version

Summary of OsREG592 (All List)

OrganismOryza sativa  
IDOsREG592  
SequenceGCCCAAAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2363  

Entry Sequences (2363 entries)

LocusGene modelSequenceDescription
Os01g0184800AK073377GAGGCCCAAAAPhosducin family protein. 
AK102544GAGGCCCAAAANONE 
J023047L21GAGGCCCAAAANONE 
J023135I09GAGGCCCAAAANONE 
J033028G17GAGGCCCAAAANONE 
J065164L07GAGGCCCAAAANONE 
J065193F22GAGGCCCAAAANONE 
J075035I10GAGGCCCAAAANONE 
J075168H15GAGGCCCAAAANONE 
Os01g0219500AK106863TTTTGGGCCGTTNONE 
AK109524TTTTGGGCCGTTPlant lipid transfer protein/Par allergen family protein. 
J075053J18TTTTGGGCCGTTNONE 
J080023G09TTTTGGGCCGTTNONE 
J080051F19TTTTGGGCCGTTNONE 
J080085H15TTTTGGGCCGTTNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
AK069972CCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075090M12CCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12CCAAGCCCAAAANONE 
Os01g0233500AB024986TAGGCCCAAAANONE 
AK063476TAGGCCCAAAACyclin. 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0250600J075046P13AAGGCCCAAAANONE 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
AK107814TGCGGCCCAAAASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
J065112H10TGCGGCCCAAAANONE 
Os01g0303100009-049-H10TTTTGGGCCTANONE 
AK062603TTTTGGGCCTASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0305900Os01g0305900ACAGCCCAAAASimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
AK104939TTTTGGGCCCACCACNONE 
J033044B03TTTTGGGCCCACCACNONE 
J033060E12TTTTGGGCCCACCACNONE 
J043037E21TTTTGGGCCCACCACNONE 
J065019O18TTTTGGGCCCACCACNONE 
J065025P22TTTTGGGCCCACCACNONE 
J065042P06TTTTGGGCCCACCACNONE 
J065074C19TTTTGGGCCCACCACNONE 
J065074E13TTTTGGGCCCACCACNONE 
J065094E05TTTTGGGCCCACCACNONE 
J065108N08TTTTGGGCCCACCACNONE 
J065134L13TTTTGGGCCCACCACNONE 
J065152N24TTTTGGGCCCACCACNONE 
J065162N24TTTTGGGCCCACCACNONE 
J065170P16TTTTGGGCCCACCACNONE 
J065177M20TTTTGGGCCCACCACNONE 
J065187N01TTTTGGGCCCACCACNONE 
J075012N12TTTTGGGCCCACCACNONE 
J075046C17TTTTGGGCCCACCACNONE 
J075055N06TTTTGGGCCCACCACNONE 
J075141H03TTTTGGGCCCACCACNONE 
J075150M11TTTTGGGCCCACCACNONE 
J090005B16TTTTGGGCCCACCACNONE 
J090079L11TTTTGGGCCCACCACNONE 
J100039F16TTTTGGGCCCACCACNONE 
Os01g0332100AK120720AGCCCAAAASimilar to Neutral invertase-like protein (Fragment). 
AY187621AGCCCAAAANONE 
J080021I24AGCCCAAAANONE 
Os01g0349000AK108540TAAGCCCAAAAConserved hypothetical protein. 
J065059M15TAAGCCCAAAANONE 
Os01g0374000J075056E14TTTTGGGCNONE 
J075080L13TTTTGGGCNONE 
J075176C11TTTTGGGCSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
Os01g0513700AK058445GCCCAAAANONE 
AK068877GCCCAAAASybindin-like protein family protein. 
J023001F01GCCCAAAANONE 
J065065I18GCCCAAAANONE 
J065165A09GCCCAAAANONE 
J065184N12GCCCAAAANONE 
J065205M05GCCCAAAANONE 
J075172I17GCCCAAAANONE 
J090025O09GCCCAAAANONE 
J100087H03GCCCAAAANONE 
Os01g0530366J075001P06CTCGGCCCAAAANONE 
J075006K21CTCGGCCCAAAARNA polymerase Rbp10 domain containing protein. 
J075030G13CTCGGCCCAAAANONE 
Os01g0533900AK101194TAGGCCCAAAASimilar to Multidrug resistance protein 1 homolog. 
Os01g0555100AK111255TCAGCCCAAAASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0623500AK066142TTTTGGGCCAAAAA ATPase domain containing protein. 
J013055O07TTTTGGGCCAANONE 
J053069D06TTTTGGGCCAANONE 
J053095J11TTTTGGGCCAANONE 
J065106D24TTTTGGGCCAANONE 
J065134H18TTTTGGGCCAANONE 
J075066D09TTTTGGGCCAANONE 
J090004M17TTTTGGGCCAANONE 
J100039L05TTTTGGGCCAANONE 
J100042E15TTTTGGGCCAANONE 
J100043B18TTTTGGGCCAANONE 
J100057L11TTTTGGGCCAANONE 
J100067C24TTTTGGGCCAANONE 
J100073H01TTTTGGGCCAANONE 
J100081J21TTTTGGGCCAANONE 
Os01g0626300016-070-G04TTTTGGGCCCATCANONE 
AK122071TTTTGGGCCCATCASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04TTTTGGGCCCATCANONE 
J033117J08TTTTGGGCCCATCANONE 
J065007O12TTTTGGGCCCATCANONE 
J065020K12TTTTGGGCCCATCANONE 
J065142D24TTTTGGGCCCATCANONE 
J065157K19TTTTGGGCCCATCANONE 
J080307H19TTTTGGGCCCATCANONE 
J080311D16TTTTGGGCCCATCANONE 
J080316C12TTTTGGGCCCATCANONE 
J080316E03TTTTGGGCCCATCANONE 
J100033K16TTTTGGGCCCATCANONE 
J100042J21TTTTGGGCCCATCANONE 
J100051E06TTTTGGGCCCATCANONE 
J100071E22TTTTGGGCCCATCANONE 
Os01g0637600AK106980GCCCAAAASimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase). 
AK106980GCCCAAAASimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase). 
Os01g0642900009-109-F01GAGGCCCAAAANONE 
AK063836GAGGCCCAAAASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560GAGGCCCAAAANONE 
J033043K18GAGGCCCAAAANONE 
J100023C05GAGGCCCAAAANONE 
J100038C15GAGGCCCAAAANONE 
J100039C23GAGGCCCAAAANONE 
Os01g0649900AK068077TTTTGGGCTTTTLipolytic enzyme, G-D-S-L family protein. 
Os01g0680400AK067914CCCGGCCCAAAATAFII28-like protein family protein. 
J065039K13CCCGGCCCAAAANONE 
J065042K22CCCGGCCCAAAANONE 
J080016E23CCCGGCCCAAAANONE 
J080064E22CCCGGCCCAAAANONE 
Os01g0681100016-048-E04TTTTGGGCCTTGNONE 
AK072230TTTTGGGCCTTGSimilar to Dynamin-related protein 1B (Dynamin-like protein B). 
J023002D21TTTTGGGCCTTGNONE 
J033136O22TTTTGGGCCTTGNONE 
Os01g0695200015-090-F01GAGGCCCAAAANONE 
AK064145GAGGCCCAAAAProtein of unknown function DUF266, plant family protein. 
J065163N10GAGGCCCAAAANONE 
J100051F21GAGGCCCAAAANONE 
Os01g0710800013-097-E05TTTTGGGCCTTAGGCCCATATNONE 
AK069973TTTTGGGCCTTAGGCCCATATNONE 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
J023081K01TTTTGGGCCTTAGGCCCATATNONE 
J023123E16TTTTGGGCCTTAGGCCCATATNONE 
J033066B11TTTTGGGCCTTAGGCCCATATNONE 
J065144G11TTTTGGGCCTTAGGCCCATATNONE 
Os01g0736100011-091-H04TTTTGGGCTTTTNONE 
015-004-D10TTTTGGGCTTTTNONE 
AK064298TTTTGGGCTTTTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365TTTTGGGCTTTTNONE 
AK103355TTTTGGGCTTTTNONE 
J033044B20TTTTGGGCTTTTNONE 
J033094G06TTTTGGGCTTTTNONE 
J033111N02TTTTGGGCTTTTNONE 
J033111P10TTTTGGGCTTTTNONE 
J033126K03TTTTGGGCTTTTNONE 
J043034D12TTTTGGGCTTTTNONE 
Os01g0765000AK101905TTTTGGGCCGASimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0812200003-009-E06GCCCAAAACGCACGCGNONE 
AK072651GCCCAAAACGCACGCGCyclin-like F-box domain containing protein. 
AK104334GCCCAAAACGCACGCGNONE 
J013030E13GCCCAAAACGCACGCGNONE 
J013169M21GCCCAAAACGCACGCGNONE 
J023012J16GCCCAAAACGCACGCGNONE 
J023103F22GCCCAAAACGCACGCGNONE 
J023123A01GCCCAAAACGCACGCGNONE 
J023131F07GCCCAAAACGCACGCGNONE 
J023146I01GCCCAAAACGCACGCGNONE 
J033040K02GCCCAAAACGCACGCGNONE 
J033079F06GCCCAAAACGCACGCGNONE 
J033105G06GCCCAAAACGCACGCGNONE 
J033117E08GCCCAAAACGCACGCGNONE 
J043030C01GCCCAAAACGCACGCGNONE 
J053043H16GCCCAAAACGCACGCGNONE 
J053061H01GCCCAAAACGCACGCGNONE 
J065044A03GCCCAAAACGCACGCGNONE 
J065068E12GCCCAAAACGCACGCGNONE 
J065069D09GCCCAAAACGCACGCGNONE 
J065143M19GCCCAAAACGCACGCGNONE 
J065193C10GCCCAAAACGCACGCGNONE 
J065209D07GCCCAAAACGCACGCGNONE 
J090083C17GCCCAAAACGCACGCGNONE 
J090086G06GCCCAAAACGCACGCGNONE 
J090093I09GCCCAAAACGCACGCGNONE 
J100023G21GCCCAAAACGCACGCGNONE 
J100025D15GCCCAAAACGCACGCGNONE 
J100034B13GCCCAAAACGCACGCGNONE 
J100040F10GCCCAAAACGCACGCGNONE 
J100051E15GCCCAAAACGCACGCGNONE 
J100056L08GCCCAAAACGCACGCGNONE 
J100057H04GCCCAAAACGCACGCGNONE 
J100085K20GCCCAAAACGCACGCGNONE 
J100088G21GCCCAAAACGCACGCGNONE 
Os01g0814400006-047-D09TTTTGGGCNONE 
006-077-D12TTTTGGGCNONE 
AK061117TTTTGGGCNONE 
AK104661TTTTGGGCNONE 
Os01g0829400AK109566AAAAGCCCAAAAGlutaredoxin domain containing protein. 
Os01g0836400AK073540TTTTGGGCTSAC3/GANP family protein. 
J023019D11TTTTGGGCTNONE 
J023139O22TTTTGGGCTNONE 
J033042J20TTTTGGGCTNONE 
J033046M18TTTTGGGCTNONE 
J033124J09TTTTGGGCTNONE 
J090015E05TTTTGGGCTNONE 
J090076J09TTTTGGGCTNONE 
Os01g0863300014-030-D08GCCCAAAANONE 
AK111571GCCCAAAASimilar to MCB2 protein. 
J013071A13GCCCAAAANONE 
J075060E09GCCCAAAANONE 
J075138C14GCCCAAAANONE 
J075150M17GCCCAAAANONE 
Os01g0866200009-039-E12GCCCAAAANONE 
J065059P16GCCCAAAANONE 
J065063E21GCCCAAAANONE 
J065078B21GCCCAAAANONE 
J065079A11GCCCAAAANONE 
J065087H15GCCCAAAANONE 
J065137M10GCCCAAAANONE 
J065138K24GCCCAAAANONE 
J065142E08GCCCAAAANONE 
J065171G11GCCCAAAANONE 
J065183K15GCCCAAAANONE 
J065192J05GCCCAAAANONE 
J075151P09GCCCAAAANONE 
J090020B17GCCCAAAANONE 
J090067F15GCCCAAAANONE 
J090070K06GCCCAAAANONE 
J090094G13GCCCAAAANONE 
J100081M20GCCCAAAAHistone H3. 
J100089D06GCCCAAAANONE 
Os01g0866300006-087-C06GCCCAAAANONE 
006-114-E01GCCCAAAANONE 
J065202L13GCCCAAAANONE 
Os01g0868200AK067216TTTTGGGCNONE 
AK119393TTTTGGGCZinc finger, DHHC-type domain containing protein. 
Os01g0872700AK066633CTCGGCCCAAAANONE 
AK100381CTCGGCCCAAAAPutative 5-3 exonuclease domain containing protein. 
J013028K13CTCGGCCCAAAANONE 
J013038C19CTCGGCCCAAAANONE 
J023024P16CTCGGCCCAAAANONE 
J023074N21CTCGGCCCAAAANONE 
J023085E21CTCGGCCCAAAANONE 
J033034K14CTCGGCCCAAAANONE 
J033044N04CTCGGCCCAAAANONE 
J033052O10CTCGGCCCAAAANONE 
J033087J09CTCGGCCCAAAANONE 
J033129L17CTCGGCCCAAAANONE 
J033143O07CTCGGCCCAAAANONE 
J065014M22CTCGGCCCAAAANONE 
J065025H10CTCGGCCCAAAANONE 
J065051H21CTCGGCCCAAAANONE 
J065123E05CTCGGCCCAAAANONE 
J065181P03CTCGGCCCAAAANONE 
J100064B21CTCGGCCCAAAANONE 
Os01g0878400AK073884TTTTGGGCAmino acid/polyamine transporter II family protein. 
J065163K23TTTTGGGCNONE 
J065207H17TTTTGGGCNONE 
Os01g0888800AK070163TACGGCCCAAAAConserved hypothetical protein. 
J065181H02TACGGCCCAAAANONE 
Os01g0891400J065077E24TTGGCCCAAAAConserved hypothetical protein. 
J065077E24TTTTGGGCCGAAConserved hypothetical protein. 
J065206I07TTGGCCCAAAANONE 
J065206I07TTTTGGGCCGAANONE 
Os01g0915800AK103859AAAGCCCAAAASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20AAAGCCCAAAANONE 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03AAAGCCCAAAANONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14AAAGCCCAAAANONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16AAAGCCCAAAANONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19AAAGCCCAAAANONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14AAAGCCCAAAANONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0920200AK120182AAACGGCCCAAAASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14AAACGGCCCAAAANONE 
J013063O14AAACGGCCCAAAANONE 
J023023D20AAACGGCCCAAAANONE 
J075121J02AAACGGCCCAAAANONE 
Os01g0937300AK062872TTTTGGGCCTANONE 
J033136K12TTTTGGGCCTANONE 
J053048E20TTTTGGGCCTANONE 
J053088K08TTTTGGGCCTANONE 
J065011G23TTTTGGGCCTANONE 
J065202J09TTTTGGGCCTANONE 
Os01g0959900AK058375TTGGCCCAAAAConserved hypothetical protein. 
AK066497TTGGCCCAAAANONE 
Os01g0965400006-063-H08TTGGCCCAAAANONE 
011-037-A03TTGGCCCAAAANONE 
AK069647TTGGCCCAAAASimilar to Uridylate kinase (EC 2.7.4.-) (UK) (Uridine monophosphate kinase) (UMP kinase). 
AK104789TTGGCCCAAAANONE 
J013072N21TTGGCCCAAAANONE 
J023027E20TTGGCCCAAAANONE 
J023075O12TTGGCCCAAAANONE 
J033111H12TTGGCCCAAAANONE 
J080001F12TTGGCCCAAAANONE 
J080004J12TTGGCCCAAAANONE 
J080005N15TTGGCCCAAAANONE 
J080008D06TTGGCCCAAAANONE 
J080010I10TTGGCCCAAAANONE 
J080011D19TTGGCCCAAAANONE 
J080015G04TTGGCCCAAAANONE 
J080018O05TTGGCCCAAAANONE 
J080024K13TTGGCCCAAAANONE 
J080026M08TTGGCCCAAAANONE 
J080027H22TTGGCCCAAAANONE 
J080027L18TTGGCCCAAAANONE 
J080029C13TTGGCCCAAAANONE 
J080030A02TTGGCCCAAAANONE 
J080031C10TTGGCCCAAAANONE 
J080038L14TTGGCCCAAAANONE 
J080039B17TTGGCCCAAAANONE 
J080041C13TTGGCCCAAAANONE 
J080042A06TTGGCCCAAAANONE 
J080043L15TTGGCCCAAAANONE 
J080047C08TTGGCCCAAAANONE 
J080049C07TTGGCCCAAAANONE 
J080051M10TTGGCCCAAAANONE 
J080053F03TTGGCCCAAAANONE 
J080054B13TTGGCCCAAAANONE 
J080063K02TTGGCCCAAAANONE 
J080064L04TTGGCCCAAAANONE 
J080071B19TTGGCCCAAAANONE 
J080071M13TTGGCCCAAAANONE 
J080083P09TTGGCCCAAAANONE 
J080088G09TTGGCCCAAAANONE 
J080089I16TTGGCCCAAAANONE 
J080092E23TTGGCCCAAAANONE 
J080093B19TTGGCCCAAAANONE 
J080097H14TTGGCCCAAAANONE 
Os02g0133800006-092-D12TCGGCCCAAAANONE 
006-111-G01TCGGCCCAAAANONE 
AK103646TCGGCCCAAAANONE 
AK109376TCGGCCCAAAAProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886TCGGCCCAAAANONE 
J033135B19TCGGCCCAAAANONE 
J065200F01TCGGCCCAAAANONE 
J065213J11TCGGCCCAAAANONE 
J075031N16TCGGCCCAAAANONE 
J075032N17TCGGCCCAAAANONE 
J075047P04TCGGCCCAAAANONE 
J075063D01TCGGCCCAAAANONE 
J075105F23TCGGCCCAAAANONE 
J075121E16TCGGCCCAAAANONE 
J075176F10TCGGCCCAAAANONE 
J075182M16TCGGCCCAAAANONE 
J075190E09TCGGCCCAAAANONE 
J075191B14TCGGCCCAAAANONE 
J100055J24TCGGCCCAAAANONE 
J100066H24TCGGCCCAAAANONE 
J100073N01TCGGCCCAAAANONE 
Os02g0146700AK105609TTTTGGGCCACSimilar to PSMD2 subunit (Fragment). 
AK119490TTTTGGGCCACNONE 
AK121963TTTTGGGCCACNONE 
Os02g0174100006-035-F12AGCCCAAAANONE 
AK061484AGCCCAAAANONE 
AK062651AGCCCAAAANONE 
AK066057AGCCCAAAASBP domain containing protein. 
AK068702AGCCCAAAANONE 
J075009H13AGCCCAAAANONE 
J075031O22AGCCCAAAANONE 
J075128E09AGCCCAAAANONE 
Os02g0188500AK102004AAACGGCCCAAAANONE 
AK106917AAACGGCCCAAAAUbiquitin domain containing protein. 
J090039N13AAACGGCCCAAAANONE 
Os02g0190900AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02TTTTGGGCCCAACCConserved hypothetical protein. 
J075117E23TTTTGGGCCCAACCNONE 
J075117F23TTTTGGGCCCAACCNONE 
J075144M12TTTTGGGCCCAACCNONE 
J075145H10TTTTGGGCCCAACCNONE 
J075186B15TTTTGGGCCCAACCNONE 
Os02g0198600005-012-D12TTTTGGGCTTGNONE 
AK058299TTTTGGGCTTGNONE 
Os02g0209900Os02g0209900AAAGCCCAAAASyntaxin/epimorphin family protein. 
Os02g0241100Os02g0241100TTCGGCCCAAAAProtein kinase-like domain containing protein. 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0288200AK073147GCCCAAAANONE 
AK102886GCCCAAAAConserved hypothetical protein. 
Os02g0292800AK106941TTTTGGGCProtein of unknown function DUF599 family protein. 
Os02g0317800J033050F18TTTTGGGCCCAAGNONE 
J075032I21TTTTGGGCCCAAGNONE 
J075108K06TTTTGGGCCCAAGNONE 
J075120B04TTTTGGGCCCAAGNONE 
J080315C12TTTTGGGCCCAAGConserved hypothetical protein. 
J100056L07TTTTGGGCCCAAGNONE 
Os02g0452850J065026D13TTTTGGGCNONE 
J065194A21TTTTGGGCConserved hypothetical protein. 
Os02g0497700011-094-A10AAGGCCCAAAANONE 
012-073-H02AAGGCCCAAAANONE 
016-056-G05AAGGCCCAAAANONE 
AK070143AAGGCCCAAAANONE 
J023041O14AAGGCCCAAAANONE 
J023092H01AAGGCCCAAAANONE 
J033048A17AAGGCCCAAAANONE 
J033051K21AAGGCCCAAAANONE 
J033122D01AAGGCCCAAAANONE 
J090032E23AAGGCCCAAAANONE 
J090055K13AAGGCCCAAAANONE 
Os02g0517333AK105573TCAGCCCAAAANONE 
AK111331TCAGCCCAAAAConserved hypothetical protein. 
Os02g0562400AK106570TTTTGGGCAnkyrin repeat containing protein. 
J090082L20TTTTGGGCNONE 
Os02g0580900AK120486GTGGCCCAAAATGF-beta receptor, type I/II extracellular region family protein. 
J100082N03GTGGCCCAAAANONE 
Os02g0627100AK068993AGCCCAAAASimilar to Phenylalanine ammonia-lyase (EC 4.3.1.5). 
D21290AGCCCAAAANONE 
J023001A06AGCCCAAAANONE 
J065156K20AGCCCAAAANONE 
J065187O09AGCCCAAAANONE 
J100036D20AGCCCAAAANONE 
J100089I01AGCCCAAAANONE 
Os02g0629900AK108563AGCCCAAAAACGGCCCConserved hypothetical protein. 
J065138O07AGCCCAAAAACGGCCCNONE 
Os02g0638300AK107831AGGGCCCAAAASimilar to Ferredoxin-thioredoxin reductase, variable chain (FTR-V) (Ferredoxin- thioredoxin reductase subunit A) (FTR-A). 
Os02g0679500AK067772AGGGCCCAAAASimilar to Rac GTPase activating protein 1. 
AY364311AGGGCCCAAAANONE 
Os02g0694700AK106892TTTTGGGCRWD domain containing protein. 
Os02g0700100AK102954TTTTGGGCTGCSimilar to WD-repeat protein. 
Os02g0705300006-028-G05GCCCAAAATTTGGGCTNONE 
006-064-H09GCCCAAAATTTGGGCTNONE 
AK062089GCCCAAAATTTGGGCTNONE 
AK064855GCCCAAAATTTGGGCTNONE 
AK106164GCCCAAAATTTGGGCTTubby family protein. 
Os02g0709800AK068743GCCCAAAARabGAP/TBC domain containing protein. 
J013001O05GCCCAAAANONE 
J013155F06GCCCAAAANONE 
J013162A17GCCCAAAANONE 
J023056J02GCCCAAAANONE 
J023061O22GCCCAAAANONE 
J033065F09GCCCAAAANONE 
J065109H07GCCCAAAANONE 
J065212K11GCCCAAAANONE 
J090059P10GCCCAAAANONE 
J100039J04GCCCAAAANONE 
J100066I07GCCCAAAANONE 
J100076G23GCCCAAAANONE 
Os02g0732900AK065796TTTTGGGCCATProtein of unknown function DUF794, plant family protein. 
AK104342TTTTGGGCCATNONE 
Os02g0740300AK067833TAAGCCCATTTTGGGCCTGAAA ATPase domain containing protein. 
Os02g0744000AK064898CCAAGCCCAAAAConserved hypothetical protein. 
AK104827CCAAGCCCAAAANONE 
J013000L12CCAAGCCCAAAANONE 
J013156N02CCAAGCCCAAAANONE 
J065001H14CCAAGCCCAAAANONE 
J065038D18CCAAGCCCAAAANONE 
J065039I18CCAAGCCCAAAANONE 
J065047C13CCAAGCCCAAAANONE 
J065053J09CCAAGCCCAAAANONE 
J065064G03CCAAGCCCAAAANONE 
J065066M05CCAAGCCCAAAANONE 
J065068O10CCAAGCCCAAAANONE 
J065090H22CCAAGCCCAAAANONE 
J065113L19CCAAGCCCAAAANONE 
J065121M02CCAAGCCCAAAANONE 
J065122K23CCAAGCCCAAAANONE 
J065138C12CCAAGCCCAAAANONE 
J065153E14CCAAGCCCAAAANONE 
J065156N12CCAAGCCCAAAANONE 
J065158L20CCAAGCCCAAAANONE 
J065166I06CCAAGCCCAAAANONE 
J065174L15CCAAGCCCAAAANONE 
J065175N03CCAAGCCCAAAANONE 
J090092C23CCAAGCCCAAAANONE 
Os02g0753700009-083-H09TTGGCCCAAAANONE 
AK062661TTGGCCCAAAANONE 
AK103542TTGGCCCAAAAVQ domain containing protein. 
J100025D08TTGGCCCAAAANONE 
J100035B22TTGGCCCAAAANONE 
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE 
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE 
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE 
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE 
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE 
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE 
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE 
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE 
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE 
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE 
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE 
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE 
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE 
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE 
Os02g0767900009-154-G01TTTTGGGCCCATAANONE 
009-154-G01TTTTGGGCCCATATNONE 
009-172-H09TTTTGGGCCCATAANONE 
009-172-H09TTTTGGGCCCATATNONE 
AK099885TTTTGGGCCCATAAGlutaredoxin 2 family protein. 
AK099885TTTTGGGCCCATATGlutaredoxin 2 family protein. 
Os02g0769800009-140-D12TTTTGGGCTTGNONE 
AK062956TTTTGGGCTTGSimilar to Mitogen-activated protein kinase kinase kinase 1 (EC 2.7.1.-) (Arabidospsis NPK1-related protein kinase 1). Splice isoform 1S. 
Os02g0770000006-065-A12AGCCCAAAANONE 
AB026563AGCCCAAAANONE 
AK059837AGCCCAAAANONE 
AK103425AGCCCAAAABeta 1 subunit of 20S proteasome. 
AK104505AGCCCAAAANONE 
J023150K14AGCCCAAAANONE 
J033128K18AGCCCAAAANONE 
J043022N12AGCCCAAAANONE 
J065007E07AGCCCAAAANONE 
J065029G17AGCCCAAAANONE 
J065137H11AGCCCAAAANONE 
J065138C23AGCCCAAAANONE 
J065187H11AGCCCAAAANONE 
J065203L18AGCCCAAAANONE 
J090041B22AGCCCAAAANONE 
Os02g0791200AK120632TTTTGGGCCAAZinc finger, RING-type domain containing protein. 
J013153H21TTTTGGGCCAANONE 
J075179E08TTTTGGGCCAANONE 
J075181C07TTTTGGGCCAANONE 
Os02g0804300006-046-D12TTTTGGGCCTTNONE 
AK060165TTTTGGGCCTTNONE 
AK067584TTTTGGGCCTTSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TTTTGGGCCTTNONE 
J023098C22TTTTGGGCCTTNONE 
J033123P06TTTTGGGCCTTNONE 
J065060N24TTTTGGGCCTTNONE 
J065069H22TTTTGGGCCTTNONE 
J065155N20TTTTGGGCCTTNONE 
J065170K07TTTTGGGCCTTNONE 
J090033D12TTTTGGGCCTTNONE 
Os02g0814300AK111376TTTTGGGCCAGCytochrome c, monohaem domain containing protein. 
J065063I24TTTTGGGCCAGNONE 
Os02g0830100J013032G02TAAGCCCAAAANONE 
J013052O21TAAGCCCAAAANONE 
J023078A05TAAGCCCAAAANONE 
J033114C07TAAGCCCAAAANONE 
J033125M07TAAGCCCAAAANONE 
J053045C11TAAGCCCAAAANONE 
J100055G05TAAGCCCAAAANONE 
J100080J22TAAGCCCAAAANONE 
Os03g0113700AK103835CCTGGGCCGGCCCAAAASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925TTTTGGGCCGGCCCAGGProtein prenyltransferase domain containing protein. 
J013047E20TTTTGGGCCGGCCCAGGNONE 
J065026F21TTTTGGGCCGGCCCAGGNONE 
J065047B03TTTTGGGCCGGCCCAGGNONE 
J065054J12TTTTGGGCCGGCCCAGGNONE 
J065079M24TTTTGGGCCGGCCCAGGNONE 
J065093M07TTTTGGGCCGGCCCAGGNONE 
J065153F02TTTTGGGCCGGCCCAGGNONE 
J065155E21TTTTGGGCCGGCCCAGGNONE 
J065179H15TTTTGGGCCGGCCCAGGNONE 
J075019N02TTTTGGGCCGGCCCAGGNONE 
J075089E01TTTTGGGCCGGCCCAGGNONE 
J090066I18TTTTGGGCCGGCCCAGGNONE 
J090087K20TTTTGGGCCGGCCCAGGNONE 
J100079F05TTTTGGGCCGGCCCAGGNONE 
Os03g0114100AK108265CGCACCGCCCAAAAConserved hypothetical protein. 
Os03g0125700009-132-G03AAGGCCCAAAANONE 
AK062913AAGGCCCAAAAConserved hypothetical protein. 
J075046C16AAGGCCCAAAANONE 
J075115L05AAGGCCCAAAANONE 
J075143I05AAGGCCCAAAANONE 
J075197O07AAGGCCCAAAANONE 
Os03g0136200004-011-E10GCCCAAAANONE 
006-067-A08GCCCAAAANONE 
011-007-E02GCCCAAAANONE 
011-099-H10GCCCAAAANONE 
012-044-D08GCCCAAAANONE 
013-045-G12GCCCAAAANONE 
013-062-C09GCCCAAAANONE 
013-072-F09GCCCAAAANONE 
013-085-B12GCCCAAAANONE 
013-097-E09GCCCAAAANONE 
013-097-F09GCCCAAAANONE 
014-013-C09GCCCAAAANONE 
014-082-D08GCCCAAAANONE 
015-071-A09GCCCAAAANONE 
AF042333GCCCAAAANONE 
AK060887GCCCAAAANONE 
AK121681GCCCAAAA24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14GCCCAAAANONE 
J013123F01GCCCAAAANONE 
J023050A02GCCCAAAANONE 
J033046H22GCCCAAAANONE 
J033070A11GCCCAAAANONE 
J065059G11GCCCAAAANONE 
J065068F10GCCCAAAANONE 
J065164A10GCCCAAAANONE 
J075031F07GCCCAAAANONE 
J075054J01GCCCAAAANONE 
J075086M04GCCCAAAANONE 
J075118K23GCCCAAAANONE 
J075122A09GCCCAAAANONE 
J075123D06GCCCAAAANONE 
J075129A22GCCCAAAANONE 
J075161E07GCCCAAAANONE 
J075179H04GCCCAAAANONE 
J075181C06GCCCAAAANONE 
J075186A12GCCCAAAANONE 
J090014H16GCCCAAAANONE 
J090045G17GCCCAAAANONE 
J090048B09GCCCAAAANONE 
J090052J23GCCCAAAANONE 
J090052K22GCCCAAAANONE 
J090059F10GCCCAAAANONE 
J090080F19GCCCAAAANONE 
J100039J08GCCCAAAANONE 
J100044K02GCCCAAAANONE 
J100051E16GCCCAAAANONE 
J100053F08GCCCAAAANONE 
J100056F07GCCCAAAANONE 
J100058A10GCCCAAAANONE 
Os03g0159100AK065635AAAAGCCCAAAASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os03g0159700012-100-B09TTTTGGGCCGTANONE 
AK063559TTTTGGGCCGTAProtein prenyltransferase domain containing protein. 
J065197I24TTTTGGGCCGTANONE 
J090089G20TTTTGGGCCGTANONE 
Os03g0167600AK121254TAAGCCCAAAASimilar to Male sterility protein 2. 
Os03g0174300AK067994TTTTGGGCTExostosin-like family protein. 
Os03g0185700AK108939AGCCCAAAATransferase family protein. 
J100089D02AGCCCAAAANONE 
Os03g0219200011-045-E01CTGGCCCAAAANONE 
011-045-E01TTTTGGGCNONE 
AK073785CTGGCCCAAAASimilar to Superoxide dismutase (EC 1.15.1.1). 
AK073785TTTTGGGCSimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19CTGGCCCAAAANONE 
J033068D19TTTTGGGCNONE 
J043009H23CTGGCCCAAAANONE 
J043009H23TTTTGGGCNONE 
Os03g0232500AK110980TTTTGGGCCACGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TTTTGGGCCACNONE 
Os03g0257900009-150-G06AATTGGGCCTTTTTGGGCCGANONE 
009-181-H05AATTGGGCCTTTTTGGGCCGANONE 
AK063892AATTGGGCCTTTTTGGGCCGANONE 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK103486AATTGGGCCTTTTTGGGCCGANONE 
J023006K11AATTGGGCCTTTTTGGGCCGANONE 
J075005E15AATTGGGCCTTTTTGGGCCGANONE 
J075007K24AATTGGGCCTTTTTGGGCCGANONE 
J075034G06AATTGGGCCTTTTTGGGCCGANONE 
J075051I19AATTGGGCCTTTTTGGGCCGANONE 
J075076A08AATTGGGCCTTTTTGGGCCGANONE 
J075096H04AATTGGGCCTTTTTGGGCCGANONE 
J075115I09AATTGGGCCTTTTTGGGCCGANONE 
J075132K23AATTGGGCCTTTTTGGGCCGANONE 
J075147C17AATTGGGCCTTTTTGGGCCGANONE 
J090059O20AATTGGGCCTTTTTGGGCCGANONE 
Os03g0262400014-013-D09AAAAGCCCAAAAGGCCGAAANONE 
AK059989AAAAGCCCAAAAGGCCGAAASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18AAAAGCCCAAAAGGCCGAAANONE 
J033025J23AAAAGCCCAAAAGGCCGAAANONE 
J065047G10AAAAGCCCAAAAGGCCGAAANONE 
J065153H03AAAAGCCCAAAAGGCCGAAANONE 
J065155J08AAAAGCCCAAAAGGCCGAAANONE 
J075025C05AAAAGCCCAAAAGGCCGAAANONE 
Os03g0263500006-112-E09GTGGGCTTGGGCCCAAAANONE 
009-122-C01GTGGGCTTGGGCCCAAAANONE 
AK106060GTGGGCTTGGGCCCAAAASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0277000AK100522TCTGGCCCAAAASimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0322600009-180-H12GAGGCCCAAAANONE 
AK067222GAGGCCCAAAAHypothetical protein. 
J065017H05GAGGCCCAAAANONE 
J065118G12GAGGCCCAAAANONE 
J065175F07GAGGCCCAAAANONE 
J065175N14GAGGCCCAAAANONE 
Os03g0331600009-025-C11GGTCCACGTGTGCCCAAAANONE 
AK063782GGTCCACGTGTGCCCAAAAConserved hypothetical protein. 
Os03g0332700AK072820GCCCAAAASimilar to ABC Transporter, ATP binding component. 
Os03g0372700AK064323TTTTGGGCTGGNONE 
AK073312TTTTGGGCTGGLow temperature viability protein family protein. 
Os03g0383100AK107106TCAGCCCAAAAConserved hypothetical protein. 
Os03g0395000AK073283CCAAGCCCAAAASimilar to Heme oxygenase 2 (Fragment). 
Os03g0598200AK068322TTTTGGGCCTCNop14-like protein family protein. 
Os03g0625900AK101109CGGGCCCAAAAWD40-like domain containing protein. 
Os03g0628900009-062-G01TTTTGGGCTGGGCTNONE 
AK103619TTTTGGGCTGGGCTPrefoldin domain containing protein. 
J033133L23TTTTGGGCTGGGCTNONE 
J100039C17TTTTGGGCTGGGCTNONE 
J100048I07TTTTGGGCTGGGCTNONE 
J100062E19TTTTGGGCTGGGCTNONE 
J100063B11TTTTGGGCTGGGCTNONE 
Os03g0646300AK069229TTGGCCCAAAASimilar to Cyclic nucleotide-gated channel A (Fragment). 
AK069229TTTTGGGCCGCSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0689300AK068765CCCAGCCCAAAAPlasma membrane H+ ATPase (EC 3.6.3.6) (H-ATPase). 
AK100996CCCAGCCCAAAANONE 
D10207CCCAGCCCAAAANONE 
J013162E15CCCAGCCCAAAANONE 
J033116I16CCCAGCCCAAAANONE 
J043027N09CCCAGCCCAAAANONE 
J075112N21CCCAGCCCAAAANONE 
J090035D23CCCAGCCCAAAANONE 
J090095G13CCCAGCCCAAAANONE 
Os03g0701900AK068404CTGGCCCAAAAConserved hypothetical protein. 
Os03g0712600015-008-G03TCAGCCCAAAANONE 
AK103705TCAGCCCAAAAHypothetical protein. 
J033136N14TCAGCCCAAAANONE 
Os03g0727800014-002-D07GCCCAAAANONE 
014-002-D07GCCCAAAANONE 
AK109453GCCCAAAACyclin-like F-box domain containing protein. 
AK109453GCCCAAAACyclin-like F-box domain containing protein. 
Os03g0736700006-022-F08AAAGCCCAAAANONE 
006-042-H09AAAGCCCAAAANONE 
006-053-H02AAAGCCCAAAANONE 
009-127-A06AAAGCCCAAAANONE 
013-089-C06AAAGCCCAAAANONE 
AK060947AAAGCCCAAAAGRAM domain containing protein. 
AK073026AAAGCCCAAAANONE 
AK104415AAAGCCCAAAANONE 
AK104642AAAGCCCAAAANONE 
J065027H19AAAGCCCAAAANONE 
J065059K06AAAGCCCAAAANONE 
J065065I02AAAGCCCAAAANONE 
J065085E10AAAGCCCAAAANONE 
J065140M09AAAGCCCAAAANONE 
J075115M21AAAGCCCAAAANONE 
Os03g0740800AK071772CAGGCCCAAAAXRCC4, N-terminal domain containing protein. 
J023110F02CAGGCCCAAAANONE 
J075054I11CAGGCCCAAAANONE 
Os03g0752800AB041020GACGGCCCAAAANONE 
AF058697GACGGCCCAAAAMADS14 protein. 
AF139664GACGGCCCAAAANONE 
AK121171GACGGCCCAAAANONE 
AY332478GACGGCCCAAAANONE 
AY551916GACGGCCCAAAANONE 
J023081C04GACGGCCCAAAANONE 
Os03g0802500005-009-E09GCCCAAAANONE 
016-058-E03GCCCAAAANONE 
AK070731GCCCAAAAAAA ATPase domain containing protein. 
AK099212GCCCAAAANONE 
AK104696GCCCAAAANONE 
J013050J10GCCCAAAANONE 
J023061A01GCCCAAAANONE 
J023088E08GCCCAAAANONE 
J033084A02GCCCAAAANONE 
J090015G11GCCCAAAANONE 
J090075G22GCCCAAAANONE 
J100067G24GCCCAAAANONE 
Os03g0819300AK072873AGCCCAAAASimilar to Annexin A7 (Annexin VII) (Synexin) (Fragment). 
J023027N16AGCCCAAAANONE 
J023105J17AGCCCAAAANONE 
J023145D16AGCCCAAAANONE 
J023149I08AGCCCAAAANONE 
Os03g0851900AK102145TTTTGGGCCTCAFG1-like ATPase family protein. 
J033086B08TTTTGGGCCTCNONE 
Os03g0858700006-024-D11TTTTGGGCCTTGNONE 
AK061723TTTTGGGCCTTGProtein of unknown function DUF1499 family protein. 
AK064976TTTTGGGCCTTGNONE 
J013001B23TTTTGGGCCTTGNONE 
Os04g0305700009-180-E11TTTTGGGCCTANONE 
AK068128TTTTGGGCCTAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK105689TTTTGGGCCTANONE 
J065026K17TTTTGGGCCTANONE 
J065122C23TTTTGGGCCTANONE 
Os04g0316200AK110725GCAGCCCAAAAProtein of unknown function DUF26 domain containing protein. 
AY576676GCAGCCCAAAANONE 
J100043J22GCAGCCCAAAANONE 
J100049F15GCAGCCCAAAANONE 
J100081M23GCAGCCCAAAANONE 
Os04g0322100J075093H10GCAGCCCAAAAProtein of unknown function DUF26 domain containing protein. 
J100044L06GCAGCCCAAAANONE 
J100048J12GCAGCCCAAAANONE 
J100073D10GCAGCCCAAAANONE 
Os04g0436800015-053-A06CAAGGCCCAAAANONE 
AK101115CAAGGCCCAAAAProtein prenyltransferase domain containing protein. 
J033025G14CAAGGCCCAAAANONE 
J033073N23CAAGGCCCAAAANONE 
J033097L19CAAGGCCCAAAANONE 
Os04g0457300AK061416TTTTGGGCProtein of unknown function DUF6, transmembrane domain containing protein. 
Os04g0465000AK060688TAGGCCCAAAANONE 
AK102302TAGGCCCAAAASterile alpha motif homology domain containing protein. 
J023084D14TAGGCCCAAAANONE 
J023086J22TAGGCCCAAAANONE 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0483200AK069389AGCCCAAAASteroid nuclear receptor, ligand-binding domain containing protein. 
AK121909AGCCCAAAANONE 
J043031E24AGCCCAAAANONE 
J043032N20AGCCCAAAANONE 
J090078C11AGCCCAAAANONE 
Os04g0495900AK061559TACGGCCCAAAAConserved hypothetical protein. 
Os04g0503800J065116G03TTTTGGGCCAGNONE 
Os04g0530000009-106-E11CACGGCCCAAAANONE 
011-012-E12CACGGCCCAAAANONE 
AK066169CACGGCCCAAAAConserved hypothetical protein. 
J013052P20CACGGCCCAAAANONE 
J090060G12CACGGCCCAAAANONE 
J100073H10CACGGCCCAAAANONE 
Os04g0551300AK103502AGGGCCCAAAASimilar to Growth regulator like protein. 
Os04g0581000AK061337TTTTGGGCTTTSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142TTTTGGGCTTTNONE 
Os04g0581300009-171-H01ATTTGGGCCTTTTTGGGCCTANONE 
AK063093ATTTGGGCCTTTTTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0585600006-117-A02TCTGGCCCAAAANONE 
AK106073TCTGGCCCAAAAConserved hypothetical protein. 
J053089I23TCTGGCCCAAAANONE 
J065112K06TCTGGCCCAAAANONE 
J065128D09TCTGGCCCAAAANONE 
J100038D09TCTGGCCCAAAANONE 
Os04g0592500AK066893TACGGCCCAAAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TACGGCCCAAAANONE 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
Os04g0607200J065082C16AGCCCAAAANONE 
J065167I02AGCCCAAAANONE 
Os04g0611300009-006-G08TTTTGGGCTNONE 
009-011-C01TTTTGGGCTNONE 
009-036-B09TTTTGGGCTNONE 
009-116-G09TTTTGGGCTNONE 
009-126-E09TTTTGGGCTNONE 
009-132-F09TTTTGGGCTNONE 
009-151-G07TTTTGGGCTNONE 
009-155-C07TTTTGGGCTNONE 
009-163-G01TTTTGGGCTNONE 
009-169-G08TTTTGGGCTNONE 
009-191-B02TTTTGGGCTNONE 
009-196-A08TTTTGGGCTNONE 
009-198-E07TTTTGGGCTNONE 
014-015-F04TTTTGGGCTNONE 
015-087-H04TTTTGGGCTNONE 
AK062605TTTTGGGCTNONE 
AK063022TTTTGGGCTConserved hypothetical protein. 
AK066749TTTTGGGCTNONE 
AK104924TTTTGGGCTNONE 
J065002M20TTTTGGGCTNONE 
J065045L23TTTTGGGCTNONE 
J065101E05TTTTGGGCTNONE 
J065140J23TTTTGGGCTNONE 
J065179G11TTTTGGGCTNONE 
J065191B18TTTTGGGCTNONE 
J065192E03TTTTGGGCTNONE 
J065199H21TTTTGGGCTNONE 
J075067F01TTTTGGGCTNONE 
J075089L01TTTTGGGCTNONE 
J075147K22TTTTGGGCTNONE 
J080069G23TTTTGGGCTNONE 
J100053D10TTTTGGGCTNONE 
J100078C10TTTTGGGCTNONE 
Os04g0625100AK064614GCCCAAAAConserved hypothetical protein. 
AK121861GCCCAAAANONE 
J033103A14GCCCAAAANONE 
J090024H07GCCCAAAANONE 
Os04g0625600AK070994TTTTGGGCCGGATRAF-like domain containing protein. 
J023080H04TTTTGGGCCGGANONE 
J023086H15TTTTGGGCCGGANONE 
J033037L21TTTTGGGCCGGANONE 
J033044P14TTTTGGGCCGGANONE 
J065075C23TTTTGGGCCGGANONE 
J065167C18TTTTGGGCCGGANONE 
J100024E02TTTTGGGCCGGANONE 
J100068N24TTTTGGGCCGGANONE 
J100070G20TTTTGGGCCGGANONE 
Os04g0635700009-079-G03TTTTGGGCTNONE 
AK062025TTTTGGGCTRibbon-helix-helix domain containing protein. 
AK098916TTTTGGGCTNONE 
J013002J07TTTTGGGCTNONE 
J013109L20TTTTGGGCTNONE 
J023055C07TTTTGGGCTNONE 
J065036K04TTTTGGGCTNONE 
J065164G12TTTTGGGCTNONE 
Os04g0645600AK100006CCCACCACCCACACGCCACACGCCCAAAAProtein of unknown function DUF6, transmembrane domain containing protein. 
J013135P10CCCACCACCCACACGCCACACGCCCAAAANONE 
Os04g0658100AK065495CAACGGCCCAAAAHistone-fold domain containing protein. 
J013021B22CAACGGCCCAAAANONE 
J065054D12CAACGGCCCAAAANONE 
J065135I05CAACGGCCCAAAANONE 
J065198F14CAACGGCCCAAAANONE 
J090027O06CAACGGCCCAAAANONE 
Os04g0658300AK067399AAAGCCCAAAASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0665000009-149-A12TCCGGCCCAAAANONE 
AK062995TCCGGCCCAAAACHCH domain containing protein. 
J065017G19TCCGGCCCAAAANONE 
J080301G12TCCGGCCCAAAANONE 
Os04g0667600009-131-H09TTTTGGGCNONE 
009-200-A04TTTTGGGCNONE 
AK068657TTTTGGGCHeavy metal transport/detoxification protein domain containing protein. 
J065013M12TTTTGGGCNONE 
J065024H17TTTTGGGCNONE 
J065025P10TTTTGGGCNONE 
J065028I11TTTTGGGCNONE 
J065044K11TTTTGGGCNONE 
J065045B14TTTTGGGCNONE 
J065052B02TTTTGGGCNONE 
J065061F20TTTTGGGCNONE 
J065061K16TTTTGGGCNONE 
J065063E12TTTTGGGCNONE 
J065065E16TTTTGGGCNONE 
J065082M02TTTTGGGCNONE 
J065084O10TTTTGGGCNONE 
J065096H18TTTTGGGCNONE 
J065122F02TTTTGGGCNONE 
J065131F09TTTTGGGCNONE 
J065139P06TTTTGGGCNONE 
J065148L17TTTTGGGCNONE 
J065164D23TTTTGGGCNONE 
J065167M17TTTTGGGCNONE 
J065174B15TTTTGGGCNONE 
J065176G01TTTTGGGCNONE 
J065186K17TTTTGGGCNONE 
J065186N05TTTTGGGCNONE 
J065213N24TTTTGGGCNONE 
J075001P17TTTTGGGCNONE 
J075004A15TTTTGGGCNONE 
J075007B03TTTTGGGCNONE 
J075026D23TTTTGGGCNONE 
J075032D17TTTTGGGCNONE 
J075058C22TTTTGGGCNONE 
J075080L14TTTTGGGCNONE 
J075094K18TTTTGGGCNONE 
J075097K15TTTTGGGCNONE 
J075098E02TTTTGGGCNONE 
J075104D11TTTTGGGCNONE 
J075120L16TTTTGGGCNONE 
J075126A18TTTTGGGCNONE 
J075129M08TTTTGGGCNONE 
J075143N14TTTTGGGCNONE 
J075146D07TTTTGGGCNONE 
J075149L10TTTTGGGCNONE 
J075171F22TTTTGGGCNONE 
J090058C05TTTTGGGCNONE 
J100018N19TTTTGGGCNONE 
J100024K09TTTTGGGCNONE 
J100036F15TTTTGGGCNONE 
J100042A15TTTTGGGCNONE 
J100042P14TTTTGGGCNONE 
J100051N18TTTTGGGCNONE 
J100055K14TTTTGGGCNONE 
J100056F05TTTTGGGCNONE 
J100058L10TTTTGGGCNONE 
J100083J17TTTTGGGCNONE 
J100086N07TTTTGGGCNONE 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
J065195K10GGGGCCCAGGCCCAAAANONE 
Os04g0682500015-003-H03TTTTGGGCNONE 
AK064978TTTTGGGCNONE 
AK121739TTTTGGGCPeptidase T2, asparaginase 2 family protein. 
J013001C03TTTTGGGCNONE 
J023028M11TTTTGGGCNONE 
J033085H01TTTTGGGCNONE 
Os05g0100500AK071466GCAGCCCAAAAAGCCCAAGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0104800006-022-G08TTTTGGGCNONE 
AK070215TTTTGGGCSimilar to Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) (eIF3 p32 subunit) (eIF3f). 
AK104207TTTTGGGCNONE 
AK104554TTTTGGGCNONE 
J023043K07TTTTGGGCNONE 
J023079C24TTTTGGGCNONE 
J033050A14TTTTGGGCNONE 
J033095G11TTTTGGGCNONE 
J033097D16TTTTGGGCNONE 
J033108J11TTTTGGGCNONE 
J053037E01TTTTGGGCNONE 
J053061I17TTTTGGGCNONE 
J065040F22TTTTGGGCNONE 
J065055B15TTTTGGGCNONE 
J065091N23TTTTGGGCNONE 
J090062J16TTTTGGGCNONE 
J100065J21TTTTGGGCNONE 
Os05g0105300AK069395CCAGCCCACAGCCCAAAACAP-Gly domain containing protein. 
Os05g0106100009-186-E05CAGGCCCAAAANONE 
013-067-H01CAGGCCCAAAANONE 
AK063178CAGGCCCAAAASimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
J065010J15CAGGCCCAAAANONE 
J065073M24CAGGCCCAAAANONE 
J065077A22CAGGCCCAAAANONE 
J065167I04CAGGCCCAAAANONE 
J075084F11CAGGCCCAAAANONE 
J075086M18CAGGCCCAAAANONE 
Os05g0107700009-025-D07TTTTGGGCNONE 
AK065182TTTTGGGCTranscription factor IIA small subunit (Transcription factor IIA gamma subunit). 
AY643716TTTTGGGCNONE 
AY643717TTTTGGGCNONE 
J013002D19TTTTGGGCNONE 
J013157N01TTTTGGGCNONE 
J023007J15TTTTGGGCNONE 
J023090I18TTTTGGGCNONE 
J075051N10TTTTGGGCNONE 
J075080D23TTTTGGGCNONE 
J075092B08TTTTGGGCNONE 
J075108H08TTTTGGGCNONE 
J075140N22TTTTGGGCNONE 
J075143H17TTTTGGGCNONE 
J075149F06TTTTGGGCNONE 
Os05g0142400009-025-C05GCCCAAAANONE 
009-128-B02GCCCAAAANONE 
AK062395GCCCAAAAConserved hypothetical protein. 
J065177G20GCCCAAAANONE 
J075015F02GCCCAAAANONE 
J100039M05GCCCAAAANONE 
J100058B01GCCCAAAANONE 
J100078E16GCCCAAAANONE 
J100079E02GCCCAAAANONE 
Os05g0194600AK102487TTTTGGGCTTAAGGGCCCAATTPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTTGGGCTTAAGGGCCCAATTNONE 
J100041A08TTTTGGGCTTAAGGGCCCAATTNONE 
Os05g0214900006-070-A10TTTTGGGCNONE 
AK061081TTTTGGGCConserved hypothetical protein. 
Os05g0243200009-073-F12GGGGCCCAAAANONE 
AK061317GGGGCCCAAAASimilar to Ribosomal protein L13. 
J065120F21GGGGCCCAAAANONE 
J065185K05GGGGCCCAAAANONE 
Os05g0339200AK111022CAGGCCCAAAAConserved hypothetical protein. 
Os05g0349400AK107832GCCCAAAAConserved hypothetical protein. 
Os05g0357100AK102042AAGGCCCAAAA3'-5' exonuclease domain containing protein. 
J033081J05AAGGCCCAAAANONE 
J100022A18AAGGCCCAAAANONE 
Os05g0388500AK065313TTTTGGGCCCAATCCGACGSimilar to 50S ribosomal protein L1. 
AK098990TTTTGGGCCCAATCCGACGNONE 
AK104689TTTTGGGCCCAATCCGACGNONE 
J013094L23TTTTGGGCCCAATCCGACGNONE 
J065118O04TTTTGGGCCCAATCCGACGNONE 
Os05g0412900006-037-H10AGCCCAAAANONE 
AK061020AGCCCAAAAConserved hypothetical protein. 
Os05g0414300AK120513TTTTGGGCTTGDisease resistance protein family protein. 
AK120791TTTTGGGCTTGNONE 
Os05g0415600AK065818GCGGCCCAAAANONE 
J013042K21GCGGCCCAAAANONE 
J013114E15GCGGCCCAAAANONE 
J013131H02GCGGCCCAAAANONE 
J023041G06GCGGCCCAAAANONE 
J100037M21GCGGCCCAAAANONE 
Os05g0437200014-036-D04GCGGCCCAAAANONE 
AK059283GCGGCCCAAAANONE 
AK121867GCGGCCCAAAAProtein of unknown function DUF502 family protein. 
Os05g0437300AK102760AGCCCAAAAHnRNP-L/PTB/hephaestus splicing factor family protein. 
Os05g0456000AK058420GCGTGGGCGTGTGGCCCAAAAMitochondrial glycoprotein family protein. 
AK102036GCGTGGGCGTGTGGCCCAAAANONE 
J065066F02GCGTGGGCGTGTGGCCCAAAANONE 
Os05g0481900AK106744TTTTGGGCNONE 
AK119626TTTTGGGCAuxin Efflux Carrier family protein. 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0506900AK106697TAAGCCCAAAABrix domain containing protein. 
Os05g0520600AK067487TTTTGGGCConserved hypothetical protein. 
Os05g0553000015-052-H09ACAGCCCAAAANONE 
AK061681ACAGCCCAAAAATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143ACAGCCCAAAANONE 
J013068H04ACAGCCCAAAANONE 
J013124C06ACAGCCCAAAANONE 
J033127N11ACAGCCCAAAANONE 
J100056O04ACAGCCCAAAANONE 
Os05g0562200AK061766GCCCAAAADrought induced 19 family protein. 
AK109438GCCCAAAANONE 
Os05g0567300013-039-F11TTTTGGGCCAGCCCAAGNONE 
AK112068TTTTGGGCCAGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0571400009-019-B04AGCCCATGCGGCCCAAAANONE 
009-043-H02AGCCCATGCGGCCCAAAANONE 
AK062369AGCCCATGCGGCCCAAAAConserved hypothetical protein. 
Os05g0597700AK121194TTTTGGGCConserved hypothetical protein. 
J023086G21TTTTGGGCNONE 
Os06g0141600006-035-C07GCCCAAAANONE 
AK059772GCCCAAAAEarly nodulin 93 ENOD93 protein family protein. 
J075028K13GCCCAAAANONE 
J075070B17GCCCAAAANONE 
J075075G08GCCCAAAANONE 
J075081B21GCCCAAAANONE 
J075116B04GCCCAAAANONE 
J075133E10GCCCAAAANONE 
J075144I23GCCCAAAANONE 
J075147G16GCCCAAAANONE 
J075151E04GCCCAAAANONE 
J075162E07GCCCAAAANONE 
J075163P14GCCCAAAANONE 
J075182C07GCCCAAAANONE 
J075196O22GCCCAAAANONE 
J100086C12GCCCAAAANONE 
Os06g0144000AK068998TTTTGGGCCCCAGBRCT domain containing protein. 
J023001F16TTTTGGGCCCCAGNONE 
Os06g0163300006-112-F11GCCCAAAANONE 
006-115-G04GCCCAAAANONE 
012-079-D09GCCCAAAANONE 
AK058295GCCCAAAAHarpin-induced 1 domain containing protein. 
AK060328GCCCAAAANONE 
AK073824GCCCAAAANONE 
AK106071GCCCAAAANONE 
J023025D10GCCCAAAANONE 
J033070N04GCCCAAAANONE 
J065016B01GCCCAAAANONE 
J065030K12GCCCAAAANONE 
J065076I03GCCCAAAANONE 
J065084L24GCCCAAAANONE 
J065179O03GCCCAAAANONE 
J090025I06GCCCAAAANONE 
Os06g0186600012-099-H03GCCCAAAANONE 
016-007-A09GCCCAAAANONE 
AK062237GCCCAAAANONE 
J065059N11GCCCAAAANONE 
J065158I12GCCCAAAANONE 
J065191N03GCCCAAAANONE 
J065212L12GCCCAAAANONE 
Os06g0192800AK070038ACAGCCCAAAASimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
J065057C13ACAGCCCAAAANONE 
J100067A03ACAGCCCAAAANONE 
Os06g0202400009-101-G07CAAGCCCAAAANONE 
AK062755CAAGCCCAAAAConserved hypothetical protein. 
Os06g0216400AK101267GCCCAAAAProtein prenyltransferase domain containing protein. 
Os06g0222900AK109820AAAAGCCCAAAASimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
Os06g0248200Os06g0248200AACGGGCCCAAAANONE 
Os06g0269300AK064807AGGGCCCAAAANONE 
AK122070AGGGCCCAAAASoluble quinoprotein glucose dehydrogenase domain containing protein. 
J013000D18AGGGCCCAAAANONE 
J023060J19AGGGCCCAAAANONE 
J033028I01AGGGCCCAAAANONE 
J033032M06AGGGCCCAAAANONE 
J033038E05AGGGCCCAAAANONE 
J033106J02AGGGCCCAAAANONE 
Os06g0335500AK121989TCAGCCCAAAAAUX/IAA protein family protein. 
Os06g0556000011-042-F02GCCCAAAANONE 
012-064-G09GCCCAAAANONE 
015-076-A04GCCCAAAANONE 
AK058304GCCCAAAANONE 
AK102763GCCCAAAASimilar to Amino acid carrier (Fragment). 
J033107D14GCCCAAAANONE 
J090050O09GCCCAAAANONE 
J100048H19GCCCAAAANONE 
J100056H17GCCCAAAANONE 
J100064D16GCCCAAAANONE 
J100080A13GCCCAAAANONE 
J100090G17GCCCAAAANONE 
Os06g0556200AK071510TTTTGGGCSimilar to Amino acid permease I (Amino acid transporter) (F19C14.3 protein). 
J023095G15TTTTGGGCNONE 
Os06g0592500AK119729CAACGGCCCAAAASimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CAACGGCCCAAAANONE 
Os06g0594100AK072650TTTTGGGCEnoyl-CoA hydratase/isomerase domain containing protein. 
J013035P10TTTTGGGCNONE 
Os06g0618700AK107075GCCCAAAAVQ domain containing protein. 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTGGCCCAAAAGGCCCACANONE 
J065100L18TCTGGCCCAAAAGGCCCACANONE 
J065129N15TCTGGCCCAAAAGGCCCACANONE 
J065152M08TCTGGCCCAAAAGGCCCACANONE 
J065198M12TCTGGCCCAAAAGGCCCACANONE 
J090077J22TCTGGCCCAAAAGGCCCACANONE 
J100024G23TCTGGCCCAAAAGGCCCACANONE 
J100027L01TCTGGCCCAAAAGGCCCACANONE 
J100047C06TCTGGCCCAAAAGGCCCACANONE 
J100055D01TCTGGCCCAAAAGGCCCACANONE 
J100067M05TCTGGCCCAAAAGGCCCACANONE 
J100077M16TCTGGCCCAAAAGGCCCACANONE 
J100078M22TCTGGCCCAAAAGGCCCACANONE 
Os06g0696600006-060-B12AAGGCCCAAAANONE 
AK105934AAGGCCCAAAASimilar to Xyloglucan endo-transglycosylase homolog. 
Os07g0110100009-059-D11AAAGCCCAAAANONE 
AK071499AAAGCCCAAAAConserved hypothetical protein. 
J065064P17AAAGCCCAAAANONE 
J065111B09AAAGCCCAAAANONE 
J075099A14AAAGCCCAAAANONE 
J075139C23AAAGCCCAAAANONE 
Os07g0113200AK108787TTTTGGGCTTTConserved hypothetical protein. 
J065090J04TTTTGGGCTTTNONE 
J065116K24TTTTGGGCTTTNONE 
J065161F14TTTTGGGCTTTNONE 
J065203E23TTTTGGGCTTTNONE 
Os07g0123000AK070836ATGGCCCAAAACyclin-like F-box domain containing protein. 
Os07g0131600AK068296TTTTGGGCSimilar to Monosaccharide transporter. 
J043003K23TTTTGGGCNONE 
J075095N04TTTTGGGCNONE 
Os07g0167300AK108281GCCCAAAAConserved hypothetical protein. 
J065062F06GCCCAAAANONE 
Os07g0187300AK103069AAAAGCCCAAAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAAAGCCCAAAANONE 
J033117P16AAAAGCCCAAAANONE 
Os07g0192000AK065505GCCCAAAAAAA ATPase domain containing protein. 
J013027N01GCCCAAAANONE 
J100039B05GCCCAAAANONE 
J100062N08GCCCAAAANONE 
J100082N21GCCCAAAANONE 
Os07g0197100006-071-D01TTTTGGGCNONE 
AK059853TTTTGGGCNONE 
Os07g0213600AK107696TTTTGGGCCCAATPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09TTTTGGGCCCAATNONE 
J100082J05TTTTGGGCCCAATNONE 
Os07g0290800AK071498ATGGCCCAAAATic22-like family protein. 
J075099P10ATGGCCCAAAANONE 
Os07g0462700009-033-D05TTTTGGGCCTTGNONE 
AK073834TTTTGGGCCTTGNONE 
AK104968TTTTGGGCCTTGThioesterase superfamily domain containing protein. 
J065104G16TTTTGGGCCTTGNONE 
J065197C14TTTTGGGCCTTGNONE 
J065213E17TTTTGGGCCTTGNONE 
J065215D11TTTTGGGCCTTGNONE 
J075001J15TTTTGGGCCTTGNONE 
J075026M11TTTTGGGCCTTGNONE 
J075142G03TTTTGGGCCTTGNONE 
J075178H04TTTTGGGCCTTGNONE 
J100069P18TTTTGGGCCTTGNONE 
Os07g0531500J065122B10TTTTGGGCHarpin-induced 1 domain containing protein. 
Os07g0535200011-024-E05TTTTGGGCCTANONE 
AK063926TTTTGGGCCTANONE 
AK101804TTTTGGGCCTACyclin-like F-box domain containing protein. 
J033066K01TTTTGGGCCTANONE 
J033133J23TTTTGGGCCTANONE 
Os07g0562700003-111-G08GCCCGGCCCAAAANONE 
004-013-E07GCCCGGCCCAAAANONE 
006-021-D03GCCCGGCCCAAAANONE 
006-021-D07GCCCGGCCCAAAANONE 
006-021-F09GCCCGGCCCAAAANONE 
006-023-D01GCCCGGCCCAAAANONE 
006-024-F04GCCCGGCCCAAAANONE 
006-024-G09GCCCGGCCCAAAANONE 
006-024-G11GCCCGGCCCAAAANONE 
006-025-A10GCCCGGCCCAAAANONE 
006-025-B08GCCCGGCCCAAAANONE 
006-025-E10GCCCGGCCCAAAANONE 
006-025-F10GCCCGGCCCAAAANONE 
006-026-B04GCCCGGCCCAAAANONE 
006-026-C08GCCCGGCCCAAAANONE 
006-026-D03GCCCGGCCCAAAANONE 
006-026-F03GCCCGGCCCAAAANONE 
006-026-F08GCCCGGCCCAAAANONE 
006-026-F12GCCCGGCCCAAAANONE 
006-027-A10GCCCGGCCCAAAANONE 
006-027-C03GCCCGGCCCAAAANONE 
006-028-C03GCCCGGCCCAAAANONE 
006-029-E02GCCCGGCCCAAAANONE 
006-029-G05GCCCGGCCCAAAANONE 
006-030-A10GCCCGGCCCAAAANONE 
006-030-C06GCCCGGCCCAAAANONE 
006-030-D03GCCCGGCCCAAAANONE 
006-030-D06GCCCGGCCCAAAANONE 
006-030-G05GCCCGGCCCAAAANONE 
006-031-B10GCCCGGCCCAAAANONE 
006-031-D04GCCCGGCCCAAAANONE 
006-031-D11GCCCGGCCCAAAANONE 
006-031-H09GCCCGGCCCAAAANONE 
006-032-C09GCCCGGCCCAAAANONE 
006-032-H09GCCCGGCCCAAAANONE 
006-033-B02GCCCGGCCCAAAANONE 
006-033-B09GCCCGGCCCAAAANONE 
006-033-E01GCCCGGCCCAAAANONE 
006-033-F06GCCCGGCCCAAAANONE 
006-033-G03GCCCGGCCCAAAANONE 
006-034-A08GCCCGGCCCAAAANONE 
006-034-C09GCCCGGCCCAAAANONE 
006-034-F06GCCCGGCCCAAAANONE 
006-035-B12GCCCGGCCCAAAANONE 
006-035-C12GCCCGGCCCAAAANONE 
006-035-H04GCCCGGCCCAAAANONE 
006-035-H12GCCCGGCCCAAAANONE 
006-036-A05GCCCGGCCCAAAANONE 
006-036-A09GCCCGGCCCAAAANONE 
006-036-B10GCCCGGCCCAAAANONE 
006-036-C03GCCCGGCCCAAAANONE 
006-036-E06GCCCGGCCCAAAANONE 
006-037-H11GCCCGGCCCAAAANONE 
006-038-G01GCCCGGCCCAAAANONE 
006-039-B01GCCCGGCCCAAAANONE 
006-039-B12GCCCGGCCCAAAANONE 
006-039-C02GCCCGGCCCAAAANONE 
006-039-E06GCCCGGCCCAAAANONE 
006-039-G12GCCCGGCCCAAAANONE 
006-040-G07GCCCGGCCCAAAANONE 
006-041-H04GCCCGGCCCAAAANONE 
006-042-A11GCCCGGCCCAAAANONE 
006-042-E07GCCCGGCCCAAAANONE 
006-042-F12GCCCGGCCCAAAANONE 
006-043-C01GCCCGGCCCAAAANONE 
006-045-H12GCCCGGCCCAAAANONE 
006-046-A12GCCCGGCCCAAAANONE 
006-046-F03GCCCGGCCCAAAANONE 
006-047-A07GCCCGGCCCAAAANONE 
006-047-A09GCCCGGCCCAAAANONE 
006-047-E10GCCCGGCCCAAAANONE 
006-047-G12GCCCGGCCCAAAANONE 
006-048-B04GCCCGGCCCAAAANONE 
006-049-D01GCCCGGCCCAAAANONE 
006-049-G02GCCCGGCCCAAAANONE 
006-049-G10GCCCGGCCCAAAANONE 
006-049-H04GCCCGGCCCAAAANONE 
006-050-D05GCCCGGCCCAAAANONE 
006-050-F05GCCCGGCCCAAAANONE 
006-051-B05GCCCGGCCCAAAANONE 
006-051-G12GCCCGGCCCAAAANONE 
006-052-D12GCCCGGCCCAAAANONE 
006-053-D06GCCCGGCCCAAAANONE 
006-054-H02GCCCGGCCCAAAANONE 
006-055-A03GCCCGGCCCAAAANONE 
006-055-C01GCCCGGCCCAAAANONE 
006-055-E07GCCCGGCCCAAAANONE 
006-055-H06GCCCGGCCCAAAANONE 
006-056-F06GCCCGGCCCAAAANONE 
006-057-D03GCCCGGCCCAAAANONE 
006-057-D05GCCCGGCCCAAAANONE 
006-057-G01GCCCGGCCCAAAANONE 
006-058-A03GCCCGGCCCAAAANONE 
006-058-B06GCCCGGCCCAAAANONE 
006-059-A09GCCCGGCCCAAAANONE 
006-059-H11GCCCGGCCCAAAANONE 
006-060-A04GCCCGGCCCAAAANONE 
006-060-A09GCCCGGCCCAAAANONE 
006-060-C11GCCCGGCCCAAAANONE 
006-060-D08GCCCGGCCCAAAANONE 
006-061-A04GCCCGGCCCAAAANONE 
006-061-E01GCCCGGCCCAAAANONE 
006-061-G10GCCCGGCCCAAAANONE 
006-061-H12GCCCGGCCCAAAANONE 
006-062-B07GCCCGGCCCAAAANONE 
006-062-G03GCCCGGCCCAAAANONE 
006-062-H12GCCCGGCCCAAAANONE 
006-063-D05GCCCGGCCCAAAANONE 
006-063-E04GCCCGGCCCAAAANONE 
006-063-F05GCCCGGCCCAAAANONE 
006-063-G05GCCCGGCCCAAAANONE 
006-064-B07GCCCGGCCCAAAANONE 
006-065-C11GCCCGGCCCAAAANONE 
006-065-H02GCCCGGCCCAAAANONE 
006-067-C12GCCCGGCCCAAAANONE 
006-067-F10GCCCGGCCCAAAANONE 
006-068-E02GCCCGGCCCAAAANONE 
006-068-G04GCCCGGCCCAAAANONE 
006-069-A02GCCCGGCCCAAAANONE 
006-071-A07GCCCGGCCCAAAANONE 
006-072-F11GCCCGGCCCAAAANONE 
006-072-F12GCCCGGCCCAAAANONE 
006-073-E12GCCCGGCCCAAAANONE 
006-073-F08GCCCGGCCCAAAANONE 
006-073-H07GCCCGGCCCAAAANONE 
006-074-A07GCCCGGCCCAAAANONE 
006-075-A12GCCCGGCCCAAAANONE 
006-075-B01GCCCGGCCCAAAANONE 
006-075-H10GCCCGGCCCAAAANONE 
006-075-H12GCCCGGCCCAAAANONE 
006-076-B06GCCCGGCCCAAAANONE 
006-077-A09GCCCGGCCCAAAANONE 
006-077-D05GCCCGGCCCAAAANONE 
006-078-C11GCCCGGCCCAAAANONE 
006-078-D12GCCCGGCCCAAAANONE 
006-078-E02GCCCGGCCCAAAANONE 
006-079-A01GCCCGGCCCAAAANONE 
006-079-E02GCCCGGCCCAAAANONE 
006-079-F03GCCCGGCCCAAAANONE 
006-080-G11GCCCGGCCCAAAANONE 
006-081-C02GCCCGGCCCAAAANONE 
006-081-C08GCCCGGCCCAAAANONE 
006-082-B06GCCCGGCCCAAAANONE 
006-082-C11GCCCGGCCCAAAANONE 
006-082-H04GCCCGGCCCAAAANONE 
006-083-E04GCCCGGCCCAAAANONE 
006-083-H12GCCCGGCCCAAAANONE 
006-084-C08GCCCGGCCCAAAANONE 
006-084-E07GCCCGGCCCAAAANONE 
006-084-E10GCCCGGCCCAAAANONE 
006-085-E06GCCCGGCCCAAAANONE 
006-085-E10GCCCGGCCCAAAANONE 
006-086-F06GCCCGGCCCAAAANONE 
006-087-D08GCCCGGCCCAAAANONE 
006-087-F03GCCCGGCCCAAAANONE 
006-087-F10GCCCGGCCCAAAANONE 
006-087-G07GCCCGGCCCAAAANONE 
006-088-A02GCCCGGCCCAAAANONE 
006-089-A04GCCCGGCCCAAAANONE 
006-089-B12GCCCGGCCCAAAANONE 
006-089-D06GCCCGGCCCAAAANONE 
006-089-D10GCCCGGCCCAAAANONE 
006-089-H05GCCCGGCCCAAAANONE 
006-090-C06GCCCGGCCCAAAANONE 
006-091-A03GCCCGGCCCAAAANONE 
006-091-E04GCCCGGCCCAAAANONE 
006-091-H12GCCCGGCCCAAAANONE 
006-092-A08GCCCGGCCCAAAANONE 
006-092-F01GCCCGGCCCAAAANONE 
006-092-G08GCCCGGCCCAAAANONE 
006-093-B12GCCCGGCCCAAAANONE 
006-093-D04GCCCGGCCCAAAANONE 
006-093-F01GCCCGGCCCAAAANONE 
006-094-A08GCCCGGCCCAAAANONE 
006-094-F01GCCCGGCCCAAAANONE 
006-094-F03GCCCGGCCCAAAANONE 
006-095-C12GCCCGGCCCAAAANONE 
006-095-E10GCCCGGCCCAAAANONE 
006-095-E12GCCCGGCCCAAAANONE 
006-095-G06GCCCGGCCCAAAANONE 
006-096-B12GCCCGGCCCAAAANONE 
006-096-C12GCCCGGCCCAAAANONE 
006-096-G02GCCCGGCCCAAAANONE 
006-097-D01GCCCGGCCCAAAANONE 
006-097-D07GCCCGGCCCAAAANONE 
006-097-F04GCCCGGCCCAAAANONE 
006-098-C07GCCCGGCCCAAAANONE 
006-098-D04GCCCGGCCCAAAANONE 
006-099-E06GCCCGGCCCAAAANONE 
006-099-F02GCCCGGCCCAAAANONE 
006-099-F10GCCCGGCCCAAAANONE 
006-100-A07GCCCGGCCCAAAANONE 
006-100-B10GCCCGGCCCAAAANONE 
006-100-G01GCCCGGCCCAAAANONE 
006-100-H06GCCCGGCCCAAAANONE 
006-101-D01GCCCGGCCCAAAANONE 
006-101-F03GCCCGGCCCAAAANONE 
006-102-A12GCCCGGCCCAAAANONE 
006-102-B11GCCCGGCCCAAAANONE 
006-102-C03GCCCGGCCCAAAANONE 
006-102-F11GCCCGGCCCAAAANONE 
006-103-A08GCCCGGCCCAAAANONE 
006-103-B06GCCCGGCCCAAAANONE 
006-103-D01GCCCGGCCCAAAANONE 
006-103-F02GCCCGGCCCAAAANONE 
006-104-B02GCCCGGCCCAAAANONE 
006-104-C01GCCCGGCCCAAAANONE 
006-104-F09GCCCGGCCCAAAANONE 
006-104-H11GCCCGGCCCAAAANONE 
006-105-A03GCCCGGCCCAAAANONE 
006-105-D09GCCCGGCCCAAAANONE 
006-106-B10GCCCGGCCCAAAANONE 
006-107-A06GCCCGGCCCAAAANONE 
006-107-C04GCCCGGCCCAAAANONE 
006-107-E03GCCCGGCCCAAAANONE 
006-107-F05GCCCGGCCCAAAANONE 
006-108-C09GCCCGGCCCAAAANONE 
006-109-C09GCCCGGCCCAAAANONE 
006-109-D10GCCCGGCCCAAAANONE 
006-109-E06GCCCGGCCCAAAANONE 
006-109-E10GCCCGGCCCAAAANONE 
006-110-A06GCCCGGCCCAAAANONE 
006-110-C11GCCCGGCCCAAAANONE 
006-111-A02GCCCGGCCCAAAANONE 
006-111-F02GCCCGGCCCAAAANONE 
006-112-A08GCCCGGCCCAAAANONE 
006-112-H06GCCCGGCCCAAAANONE 
006-113-A08GCCCGGCCCAAAANONE 
006-113-B01GCCCGGCCCAAAANONE 
006-113-C05GCCCGGCCCAAAANONE 
006-113-D01GCCCGGCCCAAAANONE 
006-113-D04GCCCGGCCCAAAANONE 
006-113-D06GCCCGGCCCAAAANONE 
006-113-E09GCCCGGCCCAAAANONE 
006-114-F06GCCCGGCCCAAAANONE 
006-116-B02GCCCGGCCCAAAANONE 
006-117-B07GCCCGGCCCAAAANONE 
006-117-G04GCCCGGCCCAAAANONE 
006-118-D01GCCCGGCCCAAAANONE 
006-118-D12GCCCGGCCCAAAANONE 
006-118-F12GCCCGGCCCAAAANONE 
006-118-G12GCCCGGCCCAAAANONE 
006-119-B08GCCCGGCCCAAAANONE 
006-120-E09GCCCGGCCCAAAANONE 
006-120-G05GCCCGGCCCAAAANONE 
006-120-G10GCCCGGCCCAAAANONE 
009-022-D12GCCCGGCCCAAAANONE 
009-051-H08GCCCGGCCCAAAANONE 
009-065-F05GCCCGGCCCAAAANONE 
009-070-A06GCCCGGCCCAAAANONE 
009-073-B07GCCCGGCCCAAAANONE 
009-092-C10GCCCGGCCCAAAANONE 
009-093-D03GCCCGGCCCAAAANONE 
009-103-B04GCCCGGCCCAAAANONE 
009-106-H08GCCCGGCCCAAAANONE 
009-120-B05GCCCGGCCCAAAANONE 
009-121-F05GCCCGGCCCAAAANONE 
009-122-B04GCCCGGCCCAAAANONE 
009-122-D08GCCCGGCCCAAAANONE 
009-123-F07GCCCGGCCCAAAANONE 
009-125-G02GCCCGGCCCAAAANONE 
009-128-F02GCCCGGCCCAAAANONE 
009-128-H07GCCCGGCCCAAAANONE 
009-131-C06GCCCGGCCCAAAANONE 
009-132-F08GCCCGGCCCAAAANONE 
009-133-G08GCCCGGCCCAAAANONE 
009-134-D09GCCCGGCCCAAAANONE 
009-135-F01GCCCGGCCCAAAANONE 
009-149-E11GCCCGGCCCAAAANONE 
009-153-H04GCCCGGCCCAAAANONE 
009-161-E04GCCCGGCCCAAAANONE 
009-163-A09GCCCGGCCCAAAANONE 
009-163-C05GCCCGGCCCAAAANONE 
009-163-E10GCCCGGCCCAAAANONE 
009-165-F04GCCCGGCCCAAAANONE 
009-166-A07GCCCGGCCCAAAANONE 
009-169-G12GCCCGGCCCAAAANONE 
009-172-G08GCCCGGCCCAAAANONE 
009-179-E06GCCCGGCCCAAAANONE 
009-181-F09GCCCGGCCCAAAANONE 
009-190-G07GCCCGGCCCAAAANONE 
009-191-D01GCCCGGCCCAAAANONE 
009-195-G02GCCCGGCCCAAAANONE 
AF022738GCCCGGCCCAAAANONE 
AK061512GCCCGGCCCAAAANONE 
AK068972GCCCGGCCCAAAANONE 
AK103926GCCCGGCCCAAAANONE 
AK103999GCCCGGCCCAAAANONE 
AK104224GCCCGGCCCAAAANONE 
AK104465GCCCGGCCCAAAANONE 
AK104495GCCCGGCCCAAAANONE 
AK109399GCCCGGCCCAAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCCCGGCCCAAAANONE 
AK119545GCCCGGCCCAAAANONE 
J013043L10GCCCGGCCCAAAANONE 
J013050A09GCCCGGCCCAAAANONE 
J023001G03GCCCGGCCCAAAANONE 
J023024D14GCCCGGCCCAAAANONE 
J023072E11GCCCGGCCCAAAANONE 
J023149E18GCCCGGCCCAAAANONE 
J033029B16GCCCGGCCCAAAANONE 
J065001O21GCCCGGCCCAAAANONE 
J065035B04GCCCGGCCCAAAANONE 
J065044D18GCCCGGCCCAAAANONE 
J065057F12GCCCGGCCCAAAANONE 
J065060A11GCCCGGCCCAAAANONE 
J065062G15GCCCGGCCCAAAANONE 
J065080F13GCCCGGCCCAAAANONE 
J065084N12GCCCGGCCCAAAANONE 
J065101D02GCCCGGCCCAAAANONE 
J065107C07GCCCGGCCCAAAANONE 
J065112N24GCCCGGCCCAAAANONE 
J065141I16GCCCGGCCCAAAANONE 
J065147D05GCCCGGCCCAAAANONE 
J065167H02GCCCGGCCCAAAANONE 
J065207K23GCCCGGCCCAAAANONE 
J075008E16GCCCGGCCCAAAANONE 
J075014F03GCCCGGCCCAAAANONE 
J075015O17GCCCGGCCCAAAANONE 
J075020H20GCCCGGCCCAAAANONE 
J075021E22GCCCGGCCCAAAANONE 
J075023N13GCCCGGCCCAAAANONE 
J075028H10GCCCGGCCCAAAANONE 
J075040F20GCCCGGCCCAAAANONE 
J075051L23GCCCGGCCCAAAANONE 
J075069G16GCCCGGCCCAAAANONE 
J075084F24GCCCGGCCCAAAANONE 
J075090H09GCCCGGCCCAAAANONE 
J075092M21GCCCGGCCCAAAANONE 
J075110C10GCCCGGCCCAAAANONE 
J075111J12GCCCGGCCCAAAANONE 
J075114L04GCCCGGCCCAAAANONE 
J075139E02GCCCGGCCCAAAANONE 
J075160M10GCCCGGCCCAAAANONE 
J075176J03GCCCGGCCCAAAANONE 
J075183I17GCCCGGCCCAAAANONE 
J075191N10GCCCGGCCCAAAANONE 
J075193D07GCCCGGCCCAAAANONE 
J075194M16GCCCGGCCCAAAANONE 
J075197K04GCCCGGCCCAAAANONE 
J080032I11GCCCGGCCCAAAANONE 
J080076M11GCCCGGCCCAAAANONE 
J080311J08GCCCGGCCCAAAANONE 
J080317E05GCCCGGCCCAAAANONE 
J090034L08GCCCGGCCCAAAANONE 
J100040D19GCCCGGCCCAAAANONE 
J100074C11GCCCGGCCCAAAANONE 
Os07g0564700AK059018TTTTGGGCTTGHypothetical protein. 
Os07g0565600AK071983CTGGCCCAAAASimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481CTGGCCCAAAANONE 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0569100013-067-E02GCCCAAAANONE 
013-081-C06GCCCAAAANONE 
014-030-G06GCCCAAAANONE 
014-034-H09GCCCAAAANONE 
AK120160GCCCAAAARemorin, C-terminal region domain containing protein. 
J090034F20GCCCAAAANONE 
Os07g0586500AK072668GCCCAAAANONE 
AK120683GCCCAAAASimilar to SUMO activating enzyme 2. 
J065033L18GCCCAAAANONE 
J065038H20GCCCAAAANONE 
J065045M20GCCCAAAANONE 
J065046E10GCCCAAAANONE 
J065055A10GCCCAAAANONE 
J065098P14GCCCAAAANONE 
J065156B19GCCCAAAANONE 
J065195P22GCCCAAAANONE 
J075002O06GCCCAAAANONE 
J075003D13GCCCAAAANONE 
J075004K05GCCCAAAANONE 
J075010C10GCCCAAAANONE 
J075011C14GCCCAAAANONE 
J075026E16GCCCAAAANONE 
J075041L23GCCCAAAANONE 
J075044C21GCCCAAAANONE 
J075071M16GCCCAAAANONE 
J075076O13GCCCAAAANONE 
J075080G12GCCCAAAANONE 
J075091A03GCCCAAAANONE 
J075091A21GCCCAAAANONE 
J075106K17GCCCAAAANONE 
J075120G20GCCCAAAANONE 
J075125H10GCCCAAAANONE 
J075129E05GCCCAAAANONE 
J075143B18GCCCAAAANONE 
J075153P22GCCCAAAANONE 
J075156A12GCCCAAAANONE 
J075156E19GCCCAAAANONE 
J075159E16GCCCAAAANONE 
J075165E16GCCCAAAANONE 
J075174L21GCCCAAAANONE 
J075176N06GCCCAAAANONE 
J075176N13GCCCAAAANONE 
J075179L20GCCCAAAANONE 
J075186P20GCCCAAAANONE 
J090044I17GCCCAAAANONE 
J090051K13GCCCAAAANONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0598900015-040-C12TTTTGGGCCATNONE 
AK102627TTTTGGGCCATCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521TTTTGGGCCATNONE 
J033087C18TTTTGGGCCATNONE 
J033099K03TTTTGGGCCATNONE 
J065054E02TTTTGGGCCATNONE 
J090055O05TTTTGGGCCATNONE 
Os07g0611600AK059431TTTTGGGCCTTGNONE 
J033096O12TTTTGGGCCTTGNONE 
J075143O21TTTTGGGCCTTGNONE 
Os07g0614100AB032062TTTTGGGCCGCANONE 
AK058885TTTTGGGCCGCANONE 
AK069145TTTTGGGCCGCANONE 
AK102448TTTTGGGCCGCAAlpha 1-2 subunit of 20S proteasome. 
J023007E07TTTTGGGCCGCANONE 
J033093O06TTTTGGGCCGCANONE 
Os07g0616900AK071047CTCGGCCCAAAAProtein of unknown function DUF500 family protein. 
J013106G03CTCGGCCCAAAANONE 
J013124C20CTCGGCCCAAAANONE 
J033096D16CTCGGCCCAAAANONE 
J043005E08CTCGGCCCAAAANONE 
J065197K12CTCGGCCCAAAANONE 
J065211I03CTCGGCCCAAAANONE 
Os07g0622700AK107120GCCCAAAAEpoxide hydrolase family protein. 
Os07g0644300AK066726TCAGCCCAAAASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TCAGCCCAAAANONE 
Os07g0659300AK069789GCCCAAAAConserved hypothetical protein. 
Os07g0673900J080092A21GCCCAAAANONE 
Os07g0679000AK070738GCCCAAAASimilar to Potassium transporter 2 (AtPOT2) (AtKUP2) (AtKT2). 
Os07g0681700AK103213TTTTGGGCGlycosyl transferase, family 8 protein. 
Os07g0688300AK068325TTGGCCCAAAASimilar to Importin alpha 1. 
AK099611TTGGCCCAAAANONE 
Os08g0143500006-072-G06TTTTGGGCCGTTNONE 
016-053-H02TTTTGGGCCGTTNONE 
AK061094TTTTGGGCCGTTNONE 
AK071122TTTTGGGCCGTTGlycosyl transferase, family 14 protein. 
J023081E17TTTTGGGCCGTTNONE 
J023106O18TTTTGGGCCGTTNONE 
J043001N22TTTTGGGCCGTTNONE 
J065062D05TTTTGGGCCGTTNONE 
J065099M15TTTTGGGCCGTTNONE 
J065180K12TTTTGGGCCGTTNONE 
J090045L23TTTTGGGCCGTTNONE 
J100088K05TTTTGGGCCGTTNONE 
Os08g0158900AK067062TTTTGGGCTGGGTP1/OBG domain containing protein. 
J013089F04TTTTGGGCTGGNONE 
J013092D16TTTTGGGCTGGNONE 
J033120K14TTTTGGGCTGGNONE 
J033133F24TTTTGGGCTGGNONE 
J033145A10TTTTGGGCTGGNONE 
J033145A11TTTTGGGCTGGNONE 
J053048H24TTTTGGGCTGGNONE 
J053075H10TTTTGGGCTGGNONE 
Os08g0159000AK073617CCAGCCCAAAANONE 
AK103973CCAGCCCAAAASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CCAGCCCAAAANONE 
J033051J11CCAGCCCAAAANONE 
J065101C10CCAGCCCAAAANONE 
J065168B04CCAGCCCAAAANONE 
J065184E22CCAGCCCAAAANONE 
J080021D11CCAGCCCAAAANONE 
J080025H10CCAGCCCAAAANONE 
J080026N19CCAGCCCAAAANONE 
J080034A12CCAGCCCAAAANONE 
J080040L02CCAGCCCAAAANONE 
J080042H19CCAGCCCAAAANONE 
J080047B05CCAGCCCAAAANONE 
J080047E09CCAGCCCAAAANONE 
J080047I01CCAGCCCAAAANONE 
J080052H19CCAGCCCAAAANONE 
J080062K13CCAGCCCAAAANONE 
J080063A22CCAGCCCAAAANONE 
J080068G18CCAGCCCAAAANONE 
J080068N19CCAGCCCAAAANONE 
J080076G08CCAGCCCAAAANONE 
J080077H13CCAGCCCAAAANONE 
J080077K06CCAGCCCAAAANONE 
J080093D15CCAGCCCAAAANONE 
J080094D21CCAGCCCAAAANONE 
J080097A20CCAGCCCAAAANONE 
J080097E21CCAGCCCAAAANONE 
J080097N17CCAGCCCAAAANONE 
J100071K18CCAGCCCAAAANONE 
J100072F09CCAGCCCAAAANONE 
Os08g0227100AK071657TAGGCCCAAAATRAF-like domain containing protein. 
AK103481TAGGCCCAAAANONE 
J065183O06TAGGCCCAAAANONE 
J090013C07TAGGCCCAAAANONE 
J090081F11TAGGCCCAAAANONE 
Os08g0236900AK109597TTTTGGGCConserved hypothetical protein. 
Os08g0243600AB110183CACGGCCCAAAANONE 
AK101443CACGGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0243900011-052-H03TTTTGGGCCAGNONE 
AK102707TTTTGGGCCAGNONE 
AK121452TTTTGGGCCAGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20TTTTGGGCCAGNONE 
J065168E04TTTTGGGCCAGNONE 
Os08g0260600AK108529ACAGCCCAAAACD9/CD37/CD63 antigen family protein. 
Os08g0327400AK070992AAGGCCCAAAASimilar to Enoyl-ACP reductase (Fragment). 
J023077K10AAGGCCCAAAANONE 
J065075F06AAGGCCCAAAANONE 
J065112N14AAGGCCCAAAANONE 
J090028K07AAGGCCCAAAANONE 
J090039C15AAGGCCCAAAANONE 
J090048I11AAGGCCCAAAANONE 
J090083M10AAGGCCCAAAANONE 
Os08g0386300AK059323GCCCAAAANONE 
AK070379GCCCAAAACytochrome b5 domain containing protein. 
J023054P20GCCCAAAANONE 
J033089H01GCCCAAAANONE 
J065013I01GCCCAAAANONE 
J065212E17GCCCAAAANONE 
J080317O15GCCCAAAANONE 
J090018O07GCCCAAAANONE 
Os08g0401100AK121508TTTTGGGCTAnkyrin repeat containing protein. 
J023009D05TTTTGGGCTNONE 
J033023C05TTTTGGGCTNONE 
Os08g0412100AK072641TTGGCCCAAAADisease resistance protein family protein. 
Os08g0474000009-121-F01TTTTGGGCNONE 
009-124-B06TTTTGGGCNONE 
AK062882TTTTGGGCSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0485900AK110716AAAAGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0496000011-009-D02TCAGCCCAAAANONE 
011-009-D02TTTTGGGCNONE 
AK103187TCAGCCCAAAACytochrome oxidase assembly family protein. 
AK103187TTTTGGGCCytochrome oxidase assembly family protein. 
J033121L24TCAGCCCAAAANONE 
J033121L24TTTTGGGCNONE 
J033149A07TCAGCCCAAAANONE 
J033149A07TTTTGGGCNONE 
J065198L20TCAGCCCAAAANONE 
J065198L20TTTTGGGCNONE 
J090096F24TCAGCCCAAAANONE 
J090096F24TTTTGGGCNONE 
Os08g0498100006-021-A02TTTTGGGCNONE 
006-023-A11TTTTGGGCNONE 
006-030-F06TTTTGGGCNONE 
006-030-H09TTTTGGGCNONE 
006-036-F02TTTTGGGCNONE 
006-041-G03TTTTGGGCNONE 
006-048-C06TTTTGGGCNONE 
006-054-B09TTTTGGGCNONE 
006-055-H11TTTTGGGCNONE 
006-058-A05TTTTGGGCNONE 
006-067-H01TTTTGGGCNONE 
006-075-E10TTTTGGGCNONE 
006-075-G10TTTTGGGCNONE 
006-078-G01TTTTGGGCNONE 
006-087-F08TTTTGGGCNONE 
006-094-B02TTTTGGGCNONE 
006-094-D07TTTTGGGCNONE 
006-094-G04TTTTGGGCNONE 
006-095-B05TTTTGGGCNONE 
006-095-C10TTTTGGGCNONE 
006-099-C11TTTTGGGCNONE 
006-100-G11TTTTGGGCNONE 
006-103-A01TTTTGGGCNONE 
006-104-D10TTTTGGGCNONE 
006-107-F12TTTTGGGCNONE 
006-115-B10TTTTGGGCNONE 
006-117-C05TTTTGGGCNONE 
006-118-A01TTTTGGGCNONE 
006-120-E06TTTTGGGCNONE 
006-120-H08TTTTGGGCNONE 
009-107-F08TTTTGGGCNONE 
009-114-B07TTTTGGGCNONE 
009-153-C12TTTTGGGCNONE 
009-166-B03TTTTGGGCNONE 
AB110168TTTTGGGCNONE 
AK071482TTTTGGGCSimilar to Caffeoyl-CoA O-methyltransferase 2 (EC 2.1.1.104) (Trans-caffeoyl-CoA 3-O-methyltransferase 2) (CCoAMT-2) (CCoAOMT-2). 
AK104326TTTTGGGCNONE 
AK104801TTTTGGGCNONE 
J013097M21TTTTGGGCNONE 
J023084B07TTTTGGGCNONE 
J023093N24TTTTGGGCNONE 
J033089B10TTTTGGGCNONE 
J065047L15TTTTGGGCNONE 
J065106O12TTTTGGGCNONE 
J065190P10TTTTGGGCNONE 
J090026B04TTTTGGGCNONE 
J100065D22TTTTGGGCNONE 
J100072K13TTTTGGGCNONE 
J100083E01TTTTGGGCNONE 
J100090A05TTTTGGGCNONE 
Os08g0517900015-019-D06AAAAGCCCAAAAAAGGCCCATATNONE 
AK064304AAAAGCCCAAAAAAGGCCCATATSimilar to 30S ribosomal protein S16. 
Os08g0520100AK059686TTTTGGGCCCACAANONE 
AK120052TTTTGGGCCCACAAPseudouridine synthase domain containing protein. 
Os08g0526500016-063-D04TTTTGGGCCAGANONE 
AK073431TTTTGGGCCAGASimilar to SOX-1 protein. 
J033042D10TTTTGGGCCAGANONE 
J065019E02TTTTGGGCCAGANONE 
Os08g0530200009-166-A09TTTTGGGCCCNONE 
AK062052TTTTGGGCCCNONE 
AK120448TTTTGGGCCCSimilar to 60S ribosomal protein L17. 
J013100M19TTTTGGGCCCNONE 
J023045K22TTTTGGGCCCNONE 
J033046D13TTTTGGGCCCNONE 
J033066N01TTTTGGGCCCNONE 
J033143N05TTTTGGGCCCNONE 
J053070P13TTTTGGGCCCNONE 
J065011C18TTTTGGGCCCNONE 
J065013C23TTTTGGGCCCNONE 
J065016B09TTTTGGGCCCNONE 
J065016C21TTTTGGGCCCNONE 
J065023K18TTTTGGGCCCNONE 
J065028F12TTTTGGGCCCNONE 
J065030L02TTTTGGGCCCNONE 
J065042H15TTTTGGGCCCNONE 
J065078H02TTTTGGGCCCNONE 
J065092D07TTTTGGGCCCNONE 
J065092E01TTTTGGGCCCNONE 
J065104M21TTTTGGGCCCNONE 
J065119P21TTTTGGGCCCNONE 
J065124B15TTTTGGGCCCNONE 
J065146H09TTTTGGGCCCNONE 
J065149L09TTTTGGGCCCNONE 
J065156A09TTTTGGGCCCNONE 
J065157H23TTTTGGGCCCNONE 
J065165L14TTTTGGGCCCNONE 
J065165M18TTTTGGGCCCNONE 
J065172O03TTTTGGGCCCNONE 
J065192M18TTTTGGGCCCNONE 
J065198D21TTTTGGGCCCNONE 
J065200D05TTTTGGGCCCNONE 
J065202B20TTTTGGGCCCNONE 
J065212P11TTTTGGGCCCNONE 
J065215E08TTTTGGGCCCNONE 
J065217P19TTTTGGGCCCNONE 
J075005I19TTTTGGGCCCNONE 
J075134J06TTTTGGGCCCNONE 
J075162G12TTTTGGGCCCNONE 
J075178H07TTTTGGGCCCNONE 
J075186K01TTTTGGGCCCNONE 
J080315I17TTTTGGGCCCNONE 
J080318P19TTTTGGGCCCNONE 
J090004H16TTTTGGGCCCNONE 
J090020A16TTTTGGGCCCNONE 
J090047J12TTTTGGGCCCNONE 
J090080E07TTTTGGGCCCNONE 
J090090H23TTTTGGGCCCNONE 
J100021G24TTTTGGGCCCNONE 
J100037L04TTTTGGGCCCNONE 
J100043L09TTTTGGGCCCNONE 
J100044A10TTTTGGGCCCNONE 
Os08g0532900003-130-B08GCCCAAAANONE 
AK073679GCCCAAAAemp24/gp25L/p24 family protein. 
AK105383GCCCAAAANONE 
J023029A07GCCCAAAANONE 
J023069M02GCCCAAAANONE 
J075149A05GCCCAAAANONE 
J090095E01GCCCAAAANONE 
J100031L03GCCCAAAANONE 
J100082P11GCCCAAAANONE 
Os08g0535400004-001-H10CCCGGCCCAAAANONE 
AK071527CCCGGCCCAAAAZinc finger, DHHC-type domain containing protein. 
J023107B02CCCGGCCCAAAANONE 
Os08g0557100AK070743AAGGCCCAAAANONE 
AK101214AAGGCCCAAAASimilar to Nucleic acid-binding protein precursor. 
AK105901AAGGCCCAAAANONE 
J033031B04AAGGCCCAAAANONE 
J080004F08AAGGCCCAAAANONE 
J080004H12AAGGCCCAAAANONE 
J080005H08AAGGCCCAAAANONE 
J080005I02AAGGCCCAAAANONE 
J080008N16AAGGCCCAAAANONE 
J080009H23AAGGCCCAAAANONE 
J080012H17AAGGCCCAAAANONE 
J080012J21AAGGCCCAAAANONE 
J080013I20AAGGCCCAAAANONE 
J080016E07AAGGCCCAAAANONE 
J080018O04AAGGCCCAAAANONE 
J080020B18AAGGCCCAAAANONE 
J080021I16AAGGCCCAAAANONE 
J080022N01AAGGCCCAAAANONE 
J080023G08AAGGCCCAAAANONE 
J080023N09AAGGCCCAAAANONE 
J080024J24AAGGCCCAAAANONE 
J080025M12AAGGCCCAAAANONE 
J080028A22AAGGCCCAAAANONE 
J080028I01AAGGCCCAAAANONE 
J080029D22AAGGCCCAAAANONE 
J080030M02AAGGCCCAAAANONE 
J080031B06AAGGCCCAAAANONE 
J080035G08AAGGCCCAAAANONE 
J080036F19AAGGCCCAAAANONE 
J080038P14AAGGCCCAAAANONE 
J080039C17AAGGCCCAAAANONE 
J080043A10AAGGCCCAAAANONE 
J080044H02AAGGCCCAAAANONE 
J080044P12AAGGCCCAAAANONE 
J080047L06AAGGCCCAAAANONE 
J080050L06AAGGCCCAAAANONE 
J080052J11AAGGCCCAAAANONE 
J080052M10AAGGCCCAAAANONE 
J080053E20AAGGCCCAAAANONE 
J080054J01AAGGCCCAAAANONE 
J080059N09AAGGCCCAAAANONE 
J080064F19AAGGCCCAAAANONE 
J080064N22AAGGCCCAAAANONE 
J080065K14AAGGCCCAAAANONE 
J080065M12AAGGCCCAAAANONE 
J080068O07AAGGCCCAAAANONE 
J080076P20AAGGCCCAAAANONE 
J080087D08AAGGCCCAAAANONE 
J080087H16AAGGCCCAAAANONE 
J080090N23AAGGCCCAAAANONE 
J080091H04AAGGCCCAAAANONE 
J080091P13AAGGCCCAAAANONE 
J080094O15AAGGCCCAAAANONE 
J080094P14AAGGCCCAAAANONE 
J080095I07AAGGCCCAAAANONE 
J080097E22AAGGCCCAAAANONE 
Os08g0558000J080005K14TCCGGCCCAAAAGGCCCAGTANONE 
Os09g0134500AK065095AGCCCAAAANONE 
AK074022AGCCCAAAASimilar to Trithorax-like protein 1. 
J013001M12AGCCCAAAANONE 
J013122N21AGCCCAAAANONE 
J033024A02AGCCCAAAANONE 
J033039K15AGCCCAAAANONE 
J033074A15AGCCCAAAANONE 
J065032I05AGCCCAAAANONE 
J065087M02AGCCCAAAANONE 
J065182B06AGCCCAAAANONE 
J065183O07AGCCCAAAANONE 
J090036I19AGCCCAAAANONE 
Os09g0324200AK109621TTTCGGCCTTTTGGGCTGACyclin-like F-box domain containing protein. 
Os09g0327300AK059603AGGGCCCAAAASimilar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment). 
AK059603GTGGCCCAAAASimilar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment). 
J100073E06AGGGCCCAAAANONE 
J100073E06GTGGCCCAAAANONE 
Os09g0329800AK069775TTTTGGGCCTAACAGCCCATATConserved hypothetical protein. 
Os09g0329900Os09g0329900TTTTGGGCCTAACAGCCCATATNONE 
Os09g0446200011-092-H04GCCCAAAASpc97/Spc98 family protein. 
Os09g0465800009-106-E01AAAGCCCAAAANONE 
009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785AAAGCCCAAAAConserved hypothetical protein. 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21AAAGCCCAAAANONE 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0466100011-041-C05GCCCAAAANONE 
AB080248GCCCAAAACyclin-like domain containing protein. 
AK063940GCCCAAAANONE 
AK102698GCCCAAAANONE 
J033060F17GCCCAAAANONE 
J033103I16GCCCAAAANONE 
J043024L16GCCCAAAANONE 
Os09g0480400AK100641GCCCAAAASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
J023110G15GCCCAAAANONE 
J090053K21GCCCAAAANONE 
Os09g0497400AK058354AGCCCAAAANONE 
AK068677AGCCCAAAAProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19AGCCCAAAANONE 
J023011D22AGCCCAAAANONE 
J023081K05AGCCCAAAANONE 
J033060O14AGCCCAAAANONE 
J075020I08AGCCCAAAANONE 
J075034J03AGCCCAAAANONE 
J075049M15AGCCCAAAANONE 
J075065K02AGCCCAAAANONE 
J075099L06AGCCCAAAANONE 
Os09g0534000AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0568000AK068829CAGGCCCAAAANONE 
Os11g0106700006-055-F11CCAGCCCAAAANONE 
006-099-D08CCAGCCCAAAANONE 
009-155-A12CCAGCCCAAAANONE 
AF519570CCAGCCCAAAANONE 
AK059354CCAGCCCAAAASimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0130500J065119D16TTTTGGGCNONE 
J065169E14TTTTGGGCCyclin-like F-box domain containing protein. 
Os11g0130600AK066342GCCCAAAAConserved hypothetical protein. 
J065192M10GCCCAAAANONE 
Os11g0153600AK065028TTTTGGGCCTGAGTP-binding signal recognition particle SRP54, G-domain containing protein. 
J013001G13TTTTGGGCCTGANONE 
Os11g0159000AK065738AAAAGCCCAAAAConserved hypothetical protein. 
Os11g0162200009-059-H04TCATGGGCCAAAAGCCCAAAANONE 
AK060396TCATGGGCCAAAAGCCCAAAASimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11TCATGGGCCAAAAGCCCAAAANONE 
J065105K09TCATGGGCCAAAAGCCCAAAANONE 
J075024G12TCATGGGCCAAAAGCCCAAAANONE 
J075040K04TCATGGGCCAAAAGCCCAAAANONE 
J075066D13TCATGGGCCAAAAGCCCAAAANONE 
J075108A11TCATGGGCCAAAAGCCCAAAANONE 
J100031D04TCATGGGCCAAAAGCCCAAAANONE 
J100060O05TCATGGGCCAAAAGCCCAAAANONE 
J100075M22TCATGGGCCAAAAGCCCAAAANONE 
Os11g0175500015-087-F02TTTTGGGCCCCACANONE 
AK064320TTTTGGGCCCCACAZinc finger, RING-type domain containing protein. 
AK101592TTTTGGGCCCCACANONE 
Os11g0202600AK102530CTGGCCCAAAAHypothetical protein. 
J090084P12CTGGCCCAAAANONE 
Os11g0231400AK108047TTTTGGGCTProtein of unknown function DUF295 family protein. 
Os11g0264600J100079I22TCAGCCCAAAANONE 
Os11g0311300AK073252GCCCAAAANONE 
AK102900GCCCAAAANONE 
AK122064GCCCAAAANONE 
Os11g0438700012-011-H02TCAGCCCAAAANONE 
AK063434TCAGCCCAAAASimilar to Tropinone reductase-I (EC 1.1.1.206) (TR-I) (Tropine dehydrogenase). 
AK073524TCAGCCCAAAANONE 
J033046I10TCAGCCCAAAANONE 
J043029B09TCAGCCCAAAANONE 
J065033C17TCAGCCCAAAANONE 
J065062D11TCAGCCCAAAANONE 
J065138G10TCAGCCCAAAANONE 
J065184I11TCAGCCCAAAANONE 
J080030B02TCAGCCCAAAANONE 
J090063K06TCAGCCCAAAANONE 
Os11g0449800AK108433TTTTGGGCHypothetical protein. 
Os11g0484300AK121422TTTTGGGCTTCSimilar to Mcm2-prov protein. 
Os11g0532600AK060253AGCTGAGCCCAAAALeucine-rich repeat 2 containing protein. 
J023065M14AGCTGAGCCCAAAANONE 
J023101A10AGCTGAGCCCAAAANONE 
Os11g0581900AK069449GCCCAAAAProtein of unknown function UPF0005 family protein. 
Os11g0592000016-009-G07GCCCAAAANONE 
AK121059GCCCAAAASimilar to Barwin. 
J023056K07GCCCAAAANONE 
J065042D11GCCCAAAANONE 
J075011F19GCCCAAAANONE 
J075024L10GCCCAAAANONE 
J075070F17GCCCAAAANONE 
J075085G18GCCCAAAANONE 
J075118N24GCCCAAAANONE 
J100021P22GCCCAAAANONE 
J100043H20GCCCAAAANONE 
J100047L04GCCCAAAANONE 
J100056C08GCCCAAAANONE 
J100063M03GCCCAAAANONE 
Os11g0592100009-197-B11GCCCAAAANONE 
013-079-C03GCCCAAAANONE 
AK063234GCCCAAAASimilar to Barwin. 
AY435041GCCCAAAANONE 
J065008M11GCCCAAAANONE 
J065013E06GCCCAAAANONE 
J065014I22GCCCAAAANONE 
J065037I15GCCCAAAANONE 
J065058D09GCCCAAAANONE 
J065096G13GCCCAAAANONE 
J065102G18GCCCAAAANONE 
J065168I12GCCCAAAANONE 
J065200B19GCCCAAAANONE 
J065203D22GCCCAAAANONE 
J100035P11GCCCAAAANONE 
J100062N17GCCCAAAANONE 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0603200AK120191GCCCAAAASimilar to ABCF-type protein. 
Os11g0616200AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0703900011-004-D05ACAGCCCAAAANONE 
011-014-C03ACAGCCCAAAANONE 
011-016-C01ACAGCCCAAAANONE 
011-017-B04ACAGCCCAAAANONE 
011-017-E09ACAGCCCAAAANONE 
011-019-E12ACAGCCCAAAANONE 
011-021-H12ACAGCCCAAAANONE 
011-025-H02ACAGCCCAAAANONE 
011-027-B09ACAGCCCAAAANONE 
011-039-G07ACAGCCCAAAANONE 
011-044-G07ACAGCCCAAAANONE 
011-046-F11ACAGCCCAAAANONE 
011-070-F02ACAGCCCAAAANONE 
011-071-A07ACAGCCCAAAANONE 
011-082-A03ACAGCCCAAAANONE 
011-086-B09ACAGCCCAAAANONE 
011-092-C04ACAGCCCAAAANONE 
012-006-F02ACAGCCCAAAANONE 
012-011-G08ACAGCCCAAAANONE 
012-026-C06ACAGCCCAAAANONE 
012-026-G06ACAGCCCAAAANONE 
012-028-E05ACAGCCCAAAANONE 
012-040-A05ACAGCCCAAAANONE 
012-045-C01ACAGCCCAAAANONE 
012-046-A10ACAGCCCAAAANONE 
012-047-H09ACAGCCCAAAANONE 
012-059-A12ACAGCCCAAAANONE 
012-072-D06ACAGCCCAAAANONE 
012-073-D05ACAGCCCAAAANONE 
012-076-D08ACAGCCCAAAANONE 
012-079-G05ACAGCCCAAAANONE 
012-080-A04ACAGCCCAAAANONE 
012-080-E01ACAGCCCAAAANONE 
012-083-C03ACAGCCCAAAANONE 
012-083-G06ACAGCCCAAAANONE 
012-086-G02ACAGCCCAAAANONE 
012-091-A07ACAGCCCAAAANONE 
012-094-G10ACAGCCCAAAANONE 
012-098-A07ACAGCCCAAAANONE 
012-100-G04ACAGCCCAAAANONE 
015-001-A11ACAGCCCAAAANONE 
015-033-E01ACAGCCCAAAANONE 
015-047-F12ACAGCCCAAAANONE 
015-054-E05ACAGCCCAAAANONE 
015-063-H02ACAGCCCAAAANONE 
015-075-E10ACAGCCCAAAANONE 
015-086-F05ACAGCCCAAAANONE 
016-031-A08ACAGCCCAAAANONE 
016-053-A03ACAGCCCAAAANONE 
016-054-C09ACAGCCCAAAANONE 
016-079-C08ACAGCCCAAAANONE 
AK065431ACAGCCCAAAAHeat shock protein 70. 
AK119255ACAGCCCAAAANONE 
J013021C12ACAGCCCAAAANONE 
J013021C17ACAGCCCAAAANONE 
J023027B08ACAGCCCAAAANONE 
J023078A21ACAGCCCAAAANONE 
J023097M06ACAGCCCAAAANONE 
J023100O04ACAGCCCAAAANONE 
J023107B17ACAGCCCAAAANONE 
J023108L24ACAGCCCAAAANONE 
J023109L05ACAGCCCAAAANONE 
J033022M22ACAGCCCAAAANONE 
J033023K21ACAGCCCAAAANONE 
J033031L11ACAGCCCAAAANONE 
J033034H10ACAGCCCAAAANONE 
J033037B16ACAGCCCAAAANONE 
J033037F16ACAGCCCAAAANONE 
J033037H07ACAGCCCAAAANONE 
J033046E22ACAGCCCAAAANONE 
J033050N12ACAGCCCAAAANONE 
J033064F10ACAGCCCAAAANONE 
J033064N10ACAGCCCAAAANONE 
J033066O09ACAGCCCAAAANONE 
J033068H01ACAGCCCAAAANONE 
J033068J07ACAGCCCAAAANONE 
J033070B10ACAGCCCAAAANONE 
J033070G13ACAGCCCAAAANONE 
J033073O13ACAGCCCAAAANONE 
J033075B07ACAGCCCAAAANONE 
J033079L15ACAGCCCAAAANONE 
J033081J06ACAGCCCAAAANONE 
J033086G13ACAGCCCAAAANONE 
J033086N07ACAGCCCAAAANONE 
J033086O05ACAGCCCAAAANONE 
J033091A15ACAGCCCAAAANONE 
J033091D05ACAGCCCAAAANONE 
J033094C12ACAGCCCAAAANONE 
J033099P03ACAGCCCAAAANONE 
J033107L09ACAGCCCAAAANONE 
J033108D16ACAGCCCAAAANONE 
J033109E12ACAGCCCAAAANONE 
J033109K14ACAGCCCAAAANONE 
J033112P22ACAGCCCAAAANONE 
J033116F12ACAGCCCAAAANONE 
J033116K01ACAGCCCAAAANONE 
J033118F19ACAGCCCAAAANONE 
J033121J10ACAGCCCAAAANONE 
J033126H04ACAGCCCAAAANONE 
J033131G17ACAGCCCAAAANONE 
J033131L05ACAGCCCAAAANONE 
J033136A08ACAGCCCAAAANONE 
J033136H22ACAGCCCAAAANONE 
J033143F01ACAGCCCAAAANONE 
J065040M10ACAGCCCAAAANONE 
J065046F17ACAGCCCAAAANONE 
J065048G20ACAGCCCAAAANONE 
J065071N06ACAGCCCAAAANONE 
J065084I24ACAGCCCAAAANONE 
J065171B01ACAGCCCAAAANONE 
J065191J21ACAGCCCAAAANONE 
J065199I20ACAGCCCAAAANONE 
J075076C02ACAGCCCAAAANONE 
J090002P12ACAGCCCAAAANONE 
J090003A11ACAGCCCAAAANONE 
J090003H11ACAGCCCAAAANONE 
J090009M22ACAGCCCAAAANONE 
J090009O11ACAGCCCAAAANONE 
J090014N09ACAGCCCAAAANONE 
J090015A18ACAGCCCAAAANONE 
J090016E16ACAGCCCAAAANONE 
J090016I07ACAGCCCAAAANONE 
J090017O07ACAGCCCAAAANONE 
J090019E10ACAGCCCAAAANONE 
J090020D24ACAGCCCAAAANONE 
J090021M16ACAGCCCAAAANONE 
J090022F13ACAGCCCAAAANONE 
J090023H03ACAGCCCAAAANONE 
J090024E15ACAGCCCAAAANONE 
J090024G19ACAGCCCAAAANONE 
J090026J19ACAGCCCAAAANONE 
J090030E20ACAGCCCAAAANONE 
J090030I15ACAGCCCAAAANONE 
J090032F04ACAGCCCAAAANONE 
J090033N22ACAGCCCAAAANONE 
J090033O19ACAGCCCAAAANONE 
J090036F08ACAGCCCAAAANONE 
J090039A13ACAGCCCAAAANONE 
J090042N07ACAGCCCAAAANONE 
J090043C15ACAGCCCAAAANONE 
J090043N09ACAGCCCAAAANONE 
J090053J10ACAGCCCAAAANONE 
J090054F14ACAGCCCAAAANONE 
J090057N12ACAGCCCAAAANONE 
J090061P13ACAGCCCAAAANONE 
J090062F17ACAGCCCAAAANONE 
J090065H15ACAGCCCAAAANONE 
J090067P11ACAGCCCAAAANONE 
J090068M09ACAGCCCAAAANONE 
J090069E24ACAGCCCAAAANONE 
J090069K16ACAGCCCAAAANONE 
J090070N07ACAGCCCAAAANONE 
J090072M09ACAGCCCAAAANONE 
J090075I24ACAGCCCAAAANONE 
J090075M04ACAGCCCAAAANONE 
J090077D24ACAGCCCAAAANONE 
J090080M17ACAGCCCAAAANONE 
J090080O14ACAGCCCAAAANONE 
J090081C12ACAGCCCAAAANONE 
J090084N21ACAGCCCAAAANONE 
J090084O21ACAGCCCAAAANONE 
J090087J18ACAGCCCAAAANONE 
J090092L17ACAGCCCAAAANONE 
J090097A08ACAGCCCAAAANONE 
J100017E24ACAGCCCAAAANONE 
J100018K11ACAGCCCAAAANONE 
J100019A16ACAGCCCAAAANONE 
J100023I23ACAGCCCAAAANONE 
J100024D07ACAGCCCAAAANONE 
J100025H12ACAGCCCAAAANONE 
J100027K19ACAGCCCAAAANONE 
J100028C23ACAGCCCAAAANONE 
J100029A14ACAGCCCAAAANONE 
J100029O19ACAGCCCAAAANONE 
J100030I09ACAGCCCAAAANONE 
J100030J16ACAGCCCAAAANONE 
J100031C01ACAGCCCAAAANONE 
J100031N06ACAGCCCAAAANONE 
J100033H04ACAGCCCAAAANONE 
J100034L20ACAGCCCAAAANONE 
J100036K13ACAGCCCAAAANONE 
J100039M02ACAGCCCAAAANONE 
J100040J01ACAGCCCAAAANONE 
J100042O21ACAGCCCAAAANONE 
J100042P20ACAGCCCAAAANONE 
J100047K22ACAGCCCAAAANONE 
J100049B16ACAGCCCAAAANONE 
J100052M10ACAGCCCAAAANONE 
J100053B05ACAGCCCAAAANONE 
J100053B20ACAGCCCAAAANONE 
J100055I11ACAGCCCAAAANONE 
J100056A13ACAGCCCAAAANONE 
J100057C08ACAGCCCAAAANONE 
J100057N11ACAGCCCAAAANONE 
J100057P07ACAGCCCAAAANONE 
J100059E16ACAGCCCAAAANONE 
J100063N14ACAGCCCAAAANONE 
J100069H01ACAGCCCAAAANONE 
J100071C17ACAGCCCAAAANONE 
J100071K09ACAGCCCAAAANONE 
J100077D07ACAGCCCAAAANONE 
J100078P22ACAGCCCAAAANONE 
J100080F11ACAGCCCAAAANONE 
J100081L07ACAGCCCAAAANONE 
J100083B10ACAGCCCAAAANONE 
J100083K17ACAGCCCAAAANONE 
J100085B22ACAGCCCAAAANONE 
J100085L21ACAGCCCAAAANONE 
J100086B11ACAGCCCAAAANONE 
J100087E06ACAGCCCAAAANONE 
J100087P07ACAGCCCAAAANONE 
J100089H24ACAGCCCAAAANONE 
Os12g0100050Os12g0100050TTTTGGGCTTTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AAAGCCCAAAANONE 
AK061492AAAGCCCAAAASimilar to ALY protein. 
AK068452AAAGCCCAAAANONE 
J013153E18AAAGCCCAAAANONE 
J033140D06AAAGCCCAAAANONE 
J065046A19AAAGCCCAAAANONE 
J065061F08AAAGCCCAAAANONE 
J065101I03AAAGCCCAAAANONE 
J065158B05AAAGCCCAAAANONE 
J065162H06AAAGCCCAAAANONE 
J065195I23AAAGCCCAAAANONE 
J065218E07AAAGCCCAAAANONE 
Os12g0106000AF370029CAAGCCCAAAASimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CAAGCCCAAAANONE 
AK102242CAAGCCCAAAANONE 
AY324879CAAGCCCAAAANONE 
J053063M21CAAGCCCAAAANONE 
J090080A16CAAGCCCAAAANONE 
Os12g0131400J065213D17TTTTGGGCConserved hypothetical protein. 
Os12g0164300AK120100TTTTGGGCTTGCyclin-like F-box domain containing protein. 
J013022J17TTTTGGGCTTGNONE 
J013040L22TTTTGGGCTTGNONE 
J013041G05TTTTGGGCTTGNONE 
J013096I02TTTTGGGCTTGNONE 
J013156F05TTTTGGGCTTGNONE 
J023122E20TTTTGGGCTTGNONE 
J065008K06TTTTGGGCTTGNONE 
J065073G14TTTTGGGCTTGNONE 
J065105H07TTTTGGGCTTGNONE 
J065117A15TTTTGGGCTTGNONE 
J075025K21TTTTGGGCTTGNONE 
J075051A13TTTTGGGCTTGNONE 
J075119C17TTTTGGGCTTGNONE 
J075143A02TTTTGGGCTTGNONE 
J075149K04TTTTGGGCTTGNONE 
J080304A20TTTTGGGCTTGNONE 
J080305H17TTTTGGGCTTGNONE 
J080306D14TTTTGGGCTTGNONE 
J080306N01TTTTGGGCTTGNONE 
J080308P13TTTTGGGCTTGNONE 
J080310C04TTTTGGGCTTGNONE 
J090048B12TTTTGGGCTTGNONE 
J090092A18TTTTGGGCTTGNONE 
J090099G20TTTTGGGCTTGNONE 
Os12g0182200AK099737CAAGCCCAAAASimilar to Dihydrolipoamide S-acetyltransferase. 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0631100006-045-F12TTTTGGGCTTTTNONE 
006-077-C09TTTTGGGCTTTTNONE 
006-078-B11TTTTGGGCTTTTNONE 
AJ292320TTTTGGGCTTTTNONE 
AK061116TTTTGGGCTTTTNONE 
AK066784TTTTGGGCTTTTNONE 
AY029301TTTTGGGCTTTTRas small GTPase, Ras type family protein. 
J065015G13TTTTGGGCTTTTNONE 
J065035E22TTTTGGGCTTTTNONE 
J065037H03TTTTGGGCTTTTNONE 
J065065F12TTTTGGGCTTTTNONE 
J065078K22TTTTGGGCTTTTNONE 
J065081K09TTTTGGGCTTTTNONE 
J065121I23TTTTGGGCTTTTNONE 
J065127I03TTTTGGGCTTTTNONE 
J065130G24TTTTGGGCTTTTNONE 
J065134E23TTTTGGGCTTTTNONE 
J065154H14TTTTGGGCTTTTNONE 
J065183K16TTTTGGGCTTTTNONE 
J065209P13TTTTGGGCTTTTNONE 
J075087O18TTTTGGGCTTTTNONE 
J090065E06TTTTGGGCTTTTNONE 
Os12g0641500AK065733AGCCCAAAANONE 
AK120333AGCCCAAAANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.