version

Summary of OsREG593 (All List)

OrganismOryza sativa  
IDOsREG593  
SequenceGCCCAAAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1554  

Entry Sequences (1554 entries)

LocusGene modelSequenceDescription
Os01g0166200AK111019GTTTGGGCConserved hypothetical protein. 
Os01g0222700012-011-E01GTTTGGGCCGACCGTTGNONE 
AK068883GTTTGGGCCGACCGTTGNONE 
AK101946GTTTGGGCCGACCGTTGZinc finger, BED-type predicted domain containing protein. 
J033075C16GTTTGGGCCGACCGTTGNONE 
J043013D08GTTTGGGCCGACCGTTGNONE 
J065089G19GTTTGGGCCGACCGTTGNONE 
J065197K19GTTTGGGCCGACCGTTGNONE 
J075161L21GTTTGGGCCGACCGTTGNONE 
Os01g0231800009-133-C07GCCCAAACNONE 
AK062918GCCCAAACAppr>p cyclic nucleotide phosphodiesterase domain containing protein. 
Os01g0244400J075054J20AGCCCACCCGCCCAAACProtein of unknown function DUF1618 domain containing protein. 
J075101O11AGCCCACCCGCCCAAACNONE 
J075123K08AGCCCACCCGCCCAAACNONE 
Os01g0246100AK120732AGCCCAAACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0269100011-080-F08AAGGCCCAAACNONE 
AK067610AAGGCCCAAACSimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18AAGGCCCAAACNONE 
J013112F12AAGGCCCAAACNONE 
J023002M17AAGGCCCAAACNONE 
J023022J24AAGGCCCAAACNONE 
J033050A10AAGGCCCAAACNONE 
J033091A17AAGGCCCAAACNONE 
J033123E17AAGGCCCAAACNONE 
J033143H04AAGGCCCAAACNONE 
J043005H18AAGGCCCAAACNONE 
J075038A05AAGGCCCAAACNONE 
J075091K23AAGGCCCAAACNONE 
J075118O05AAGGCCCAAACNONE 
J075195P17AAGGCCCAAACNONE 
J090027J21AAGGCCCAAACNONE 
J100024I09AAGGCCCAAACNONE 
J100032D15AAGGCCCAAACNONE 
J100071I02AAGGCCCAAACNONE 
J100080E01AAGGCCCAAACNONE 
J100086A08AAGGCCCAAACNONE 
Os01g0295900J065076G19TCAGCCCAAACNONE 
Os01g0331900013-026-D04GTTTGGGCCAANONE 
AK064784GTTTGGGCCAANONE 
AK121761GTTTGGGCCAAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTTTGGGCCAANONE 
J033090D07GTTTGGGCCAANONE 
J090006L21GTTTGGGCCAANONE 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0527700006-102-G07GTTTGGGCTGGNONE 
012-094-B11GTTTGGGCTGGNONE 
015-096-C04GTTTGGGCTGGNONE 
AK061861GTTTGGGCTGGProtoheme IX farnesyltransferase family protein. 
AK099005GTTTGGGCTGGNONE 
J013109B04GTTTGGGCTGGNONE 
J033057L14GTTTGGGCTGGNONE 
J090072H04GTTTGGGCTGGNONE 
J100030A14GTTTGGGCTGGNONE 
Os01g0530400016-019-E07GCCCAAACNONE 
AK103724GCCCAAACNONE 
AK106476GCCCAAACGlutaredoxin-related protein family protein. 
J023108F14GCCCAAACNONE 
J033138C10GCCCAAACNONE 
Os01g0533900AK101194GAGGCCCAAACSimilar to Multidrug resistance protein 1 homolog. 
Os01g0574400AK072509AGCCCAAACSimilar to Cell division protein ftsH (EC 3.4.24.-). 
Os01g0626300016-070-G04CCAGCCCAAACNONE 
AK122071CCAGCCCAAACSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04CCAGCCCAAACNONE 
J033117J08CCAGCCCAAACNONE 
J065007O12CCAGCCCAAACNONE 
J065020K12CCAGCCCAAACNONE 
J065142D24CCAGCCCAAACNONE 
J065157K19CCAGCCCAAACNONE 
J080307H19CCAGCCCAAACNONE 
J080311D16CCAGCCCAAACNONE 
J080316C12CCAGCCCAAACNONE 
J080316E03CCAGCCCAAACNONE 
J100033K16CCAGCCCAAACNONE 
J100042J21CCAGCCCAAACNONE 
J100051E06CCAGCCCAAACNONE 
J100071E22CCAGCCCAAACNONE 
Os01g0633000006-075-A01TCAGCCCAAACNONE 
009-064-A11TCAGCCCAAACNONE 
009-153-F07TCAGCCCAAACNONE 
AK062051TCAGCCCAAACSimilar to 50S ribosomal protein L31. 
J013073B08TCAGCCCAAACNONE 
J065006K19TCAGCCCAAACNONE 
J065053P08TCAGCCCAAACNONE 
J065057D08TCAGCCCAAACNONE 
J065086P07TCAGCCCAAACNONE 
J065095C14TCAGCCCAAACNONE 
J065116B05TCAGCCCAAACNONE 
J065164L20TCAGCCCAAACNONE 
J065185K19TCAGCCCAAACNONE 
J065191E21TCAGCCCAAACNONE 
J065199P21TCAGCCCAAACNONE 
J065216M12TCAGCCCAAACNONE 
J075002M09TCAGCCCAAACNONE 
J075016N10TCAGCCCAAACNONE 
J075041K05TCAGCCCAAACNONE 
J075094E04TCAGCCCAAACNONE 
J075154O04TCAGCCCAAACNONE 
J075176D22TCAGCCCAAACNONE 
J075186M09TCAGCCCAAACNONE 
J075191H20TCAGCCCAAACNONE 
Os01g0639600005-018-A02GAAGCCCAAACNONE 
AK067056GAAGCCCAAACProtein of unknown function DUF1645 family protein. 
J013066M03GAAGCCCAAACNONE 
J013066O05GAAGCCCAAACNONE 
J013088M21GAAGCCCAAACNONE 
J065045F04GAAGCCCAAACNONE 
J080018F22GAAGCCCAAACNONE 
J080037B10GAAGCCCAAACNONE 
J080042G23GAAGCCCAAACNONE 
J080052B21GAAGCCCAAACNONE 
J080060H13GAAGCCCAAACNONE 
J100024A05GAAGCCCAAACNONE 
J100071A09GAAGCCCAAACNONE 
J100080K14GAAGCCCAAACNONE 
Os01g0661400AK073113AGCCCAGCCCAAACNucleic acid-binding, OB-fold domain containing protein. 
J023014C20AGCCCAGCCCAAACNONE 
J033022G03AGCCCAGCCCAAACNONE 
J065050H15AGCCCAGCCCAAACNONE 
J065059J19AGCCCAGCCCAAACNONE 
J065085I24AGCCCAGCCCAAACNONE 
J065166G12AGCCCAGCCCAAACNONE 
J065182C18AGCCCAGCCCAAACNONE 
Os01g0678500AB071014GCCCAAACNONE 
AB100696GCCCAAACSimilar to Two-pore calcium channel. 
AK067839GCCCAAACNONE 
AK100998GCCCAAACNONE 
J013089O09GCCCAAACNONE 
J013126J24GCCCAAACNONE 
J013146L16GCCCAAACNONE 
J013160D06GCCCAAACNONE 
J090067N19GCCCAAACNONE 
J090070E11GCCCAAACNONE 
Os01g0736900AK062151GTTTGGGCTNONE 
AK065226GTTTGGGCTNONE 
AK121245GTTTGGGCTReticulon family protein. 
J013070F01GTTTGGGCTNONE 
J013156J22GTTTGGGCTNONE 
J023067B03GTTTGGGCTNONE 
J023082O14GTTTGGGCTNONE 
J023087F01GTTTGGGCTNONE 
J023099G09GTTTGGGCTNONE 
J023147M08GTTTGGGCTNONE 
J033028C13GTTTGGGCTNONE 
J033060K07GTTTGGGCTNONE 
J033140C08GTTTGGGCTNONE 
J033142C08GTTTGGGCTNONE 
J043005M06GTTTGGGCTNONE 
J043010C19GTTTGGGCTNONE 
J043030H20GTTTGGGCTNONE 
J065006K03GTTTGGGCTNONE 
J065056E13GTTTGGGCTNONE 
J065067O06GTTTGGGCTNONE 
J065117P05GTTTGGGCTNONE 
J065169I07GTTTGGGCTNONE 
J080304L01GTTTGGGCTNONE 
J080319G10GTTTGGGCTNONE 
J090002N09GTTTGGGCTNONE 
J090008E16GTTTGGGCTNONE 
J090010L14GTTTGGGCTNONE 
J090033C23GTTTGGGCTNONE 
J090038D19GTTTGGGCTNONE 
J090051E24GTTTGGGCTNONE 
J090051H09GTTTGGGCTNONE 
J090058A20GTTTGGGCTNONE 
J090058B16GTTTGGGCTNONE 
J090081I15GTTTGGGCTNONE 
J090083P18GTTTGGGCTNONE 
J090089J07GTTTGGGCTNONE 
J090096D13GTTTGGGCTNONE 
J100036N19GTTTGGGCTNONE 
J100043M11GTTTGGGCTNONE 
J100046C12GTTTGGGCTNONE 
J100072C01GTTTGGGCTNONE 
J100088P11GTTTGGGCTNONE 
Os01g0738600AK073479GAGGCCCAAACENTH/VHS domain containing protein. 
AK120616GAGGCCCAAACNONE 
J013046M12GAGGCCCAAACNONE 
J013152B11GAGGCCCAAACNONE 
J023007A09GAGGCCCAAACNONE 
J023007N03GAGGCCCAAACNONE 
J023042A01GAGGCCCAAACNONE 
J023059P06GAGGCCCAAACNONE 
J023113A05GAGGCCCAAACNONE 
J033044K11GAGGCCCAAACNONE 
J033082E04GAGGCCCAAACNONE 
J090033B13GAGGCCCAAACNONE 
J090062H08GAGGCCCAAACNONE 
J100086G23GAGGCCCAAACNONE 
Os01g0762000AK120818GCCCAAACPatatin family protein. 
Os01g0764600AK060621GTTTGGGCCGAGAFosfomycin resistance kinase FomA family protein. 
J013111L18GTTTGGGCCGAGANONE 
J013134N08GTTTGGGCCGAGANONE 
Os01g0788900AK073287GCGGCCCAAACNONE 
Os01g0810000AK102143AGGGCCCAAACNONE 
AK102143GTTTGGGCTGGGCTGCNONE 
AK120752AGGGCCCAAACUtp11 family protein. 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09AGGGCCCAAACNONE 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13AGGGCCCAAACNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07AGGGCCCAAACNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16AGGGCCCAAACNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01AGGGCCCAAACNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18AGGGCCCAAACNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12AGGGCCCAAACNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0836400AK068741TTGTGGGCCCAAACNONE 
AK073540TTGTGGGCCCAAACSAC3/GANP family protein. 
J023019D11TTGTGGGCCCAAACNONE 
J023139O22TTGTGGGCCCAAACNONE 
J033042J20TTGTGGGCCCAAACNONE 
J033046M18TTGTGGGCCCAAACNONE 
J033124J09TTGTGGGCCCAAACNONE 
J090015E05TTGTGGGCCCAAACNONE 
J090076J09TTGTGGGCCCAAACNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0867900AK061366CCAGCCCAAACProtein of unknown function DUF502 family protein. 
Os01g0869000AK067351CGGGTGGGGCCCACCGCCCACGCCCAAACNONE 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0878000006-045-H09GCCCAAACNONE 
006-078-F07GCCCAAACNONE 
016-050-A09GCCCAAACNONE 
AK060162GCCCAAACConserved hypothetical protein. 
AK061119GCCCAAACNONE 
AK104289GCCCAAACNONE 
Os01g0881100AK109822GCGGCCCAAACGGCCEpsin, N-terminal domain containing protein. 
Os01g0894700009-177-F04GCGGCCCAAACNONE 
AK067623GCGGCCCAAACConserved hypothetical protein. 
AK104876GCGGCCCAAACNONE 
J013095G01GCGGCCCAAACNONE 
J013108L20GCGGCCCAAACNONE 
J013120P13GCGGCCCAAACNONE 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0917400AK111958GTTTGGGCCTANONE 
Os01g0939100AK070064GTTTGGGCCGTASimilar to Calmodulin-stimulated calcium-ATPase. 
Os01g0971600AK070366GTTTGGGCCGAGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
AK070366GTTTGGGCCTTGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os02g0102700006-096-A07GTTTGGGCCTTNONE 
AK061193GTTTGGGCCTTSimilar to AGL157Cp. 
AK061558GTTTGGGCCTTNONE 
AK103689GTTTGGGCCTTNONE 
J023128B06GTTTGGGCCTTNONE 
J033136G21GTTTGGGCCTTNONE 
J053084F10GTTTGGGCCTTNONE 
J053089D12GTTTGGGCCTTNONE 
J075149B12GTTTGGGCCTTNONE 
J075165L17GTTTGGGCCTTNONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0136800011-089-E11AGCCCAAACNONE 
AK070727AGCCCAAACNONE 
AK103485AGCCCAAACProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10AGCCCAAACNONE 
J033140H14AGCCCAAACNONE 
J033142H14AGCCCAAACNONE 
J065151O09AGCCCAAACNONE 
J090076K09AGCCCAAACNONE 
J090085K04AGCCCAAACNONE 
Os02g0184000AK072584GCCCAAACZinc finger, DHHC-type domain containing protein. 
J090079L17GCCCAAACNONE 
Os02g0196100AK108729GCCCAAACSimilar to T6J4.5 protein (WIP6 protein). 
Os02g0219200016-016-C03GTTTGGGCCGANONE 
AK059059GTTTGGGCCGASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0503900AK100163GCCCAAACCytochrome P450 family protein. 
Os02g0509600AK111075GTTTGGGCConserved hypothetical protein. 
J065033B09GTTTGGGCNONE 
J065069L04GTTTGGGCNONE 
J065089H14GTTTGGGCNONE 
J065119J16GTTTGGGCNONE 
J065142J22GTTTGGGCNONE 
J065168B14GTTTGGGCNONE 
J065203L03GTTTGGGCNONE 
J075044C18GTTTGGGCNONE 
J075068D13GTTTGGGCNONE 
J075152O09GTTTGGGCNONE 
Os02g0510100AK058487GTTTGGGCNONE 
AK122107GTTTGGGCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06GTTTGGGCNONE 
J053077L04GTTTGGGCNONE 
J065010C11GTTTGGGCNONE 
J075104O14GTTTGGGCNONE 
J080003G03GTTTGGGCNONE 
J080014K05GTTTGGGCNONE 
J080026F03GTTTGGGCNONE 
J080027O05GTTTGGGCNONE 
J080037K15GTTTGGGCNONE 
J080039D24GTTTGGGCNONE 
J080043G19GTTTGGGCNONE 
J080047P05GTTTGGGCNONE 
J080048D22GTTTGGGCNONE 
J080049F23GTTTGGGCNONE 
J080062A21GTTTGGGCNONE 
J080063H20GTTTGGGCNONE 
J080067P15GTTTGGGCNONE 
J080068P19GTTTGGGCNONE 
J080079J15GTTTGGGCNONE 
J080092K19GTTTGGGCNONE 
J080096M04GTTTGGGCNONE 
Os02g0525400011-008-B01TAGGCCCACAGCCCAAACNONE 
AK065368TAGGCCCACAGCCCAAACSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13TAGGCCCACAGCCCAAACNONE 
J033046H10TAGGCCCACAGCCCAAACNONE 
Os02g0533800009-149-F12GAGGCCCAAACNONE 
013-058-H02GAGGCCCAAACNONE 
014-017-G07GAGGCCCAAACNONE 
014-028-F04GAGGCCCAAACNONE 
014-050-G04GAGGCCCAAACNONE 
014-095-F04GAGGCCCAAACNONE 
014-099-C08GAGGCCCAAACNONE 
016-046-F05GAGGCCCAAACNONE 
AK121139GAGGCCCAAACConserved hypothetical protein. 
J013104A14GAGGCCCAAACNONE 
J023077F13GAGGCCCAAACNONE 
J023145I11GAGGCCCAAACNONE 
J065033D14GAGGCCCAAACNONE 
J065079I15GAGGCCCAAACNONE 
J065104E21GAGGCCCAAACNONE 
J065128E06GAGGCCCAAACNONE 
J065174F07GAGGCCCAAACNONE 
J065195B12GAGGCCCAAACNONE 
J065207B12GAGGCCCAAACNONE 
J080304M24GAGGCCCAAACNONE 
J090040A13GAGGCCCAAACNONE 
J090054B18GAGGCCCAAACNONE 
J100037A06GAGGCCCAAACNONE 
J100042F24GAGGCCCAAACNONE 
J100043N23GAGGCCCAAACNONE 
J100044H14GAGGCCCAAACNONE 
J100056K24GAGGCCCAAACNONE 
J100063O22GAGGCCCAAACNONE 
J100071G05GAGGCCCAAACNONE 
J100078G15GAGGCCCAAACNONE 
Os02g0533900AB062681GTTTGGGCCTCNONE 
AK061722GTTTGGGCCTCNONE 
AK106147GTTTGGGCCTCNONE 
AK121892GTTTGGGCCTCSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0543000009-061-H02GAGGCCCAAACNONE 
009-123-H02GAGGCCCAAACNONE 
009-192-D09GAGGCCCAAACNONE 
009-197-F06GAGGCCCAAACNONE 
AK060261GAGGCCCAAACNONE 
AK062319GAGGCCCAAACABA/WDS induced protein family protein. 
AK062880GAGGCCCAAACNONE 
AK063217GAGGCCCAAACNONE 
AK066415GAGGCCCAAACNONE 
J065084L15GAGGCCCAAACNONE 
J065207N17GAGGCCCAAACNONE 
J075088J03GAGGCCCAAACNONE 
J100024G08GAGGCCCAAACNONE 
J100027P19GAGGCCCAAACNONE 
J100052E02GAGGCCCAAACNONE 
J100055B02GAGGCCCAAACNONE 
Os02g0595700006-057-E01TCTGGCCCAAACNONE 
006-082-F10TCTGGCCCAAACNONE 
006-087-C10TCTGGCCCAAACNONE 
006-091-H03TCTGGCCCAAACNONE 
006-094-A11TCTGGCCCAAACNONE 
AF145053TCTGGCCCAAACNONE 
AK064937TCTGGCCCAAACNONE 
AK066858TCTGGCCCAAACNONE 
AK104785TCTGGCCCAAACNONE 
AK119587TCTGGCCCAAACChloroplast translational elongation factor Tu. 
J013000P03TCTGGCCCAAACNONE 
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE 
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein. 
AK100281TAAGCCCACGTAGGCCCAAACNONE 
J023074H03TAAGCCCACGTAGGCCCAAACNONE 
J065002J16TAAGCCCACGTAGGCCCAAACNONE 
J065032I20TAAGCCCACGTAGGCCCAAACNONE 
J065076A07TAAGCCCACGTAGGCCCAAACNONE 
J065142O21TAAGCCCACGTAGGCCCAAACNONE 
J065203A03TAAGCCCACGTAGGCCCAAACNONE 
J075017F24TAAGCCCACGTAGGCCCAAACNONE 
J075017G24TAAGCCCACGTAGGCCCAAACNONE 
Os02g0622400005-010-C04GTTTGGGCCCTNONE 
AK061679GTTTGGGCCCTConserved hypothetical protein. 
J013058H01GTTTGGGCCCTNONE 
J013095D07GTTTGGGCCCTNONE 
J023054G05GTTTGGGCCCTNONE 
J023093A17GTTTGGGCCCTNONE 
J023146P16GTTTGGGCCCTNONE 
J033089D16GTTTGGGCCCTNONE 
J033099G12GTTTGGGCCCTNONE 
J033131N10GTTTGGGCCCTNONE 
J053073J04GTTTGGGCCCTNONE 
J053074P03GTTTGGGCCCTNONE 
J053075M06GTTTGGGCCCTNONE 
J053088K13GTTTGGGCCCTNONE 
J090039F18GTTTGGGCCCTNONE 
J090045M03GTTTGGGCCCTNONE 
Os02g0625500AK059188GTTTGGGCNONE 
Os02g0658033J090015D03GCCCAAACPleckstrin-like domain containing protein. 
Os02g0681100AK100584GTTTGGGCCATProtein of unknown function DUF604 family protein. 
J023106A15GTTTGGGCCATNONE 
Os02g0702800AK071767GCCCAAACSimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
Os02g0736500AK065166GTTTGGGCCGGGCNicastrin family protein. 
J013099D16GTTTGGGCCGGGCNONE 
Os02g0741500AK068867TCCGGCCCAAACRibbon-helix-helix domain containing protein. 
Os02g0744000AK064898TCCGGCCCAAACConserved hypothetical protein. 
AK104827TCCGGCCCAAACNONE 
J013000L12TCCGGCCCAAACNONE 
J013156N02TCCGGCCCAAACNONE 
J065001H14TCCGGCCCAAACNONE 
J065038D18TCCGGCCCAAACNONE 
J065039I18TCCGGCCCAAACNONE 
J065047C13TCCGGCCCAAACNONE 
J065053J09TCCGGCCCAAACNONE 
J065064G03TCCGGCCCAAACNONE 
J065066M05TCCGGCCCAAACNONE 
J065068O10TCCGGCCCAAACNONE 
J065090H22TCCGGCCCAAACNONE 
J065113L19TCCGGCCCAAACNONE 
J065121M02TCCGGCCCAAACNONE 
J065122K23TCCGGCCCAAACNONE 
J065138C12TCCGGCCCAAACNONE 
J065153E14TCCGGCCCAAACNONE 
J065156N12TCCGGCCCAAACNONE 
J065158L20TCCGGCCCAAACNONE 
J065166I06TCCGGCCCAAACNONE 
J065174L15TCCGGCCCAAACNONE 
J065175N03TCCGGCCCAAACNONE 
J090092C23TCCGGCCCAAACNONE 
Os02g0753200AK067176GTTTGGGCCCAAATConserved hypothetical protein. 
J013097D23GTTTGGGCCCAAATNONE 
J065085J01GTTTGGGCCCAAATNONE 
J065152L23GTTTGGGCCCAAATNONE 
J065162F18GTTTGGGCCCAAATNONE 
J075002K17GTTTGGGCCCAAATNONE 
J075047D24GTTTGGGCCCAAATNONE 
J075064A01GTTTGGGCCCAAATNONE 
J075075C09GTTTGGGCCCAAATNONE 
J075088M01GTTTGGGCCCAAATNONE 
J075130K03GTTTGGGCCCAAATNONE 
J075146K03GTTTGGGCCCAAATNONE 
J090049F07GTTTGGGCCCAAATNONE 
Os02g0768600006-034-F01TCTGGCCCGGCCCAAACNONE 
006-046-G07TCTGGCCCGGCCCAAACNONE 
006-054-C07TCTGGCCCGGCCCAAACNONE 
006-056-F07TCTGGCCCGGCCCAAACNONE 
006-100-C02TCTGGCCCGGCCCAAACNONE 
AK059725TCTGGCCCGGCCCAAACNONE 
AK098996TCTGGCCCGGCCCAAACNONE 
AK099120TCTGGCCCGGCCCAAACNONE 
AK104659TCTGGCCCGGCCCAAACNONE 
J065043H04TCTGGCCCGGCCCAAACNONE 
J075034N21TCTGGCCCGGCCCAAACNONE 
J075145C18TCTGGCCCGGCCCAAACNONE 
J080016H01TCTGGCCCGGCCCAAACNONE 
J080040F01TCTGGCCCGGCCCAAACNONE 
J080047L23TCTGGCCCGGCCCAAACNONE 
J080049B22TCTGGCCCGGCCCAAACNONE 
J080062J16TCTGGCCCGGCCCAAACNONE 
J080064C23TCTGGCCCGGCCCAAACNONE 
J080064L22TCTGGCCCGGCCCAAACNONE 
J080077N01TCTGGCCCGGCCCAAACNONE 
J080097G17TCTGGCCCGGCCCAAACNONE 
J100065L15TCTGGCCCGGCCCAAACNONE 
J100066K23TCTGGCCCGGCCCAAACNONE 
J100088C07TCTGGCCCGGCCCAAACNONE 
J100090H09TCTGGCCCGGCCCAAACNONE 
Os02g0777950J090078H24GTTTGGGCCCAAATConserved hypothetical protein. 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0819700AK067374GTTTGGGCCGAAZinc finger, Zim17-type family protein. 
AK099160GTTTGGGCCGAANONE 
J100086K17GTTTGGGCCGAANONE 
Os02g0824400AK121390GTTTGGGCCTTGConserved hypothetical protein. 
J023128P21GTTTGGGCCTTGNONE 
J053097O16GTTTGGGCCTTGNONE 
J065012I02GTTTGGGCCTTGNONE 
J065049C06GTTTGGGCCTTGNONE 
J065051H02GTTTGGGCCTTGNONE 
J065069A13GTTTGGGCCTTGNONE 
J065082E04GTTTGGGCCTTGNONE 
J065102N09GTTTGGGCCTTGNONE 
J065157O10GTTTGGGCCTTGNONE 
J065188N23GTTTGGGCCTTGNONE 
J065190J11GTTTGGGCCTTGNONE 
J065202M09GTTTGGGCCTTGNONE 
Os02g0829100AB037145GTTTGGGCNONE 
AJ278822GTTTGGGCReplication protein A 30kDa. 
AK103235GTTTGGGCNONE 
Os03g0108600AK065776CAAGCCCAAACDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013038N14CAAGCCCAAACNONE 
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
J023055L16TAGGCCCATGAAAGCCCAAACNONE 
J023088I16TAGGCCCATGAAAGCCCAAACNONE 
J033070E21TAGGCCCATGAAAGCCCAAACNONE 
J065124N22TAGGCCCATGAAAGCCCAAACNONE 
J075152A19TAGGCCCATGAAAGCCCAAACNONE 
J075181J21TAGGCCCATGAAAGCCCAAACNONE 
J090011F23TAGGCCCATGAAAGCCCAAACNONE 
Os03g0119700011-050-F05GTTTGGGCNONE 
AK105249GTTTGGGCNONE 
AK119410GTTTGGGCTetratricopeptide-like helical domain containing protein. 
Os03g0119900AK058741GCCCAAAChistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07GCCCAAACNONE 
J065165C24GCCCAAACNONE 
J075039M05GCCCAAACNONE 
Os03g0123300003-131-G09ATGGCCCAAACNONE 
AK058595ATGGCCCAAACNONE 
AK070642ATGGCCCAAACSimilar to Cell cycle switch protein. 
J075056B01ATGGCCCAAACNONE 
Os03g0124300AK069148ACAGCCCAAACConserved hypothetical protein. 
AK069148CCACGGCCCAAACConserved hypothetical protein. 
AK106076ACAGCCCAAACNONE 
AK106076CCACGGCCCAAACNONE 
J023003G19ACAGCCCAAACNONE 
J023003G19CCACGGCCCAAACNONE 
Os03g0135700AK060029GTTTGGGCNONE 
AK103779GTTTGGGCSimilar to Transcriptional activator Rb homolog (Fragment). 
J033145C17GTTTGGGCNONE 
J043021B17GTTTGGGCNONE 
Os03g0142800015-062-B07CTGGCCCAAACNONE 
AK064325CTGGCCCAAACNONE 
Os03g0153900015-084-H06GTTTGGGCCGTANONE 
AK106420GTTTGGGCCGTAAromatic-ring hydroxylase family protein. 
Os03g0162200009-031-E05GTTTGGGCCGAGNONE 
013-049-D04GTTTGGGCCGAGNONE 
013-082-E03GTTTGGGCCGAGNONE 
014-039-G04GTTTGGGCCGAGNONE 
014-098-G11GTTTGGGCCGAGNONE 
AK061605GTTTGGGCCGAGNONE 
AK121533GTTTGGGCCGAGSimilar to Histone H2A. 
J033024D06GTTTGGGCCGAGNONE 
J033030P21GTTTGGGCCGAGNONE 
J065063C20GTTTGGGCCGAGNONE 
J065064A18GTTTGGGCCGAGNONE 
J065147G02GTTTGGGCCGAGNONE 
J065204K06GTTTGGGCCGAGNONE 
J090004C22GTTTGGGCCGAGNONE 
J090014K02GTTTGGGCCGAGNONE 
J090074E10GTTTGGGCCGAGNONE 
J090086L09GTTTGGGCCGAGNONE 
Os03g0175800006-112-F12GCCCAAACNONE 
AK109502GCCCAAACConserved hypothetical protein. 
J065019F17GCCCAAACNONE 
J065138H07GCCCAAACNONE 
Os03g0181400012-051-B05AGCCCAAACNONE 
015-065-E09AGCCCAAACNONE 
AK064006AGCCCAAACProtein of unknown function DUF860, plant family protein. 
Os03g0227000AK068454GTTTGGGCCAASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0240700009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0263500006-112-E09GTTTGGGCTGANONE 
009-122-C01GTTTGGGCTGANONE 
AK106060GTTTGGGCTGASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0288400Os03g0288400GAAGCCCAAACConserved hypothetical protein. 
Os03g0300300AK099693GTTTGGGCWD40-like domain containing protein. 
Os03g0324800AK059868AATGGGCCCAAACNONE 
AK071431AATGGGCCCAAACHypothetical protein. 
Os03g0341100009-012-D06GCCCAAACNONE 
AK121580GCCCAAACSimilar to 60S ribosomal protein L18. 
J033037B18GCCCAAACNONE 
J053090K21GCCCAAACNONE 
J065040D12GCCCAAACNONE 
J075106P15GCCCAAACNONE 
J075117P13GCCCAAACNONE 
J075128N02GCCCAAACNONE 
J090031L12GCCCAAACNONE 
J100023E19GCCCAAACNONE 
J100033O21GCCCAAACNONE 
J100070A12GCCCAAACNONE 
J100087M20GCCCAAACNONE 
Os03g0347800AK073756TCGGCCCAAACPeptidyl-tRNA hydrolase family protein. 
Os03g0389900AK062245GTTTGGGCNONE 
Os03g0423300012-006-G05GCCCAAACNONE 
015-100-F02GCCCAAACNONE 
AK070282GCCCAAACSimilar to Stearoyl-acyl carrier protein desaturse (EC 1.14.99.6) (Fragment). 
J065161D21GCCCAAACNONE 
J065186O20GCCCAAACNONE 
Os03g0569800AK070080GCCCAAACProtein prenyltransferase domain containing protein. 
AK120873GCCCAAACNONE 
Os03g0650700012-086-H01GTTTGGGCNONE 
AK102195GTTTGGGCProtein synthesis factor, GTP-binding domain containing protein. 
J033087C22GTTTGGGCNONE 
J090041M15GTTTGGGCNONE 
Os03g0685000009-031-F08GCGGCCCAAACNONE 
AK059896GCGGCCCAAACSimilar to Ferredoxin. 
AK098989GCGGCCCAAACNONE 
AK099303GCGGCCCAAACNONE 
J065041E14GCGGCCCAAACNONE 
J065085G22GCGGCCCAAACNONE 
Os03g0708600AK069199CAAGCCCAAACDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CAAGCCCAAACNONE 
J023008E04CAAGCCCAAACNONE 
J023030D22CAAGCCCAAACNONE 
J033027E16CAAGCCCAAACNONE 
J033046D09CAAGCCCAAACNONE 
J033068I10CAAGCCCAAACNONE 
J033135A12CAAGCCCAAACNONE 
J065027E22CAAGCCCAAACNONE 
J065191K23CAAGCCCAAACNONE 
J090054D15CAAGCCCAAACNONE 
J090058J15CAAGCCCAAACNONE 
Os03g0712200AK073205TCGGCCCAAACZinc finger, RanBP2-type domain containing protein. 
AK098968TCGGCCCAAACNONE 
Os03g0719500AK106321AGCCCAAACNONE 
Os03g0726900AK072553GGCCCGTTTGGGCCACConserved hypothetical protein. 
AK100280GGCCCGTTTGGGCCACNONE 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0732100Os03g0732100GTTTGGGCTSimilar to Homeodomain protein JUBEL1. 
Os03g0744700AK071178GAAGCCCAAACConserved hypothetical protein. 
J075006D24GAAGCCCAAACNONE 
J075165F21GAAGCCCAAACNONE 
Os03g0758700AK106620AGCCCAAACWD40-like domain containing protein. 
Os03g0785500AK067718ACATGGGCCCAAACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0793100AK067897GTTTGGGCCACGlycosyl transferase, family 43 protein. 
J033125G24GTTTGGGCCACNONE 
J065132N21GTTTGGGCCACNONE 
Os03g0801800AK067130CAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J090079D17CAGGCCCAAACNONE 
J090087F23CAGGCCCAAACNONE 
Os03g0803800012-043-D10AGCCCAAACNONE 
AK063484AGCCCAAACConserved hypothetical protein. 
Os03g0807200011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0828100009-088-D04GTTTGGGCNONE 
009-125-F01GTTTGGGCNONE 
009-169-C06GTTTGGGCNONE 
AK059132GTTTGGGCNONE 
AK062799GTTTGGGCNONE 
AK099043GTTTGGGCSimilar to 50S ribosomal protein L18. 
J013146D01GTTTGGGCNONE 
J065057J16GTTTGGGCNONE 
Os03g0847600AK066947GTTTGGGCSimilar to GAMYB-binding protein. 
AK098991GTTTGGGCNONE 
AK104847GTTTGGGCNONE 
Os03g0848100J013028M09GAGGCCCAAACNONE 
J065080L17GAGGCCCAAACNONE 
J065083C11GAGGCCCAAACNONE 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os04g0208500015-079-C10GTTTGGGCCATNONE 
AK106410GTTTGGGCCATCyclin-like F-box domain containing protein. 
Os04g0378200AK103076ACCGGCCCAAACSterile alpha motif SAM domain containing protein. 
J033118E02ACCGGCCCAAACNONE 
J065065F15ACCGGCCCAAACNONE 
J090080I24ACCGGCCCAAACNONE 
Os04g0412700AK108347GTTTGGGCCarbonic anhydrase, eukaryotic family protein. 
J090084I06GTTTGGGCNONE 
Os04g0482300015-088-C07GGTGGGCCCAAACNONE 
AK064143GGTGGGCCCAAACBTB domain containing protein. 
J065053L16GGTGGGCCCAAACNONE 
J065053N15GGTGGGCCCAAACNONE 
Os04g0509500AK107601TTGGCCCAAACSimilar to Ammonium transporter Amt1;1 (Fragment). 
Os04g0542900AK068610AAGGCCCAAACConserved hypothetical protein. 
Os04g0551800016-049-G12GTTTGGGCCGGTNONE 
AK121568GTTTGGGCCGGTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06GTTTGGGCCGGTNONE 
J013111B11GTTTGGGCCGGTNONE 
J013121H23GTTTGGGCCGGTNONE 
J023012A17GTTTGGGCCGGTNONE 
J023092M05GTTTGGGCCGGTNONE 
J033026P14GTTTGGGCCGGTNONE 
J033033C10GTTTGGGCCGGTNONE 
J033033M10GTTTGGGCCGGTNONE 
J033035C24GTTTGGGCCGGTNONE 
J033052E19GTTTGGGCCGGTNONE 
J033140K19GTTTGGGCCGGTNONE 
J065036F18GTTTGGGCCGGTNONE 
J065067L12GTTTGGGCCGGTNONE 
J065095G09GTTTGGGCCGGTNONE 
J065115B08GTTTGGGCCGGTNONE 
J065218E24GTTTGGGCCGGTNONE 
J090002N13GTTTGGGCCGGTNONE 
J090008B12GTTTGGGCCGGTNONE 
J090016F24GTTTGGGCCGGTNONE 
J090019H14GTTTGGGCCGGTNONE 
J090020G20GTTTGGGCCGGTNONE 
J090029L18GTTTGGGCCGGTNONE 
J090057C23GTTTGGGCCGGTNONE 
J090073H23GTTTGGGCCGGTNONE 
J090081C16GTTTGGGCCGGTNONE 
J090081E21GTTTGGGCCGGTNONE 
J090084L14GTTTGGGCCGGTNONE 
J090086M01GTTTGGGCCGGTNONE 
J090089E16GTTTGGGCCGGTNONE 
J100031P12GTTTGGGCCGGTNONE 
J100090N23GTTTGGGCCGGTNONE 
Os04g0555900009-154-G03AGCCCAAACNONE 
AK063168AGCCCAAACPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11AGCCCAAACNONE 
Os04g0566900AK072344AAAGCCCAAACConserved hypothetical protein. 
Os04g0573200AK065277AAGGCCCAAACNONE 
AK120348AAGGCCCAAACHeavy metal transport/detoxification protein domain containing protein. 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
Os04g0638800AK070319GCCCAAACProtein of unknown function DUF617, plant family protein. 
AK071753GCCCAAACNONE 
Os04g0640800AK065522GTTTGGGCCGTCProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0658300AK067399GTTTGGGCTSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0660600009-113-A11TTGTGGGCCCAAACNONE 
AK120899TTGTGGGCCCAAACATPase, V0 complex, subunit H family protein. 
J023030J05TTGTGGGCCCAAACNONE 
J065068M07TTGTGGGCCCAAACNONE 
J065120G22TTGTGGGCCCAAACNONE 
J065168J18TTGTGGGCCCAAACNONE 
J065211M10TTGTGGGCCCAAACNONE 
J075175E21TTGTGGGCCCAAACNONE 
J090021C06TTGTGGGCCCAAACNONE 
J090032P15TTGTGGGCCCAAACNONE 
J090082E05TTGTGGGCCCAAACNONE 
J100090O11TTGTGGGCCCAAACNONE 
Os04g0679600AK109942GTTTGGGCCBS domain containing protein. 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0121000009-181-E02GTTTGGGCCCACTAGGCCCAACCNONE 
AK058867GTTTGGGCCCACTAGGCCCAACCNONE 
AK071341GTTTGGGCCCACTAGGCCCAACCProtein of unknown function DUF1218 family protein. 
J023024H24GTTTGGGCCCACTAGGCCCAACCNONE 
J023090B22GTTTGGGCCCACTAGGCCCAACCNONE 
J023111G15GTTTGGGCCCACTAGGCCCAACCNONE 
J023134K14GTTTGGGCCCACTAGGCCCAACCNONE 
J033057C05GTTTGGGCCCACTAGGCCCAACCNONE 
J033067J15GTTTGGGCCCACTAGGCCCAACCNONE 
J033084L15GTTTGGGCCCACTAGGCCCAACCNONE 
J033088B04GTTTGGGCCCACTAGGCCCAACCNONE 
J043027A08GTTTGGGCCCACTAGGCCCAACCNONE 
J043029L03GTTTGGGCCCACTAGGCCCAACCNONE 
J053031K22GTTTGGGCCCACTAGGCCCAACCNONE 
J053046I01GTTTGGGCCCACTAGGCCCAACCNONE 
J053070B05GTTTGGGCCCACTAGGCCCAACCNONE 
J053072C10GTTTGGGCCCACTAGGCCCAACCNONE 
J065097M22GTTTGGGCCCACTAGGCCCAACCNONE 
J065164I17GTTTGGGCCCACTAGGCCCAACCNONE 
J075058I08GTTTGGGCCCACTAGGCCCAACCNONE 
J075064C09GTTTGGGCCCACTAGGCCCAACCNONE 
J080304C16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304H16GTTTGGGCCCACTAGGCCCAACCNONE 
J080306E17GTTTGGGCCCACTAGGCCCAACCNONE 
J080310L03GTTTGGGCCCACTAGGCCCAACCNONE 
J080316J07GTTTGGGCCCACTAGGCCCAACCNONE 
J080317L23GTTTGGGCCCACTAGGCCCAACCNONE 
J080319A10GTTTGGGCCCACTAGGCCCAACCNONE 
J090060F01GTTTGGGCCCACTAGGCCCAACCNONE 
J100042N16GTTTGGGCCCACTAGGCCCAACCNONE 
J100047F05GTTTGGGCCCACTAGGCCCAACCNONE 
J100075J19GTTTGGGCCCACTAGGCCCAACCNONE 
Os05g0123400AK069521CCAGCCCAAACConserved hypothetical protein. 
J023022O05CCAGCCCAAACNONE 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
J033091I05GTTTGGGCCTAGGCCCACCCGNONE 
Os05g0155100006-075-B02AAGGCCCAAACCAGCCCACAANONE 
AK061929AAGGCCCAAACCAGCCCACAANONE 
AK102810AAGGCCCAAACCAGCCCACAANONE 
AK120877AAGGCCCAAACCAGCCCACAASimilar to 60S ribosomal protein L18. 
J013023E03AAGGCCCAAACCAGCCCACAANONE 
J013038C16AAGGCCCAAACCAGCCCACAANONE 
J013120M14AAGGCCCAAACCAGCCCACAANONE 
J013153B04AAGGCCCAAACCAGCCCACAANONE 
J013159B07AAGGCCCAAACCAGCCCACAANONE 
J023012A02AAGGCCCAAACCAGCCCACAANONE 
J023027F08AAGGCCCAAACCAGCCCACAANONE 
J023027I12AAGGCCCAAACCAGCCCACAANONE 
J023120F05AAGGCCCAAACCAGCCCACAANONE 
J023138O03AAGGCCCAAACCAGCCCACAANONE 
J023142H13AAGGCCCAAACCAGCCCACAANONE 
J023143P06AAGGCCCAAACCAGCCCACAANONE 
J033023P09AAGGCCCAAACCAGCCCACAANONE 
J033035O14AAGGCCCAAACCAGCCCACAANONE 
J033042N19AAGGCCCAAACCAGCCCACAANONE 
J033043B12AAGGCCCAAACCAGCCCACAANONE 
J033065D10AAGGCCCAAACCAGCCCACAANONE 
J033081A12AAGGCCCAAACCAGCCCACAANONE 
J033084N05AAGGCCCAAACCAGCCCACAANONE 
J033085M03AAGGCCCAAACCAGCCCACAANONE 
J033112D15AAGGCCCAAACCAGCCCACAANONE 
J033114O07AAGGCCCAAACCAGCCCACAANONE 
J033119D15AAGGCCCAAACCAGCCCACAANONE 
J033140E06AAGGCCCAAACCAGCCCACAANONE 
J033141K23AAGGCCCAAACCAGCCCACAANONE 
J043040I22AAGGCCCAAACCAGCCCACAANONE 
J053050B21AAGGCCCAAACCAGCCCACAANONE 
J053065I18AAGGCCCAAACCAGCCCACAANONE 
J053074O16AAGGCCCAAACCAGCCCACAANONE 
J065072K13AAGGCCCAAACCAGCCCACAANONE 
J065211I09AAGGCCCAAACCAGCCCACAANONE 
J090004K04AAGGCCCAAACCAGCCCACAANONE 
J090016L06AAGGCCCAAACCAGCCCACAANONE 
J090040F22AAGGCCCAAACCAGCCCACAANONE 
J090063F22AAGGCCCAAACCAGCCCACAANONE 
J090081J09AAGGCCCAAACCAGCCCACAANONE 
J100032A10AAGGCCCAAACCAGCCCACAANONE 
J100037G20AAGGCCCAAACCAGCCCACAANONE 
J100056O10AAGGCCCAAACCAGCCCACAANONE 
J100071D10AAGGCCCAAACCAGCCCACAANONE 
J100075K13AAGGCCCAAACCAGCCCACAANONE 
J100079F16AAGGCCCAAACCAGCCCACAANONE 
J100080O16AAGGCCCAAACCAGCCCACAANONE 
J100086N05AAGGCCCAAACCAGCCCACAANONE 
Os05g0170800AK068085TAAGCCCAAACUvrB/UvrC protein domain containing protein. 
J100063G14TAAGCCCAAACNONE 
Os05g0190300004-005-C08GCCCAAACNONE 
006-025-C01GCCCAAACNONE 
006-027-F06GCCCAAACNONE 
006-028-B04GCCCAAACNONE 
006-035-C02GCCCAAACNONE 
006-036-C11GCCCAAACNONE 
006-041-A01GCCCAAACNONE 
006-045-D03GCCCAAACNONE 
006-054-D06GCCCAAACNONE 
006-059-H03GCCCAAACNONE 
006-064-A07GCCCAAACNONE 
006-064-D09GCCCAAACNONE 
006-066-C11GCCCAAACNONE 
006-074-H09GCCCAAACNONE 
006-079-D01GCCCAAACNONE 
006-084-A12GCCCAAACNONE 
006-089-A10GCCCAAACNONE 
006-090-A09GCCCAAACNONE 
006-096-C06GCCCAAACNONE 
006-102-E03GCCCAAACNONE 
006-109-B09GCCCAAACNONE 
006-115-D12GCCCAAACNONE 
AK061507GCCCAAACNONE 
AK104180GCCCAAACNONE 
AK104252GCCCAAACNONE 
AK104267GCCCAAACNONE 
AK104355GCCCAAACNONE 
AK106112GCCCAAACNONE 
AK119190GCCCAAACAcid phosphatase (Class B) family protein. 
J013088K07GCCCAAACNONE 
J013110D12GCCCAAACNONE 
J013118F19GCCCAAACNONE 
J013124A02GCCCAAACNONE 
J013135I19GCCCAAACNONE 
J023027C12GCCCAAACNONE 
J023063O08GCCCAAACNONE 
J023122E16GCCCAAACNONE 
J023150C11GCCCAAACNONE 
J065035F03GCCCAAACNONE 
J065057B06GCCCAAACNONE 
Os05g0293500AK072592GCCCAAACSimilar to Pectate lyase B (Fragment). 
Os05g0295900AK069962TAGGCCCATTAGCCCAAACConserved hypothetical protein. 
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH. 
Os05g0487600AK100817CAAGGCCCAAACNONE 
AK103104CAAGGCCCAAACNONE 
J043027P10CAAGGCCCAAACNONE 
J065183N17CAAGGCCCAAACNONE 
Os05g0520200006-031-F07AAGGCCCAAACNONE 
AK061451AAGGCCCAAACThioredoxin-related domain containing protein. 
AK099433AAGGCCCAAACNONE 
Os05g0528200009-146-C01GAGGCCCAAACNONE 
AK062985GAGGCCCAAACSimilar to 50S ribosomal protein L20. 
Os05g0555300009-032-C03GTTTGGGCCCTNONE 
009-125-E08GTTTGGGCCCTNONE 
009-149-C12GTTTGGGCCCTNONE 
009-172-C01GTTTGGGCCCTNONE 
AK062890GTTTGGGCCCTFerredoxin domain containing protein. 
AK062997GTTTGGGCCCTNONE 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
J013074C15GAAGCCCAAGGCCCAAACNONE 
J013098O16GAAGCCCAAGGCCCAAACNONE 
J033030M01GAAGCCCAAGGCCCAAACNONE 
J090058H12GAAGCCCAAGGCCCAAACNONE 
J090075M06GAAGCCCAAGGCCCAAACNONE 
Os05g0565000AK102673TCCGGCCCAAACSimilar to 60S ribosomal protein L18a-1. 
J033102C12TCCGGCCCAAACNONE 
J033124C13TCCGGCCCAAACNONE 
J043003L04TCCGGCCCAAACNONE 
J043006N08TCCGGCCCAAACNONE 
Os05g0577700AK107217GCCCAAACSimilar to Protein kinase. 
AY224453GCCCAAACNONE 
Os05g0589000AK061980GACGGCCCAAACGCGGAGAGNONE 
AK099181GACGGCCCAAACGCGGAGAGConserved hypothetical protein. 
Os05g0592400AB037144GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
AK065508GTTTGGGCTGGGCTGGGCTGGGCTGGUV-damaged DNA binding protein. 
J013069J24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013075H15GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013095H04GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013105L19GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013152P13GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J023072O05GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033024J22GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033030D07GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033041D09GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033051M16GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033126M01GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033145H24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
Os05g0592600011-064-D09GTTTGGGCTTTTNONE 
015-032-B11GTTTGGGCTTTTNONE 
AK073484GTTTGGGCTTTTInitiation factor 2 family protein. 
AK099632GTTTGGGCTTTTNONE 
Os06g0116400006-082-G06TAGGCCCAAACNONE 
AK058327TAGGCCCAAACNONE 
AK105979TAGGCCCAAACHigh-affinity nickel-transporter family protein. 
J065083I24TAGGCCCAAACNONE 
J100072O18TAGGCCCAAACNONE 
Os06g0135340J065061D17ACAGCCCAAACNONE 
J065159A10ACAGCCCAAACConserved hypothetical protein. 
Os06g0136700AK065081AGCCCAAACSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08AGCCCAAACNONE 
J013039I03AGCCCAAACNONE 
Os06g0139700006-052-C07AAAGCCCAAACNONE 
009-009-A08AAAGCCCAAACNONE 
015-020-D09AAAGCCCAAACNONE 
015-087-H06AAAGCCCAAACNONE 
016-078-A03AAAGCCCAAACNONE 
AK067884AAAGCCCAAACNONE 
AK103245AAAGCCCAAACConserved hypothetical protein. 
AK106116AAAGCCCAAACNONE 
AK106220AAAGCCCAAACNONE 
Os06g0187900009-171-C09CCAGGCCCAAACNONE 
AK063879CCAGGCCCAAACNONE 
AK071765CCAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CCAGGCCCAAACNONE 
J033098E13CCAGGCCCAAACNONE 
J100036J11CCAGGCCCAAACNONE 
J100047B19CCAGGCCCAAACNONE 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0268700AK120783AAAAGCCCAAACPeptidase A1, pepsin family protein. 
Os06g0324000AK109614TAGGCCCAAACConserved hypothetical protein. 
Os06g0542600J075111K18GTTTGGGCProtein of unknown function DUF295 family protein. 
Os06g0560700011-041-C04GCCCAAACNONE 
AK063332GCCCAAACLipolytic enzyme, G-D-S-L family protein. 
Os06g0603400AK060002GGGGCCCAAACNONE 
AK102325GGGGCCCAAACNONE 
AK106905GGGGCCCAAACSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22GGGGCCCAAACNONE 
J100022N15GGGGCCCAAACNONE 
J100023E09GGGGCCCAAACNONE 
J100052D21GGGGCCCAAACNONE 
Os06g0662550J023042C19GCCCAAACConserved hypothetical protein. 
J033035B05GCCCAAACNONE 
J033094J03GCCCAAACNONE 
J065165I08GCCCAAACNONE 
Os06g0670100AK102577GAAGCCCAAACHypothetical protein. 
AK102577GAGGCCCAAACHypothetical protein. 
Os06g0682800011-092-E01GTTTGGGCTTGNONE 
AK064816GTTTGGGCTTGZinc finger, CCCH-type domain containing protein. 
J013000E13GTTTGGGCTTGNONE 
J013035J22GTTTGGGCTTGNONE 
J013045M06GTTTGGGCTTGNONE 
J013120A07GTTTGGGCTTGNONE 
J033144H15GTTTGGGCTTGNONE 
J033145H15GTTTGGGCTTGNONE 
J033145N16GTTTGGGCTTGNONE 
J090019J02GTTTGGGCTTGNONE 
Os06g0694400AK065599AGCCCAAACNONE 
AK120261AGCCCAAACConserved hypothetical protein. 
J075019F13AGCCCAAACNONE 
J075121H11AGCCCAAACNONE 
J075188O15AGCCCAAACNONE 
J075194O13AGCCCAAACNONE 
J100017M20AGCCCAAACNONE 
J100026G05AGCCCAAACNONE 
J100032G09AGCCCAAACNONE 
J100044M02AGCCCAAACNONE 
J100064A07AGCCCAAACNONE 
J100066K20AGCCCAAACNONE 
J100082M20AGCCCAAACNONE 
J100084A14AGCCCAAACNONE 
Os07g0105300AK107419TCGGCCCAAACConserved hypothetical protein. 
AK109521TCGGCCCAAACNONE 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0205000009-018-A12GTGGCCCAAACNONE 
AK103963GTGGCCCAAACNONE 
AK121368GTGGCCCAAACNONE 
J023001M20GTGGCCCAAACNONE 
J023125I03GTGGCCCAAACNONE 
J053034L22GTGGCCCAAACNONE 
J065078A21GTGGCCCAAACNONE 
J065089G24GTGGCCCAAACNONE 
J065096G23GTGGCCCAAACNONE 
J065103N06GTGGCCCAAACNONE 
J065146J22GTGGCCCAAACNONE 
J065159K18GTGGCCCAAACNONE 
J065204L04GTGGCCCAAACNONE 
J065207N07GTGGCCCAAACNONE 
J065208E24GTGGCCCAAACNONE 
J075057F19GTGGCCCAAACNONE 
J075058K01GTGGCCCAAACNONE 
J075072H13GTGGCCCAAACNONE 
J080003D08GTGGCCCAAACNONE 
J080025F02GTGGCCCAAACNONE 
Os07g0205700AK120553GTTTGGGCCCAAGSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24GTTTGGGCCCAAGNONE 
Os07g0242600AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0245100AK059133GTTTGGGCCTTNONE 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0297400AK059367GCCCAGTTTGGGCNONE 
AK101219GCCCAGTTTGGGCConserved hypothetical protein. 
J033031C14GCCCAGTTTGGGCNONE 
J033133E01GCCCAGTTTGGGCNONE 
J100053J24GCCCAGTTTGGGCNONE 
J100058N23GCCCAGTTTGGGCNONE 
Os07g0410300AK108503GCCCAAACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0492300AK108270GCCCAAACConserved hypothetical protein. 
Os07g0502200006-027-C06CCTCGCCCAAACNONE 
012-007-C05CCTCGCCCAAACNONE 
AK120682CCTCGCCCAAACMulti antimicrobial extrusion protein MatE family protein. 
J053045G13CCTCGCCCAAACNONE 
J053064I18CCTCGCCCAAACNONE 
J053091G24CCTCGCCCAAACNONE 
J065016E10CCTCGCCCAAACNONE 
J065021B18CCTCGCCCAAACNONE 
J065022A17CCTCGCCCAAACNONE 
J065059D18CCTCGCCCAAACNONE 
J065063N19CCTCGCCCAAACNONE 
J065065O10CCTCGCCCAAACNONE 
J065196F12CCTCGCCCAAACNONE 
J065208I01CCTCGCCCAAACNONE 
J065218G15CCTCGCCCAAACNONE 
J100040G01CCTCGCCCAAACNONE 
J100060M03CCTCGCCCAAACNONE 
J100061P09CCTCGCCCAAACNONE 
J100065P05CCTCGCCCAAACNONE 
Os07g0503300003-129-C11GCCCAAACNONE 
006-089-D03GCCCAAACNONE 
012-065-H03GCCCAAACNONE 
012-089-D02GCCCAAACNONE 
AK105785GCCCAAACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK106005GCCCAAACNONE 
J033148M01GCCCAAACNONE 
J090008M07GCCCAAACNONE 
J090014K23GCCCAAACNONE 
J090015J19GCCCAAACNONE 
Os07g0549200006-072-D03AGCCCAAACNONE 
AK073657AGCCCAAACNONE 
AK109365AGCCCAAACProtein prenyltransferase domain containing protein. 
J033051K19AGCCCAAACNONE 
J100084G13AGCCCAAACNONE 
Os07g0564600AK061125GTTTGGGCTNONE 
AK102110GTTTGGGCTSimilar to Secretory carrier membrane protein. 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
J023056G18GTTTGGGCCTTCTTGGGCCGANONE 
J065131K04GTTTGGGCCTTCTTGGGCCGANONE 
J065190L19GTTTGGGCCTTCTTGGGCCGANONE 
J065209B06GTTTGGGCCTTCTTGGGCCGANONE 
J065216P11GTTTGGGCCTTCTTGGGCCGANONE 
J090088F06GTTTGGGCCTTCTTGGGCCGANONE 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0641600AK068478GTTTGGGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073802GTTTGGGCCCAACTNONE 
Os07g0687300AK073043CAAGCCCAAACSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0113800J033069I12TCTCGGCCCAAACNONE 
J053050I07TCTCGGCCCAAACNONE 
J065006J11TCTCGGCCCAAACNONE 
J065013D02TCTCGGCCCAAACNONE 
J065055L24TCTCGGCCCAAACNONE 
J065071I11TCTCGGCCCAAACConserved hypothetical protein. 
J065093G12TCTCGGCCCAAACNONE 
J065101N03TCTCGGCCCAAACNONE 
Os08g0135900AK069187GTTTGGGCTGCNONE 
Os08g0176800AK111670GTTTGGGCTTASimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
J013030D15GTTTGGGCTTANONE 
J013157K01GTTTGGGCTTANONE 
J023108A20GTTTGGGCTTANONE 
J033125F09GTTTGGGCTTANONE 
Os08g0192900AK103422AAAAGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AAAAGCCCAAACNONE 
Os08g0243900011-052-H03GTTTGGGCCGTGNONE 
AK102707GTTTGGGCCGTGNONE 
AK121452GTTTGGGCCGTGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20GTTTGGGCCGTGNONE 
J065168E04GTTTGGGCCGTGNONE 
Os08g0260600AK108529GTTTGGGCTCAGCTCD9/CD37/CD63 antigen family protein. 
Os08g0282000016-023-A09TAGGCCCAAACNONE 
AK101411TAGGCCCAAACCD9/CD37/CD63 antigen family protein. 
J033037J09TAGGCCCAAACNONE 
J090047I07TAGGCCCAAACNONE 
J100021H13TAGGCCCAAACNONE 
Os08g0299000AK061379GCAGCCCAAACNONE 
AK099389GCAGCCCAAACNONE 
AK101640GCAGCCCAAACProtein of unknown function DUF52 domain containing protein. 
J013100G13GCAGCCCAAACNONE 
J013153N09GCAGCCCAAACNONE 
J023097N06GCAGCCCAAACNONE 
J023123C12GCAGCCCAAACNONE 
J033088G14GCAGCCCAAACNONE 
J065033G10GCAGCCCAAACNONE 
J065128B01GCAGCCCAAACNONE 
J100085I01GCAGCCCAAACNONE 
Os08g0375400AK108186GCCCAAACPlant disease resistance response protein family protein. 
Os08g0433200013-023-E07AAGGCCCAAACNONE 
AK099471AAGGCCCAAACConserved hypothetical protein. 
J013024A05AAGGCCCAAACNONE 
J013065N03AAGGCCCAAACNONE 
J023111A21AAGGCCCAAACNONE 
J065035F10AAGGCCCAAACNONE 
J065083H01AAGGCCCAAACNONE 
J065159E03AAGGCCCAAACNONE 
J065186A03AAGGCCCAAACNONE 
J075032B02AAGGCCCAAACNONE 
J075038L14AAGGCCCAAACNONE 
J075047N21AAGGCCCAAACNONE 
J075076H05AAGGCCCAAACNONE 
J075110C08AAGGCCCAAACNONE 
J090096K17AAGGCCCAAACNONE 
Os08g0455800006-050-A09TCTGGCCCAAACNONE 
AK061573TCTGGCCCAAACProtein of unknown function DUF985 family protein. 
AK099156TCTGGCCCAAACNONE 
J023067L05TCTGGCCCAAACNONE 
J065101A05TCTGGCCCAAACNONE 
J065171H09TCTGGCCCAAACNONE 
J100022D08TCTGGCCCAAACNONE 
J100029K04TCTGGCCCAAACNONE 
J100029O10TCTGGCCCAAACNONE 
Os08g0495300Os08g0495300GTTTGGGCCGTAConserved hypothetical protein. 
Os08g0496000011-009-D02AGCCCATTCGGCCCAAACNONE 
AK103187AGCCCATTCGGCCCAAACCytochrome oxidase assembly family protein. 
J033121L24AGCCCATTCGGCCCAAACNONE 
J033149A07AGCCCATTCGGCCCAAACNONE 
J065198L20AGCCCATTCGGCCCAAACNONE 
J090096F24AGCCCATTCGGCCCAAACNONE 
Os08g0517600009-066-H05GCTGGGCCCAAACNONE 
AK073374GCTGGGCCCAAACNONE 
AK105385GCTGGGCCCAAACSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07GCTGGGCCCAAACNONE 
J075004A12GCTGGGCCCAAACNONE 
J075062F16GCTGGGCCCAAACNONE 
J075115K05GCTGGGCCCAAACNONE 
J075116H09GCTGGGCCCAAACNONE 
Os08g0540500AK106511TACGGCCCAAACSAM (and some other nucleotide) binding motif domain containing protein. 
Os09g0106200009-171-D09GTTTGGGCTNONE 
AK070749GTTTGGGCTSimilar to Ps16 protein. 
J023064A16GTTTGGGCTNONE 
J053084M03GTTTGGGCTNONE 
J075114F07GTTTGGGCTNONE 
J075121E01GTTTGGGCTNONE 
J075138L10GTTTGGGCTNONE 
J075138M14GTTTGGGCTNONE 
J075176B08GTTTGGGCTNONE 
Os09g0325300011-005-H08TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
AK068435TCGGCCCAAACTTGGGCCGGCCCGTTConserved hypothetical protein. 
AK073998TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J033071H21TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J065214H05TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
Os09g0343200AK064806GTTTGGGCTTTAnkyrin repeat containing protein. 
AK064994GTTTGGGCTTTNONE 
J013000D17GTTTGGGCTTTNONE 
J013001D17GTTTGGGCTTTNONE 
J013067O17GTTTGGGCTTTNONE 
J013097A16GTTTGGGCTTTNONE 
J013097H22GTTTGGGCTTTNONE 
J090014I04GTTTGGGCTTTNONE 
J090046D15GTTTGGGCTTTNONE 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0450901J065009G09GTTTGGGCCGAANONE 
J065015O13GTTTGGGCCGAANONE 
J065082C06GTTTGGGCCGAAConserved hypothetical protein. 
Os09g0467100012-085-D01TTCGGCCCAAACNONE 
AK063444TTCGGCCCAAACSAICAR synthetase family protein. 
J065083E16TTCGGCCCAAACNONE 
Os09g0485800AK108749GTTTGGGCCGTTTConserved hypothetical protein. 
J065137H03GTTTGGGCCGTTTNONE 
Os09g0501100009-126-C12CCAGCCCAAACNONE 
AK063752CCAGCCCAAACSimilar to 60S ribosomal protein L32A. 
AK099282CCAGCCCAAACNONE 
J023130H04CCAGCCCAAACNONE 
J075013C11CCAGCCCAAACNONE 
J075060E07CCAGCCCAAACNONE 
J075106K07CCAGCCCAAACNONE 
J075124L15CCAGCCCAAACNONE 
J075161D15CCAGCCCAAACNONE 
J080311I18CCAGCCCAAACNONE 
J080315G08CCAGCCCAAACNONE 
J080316F09CCAGCCCAAACNONE 
J080318B05CCAGCCCAAACNONE 
J100052O18CCAGCCCAAACNONE 
J100064D07CCAGCCCAAACNONE 
Os09g0535500AK108282ACAGCCCAAACSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os09g0571400AK103109GCCCAAACCyclophilin 1. 
J023011A12GCCCAAACNONE 
J033119A20GCCCAAACNONE 
J053034N16GCCCAAACNONE 
J053045N23GCCCAAACNONE 
J053052J12GCCCAAACNONE 
J053052K04GCCCAAACNONE 
J053099M15GCCCAAACNONE 
J065071H23GCCCAAACNONE 
J065131B16GCCCAAACNONE 
J075003F19GCCCAAACNONE 
J075116F02GCCCAAACNONE 
J075126G05GCCCAAACNONE 
J075145E09GCCCAAACNONE 
J075149O22GCCCAAACNONE 
J075163A09GCCCAAACNONE 
J075194A09GCCCAAACNONE 
L29471GCCCAAACNONE 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
J075053H03GCCGGCCCAAACGGCCCACGAANONE 
J075062F23GCCGGCCCAAACGGCCCACGAANONE 
J090029D08GCCGGCCCAAACGGCCCACGAANONE 
Os11g0557000009-007-D09GCCCAAACNONE 
AK062316GCCCAAACPhytosulfokine family protein. 
J065072P06GCCCAAACNONE 
J065132A14GCCCAAACNONE 
J065200C24GCCCAAACNONE 
Os11g0657200AK059959GTTTGGGCCTC2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07GAGGCCCAAACNONE 
AK062752GAGGCCCAAACSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0659600AK107017GCCCAAACVirulence factor, pectin lyase fold family protein. 
Os11g0660500009-031-D10AAAAGCCCAAACNONE 
009-100-G09AAAAGCCCAAACNONE 
009-162-G10AAAAGCCCAAACNONE 
009-183-H11AAAAGCCCAAACNONE 
013-010-B11AAAAGCCCAAACNONE 
013-050-A05AAAAGCCCAAACNONE 
013-070-E10AAAAGCCCAAACNONE 
AK105453AAAAGCCCAAACSimilar to Translationally controlled tumor protein (Fragment). 
D12626AAAAGCCCAAACNONE 
J013128M15AAAAGCCCAAACNONE 
J023004I19AAAAGCCCAAACNONE 
J033114F08AAAAGCCCAAACNONE 
J033147I20AAAAGCCCAAACNONE 
J065031M04AAAAGCCCAAACNONE 
J065033J03AAAAGCCCAAACNONE 
J065038E01AAAAGCCCAAACNONE 
J065048O06AAAAGCCCAAACNONE 
J065054E01AAAAGCCCAAACNONE 
J065075N08AAAAGCCCAAACNONE 
J065080C07AAAAGCCCAAACNONE 
J065096A12AAAAGCCCAAACNONE 
J065115P22AAAAGCCCAAACNONE 
J065122I21AAAAGCCCAAACNONE 
J065127A13AAAAGCCCAAACNONE 
J065158B06AAAAGCCCAAACNONE 
J065162E04AAAAGCCCAAACNONE 
J065162E05AAAAGCCCAAACNONE 
J065163L06AAAAGCCCAAACNONE 
J065177B16AAAAGCCCAAACNONE 
J065181M15AAAAGCCCAAACNONE 
J065201G15AAAAGCCCAAACNONE 
J065202J06AAAAGCCCAAACNONE 
J075002B19AAAAGCCCAAACNONE 
J075008G19AAAAGCCCAAACNONE 
J075010P05AAAAGCCCAAACNONE 
J075018H23AAAAGCCCAAACNONE 
J075051E18AAAAGCCCAAACNONE 
J075053C24AAAAGCCCAAACNONE 
J075077B06AAAAGCCCAAACNONE 
J075080B11AAAAGCCCAAACNONE 
J075083M04AAAAGCCCAAACNONE 
J075085H01AAAAGCCCAAACNONE 
J075109E11AAAAGCCCAAACNONE 
J075111O09AAAAGCCCAAACNONE 
J075130D13AAAAGCCCAAACNONE 
J075132H13AAAAGCCCAAACNONE 
J075147H19AAAAGCCCAAACNONE 
J075148J01AAAAGCCCAAACNONE 
J075159A18AAAAGCCCAAACNONE 
J075166F03AAAAGCCCAAACNONE 
J075191F09AAAAGCCCAAACNONE 
J075192K09AAAAGCCCAAACNONE 
J080006P15AAAAGCCCAAACNONE 
J080013J18AAAAGCCCAAACNONE 
J080023O06AAAAGCCCAAACNONE 
J080024I17AAAAGCCCAAACNONE 
J080029P03AAAAGCCCAAACNONE 
J080030C14AAAAGCCCAAACNONE 
J080038K15AAAAGCCCAAACNONE 
J080042I15AAAAGCCCAAACNONE 
J080053L07AAAAGCCCAAACNONE 
J080061H12AAAAGCCCAAACNONE 
J080064H24AAAAGCCCAAACNONE 
J080066J20AAAAGCCCAAACNONE 
J080074N07AAAAGCCCAAACNONE 
J080079F16AAAAGCCCAAACNONE 
J080079O07AAAAGCCCAAACNONE 
J080092E15AAAAGCCCAAACNONE 
J080301F19AAAAGCCCAAACNONE 
J080302O21AAAAGCCCAAACNONE 
J080306L02AAAAGCCCAAACNONE 
J080307F16AAAAGCCCAAACNONE 
J080307G01AAAAGCCCAAACNONE 
J080307K01AAAAGCCCAAACNONE 
J080309O22AAAAGCCCAAACNONE 
J080311E17AAAAGCCCAAACNONE 
J080311N08AAAAGCCCAAACNONE 
J080312O12AAAAGCCCAAACNONE 
J080315C08AAAAGCCCAAACNONE 
J080316D07AAAAGCCCAAACNONE 
J080318C17AAAAGCCCAAACNONE 
J090004B08AAAAGCCCAAACNONE 
J090009K02AAAAGCCCAAACNONE 
J090025O15AAAAGCCCAAACNONE 
J090026L03AAAAGCCCAAACNONE 
J090036P17AAAAGCCCAAACNONE 
J090047A21AAAAGCCCAAACNONE 
J090053O03AAAAGCCCAAACNONE 
J090059C04AAAAGCCCAAACNONE 
J090062O21AAAAGCCCAAACNONE 
J090064M11AAAAGCCCAAACNONE 
J090070C14AAAAGCCCAAACNONE 
J090075I03AAAAGCCCAAACNONE 
J090081G22AAAAGCCCAAACNONE 
J090083E18AAAAGCCCAAACNONE 
J090084A05AAAAGCCCAAACNONE 
J100019L11AAAAGCCCAAACNONE 
J100022D16AAAAGCCCAAACNONE 
J100042F09AAAAGCCCAAACNONE 
J100051J12AAAAGCCCAAACNONE 
J100065G21AAAAGCCCAAACNONE 
J100066D08AAAAGCCCAAACNONE 
J100069H04AAAAGCCCAAACNONE 
J100078I16AAAAGCCCAAACNONE 
J100090D15AAAAGCCCAAACNONE 
Os12g0168700AK065708GTTTGGGCCGAGAMP-dependent synthetase and ligase domain containing protein. 
AK065718GTTTGGGCCGAGNONE 
Os12g0194400Os12g0194400GCCCAAACConserved hypothetical protein. 
Os12g0257000AK064874TTGGCCCAAACSerine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
Os12g0286200AK070088AGCCCAAACConserved hypothetical protein. 
Os12g0541200AK061361GCCCAAACConserved hypothetical protein. 
AK103354GCCCAAACNONE 
J033126J24GCCCAAACNONE 
J090038M20GCCCAAACNONE 
J090052I07GCCCAAACNONE 
J100044F17GCCCAAACNONE 
J100056J23GCCCAAACNONE 
Os12g0557800AK121691TCGGCCCAAACProtein prenyltransferase domain containing protein. 
J013095M03TCGGCCCAAACNONE 
J033071H11TCGGCCCAAACNONE 
J065101B02TCGGCCCAAACNONE 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0572400016-084-F04GCAGCCCAAACATATGGGCCGCANONE 
AK065531GCAGCCCAAACATATGGGCCGCASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03GCAGCCCAAACATATGGGCCGCANONE 
J013034H02GCAGCCCAAACATATGGGCCGCANONE 
J033117N05GCAGCCCAAACATATGGGCCGCANONE 
J065027L09GCAGCCCAAACATATGGGCCGCANONE 
J065037D09GCAGCCCAAACATATGGGCCGCANONE 
J065197I09GCAGCCCAAACATATGGGCCGCANONE 
J090045C01GCAGCCCAAACATATGGGCCGCANONE 
J100031E11GCAGCCCAAACATATGGGCCGCANONE 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0609800AK101303AGCCCAAACCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01AGCCCAAACNONE 
J033033K21AGCCCAAACNONE 
J033082L13AGCCCAAACNONE 
J043034M20AGCCCAAACNONE 
J065137J24AGCCCAAACNONE 
J065141A11AGCCCAAACNONE 
J065217H09AGCCCAAACNONE 
Os12g0611000AK111837ATTGGGCCCAAACSimilar to Zinc-finger protein Lsd1. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.