843500AK067985GCAGCCCAATNONE 
AK101661GCAGCCCAATSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454GCAGCCCAATNONE 
J080302L23GCAGCCCAATNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0854000009-186-C03GCAGCCCATATNONE 
AK061374GCAGCCCATATProtein of unknown function UPF0131 family protein. 
J065138B11GCAGCCCATATNONE 
Os03g0856200009-070-B07GCAGCCCATCANONE 
009-135-H05GCAGCCCATCANONE 
J100067D22GCAGCCCATCANONE 
J100067L13GCAGCCCATCANONE 
J100073I07GCAGCCCATCANONE 
J100080D01GCAGCCCATCANONE 
Os04g0107900013-017-E10AGATGGGCTGCNONE 
014-025-A02AGATGGGCTGCNONE 
014-100-C01AGATGGGCTGCNONE 
AK063568AGATGGGCTGCNONE 
AK063698AGATGGGCTGCNONE 
AK063751AGATGGGCTGCSimilar to Heat shock protein 80. 
J013118G22AGATGGGCTGCNONE 
J033131C17AGATGGGCTGCNONE 
J065036G05AGATGGGCTGCNONE 
J065106E24AGATGGGCTGCNONE 
J065171K16AGATGGGCTGCNONE 
J065213C11AGATGGGCTGCNONE 
J065218L17AGATGGGCTGCNONE 
Os04g0117800Os04g0117800GCAGCCCAGGCCCAGCCAmidase family protein. 
Os04g0170500AK103323GCAGCCCAGHypothetical protein. 
Os04g0316200AK110725GCAGCCCAAAAProtein of unknown function DUF26 domain containing protein. 
AY576676GCAGCCCAAAANONE 
J100043J22GCAGCCCAAAANONE 
J100049F15GCAGCCCAAAANONE 
J100081M23GCAGCCCAAAANONE 
Os04g0322100J075093H10GCAGCCCAAAAProtein of unknown function DUF26 domain containing protein. 
J100044L06GCAGCCCAAAANONE 
J100048J12GCAGCCCAAAANONE 
J100073D10GCAGCCCAAAANONE 
Os04g0419500J100059A06GCAGCCCACTTGZinc finger, RING-type domain containing protein. 
Os04g0440000AK073064GCAGCCCAATTNONE 
AK101691GCAGCCCAATTConserved hypothetical protein. 
AK102407GCAGCCCAATTNONE 
Os04g0475300AK066351GCAGCCCATTAConserved hypothetical protein. 
J065138J21GCAGCCCATTANONE 
Os04g0476400J033082D17TGGGCTGCNONE 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0513100AK067841GGGCTGGGCTGCGGTGGGCTGTSimilar to Beta-glucosidase. 
J075105F14GGGCTGGGCTGCGGTGGGCTGTNONE 
Os04g0521800006-043-D11AGTTGGGCTGCNONE 
AK061536AGTTGGGCTGCNONE 
AK102934AGTTGGGCTGCPeptidase M20 family protein. 
AK103369AGTTGGGCTGCNONE 
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein. 
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein. 
Os04g0562000006-096-A05GCAGCCCACGGGNONE 
006-105-B08GCAGCCCACGGGNONE 
AK060894GCAGCCCACGGGNONE 
AK072630GCAGCCCACGGGZinc finger, DHHC-type domain containing protein. 
AK104521GCAGCCCACGGGNONE 
J023038A11GCAGCCCACGGGNONE 
J023130P03GCAGCCCACGGGNONE 
J090006F10GCAGCCCACGGGNONE 
J090007M22GCAGCCCACGGGNONE 
Os04g0577500006-039-C03CTGGGCTGCNONE 
006-043-H01CTGGGCTGCNONE 
AK061538CTGGGCTGCNONE 
AK065648CTGGGCTGCTatD-related deoxyribonuclease family protein. 
AK104763CTGGGCTGCNONE 
J013035E21CTGGGCTGCNONE 
J013066M11CTGGGCTGCNONE 
J100026B02CTGGGCTGCNONE 
Os04g0592500AK066893GCAGCCCAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18GCAGCCCANONE 
Os04g0610500006-115-C07ATATGGGCTGCAGCCCATGTNONE 
AK066289ATATGGGCTGCAGCCCATGTPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817ATATGGGCTGCAGCCCATGTNONE 
J013096N09ATATGGGCTGCAGCCCATGTNONE 
J023054I11ATATGGGCTGCAGCCCATGTNONE 
J023121P20ATATGGGCTGCAGCCCATGTNONE 
J053039O20ATATGGGCTGCAGCCCATGTNONE 
J053071L20ATATGGGCTGCAGCCCATGTNONE 
J053088H23ATATGGGCTGCAGCCCATGTNONE 
J053096J03ATATGGGCTGCAGCCCATGTNONE 
Os04g0658200J075021C22AAATGGGCTGCConserved hypothetical protein. 
Os04g0672100AK121689GCAGCCCACGAASimilar to Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kinase). 
J033057E18GCAGCCCACGAANONE 
J033071C20GCAGCCCACGAANONE 
J033107C06GCAGCCCACGAANONE 
J090033H05GCAGCCCACGAANONE 
J090036E04GCAGCCCACGAANONE 
J090082J15GCAGCCCACGAANONE 
Os04g0691900AK068257GCAGCCCAGCCACCAACChaperonin Cpn60/TCP-1 family protein. 
Os05g0100500AK071466GCAGCCCAAAAAGCCCAAGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0104800006-022-G08AACTGGGCTGCNONE 
AK070215AACTGGGCTGCSimilar to Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) (eIF3 p32 subunit) (eIF3f). 
AK104207AACTGGGCTGCNONE 
AK104554AACTGGGCTGCNONE 
J023043K07AACTGGGCTGCNONE 
J023079C24AACTGGGCTGCNONE 
J033050A14AACTGGGCTGCNONE 
J033095G11AACTGGGCTGCNONE 
J033097D16AACTGGGCTGCNONE 
J033108J11AACTGGGCTGCNONE 
J053037E01AACTGGGCTGCNONE 
J053061I17AACTGGGCTGCNONE 
J065040F22AACTGGGCTGCNONE 
J065055B15AACTGGGCTGCNONE 
J065091N23AACTGGGCTGCNONE 
J090062J16AACTGGGCTGCNONE 
J100065J21AACTGGGCTGCNONE 
Os05g0120800AK066865TGGGCTGCConserved hypothetical protein. 
Os05g0149600012-070-F05GCAGCCCAATTNONE 
012-080-A12GCAGCCCAATTNONE 
012-082-C06GCAGCCCAATTNONE 
AK073947GCAGCCCAATTSimilar to Cullin-1. 
J023063A09GCAGCCCAATTNONE 
J033073A13GCAGCCCAATTNONE 
J033093B09GCAGCCCAATTNONE 
J065017B10GCAGCCCAATTNONE 
J065037P19GCAGCCCAATTNONE 
J065142G16GCAGCCCAATTNONE 
J065147F13GCAGCCCAATTNONE 
J065195M20GCAGCCCAATTNONE 
J090011L24GCAGCCCAATTNONE 
J090018I19GCAGCCCAATTNONE 
J090040M12GCAGCCCAATTNONE 
J090054K21GCAGCCCAATTNONE 
J090059G09GCAGCCCAATTNONE 
J090070H17GCAGCCCAATTNONE 
J090071G17GCAGCCCAATTNONE 
J090077L09GCAGCCCAATTNONE 
J090091C15GCAGCCCAATTNONE 
J100032J17GCAGCCCAATTNONE 
J100061E08GCAGCCCAATTNONE 
Os05g0214900006-070-A10GCGTGGGCTGCNONE 
AK061081GCGTGGGCTGCConserved hypothetical protein. 
Os05g0219800AK102822GGCCCGCAGCCCACAASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0249100016-087-B02CTGGGCTGCATATGGGCTGGNONE 
AK064291CTGGGCTGCATATGGGCTGGConserved hypothetical protein. 
AK103049CTGGGCTGCATATGGGCTGGNONE 
J033117G22CTGGGCTGCATATGGGCTGGNONE 
J065021C19CTGGGCTGCATATGGGCTGGNONE 
J065205P17CTGGGCTGCATATGGGCTGGNONE 
Os05g0370700AK108862GCAGCCCACCACAlpha/beta hydrolase family protein. 
Os05g0393400AK059594TGGGCTGCNONE 
AK099875TGGGCTGCNONE 
AK100039TGGGCTGCSimilar to PAC (Fragment). 
Os05g0443300Os05g0443300AGTTGGGCTGCSec23/Sec24 trunk region domain containing protein. 
Os05g0445500009-021-C05GCAGCCCATGNONE 
009-129-D11GCAGCCCATGNONE 
009-147-E04GCAGCCCATGNONE 
009-169-C11GCAGCCCATGNONE 
AK121459GCAGCCCATGSimilar to 60S acidic ribosomal protein P2B. 
D21114GCAGCCCATGNONE 
J023001K23GCAGCCCATGNONE 
J023107J19GCAGCCCATGNONE 
J023143J09GCAGCCCATGNONE 
J065049D04GCAGCCCATGNONE 
J065092I06GCAGCCCATGNONE 
J065188H04GCAGCCCATGNONE 
Os05g0459300009-006-D08GCTGGGCTGCNONE 
AK062312GCTGGGCTGCNONE 
AK119604GCTGGGCTGCNONE 
AK121463GCTGGGCTGCConserved hypothetical protein. 
J023145E12GCTGGGCTGCNONE 
Os05g0470800011-027-A06TGGGCTGCNONE 
AK069780TGGGCTGCBacterial surface antigen (D15) family protein. 
J023007A20TGGGCTGCNONE 
J023028F19TGGGCTGCNONE 
J023081E20TGGGCTGCNONE 
J023089D13TGGGCTGCNONE 
J023115D18TGGGCTGCNONE 
J033087E22TGGGCTGCNONE 
J033143O14TGGGCTGCNONE 
Os05g0482400AK109526GCAGCCCAACCCytochrome P450 family protein. 
Os05g0495100AK108028GCAGCCCAConserved hypothetical protein. 
Os05g0500500AK110627GCAGCCCAGTAHSP20-like chaperone domain containing protein. 
Os05g0535700009-067-F01GCAGCCCAAGCCCAAGCCCAAGNONE 
AK061590GCAGCCCAAGCCCAAGCCCAAGNONE 
AK062545GCAGCCCAAGCCCAAGCCCAAGConserved hypothetical protein. 
Os05g0559900AK067197GCAGCCCAAATtRNA-binding arm domain containing protein. 
J013074C15GCAGCCCAAATNONE 
J013098O16GCAGCCCAAATNONE 
J033030M01GCAGCCCAAATNONE 
J090058H12GCAGCCCAAATNONE 
J090075M06GCAGCCCAAATNONE 
Os05g0591600Os05g0591600GTTGGGCTGCSimilar to Lysine decarboxylase-like protein. 
Os06g0101600AF093636AATGGGCTGCNONE 
AK070447AATGGGCTGCPlastocyanin, chloroplast precursor. 
J065001A20AATGGGCTGCNONE 
J065019M17AATGGGCTGCNONE 
J065021H18AATGGGCTGCNONE 
J065061A17AATGGGCTGCNONE 
J065073L02AATGGGCTGCNONE 
J065099F17AATGGGCTGCNONE 
J065101C23AATGGGCTGCNONE 
J065121E23AATGGGCTGCNONE 
J065122N04AATGGGCTGCNONE 
J065141N05AATGGGCTGCNONE 
J065143N21AATGGGCTGCNONE 
J065161H09AATGGGCTGCNONE 
J065161J04AATGGGCTGCNONE 
J065162P20AATGGGCTGCNONE 
J065182K10AATGGGCTGCNONE 
J065184M05AATGGGCTGCNONE 
J065186H24AATGGGCTGCNONE 
J065189G21AATGGGCTGCNONE 
J065190N14AATGGGCTGCNONE 
J065191H08AATGGGCTGCNONE 
J065205H17AATGGGCTGCNONE 
J075001E03AATGGGCTGCNONE 
J075001H21AATGGGCTGCNONE 
J075003J23AATGGGCTGCNONE 
J075003K01AATGGGCTGCNONE 
J075005I11AATGGGCTGCNONE 
J075007F16AATGGGCTGCNONE 
J075017I11AATGGGCTGCNONE 
J075018O05AATGGGCTGCNONE 
J075019G24AATGGGCTGCNONE 
J075032D04AATGGGCTGCNONE 
J075032N13AATGGGCTGCNONE 
J075033C09AATGGGCTGCNONE 
J075033D11AATGGGCTGCNONE 
J075039A20AATGGGCTGCNONE 
J075058P12AATGGGCTGCNONE 
J075062E10AATGGGCTGCNONE 
J075062P16AATGGGCTGCNONE 
J075063C17AATGGGCTGCNONE 
J075066E07AATGGGCTGCNONE 
J075066I20AATGGGCTGCNONE 
J075075K21AATGGGCTGCNONE 
J075078F03AATGGGCTGCNONE 
J075082F10AATGGGCTGCNONE 
J075086G16AATGGGCTGCNONE 
J075087E07AATGGGCTGCNONE 
J075087K06AATGGGCTGCNONE 
J075087L04AATGGGCTGCNONE 
J075088B16AATGGGCTGCNONE 
J075088D02AATGGGCTGCNONE 
J075094H21AATGGGCTGCNONE 
J075094I24AATGGGCTGCNONE 
J075094K10AATGGGCTGCNONE 
J075095C18AATGGGCTGCNONE 
J075097B05AATGGGCTGCNONE 
J075099C13AATGGGCTGCNONE 
J075099H22AATGGGCTGCNONE 
J075099L16AATGGGCTGCNONE 
J075104K08AATGGGCTGCNONE 
J075118O06AATGGGCTGCNONE 
J075119E15AATGGGCTGCNONE 
J075124N06AATGGGCTGCNONE 
J075126G02AATGGGCTGCNONE 
J075127L24AATGGGCTGCNONE 
J075131E23AATGGGCTGCNONE 
J075140H06AATGGGCTGCNONE 
J075146I20AATGGGCTGCNONE 
J075146N24AATGGGCTGCNONE 
J075147I19AATGGGCTGCNONE 
J075155K07AATGGGCTGCNONE 
J075156C05AATGGGCTGCNONE 
J075161G07AATGGGCTGCNONE 
J075164G01AATGGGCTGCNONE 
J075170J18AATGGGCTGCNONE 
J075172G17AATGGGCTGCNONE 
J075176G10AATGGGCTGCNONE 
J075178C05AATGGGCTGCNONE 
J075179G01AATGGGCTGCNONE 
J075181E24AATGGGCTGCNONE 
J080029D19AATGGGCTGCNONE 
J080034L11AATGGGCTGCNONE 
J080039G07AATGGGCTGCNONE 
J080062M23AATGGGCTGCNONE 
J080302A01AATGGGCTGCNONE 
J100042I15AATGGGCTGCNONE 
J100043G22AATGGGCTGCNONE 
J100056L12AATGGGCTGCNONE 
J100061A12AATGGGCTGCNONE 
J100073O20AATGGGCTGCNONE 
J100082I08AATGGGCTGCNONE 
Os06g0140100011-063-A02GCAGCCCAATNONE 
AK063371GCAGCCCAATLeucine carboxyl methyltransferase family protein. 
Os06g0143700AK067270GCAGCCCAGTASimilar to Sulfate transporter 2. 
J013098O05GCAGCCCAGTANONE 
J065017H17GCAGCCCAGTANONE 
Os06g0183100AK073624CTGGGCTGCNONE 
AK101165CTGGGCTGCNONE 
AK102959CTGGGCTGCSimilar to Two-component response regulator ARR14. 
J013055G23CTGGGCTGCNONE 
J033028D10CTGGGCTGCNONE 
J033107A11CTGGGCTGCNONE 
J033115H14CTGGGCTGCNONE 
J043013A11CTGGGCTGCNONE 
J065111E06CTGGGCTGCNONE 
J100018K01CTGGGCTGCNONE 
J100088B08CTGGGCTGCNONE 
J100089C02CTGGGCTGCNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0257200J053059P05GCAGCCCAATNONE 
J075006K03GCAGCCCAATNONE 
J075067F07GCAGCCCAATNONE 
J075068F14GCAGCCCAATNONE 
J075068H14GCAGCCCAATNONE 
J075098N06GCAGCCCAATNONE 
J075099F08GCAGCCCAATNONE 
J075154G24GCAGCCCAATNONE 
J075195H09GCAGCCCAATNONE 
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE 
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein. 
AK121899GCAGCCCACCCGACTGGGCCGGTNONE 
Os06g0673500J100018J12GCAGCCCAAATNONE 
J100072F13GCAGCCCAAATSimilar to Ubiquitin. 
Os06g0674800J065007E09GCAGCCCAAGNONE 
J065037D21GCAGCCCAAGHypothetical protein. 
J065063P14GCAGCCCAAGNONE 
J065128K24GCAGCCCAAGNONE 
J065188F06GCAGCCCAAGNONE 
J065199I24GCAGCCCAAGNONE 
J065214N19GCAGCCCAAGNONE 
Os07g0106000015-044-D09TGATGGGCTGCNONE 
AK064319TGATGGGCTGCNONE 
Os07g0122300015-004-G08GCAGCCCATGGGCCTTNONE 
AK103212GCAGCCCATGGGCCTTNONE 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09GCAGCCCATGGGCCTTNONE 
J090007P13GCAGCCCATGGGCCTTNONE 
Os07g0123300AK108490GCAGCCCATCAConserved hypothetical protein. 
J065197L01GCAGCCCATCANONE 
J065206N07GCAGCCCATCANONE 
J080011N05GCAGCCCATCANONE 
J080021N11GCAGCCCATCANONE 
J080025M24GCAGCCCATCANONE 
J080031E13GCAGCCCATCANONE 
J080047B07GCAGCCCATCANONE 
J080061L03GCAGCCCATCANONE 
J080062C18GCAGCCCATCANONE 
J080063E20GCAGCCCATCANONE 
J080063O12GCAGCCCATCANONE 
J080070D20GCAGCCCATCANONE 
J080074J17GCAGCCCATCANONE 
J080076K17GCAGCCCATCANONE 
J080079K21GCAGCCCATCANONE 
J080080D02GCAGCCCATCANONE 
J080088E12GCAGCCCATCANONE 
J080092I18GCAGCCCATCANONE 
Os07g0187300AK103069GCAGCCCATCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12GCAGCCCATCTNONE 
J033117P16GCAGCCCATCTNONE 
Os07g0198300006-052-H02GCAGCCCAGCCNONE 
009-097-B09GCAGCCCAGCCNONE 
009-116-E02GCAGCCCAGCCNONE 
009-186-A12GCAGCCCAGCCNONE 
AK060951GCAGCCCAGCCPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK071830GCAGCCCAGCCNONE 
J023117F24GCAGCCCAGCCNONE 
J065073D24GCAGCCCAGCCNONE 
J065116O11GCAGCCCAGCCNONE 
J065122C11GCAGCCCAGCCNONE 
Os07g0240400009-080-C04GCAGCCCAGCNONE 
AK062643GCAGCCCAGCConserved hypothetical protein. 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0421300AK121014GCAGCCCACCSimilar to Alpha glucosidase-like protein. 
Os07g0545400009-136-E03GCAGCCCACAGGCCGAGANONE 
013-015-G08GCAGCCCACAGGCCGAGANONE 
AK059228GCAGCCCACAGGCCGAGANONE 
J065040D09GCAGCCCACAGGCCGAGANONE 
J065051C19GCAGCCCACAGGCCGAGANONE 
J065139B05GCAGCCCACAGGCCGAGANONE 
J065160E20GCAGCCCACAGGCCGAGANONE 
J065207I17GCAGCCCACAGGCCGAGANONE 
J080319M24GCAGCCCACAGGCCGAGANONE 
Os07g0561300AK072982ACGTGGGCTGCCyclin-like F-box domain containing protein. 
J023149I22ACGTGGGCTGCNONE 
J065149C18ACGTGGGCTGCNONE 
J065166N15ACGTGGGCTGCNONE 
J075011J01ACGTGGGCTGCNONE 
J075013I05ACGTGGGCTGCNONE 
J075039H11ACGTGGGCTGCNONE 
J075067J09ACGTGGGCTGCNONE 
J075084E08ACGTGGGCTGCNONE 
J075085E12ACGTGGGCTGCNONE 
J075090D11ACGTGGGCTGCNONE 
J075092D12ACGTGGGCTGCNONE 
J075126N17ACGTGGGCTGCNONE 
J075179F01ACGTGGGCTGCNONE 
J075184P21ACGTGGGCTGCNONE 
Os07g0695400015-036-B08ACGTGGGCTGCNONE 
015-036-B08GCTGGGCTGCTGGCCCATGGNONE 
AK100615ACGTGGGCTGCNONE 
AK100615GCTGGGCTGCTGGCCCATGGNONE 
AK106304ACGTGGGCTGCKIP1-like domain containing protein. 
AK106304GCTGGGCTGCTGGCCCATGGKIP1-like domain containing protein. 
J023108B01ACGTGGGCTGCNONE 
J023108B01GCTGGGCTGCTGGCCCATGGNONE 
Os08g0135900AK069187GTTTGGGCTGCNONE 
Os08g0172300AK111274GCAGCCCAAAHAT dimerisation domain containing protein. 
J065184J06GCAGCCCAAANONE 
Os08g0299000AK061379GCAGCCCAAACNONE 
AK099389GCAGCCCAAACNONE 
AK101640GCAGCCCAAACProtein of unknown function DUF52 domain containing protein. 
J013100G13GCAGCCCAAACNONE 
J013153N09GCAGCCCAAACNONE 
J023097N06GCAGCCCAAACNONE 
J023123C12GCAGCCCAAACNONE 
J033088G14GCAGCCCAAACNONE 
J065033G10GCAGCCCAAACNONE 
J065128B01GCAGCCCAAACNONE 
J100085I01GCAGCCCAAACNONE 
Os08g0322400AK120116TGGTGGGCTGCATGGGCTGCNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20TGGTGGGCTGCATGGGCTGCNONE 
J013096J15TGGTGGGCTGCATGGGCTGCNONE 
Os08g0387050J043038F21CTTGGGCTGCConserved hypothetical protein. 
Os08g0387200AK120787TAATGGGCTGCProtein of unknown function DUF81 family protein. 
Os08g0414300AK072217GCAGCCCACGAConserved hypothetical protein. 
J065039C07GCAGCCCACGANONE 
J065098N11GCAGCCCACGANONE 
J065120J15GCAGCCCACGANONE 
J075076H12GCAGCCCACGANONE 
J075101N16GCAGCCCACGANONE 
J080010A07GCAGCCCACGANONE 
J080023C16GCAGCCCACGANONE 
J080027G22GCAGCCCACGANONE 
J080053D02GCAGCCCACGANONE 
J080065E17GCAGCCCACGANONE 
J080068C15GCAGCCCACGANONE 
J090061J10GCAGCCCACGANONE 
Os08g0468400011-057-F06GCAGCCCATACNONE 
AK063363GCAGCCCATACHEC/Ndc80p family protein. 
J100048N11GCAGCCCATACNONE 
Os08g0471900015-099-E10GCAGCCCAGNONE 
AK069434GCAGCCCAGZinc finger, ZPR1-type domain containing protein. 
Os08g0494300AK066150GCAGCCCAAATvon Willebrand factor, type A domain containing protein. 
Os08g0544500AK071354GCAGCCCACAASimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0558400AK071334GGTTGGGCCGCAGCCCACAASimilar to Kinesin heavy chain (Fragment). 
Os08g0565800009-034-G02AATTGGGCTGCNONE 
009-111-D12AATTGGGCTGCNONE 
AK062431AATTGGGCTGCSimilar to Glutaredoxin. 
AK062820AATTGGGCTGCNONE 
J075022E05AATTGGGCTGCNONE 
J075066F07AATTGGGCTGCNONE 
J075146B21AATTGGGCTGCNONE 
Os09g0115500006-023-A12GCAGCCCAGCCNONE 
006-042-G01GCAGCCCAGCCNONE 
AK061717GCAGCCCAGCCCBS domain containing protein. 
AK065986GCAGCCCAGCCNONE 
J013043C13GCAGCCCAGCCNONE 
J013111D13GCAGCCCAGCCNONE 
J023114K12GCAGCCCAGCCNONE 
J065102N18GCAGCCCAGCCNONE 
Os09g0332100009-067-H06CTTGGGCTGCNONE 
009-092-B11CTTGGGCTGCNONE 
009-094-D10CTTGGGCTGCNONE 
009-095-C09CTTGGGCTGCNONE 
009-147-F07CTTGGGCTGCNONE 
AK069759CTTGGGCTGCConserved hypothetical protein. 
J080092G16CTTGGGCTGCNONE 
J090053I07CTTGGGCTGCNONE 
Os09g0341500AK073913GCAGCCCATTTConserved hypothetical protein. 
J033076F19GCAGCCCATTTNONE 
J100085E04GCAGCCCATTTNONE 
Os09g0449400J023086D02GCAGCCCACAAZinc finger, C2H2-type domain containing protein. 
Os09g0458400AK070055AGTTGGGCAGCCCACGAAConserved hypothetical protein. 
AK120321AGTTGGGCAGCCCACGAANONE 
J065064N11AGTTGGGCAGCCCACGAANONE 
J065083J06AGTTGGGCAGCCCACGAANONE 
J065121D24AGTTGGGCAGCCCACGAANONE 
J065156I22AGTTGGGCAGCCCACGAANONE 
J065163J24AGTTGGGCAGCCCACGAANONE 
J075001I02AGTTGGGCAGCCCACGAANONE 
J090088O06AGTTGGGCAGCCCACGAANONE 
Os09g0475700AK101979AGTTGGGCTGCNONE 
Os09g0489500AK100210GCAGCCCAGSimilar to Transcription factor HBP-1b(C38) (Fragment). 
AK103174GCAGCCCAGNONE 
Os09g0510000AK121614GCAGCCCACTTGTTGGGCCTCConserved hypothetical protein. 
J033043O11GCAGCCCACTTGTTGGGCCTCNONE 
J065113F04GCAGCCCACTTGTTGGGCCTCNONE 
J080044D13GCAGCCCACTTGTTGGGCCTCNONE 
Os09g0517800012-034-H10TTGTGGGCTGCNONE 
AK121391TTGTGGGCTGCCyclin-like F-box domain containing protein. 
J023129D04TTGTGGGCTGCNONE 
J043012D11TTGTGGGCTGCNONE 
Os09g0553200003-101-F12GCAGCCCAATNONE 
003-125-E09GCAGCCCAATNONE 
011-031-H12GCAGCCCAATNONE 
012-033-A01GCAGCCCAATNONE 
015-046-H04GCAGCCCAATNONE 
015-056-F04GCAGCCCAATNONE 
016-029-H06GCAGCCCAATNONE 
016-080-D05GCAGCCCAATNONE 
AB062606GCAGCCCAATNONE 
AK065780GCAGCCCAATSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930GCAGCCCAATNONE 
AK104344GCAGCCCAATNONE 
AK119197GCAGCCCAATNONE 
AK119232GCAGCCCAATNONE 
J013039M01GCAGCCCAATNONE 
J013043M01GCAGCCCAATNONE 
J013064F03GCAGCCCAATNONE 
J013066K19GCAGCCCAATNONE 
J013092G12GCAGCCCAATNONE 
J013123P09GCAGCCCAATNONE 
J013155F01GCAGCCCAATNONE 
J013158J12GCAGCCCAATNONE 
J013159H14GCAGCCCAATNONE 
J013169C10GCAGCCCAATNONE 
J013170L23GCAGCCCAATNONE 
J023010J18GCAGCCCAATNONE 
J023019E23GCAGCCCAATNONE 
J023045B14GCAGCCCAATNONE 
J023082K24GCAGCCCAATNONE 
J023086G04GCAGCCCAATNONE 
J023090N09GCAGCCCAATNONE 
J023113C08GCAGCCCAATNONE 
J023125H18GCAGCCCAATNONE 
J033034M08GCAGCCCAATNONE 
J033035K03GCAGCCCAATNONE 
J033039D15GCAGCCCAATNONE 
J033045P18GCAGCCCAATNONE 
J033058P08GCAGCCCAATNONE 
J033061D16GCAGCCCAATNONE 
J033070F14GCAGCCCAATNONE 
J033086F23GCAGCCCAATNONE 
J033095C05GCAGCCCAATNONE 
J033114H22GCAGCCCAATNONE 
J033133M20GCAGCCCAATNONE 
J043026G01GCAGCCCAATNONE 
J043037F17GCAGCCCAATNONE 
J065120K17GCAGCCCAATNONE 
J065123O07GCAGCCCAATNONE 
J080305H06GCAGCCCAATNONE 
J090001F11GCAGCCCAATNONE 
J090020C17GCAGCCCAATNONE 
J090043A19GCAGCCCAATNONE 
J090051J17GCAGCCCAATNONE 
J090068K06GCAGCCCAATNONE 
J090075P19GCAGCCCAATNONE 
J100036G10GCAGCCCAATNONE 
J100084F02GCAGCCCAATNONE 
Os09g0557400AK099503GCAGCCCAGMitochondrial glycoprotein family protein. 
J065138P07GCAGCCCAGNONE 
J075092A17GCAGCCCAGNONE 
Os09g0560600AK071381ATTTGGGCTGCNONE 
J023089I18ATTTGGGCTGCNONE 
J075015L11ATTTGGGCTGCNONE 
J075038B17ATTTGGGCTGCNONE 
J075059J18ATTTGGGCTGCNONE 
J075077H09ATTTGGGCTGCNONE 
J075091F07ATTTGGGCTGCNONE 
J075100O20ATTTGGGCTGCNONE 
J075118G11ATTTGGGCTGCNONE 
J075149F18ATTTGGGCTGCNONE 
J075156B19ATTTGGGCTGCNONE 
J075185L12ATTTGGGCTGCNONE 
J075189N02ATTTGGGCTGCNONE 
J075196A12ATTTGGGCTGCNONE 
J090024N23ATTTGGGCTGCNONE 
Os11g0181500006-025-C02GCAGCCCAAANONE 
AK060074GCAGCCCAAANONE 
AK067601GCAGCCCAAASimilar to Nitrogen fixation like protein. 
Os11g0616200AK069189ATATGGGCTGCConserved hypothetical protein. 
J023004N19ATATGGGCTGCNONE 
Os12g0124400AK071024GCAGCCCACGAExostosin-like family protein. 
Os12g0127500AK064595GCAGCCCAATConserved hypothetical protein. 
J065067F11GCAGCCCAATNONE 
J090007D02GCAGCCCAATNONE 
J100035G10GCAGCCCAATNONE 
J100077J10GCAGCCCAATNONE 
Os12g0151500AK058389GCAGCCCAACCACACACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GCAGCCCAACCACACACCNONE 
Os12g0550800006-091-A05GCAGCCCAGNONE 
AK061828GCAGCCCAGNONE 
AK098944GCAGCCCAGNONE 
AK102550GCAGCCCAGHypothetical protein. 
J013045G24GCAGCCCAGNONE 
J065156K11GCAGCCCAGNONE 
J065201E21GCAGCCCAGNONE 
Os12g0572400016-084-F04GCAGCCCAAACATATGGGCCGCANONE 
AK065531GCAGCCCAAACATATGGGCCGCASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03GCAGCCCAAACATATGGGCCGCANONE 
J013034H02GCAGCCCAAACATATGGGCCGCANONE 
J033117N05GCAGCCCAAACATATGGGCCGCANONE 
J065027L09GCAGCCCAAACATATGGGCCGCANONE 
J065037D09GCAGCCCAAACATATGGGCCGCANONE 
J065197I09GCAGCCCAAACATATGGGCCGCANONE 
J090045C01GCAGCCCAAACATATGGGCCGCANONE 
J100031E11GCAGCCCAAACATATGGGCCGCANONE 
Os12g0630600J100033A04GCAGCCCATCTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.