version

Summary of OsREG594 (All List)

OrganismOryza sativa  
IDOsREG594  
SequenceGCCCAACA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1535  

Entry Sequences (1535 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0101600AK099952TACGGCCCAACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118TACGGCCCAACANONE 
J013123J12TACGGCCCAACANONE 
J033026O19TACGGCCCAACANONE 
J033128C08TACGGCCCAACANONE 
J065116M14TACGGCCCAACANONE 
J090058F15TACGGCCCAACANONE 
J090079F20TACGGCCCAACANONE 
Os01g0104000AK072087TGTTGGGCCGANONE 
AK103808TGTTGGGCCGAC-type lectin domain containing protein. 
Os01g0104100AK072797TCGGCCCAACAZinc finger, RING-type domain containing protein. 
AK104280TCGGCCCAACANONE 
Os01g0132800AK068422CCAGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os01g0134200AK102394TTGGCCCAAGCAAGCCCAACAConserved hypothetical protein. 
Os01g0185300011-055-A05GCCCAACANONE 
015-007-B11GCCCAACANONE 
015-062-F05GCCCAACANONE 
015-078-C11GCCCAACANONE 
016-068-F07GCCCAACANONE 
016-074-F08GCCCAACANONE 
AK065131GCCCAACATransferase family protein. 
AK098922GCCCAACANONE 
J013000G12GCCCAACANONE 
J013001P14GCCCAACANONE 
J013002O23GCCCAACANONE 
J013096L23GCCCAACANONE 
J013097F24GCCCAACANONE 
J013120N24GCCCAACANONE 
J023007C15GCCCAACANONE 
J023119O12GCCCAACANONE 
J033039O11GCCCAACANONE 
J033043L11GCCCAACANONE 
J033061A07GCCCAACANONE 
J033076M13GCCCAACANONE 
J033082B04GCCCAACANONE 
J033143H15GCCCAACANONE 
J043013A02GCCCAACANONE 
J043036N21GCCCAACANONE 
J065013M09GCCCAACANONE 
J065082E22GCCCAACANONE 
J065093G01GCCCAACANONE 
J065120L06GCCCAACANONE 
J065135D03GCCCAACANONE 
J065197C10GCCCAACANONE 
J100024J10GCCCAACANONE 
J100042M22GCCCAACANONE 
J100077E12GCCCAACANONE 
J100084P03GCCCAACANONE 
Os01g0221300011-021-E12TCTCGGCCCAACANONE 
AK073330TCTCGGCCCAACAConserved hypothetical protein. 
J013130J18TCTCGGCCCAACANONE 
J033024A12TCTCGGCCCAACANONE 
J065063H09TCTCGGCCCAACANONE 
J065093G05TCTCGGCCCAACANONE 
J090007K12TCTCGGCCCAACANONE 
Os01g0225400J080301M15TGTTGGGCTKetopantoate hydroxymethyltransferase family protein. 
J080315B20TGTTGGGCTNONE 
Os01g0232700AK069972CAAGGCCCAACASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12CAAGGCCCAACANONE 
J075146A12CAAGGCCCAACANONE 
Os01g0276000009-162-D08AGCCCAAGCCCAACANONE 
009-162-D08GAAGCCCAACANONE 
AK058917AGCCCAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK058917GAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK119715AGCCCAAGCCCAACANONE 
AK119715GAAGCCCAACANONE 
AK122128AGCCCAAGCCCAACANONE 
AK122128GAAGCCCAACANONE 
J033132L17AGCCCAAGCCCAACANONE 
J033132L17GAAGCCCAACANONE 
J065019G15AGCCCAAGCCCAACANONE 
J065019G15GAAGCCCAACANONE 
J065033O12AGCCCAAGCCCAACANONE 
J065033O12GAAGCCCAACANONE 
J065058J19AGCCCAAGCCCAACANONE 
J065058J19GAAGCCCAACANONE 
J065069L03AGCCCAAGCCCAACANONE 
J065069L03GAAGCCCAACANONE 
J065072E03AGCCCAAGCCCAACANONE 
J065072E03GAAGCCCAACANONE 
J065112J06AGCCCAAGCCCAACANONE 
J065112J06GAAGCCCAACANONE 
J065163C18AGCCCAAGCCCAACANONE 
J065163C18GAAGCCCAACANONE 
J065170L20AGCCCAAGCCCAACANONE 
J065170L20GAAGCCCAACANONE 
J065184O11AGCCCAAGCCCAACANONE 
J065184O11GAAGCCCAACANONE 
J065199M19AGCCCAAGCCCAACANONE 
J065199M19GAAGCCCAACANONE 
J065207P22AGCCCAAGCCCAACANONE 
J065207P22GAAGCCCAACANONE 
J065211C12AGCCCAAGCCCAACANONE 
J065211C12GAAGCCCAACANONE 
J075072K20AGCCCAAGCCCAACANONE 
J075072K20GAAGCCCAACANONE 
J075100B16AGCCCAAGCCCAACANONE 
J075100B16GAAGCCCAACANONE 
J075173F02AGCCCAAGCCCAACANONE 
J075173F02GAAGCCCAACANONE 
J090083E15AGCCCAAGCCCAACANONE 
J090083E15GAAGCCCAACANONE 
J100022F06AGCCCAAGCCCAACANONE 
J100022F06GAAGCCCAACANONE 
J100064C04AGCCCAAGCCCAACANONE 
J100064C04GAAGCCCAACANONE 
J100068F11AGCCCAAGCCCAACANONE 
J100068F11GAAGCCCAACANONE 
Os01g0331900013-026-D04TGTTGGGCCAGNONE 
AK064784TGTTGGGCCAGNONE 
AK121761TGTTGGGCCAGProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15TGTTGGGCCAGNONE 
J033090D07TGTTGGGCCAGNONE 
J090006L21TGTTGGGCCAGNONE 
Os01g0367100AK068655TGTTGGGCTNONE 
AK101540TGTTGGGCTNONE 
AK101542TGTTGGGCTNONE 
AK119785TGTTGGGCTConserved hypothetical protein. 
Os01g0371200006-104-H09GCCCAACANONE 
006-104-H09GCCCAACANONE 
AJ002380GCCCAACANONE 
AJ002380GCCCAACANONE 
AK058900GCCCAACASimilar to Glutathione-S-transferase 19E50. 
AK058900GCCCAACASimilar to Glutathione-S-transferase 19E50. 
Os01g0511600012-053-F10AGCCCAACANONE 
AK059042AGCCCAACANONE 
AK072161AGCCCAACAConserved hypothetical protein. 
J013132P06AGCCCAACANONE 
Os01g0590300014-089-E04AGCCCAACANONE 
AK063740AGCCCAACAConserved hypothetical protein. 
Os01g0618200AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0661800AK103579GCCCAACAConserved hypothetical protein. 
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0707300AK059962TAAGCCCAACANONE 
AK059962TGTTGGGCCTTNONE 
AK104463TAAGCCCAACASimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
AK104463TGTTGGGCCTTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0715800011-061-G06TGTTGGGCCTTNONE 
AK063369TGTTGGGCCTTConserved hypothetical protein. 
J065194O22TGTTGGGCCTTNONE 
Os01g0761100AK122112GCGGCCCAACATesmin/TSO1-like, CXC domain containing protein. 
Os01g0765400015-011-F09GCCCAACANONE 
AK106246GCCCAACAProteinase inhibitor I4, serpin family protein. 
J100034N10GCCCAACANONE 
J100054I23GCCCAACANONE 
J100055K02GCCCAACANONE 
J100082D02GCCCAACANONE 
Os01g0767700AK122168TGTTGGGCSimilar to DEIH-box RNA/DNA helicase. 
Os01g0782300AK109175AGCCCACCTGGCCCAACAConserved hypothetical protein. 
Os01g0807000AK109751TGTTGGGCCCGConserved hypothetical protein. 
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0817700006-112-C04TGTTGGGCCTGNONE 
Os01g0829266J065010C18TGTTGGGCCCATTANONE 
J065037A22TGTTGGGCCCATTANONE 
J065044B02TGTTGGGCCCATTAConserved hypothetical protein. 
J065044B10TGTTGGGCCCATTANONE 
J065051A06TGTTGGGCCCATTANONE 
J065073E06TGTTGGGCCCATTANONE 
J065074I11TGTTGGGCCCATTANONE 
J065086D22TGTTGGGCCCATTANONE 
J065104H10TGTTGGGCCCATTANONE 
J065107C05TGTTGGGCCCATTANONE 
J065124H16TGTTGGGCCCATTANONE 
J065165F22TGTTGGGCCCATTANONE 
J065169B11TGTTGGGCCCATTANONE 
J065172G21TGTTGGGCCCATTANONE 
J065191E05TGTTGGGCCCATTANONE 
J065191F18TGTTGGGCCCATTANONE 
Os01g0833000AK067226CCAGCCCAACAProtein prenyltransferase domain containing protein. 
J013098M23CCAGCCCAACANONE 
Os01g0848300AK120668TCAGCCCAACAProtein prenyltransferase domain containing protein. 
Os01g0851000AK065338TGTTGGGCCTAPfkB domain containing protein. 
Os01g0907300015-031-F03TGTTGGGCCTANONE 
AK103626TGTTGGGCCTAConserved hypothetical protein. 
AK108617TGTTGGGCCTANONE 
J013094D23TGTTGGGCCTANONE 
J013106G24TGTTGGGCCTANONE 
J013120M13TGTTGGGCCTANONE 
J023056M16TGTTGGGCCTANONE 
J023092M24TGTTGGGCCTANONE 
J033133N22TGTTGGGCCTANONE 
J043010O12TGTTGGGCCTANONE 
Os01g0908100AK072293TGTTGGGCTTGRabGAP/TBC domain containing protein. 
J065010B13TGTTGGGCTTGNONE 
J065010M12TGTTGGGCTTGNONE 
J065047C19TGTTGGGCTTGNONE 
J065069B18TGTTGGGCTTGNONE 
J065071K24TGTTGGGCTTGNONE 
J065142P04TGTTGGGCTTGNONE 
J065170E11TGTTGGGCTTGNONE 
Os01g0966200009-079-H11TGTTGGGCCGTANONE 
009-124-G10TGTTGGGCCGTANONE 
AK058564TGTTGGGCCGTAProtein of unknown function YGGT family protein. 
AK098935TGTTGGGCCGTANONE 
Os02g0119700AK108777AAAGCCCAACAProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
AK099931TGTTGGGCTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0152500AK101341GCCCAACAFibronectin, type III-like fold domain containing protein. 
J013027O15GCCCAACANONE 
J013066D05GCCCAACANONE 
J013089D21GCCCAACANONE 
J013111N20GCCCAACANONE 
J013122K23GCCCAACANONE 
J023001C11GCCCAACANONE 
J033034J20GCCCAACANONE 
J033042M05GCCCAACANONE 
J033080O14GCCCAACANONE 
J033113G09GCCCAACANONE 
J033123H09GCCCAACANONE 
J033131A02GCCCAACANONE 
J065116L13GCCCAACANONE 
J065120D15GCCCAACANONE 
J090012E11GCCCAACANONE 
Os02g0158400006-048-F06TGTTGGGCCGGGNONE 
AK061569TGTTGGGCCGGGssDNA-binding transcriptional regulator family protein. 
AK099479TGTTGGGCCGGGNONE 
AK104768TGTTGGGCCGGGNONE 
J013025B22TGTTGGGCCGGGNONE 
J023009C03TGTTGGGCCGGGNONE 
J033115N14TGTTGGGCCGGGNONE 
J065036F05TGTTGGGCCGGGNONE 
J065191K17TGTTGGGCCGGGNONE 
J065202K16TGTTGGGCCGGGNONE 
J075053E14TGTTGGGCCGGGNONE 
J075101E04TGTTGGGCCGGGNONE 
J075111C06TGTTGGGCCGGGNONE 
J075137O04TGTTGGGCCGGGNONE 
J075139E07TGTTGGGCCGGGNONE 
J075143K07TGTTGGGCCGGGNONE 
J075144K15TGTTGGGCCGGGNONE 
J075164L14TGTTGGGCCGGGNONE 
J075199D06TGTTGGGCCGGGNONE 
J090010G24TGTTGGGCCGGGNONE 
J090017C18TGTTGGGCCGGGNONE 
J090066F01TGTTGGGCCGGGNONE 
J090088G01TGTTGGGCCGGGNONE 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0179100AK058557TCCGGCCCAACAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10TCCGGCCCAACANONE 
Os02g0192700004-020-H12TTTCGGCCCAACANONE 
006-024-H06TTTCGGCCCAACANONE 
006-042-F06TTTCGGCCCAACANONE 
006-050-D04TTTCGGCCCAACANONE 
006-059-E10TTTCGGCCCAACANONE 
006-070-B02TTTCGGCCCAACANONE 
006-084-A09TTTCGGCCCAACANONE 
006-114-E11TTTCGGCCCAACANONE 
006-117-E05TTTCGGCCCAACANONE 
009-126-D11TTTCGGCCCAACANONE 
AK061629TTTCGGCCCAACASimilar to Thioredoxin peroxidase. 
AK065909TTTCGGCCCAACANONE 
J013043E11TTTCGGCCCAACANONE 
J065038I09TTTCGGCCCAACANONE 
J065078C12TTTCGGCCCAACANONE 
J065122O14TTTCGGCCCAACANONE 
J065198H04TTTCGGCCCAACANONE 
Os02g0199800AK072970GCCACGTGTTGGGCSimilar to No pollen. 
Os02g0205000AK060003TGTTGGGCTTTNONE 
AK073514TGTTGGGCTTTRibosomal protein L19 family protein. 
J065106I07TGTTGGGCTTTNONE 
Os02g0220600AK103901AAGGCCCAACANONE 
AK103901AAGGCCCATTTCAGCCCAACANONE 
AK103901GGCCCGTTACAGCCCAACANONE 
J013058O03AAGGCCCAACANONE 
J013058O03AAGGCCCATTTCAGCCCAACANONE 
J013058O03GGCCCGTTACAGCCCAACANONE 
J013124E21AAGGCCCAACANONE 
J013124E21AAGGCCCATTTCAGCCCAACANONE 
J013124E21GGCCCGTTACAGCCCAACANONE 
J023023L03AAGGCCCAACANONE 
J023023L03AAGGCCCATTTCAGCCCAACANONE 
J023023L03GGCCCGTTACAGCCCAACANONE 
J023023L21AAGGCCCAACANONE 
J023023L21AAGGCCCATTTCAGCCCAACANONE 
J023023L21GGCCCGTTACAGCCCAACANONE 
J023061N01AAGGCCCAACANONE 
J023061N01AAGGCCCATTTCAGCCCAACANONE 
J023061N01GGCCCGTTACAGCCCAACANONE 
J023065O09AAGGCCCAACANONE 
J023065O09AAGGCCCATTTCAGCCCAACANONE 
J023065O09GGCCCGTTACAGCCCAACANONE 
J023106J17AAGGCCCAACANONE 
J023106J17AAGGCCCATTTCAGCCCAACANONE 
J023106J17GGCCCGTTACAGCCCAACANONE 
J023119N08AAGGCCCAACANONE 
J023119N08AAGGCCCATTTCAGCCCAACANONE 
J023119N08GGCCCGTTACAGCCCAACANONE 
J033058A19AAGGCCCAACANONE 
J033058A19AAGGCCCATTTCAGCCCAACANONE 
J033058A19GGCCCGTTACAGCCCAACANONE 
J033098O13AAGGCCCAACANONE 
J033098O13AAGGCCCATTTCAGCCCAACANONE 
J033098O13GGCCCGTTACAGCCCAACANONE 
J033100M18AAGGCCCAACANONE 
J033100M18AAGGCCCATTTCAGCCCAACANONE 
J033100M18GGCCCGTTACAGCCCAACANONE 
J033125A21AAGGCCCAACANONE 
J033125A21AAGGCCCATTTCAGCCCAACANONE 
J033125A21GGCCCGTTACAGCCCAACANONE 
J033148C12AAGGCCCAACANONE 
J033148C12AAGGCCCATTTCAGCCCAACANONE 
J033148C12GGCCCGTTACAGCCCAACANONE 
J043017F03AAGGCCCAACANONE 
J043017F03AAGGCCCATTTCAGCCCAACANONE 
J043017F03GGCCCGTTACAGCCCAACANONE 
J043032J02AAGGCCCAACANONE 
J043032J02AAGGCCCATTTCAGCCCAACANONE 
J043032J02GGCCCGTTACAGCCCAACANONE 
J053047N10AAGGCCCAACANONE 
J053047N10AAGGCCCATTTCAGCCCAACANONE 
J053047N10GGCCCGTTACAGCCCAACANONE 
J053089P04AAGGCCCAACANONE 
J053089P04AAGGCCCATTTCAGCCCAACANONE 
J053089P04GGCCCGTTACAGCCCAACANONE 
J065051K09AAGGCCCAACANONE 
J065051K09AAGGCCCATTTCAGCCCAACANONE 
J065051K09GGCCCGTTACAGCCCAACANONE 
J065064H24AAGGCCCAACANONE 
J065064H24AAGGCCCATTTCAGCCCAACANONE 
J065064H24GGCCCGTTACAGCCCAACANONE 
J090001L06AAGGCCCAACANONE 
J090001L06AAGGCCCATTTCAGCCCAACANONE 
J090001L06GGCCCGTTACAGCCCAACANONE 
J090017C24AAGGCCCAACANONE 
J090017C24AAGGCCCATTTCAGCCCAACANONE 
J090017C24GGCCCGTTACAGCCCAACANONE 
J090058G15AAGGCCCAACANONE 
J090058G15AAGGCCCATTTCAGCCCAACANONE 
J090058G15GGCCCGTTACAGCCCAACANONE 
J090058H23AAGGCCCAACANONE 
J090058H23AAGGCCCATTTCAGCCCAACANONE 
J090058H23GGCCCGTTACAGCCCAACANONE 
J090061G20AAGGCCCAACANONE 
J090061G20AAGGCCCATTTCAGCCCAACANONE 
J090061G20GGCCCGTTACAGCCCAACANONE 
J090069N23AAGGCCCAACANONE 
J090069N23AAGGCCCATTTCAGCCCAACANONE 
J090069N23GGCCCGTTACAGCCCAACANONE 
J090071A08AAGGCCCAACANONE 
J090071A08AAGGCCCATTTCAGCCCAACANONE 
J090071A08GGCCCGTTACAGCCCAACANONE 
J090074A08AAGGCCCAACANONE 
J090074A08AAGGCCCATTTCAGCCCAACANONE 
J090074A08GGCCCGTTACAGCCCAACANONE 
J090077B15AAGGCCCAACANONE 
J090077B15AAGGCCCATTTCAGCCCAACANONE 
J090077B15GGCCCGTTACAGCCCAACANONE 
J090081K06AAGGCCCAACANONE 
J090081K06AAGGCCCATTTCAGCCCAACANONE 
J090081K06GGCCCGTTACAGCCCAACANONE 
J090083I05AAGGCCCAACANONE 
J090083I05AAGGCCCATTTCAGCCCAACANONE 
J090083I05GGCCCGTTACAGCCCAACANONE 
J090091O22AAGGCCCAACANONE 
J090091O22AAGGCCCATTTCAGCCCAACANONE 
J090091O22GGCCCGTTACAGCCCAACANONE 
J090097L10AAGGCCCAACANONE 
J090097L10AAGGCCCATTTCAGCCCAACANONE 
J090097L10GGCCCGTTACAGCCCAACANONE 
J100026B11AAGGCCCAACANONE 
J100026B11AAGGCCCATTTCAGCCCAACANONE 
J100026B11GGCCCGTTACAGCCCAACANONE 
J100044M01AAGGCCCAACANONE 
J100044M01AAGGCCCATTTCAGCCCAACANONE 
J100044M01GGCCCGTTACAGCCCAACANONE 
J100046F10AAGGCCCAACANONE 
J100046F10AAGGCCCATTTCAGCCCAACANONE 
J100046F10GGCCCGTTACAGCCCAACANONE 
J100051K14AAGGCCCAACANONE 
J100051K14AAGGCCCATTTCAGCCCAACANONE 
J100051K14GGCCCGTTACAGCCCAACANONE 
J100060D22AAGGCCCAACANONE 
J100060D22AAGGCCCATTTCAGCCCAACANONE 
J100060D22GGCCCGTTACAGCCCAACANONE 
J100060H18AAGGCCCAACANONE 
J100060H18AAGGCCCATTTCAGCCCAACANONE 
J100060H18GGCCCGTTACAGCCCAACANONE 
J100070I06AAGGCCCAACANONE 
J100070I06AAGGCCCATTTCAGCCCAACANONE 
J100070I06GGCCCGTTACAGCCCAACANONE 
J100071C04AAGGCCCAACANONE 
J100071C04AAGGCCCATTTCAGCCCAACANONE 
J100071C04GGCCCGTTACAGCCCAACANONE 
J100078M13AAGGCCCAACANONE 
J100078M13AAGGCCCATTTCAGCCCAACANONE 
J100078M13GGCCCGTTACAGCCCAACANONE 
J100080E17AAGGCCCAACANONE 
J100080E17AAGGCCCATTTCAGCCCAACANONE 
J100080E17GGCCCGTTACAGCCCAACANONE 
J100083I09AAGGCCCAACANONE 
J100083I09AAGGCCCATTTCAGCCCAACANONE 
J100083I09GGCCCGTTACAGCCCAACANONE 
Os02g0281200009-184-D06TTGGCCCAACANONE 
AK063172TTGGCCCAACANONE 
Os02g0308400006-022-B03GCCCAACANONE 
006-023-H07GCCCAACANONE 
006-026-F01GCCCAACANONE 
006-026-G09GCCCAACANONE 
006-031-A06GCCCAACANONE 
006-033-B03GCCCAACANONE 
006-035-F03GCCCAACANONE 
006-046-D08GCCCAACANONE 
006-048-E07GCCCAACANONE 
006-048-F12GCCCAACANONE 
006-049-F11GCCCAACANONE 
006-051-A12GCCCAACANONE 
006-055-H04GCCCAACANONE 
006-061-B09GCCCAACANONE 
006-066-E12GCCCAACANONE 
006-068-D11GCCCAACANONE 
006-072-H02GCCCAACANONE 
006-079-D02GCCCAACANONE 
006-083-B08GCCCAACANONE 
006-083-F10GCCCAACANONE 
006-093-D11GCCCAACANONE 
006-097-C09GCCCAACANONE 
006-100-C09GCCCAACANONE 
006-107-A04GCCCAACANONE 
006-110-D02GCCCAACANONE 
006-116-E06GCCCAACANONE 
006-117-H10GCCCAACANONE 
006-120-H10GCCCAACANONE 
009-033-D01GCCCAACANONE 
009-106-A02GCCCAACANONE 
009-111-B04GCCCAACANONE 
009-129-G10GCCCAACANONE 
013-036-E08GCCCAACANONE 
013-039-G02GCCCAACANONE 
014-023-A11GCCCAACANONE 
014-100-A04GCCCAACANONE 
AK061195GCCCAACANONE 
AK061421GCCCAACANONE 
AK104181GCCCAACANONE 
AK104630GCCCAACANONE 
AK104655GCCCAACABeta-Ig-H3/fasciclin domain containing protein. 
Os02g0552100AK100075GCCCAACAProtein prenyltransferase domain containing protein. 
Os02g0565000AK120665TCCGTCCGGCCCAACAHomeodomain-like containing protein. 
J100070C12TCCGTCCGGCCCAACANONE 
J100074L08TCCGTCCGGCCCAACANONE 
Os02g0582600006-041-F11GGGGCCCAACANONE 
AK059791GGGGCCCAACANONE 
AK102380GGGGCCCAACAHeavy metal transport/detoxification protein domain containing protein. 
J033092A09GGGGCCCAACANONE 
Os02g0653800J023002B17GCCCAACANONE 
J033067E03GCCCAACASimilar to GTP-binding protein. 
J033105M04GCCCAACANONE 
J053039E15GCCCAACANONE 
J065026L07GCCCAACANONE 
J065038B03GCCCAACANONE 
J065087J15GCCCAACANONE 
J065121B22GCCCAACANONE 
J065128N12GCCCAACANONE 
J065189E19GCCCAACANONE 
J100058B03GCCCAACANONE 
Os02g0658300AK073923TCTGGCCCAACAConserved hypothetical protein. 
J065152M15TCTGGCCCAACANONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AAGGCCCAACAAGCCCAACTNONE 
J023098L23AAGGCCCAACAAGCCCAACTNONE 
J065042J21AAGGCCCAACAAGCCCAACTNONE 
J065187L09AAGGCCCAACAAGCCCAACTNONE 
J065190O10AAGGCCCAACAAGCCCAACTNONE 
J080041G14AAGGCCCAACAAGCCCAACTNONE 
J080078K08AAGGCCCAACAAGCCCAACTNONE 
J080089D20AAGGCCCAACAAGCCCAACTNONE 
J080094D04AAGGCCCAACAAGCCCAACTNONE 
Os02g0686600AK102917AGCCCAACAMetal-dependent protein hydrolase family protein. 
Os02g0697200015-013-B10TGTTGGGCCGGTNONE 
AK059475TGTTGGGCCGGTNONE 
AK102993TGTTGGGCCGGTConserved hypothetical protein. 
J033079I18TGTTGGGCCGGTNONE 
J033082A14TGTTGGGCCGGTNONE 
J065047H08TGTTGGGCCGGTNONE 
J065131M14TGTTGGGCCGGTNONE 
Os02g0705300006-028-G05TGTTGGGCCGCNONE 
006-064-H09TGTTGGGCCGCNONE 
AK062089TGTTGGGCCGCNONE 
AK064855TGTTGGGCCGCNONE 
AK106164TGTTGGGCCGCTubby family protein. 
Os02g0719700AK119930GCCCAACAIQ calmodulin-binding region domain containing protein. 
Os02g0721100AK108167TAAGCCCAACASimilar to E2 ubiquitin-conjugating enzyme UbcH5B (Fragment). 
Os02g0753800AK101787GCCCAACASimilar to Annexin p35. 
Os02g0772500AK100349AGCCCAACAProtein prenyltransferase domain containing protein. 
J023082M21AGCCCAACANONE 
J065047H11AGCCCAACANONE 
J065055F20AGCCCAACANONE 
J065082I22AGCCCAACANONE 
J100074B04AGCCCAACANONE 
Os02g0774300AK065228GCAGCCCAACASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0796900009-121-E06AGCCCAACANONE 
D29725AGCCCAACASimilar to 60S ribosomal protein L39. 
J075016N24AGCCCAACANONE 
J075085F03AGCCCAACANONE 
J075147P11AGCCCAACANONE 
J075180E16AGCCCAACANONE 
J075182A19AGCCCAACANONE 
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein. 
Os02g0815300AK061607TGTTGGGCCATConserved hypothetical protein. 
J075088I01TGTTGGGCCATNONE 
Os02g0821200AK062099AGCCCAACARibosomal L28e protein family protein. 
J013108I22AGCCCAACANONE 
J023064L18AGCCCAACANONE 
J023115G17AGCCCAACANONE 
J033093D09AGCCCAACANONE 
J053025G17AGCCCAACANONE 
J053054J01AGCCCAACANONE 
J065095B03AGCCCAACANONE 
J065110E08AGCCCAACANONE 
J065114F23AGCCCAACANONE 
J065152G14AGCCCAACANONE 
J080022M24AGCCCAACANONE 
J080041G10AGCCCAACANONE 
J080043E22AGCCCAACANONE 
J080046G15AGCCCAACANONE 
J090018A08AGCCCAACANONE 
J090067B05AGCCCAACANONE 
J090088G12AGCCCAACANONE 
J100042G06AGCCCAACANONE 
J100066H17AGCCCAACANONE 
J100068M21AGCCCAACANONE 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0130700AK110670GGCTGGGCCCAACANONE 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0186800AK100356CACGGCCCAACAModifier of rudimentary, Modr family protein. 
Os03g0188000J043012N12GCCCAACANONE 
J075019M05GCCCAACANONE 
J075094K24GCCCAACANONE 
J075099J07GCCCAACANONE 
J075131A06GCCCAACANONE 
J075144N09GCCCAACAConserved hypothetical protein. 
Os03g0214000AK063756GCCCAACANONE 
AK101976GCCCAACASimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os03g0227000AK068454CTGGCCCAACASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0240700009-086-G10AATGGGCCTAGCCCAACANONE 
009-086-G10GGCCCGGCCCAACANONE 
AK071799AATGGGCCTAGCCCAACAConserved hypothetical protein. 
AK071799GGCCCGGCCCAACAConserved hypothetical protein. 
J023112A13AATGGGCCTAGCCCAACANONE 
J023112A13GGCCCGGCCCAACANONE 
J043022A01AATGGGCCTAGCCCAACANONE 
J043022A01GGCCCGGCCCAACANONE 
J065106A01AATGGGCCTAGCCCAACANONE 
J065106A01GGCCCGGCCCAACANONE 
J075023P22AATGGGCCTAGCCCAACANONE 
J075023P22GGCCCGGCCCAACANONE 
J075138I21AATGGGCCTAGCCCAACANONE 
J075138I21GGCCCGGCCCAACANONE 
J075173L02AATGGGCCTAGCCCAACANONE 
J075173L02GGCCCGGCCCAACANONE 
Os03g0240800006-092-D05TGTTGGGCCGGGCCNONE 
006-092-D05TGTTGGGCTAGGCCCATTNONE 
AK059292TGTTGGGCCGGGCCNONE 
AK059292TGTTGGGCTAGGCCCATTNONE 
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp. 
AK061178TGTTGGGCTAGGCCCATTSimilar to AGL157Cp. 
AK121552TGTTGGGCCGGGCCNONE 
AK121552TGTTGGGCTAGGCCCATTNONE 
J023131D06TGTTGGGCCGGGCCNONE 
J023131D06TGTTGGGCTAGGCCCATTNONE 
J033033E14TGTTGGGCCGGGCCNONE 
J033033E14TGTTGGGCTAGGCCCATTNONE 
J033105B01TGTTGGGCCGGGCCNONE 
J033105B01TGTTGGGCTAGGCCCATTNONE 
J033114L18TGTTGGGCCGGGCCNONE 
J033114L18TGTTGGGCTAGGCCCATTNONE 
J033132N24TGTTGGGCCGGGCCNONE 
J033132N24TGTTGGGCTAGGCCCATTNONE 
J065032H03TGTTGGGCCGGGCCNONE 
J065032H03TGTTGGGCTAGGCCCATTNONE 
J065115J20TGTTGGGCCGGGCCNONE 
J065115J20TGTTGGGCTAGGCCCATTNONE 
J065150C05TGTTGGGCCGGGCCNONE 
J065150C05TGTTGGGCTAGGCCCATTNONE 
J080302A11TGTTGGGCCGGGCCNONE 
J080302A11TGTTGGGCTAGGCCCATTNONE 
J080302H16TGTTGGGCCGGGCCNONE 
J080302H16TGTTGGGCTAGGCCCATTNONE 
J080305M12TGTTGGGCCGGGCCNONE 
J080305M12TGTTGGGCTAGGCCCATTNONE 
J080306F13TGTTGGGCCGGGCCNONE 
J080306F13TGTTGGGCTAGGCCCATTNONE 
J080312A06TGTTGGGCCGGGCCNONE 
J080312A06TGTTGGGCTAGGCCCATTNONE 
J090088P09TGTTGGGCCGGGCCNONE 
J090088P09TGTTGGGCTAGGCCCATTNONE 
Os03g0257900009-150-G06TGTTGGGCCAANONE 
009-181-H05TGTTGGGCCAANONE 
AK063892TGTTGGGCCAANONE 
AK100114TGTTGGGCCAASimilar to Lectin-like receptor kinase 7;2. 
AK103486TGTTGGGCCAANONE 
J023006K11TGTTGGGCCAANONE 
J075005E15TGTTGGGCCAANONE 
J075007K24TGTTGGGCCAANONE 
J075034G06TGTTGGGCCAANONE 
J075051I19TGTTGGGCCAANONE 
J075076A08TGTTGGGCCAANONE 
J075096H04TGTTGGGCCAANONE 
J075115I09TGTTGGGCCAANONE 
J075132K23TGTTGGGCCAANONE 
J075147C17TGTTGGGCCAANONE 
J090059O20TGTTGGGCCAANONE 
Os03g0260100AK066143TCAGCCCAACAConserved hypothetical protein. 
Os03g0265900009-004-C01TGTTGGGCCTTNONE 
009-045-B03TGTTGGGCCTTNONE 
AK099963TGTTGGGCCTTNONE 
AK120374TGTTGGGCCTTConserved hypothetical protein. 
J013036A19TGTTGGGCCTTNONE 
J013070J20TGTTGGGCCTTNONE 
J013071C06TGTTGGGCCTTNONE 
J013088C01TGTTGGGCCTTNONE 
J013112H21TGTTGGGCCTTNONE 
J065114K10TGTTGGGCCTTNONE 
J100028M20TGTTGGGCCTTNONE 
Os03g0266000AK068775AAGGCCCAACAOvarian tumour, otubain domain containing protein. 
AK104949AAGGCCCAACANONE 
J075149K24AAGGCCCAACANONE 
J075184C19AAGGCCCAACANONE 
Os03g0270700AK119531TGTTGGGCCGTANONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
016-023-H09TAGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
AK100355TAGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023013H05TAGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023043K04TAGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J023083I20TAGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033068F22TAGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J033125P21TAGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J065207A22TAGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100018D20TAGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100026L17TAGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100055D14TAGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100060P03TAGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
J100078A20TAGGCCCAACANONE 
Os03g0347800AK073756AGCCCACAGGGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os03g0363350Os03g0363350GTATGGGCCATGAGGCCCAACAProtein of unknown function DUF455 family protein. 
Os03g0388000009-082-H03TGTTGGGCTGCNONE 
AK062658TGTTGGGCTGCNONE 
Os03g0579000AK061586AGCCCAACANONE 
AK072995AGCCCAACAPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0647400AK073665TGTTGGGCCTAGCK domain containing protein. 
J033051B07TGTTGGGCCTANONE 
Os03g0647800003-103-H03ACAGCCCAACANONE 
003-103-H03GCCCAACANONE 
006-104-G09ACAGCCCAACANONE 
006-104-G09GCCCAACANONE 
AK070243ACAGCCCAACAConserved hypothetical protein. 
AK070243GCCCAACAConserved hypothetical protein. 
J100056F22ACAGCCCAACANONE 
J100056F22GCCCAACANONE 
Os03g0698900013-074-A08AAAGCCCAACANONE 
AK073303AAAGCCCAACAAlkaline phytoceramidase family protein. 
AK103953AAAGCCCAACANONE 
J033024P22AAAGCCCAACANONE 
J065194N16AAAGCCCAACANONE 
J065195O11AAAGCCCAACANONE 
J075020F03AAAGCCCAACANONE 
J075032P18AAAGCCCAACANONE 
J075037H13AAAGCCCAACANONE 
J075147I01AAAGCCCAACANONE 
J075187B13AAAGCCCAACANONE 
J100043G08AAAGCCCAACANONE 
J100060L06AAAGCCCAACANONE 
J100063O21AAAGCCCAACANONE 
J100066O13AAAGCCCAACANONE 
J100072K20AAAGCCCAACANONE 
J100083G21AAAGCCCAACANONE 
J100085D07AAAGCCCAACANONE 
Os03g0700600AK107009TGTTGGGCConserved hypothetical protein. 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0743200J065049G14TGTTGGGCCTCNONE 
J065158O18TGTTGGGCCTCNONE 
Os03g0746400AK063445TGTTGGGCTTGProtein prenyltransferase domain containing protein. 
AK070923TGTTGGGCTTGNONE 
J065008K24TGTTGGGCTTGNONE 
Os03g0758700AK106620AAAGCCCAACAWD40-like domain containing protein. 
AK106620GTGGCCCAACAWD40-like domain containing protein. 
Os03g0772800009-023-E05CAACGGCCCAACANONE 
009-059-F12CAACGGCCCAACANONE 
009-114-B08CAACGGCCCAACANONE 
009-115-G09CAACGGCCCAACANONE 
009-151-D08CAACGGCCCAACANONE 
009-158-A10CAACGGCCCAACANONE 
009-191-H02CAACGGCCCAACANONE 
009-192-E05CAACGGCCCAACANONE 
009-197-F11CAACGGCCCAACANONE 
AK059576CAACGGCCCAACANONE 
AK121608CAACGGCCCAACACytochrome c oxidase, subunit VIa family protein. 
J023087H20CAACGGCCCAACANONE 
J023105P14CAACGGCCCAACANONE 
J033026P15CAACGGCCCAACANONE 
J033042K10CAACGGCCCAACANONE 
J033133C09CAACGGCCCAACANONE 
J065123K13CAACGGCCCAACANONE 
J075190D03CAACGGCCCAACANONE 
J080310M14CAACGGCCCAACANONE 
J080317L14CAACGGCCCAACANONE 
J100067J19CAACGGCCCAACANONE 
J100079H21CAACGGCCCAACANONE 
Os03g0786600AK109838AGCCCAACAProtein of unknown function DUF860, plant family protein. 
Os03g0787100006-022-G04AGCCCAACANONE 
AK110858AGCCCAACAConserved hypothetical protein. 
J065197C24AGCCCAACANONE 
J075147E03AGCCCAACANONE 
J100065K06AGCCCAACANONE 
Os03g0802300AK120564TGTTGGGCCAGConserved hypothetical protein. 
AK120687TGTTGGGCCAGNONE 
Os03g0822200AK069405GCGGCCCAACANAD-dependent epimerase/dehydratase family protein. 
AK104151GCGGCCCAACANONE 
AK104209GCGGCCCAACANONE 
J065107D01GCGGCCCAACANONE 
J065191L23GCGGCCCAACANONE 
J065217B05GCGGCCCAACANONE 
Os03g0843400009-195-F11CCCGGCCCAACANONE 
AK061198CCCGGCCCAACASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076CCCGGCCCAACANONE 
Os03g0843500AK067985CGGGCCCAACANONE 
AK101661CGGGCCCAACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAACANONE 
J080302L23CGGGCCCAACANONE 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os03g0854000009-186-C03TGTTGGGCCGCANONE 
AK061374TGTTGGGCCGCAProtein of unknown function UPF0131 family protein. 
J065138B11TGTTGGGCCGCANONE 
Os03g0855700AK070400AGCCCAACANucleic acid-binding, OB-fold domain containing protein. 
Os04g0117100009-025-D02CCCGGCCCAACANONE 
009-056-D03CCCGGCCCAACANONE 
009-145-F01CCCGGCCCAACANONE 
009-146-C06CCCGGCCCAACANONE 
009-186-C05CCCGGCCCAACANONE 
AK060395CCCGGCCCAACANONE 
AK121763CCCGGCCCAACAConserved hypothetical protein. 
J033090J17CCCGGCCCAACANONE 
J065058O06CCCGGCCCAACANONE 
J065058P05CCCGGCCCAACANONE 
J065141C14CCCGGCCCAACANONE 
J065162F07CCCGGCCCAACANONE 
J065199N16CCCGGCCCAACANONE 
J065214I05CCCGGCCCAACANONE 
J075003L04CCCGGCCCAACANONE 
J075014C14CCCGGCCCAACANONE 
J075063K14CCCGGCCCAACANONE 
J075111N19CCCGGCCCAACANONE 
J075138E13CCCGGCCCAACANONE 
J075189E23CCCGGCCCAACANONE 
J080304J23CCCGGCCCAACANONE 
J080310L07CCCGGCCCAACANONE 
J080318A16CCCGGCCCAACANONE 
J100054P14CCCGGCCCAACANONE 
Os04g0320200012-089-H09AGGGCCCAACANONE 
AK069513AGGGCCCAACAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028AGGGCCCAACANONE 
AK119256AGGGCCCAACANONE 
J023020H09AGGGCCCAACANONE 
J065112F21AGGGCCCAACANONE 
J100036M07AGGGCCCAACANONE 
Os04g0329500015-081-E12TCAGCCCAACANONE 
AK064343TCAGCCCAACAProtein of unknown function DUF295 family protein. 
AK073994TCAGCCCAACANONE 
J033072H16TCAGCCCAACANONE 
Os04g0389800AK109628GAAGCCCAACASimilar to Acetohydroxyacid synthase. 
Os04g0466100AK064543TGTTGGGCCTCSimilar to Cell division protein FtsH-like protein. 
Os04g0504200AK110863TGTTGGGCCAAConserved hypothetical protein. 
Os04g0504600J065162K24GACGGCCCAACANONE 
Os04g0520900AK068793TGTTGGGCCAAProtein prenyltransferase domain containing protein. 
AK105606TGTTGGGCCAANONE 
Os04g0581300009-171-H01ATGGCCCATAAGGCCCAACANONE 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0636900011-028-G03TTGTGGGCTGTTGGGCTNONE 
012-040-G03TTGTGGGCTGTTGGGCTNONE 
AK058405TTGTGGGCTGTTGGGCTNONE 
AK065789TTGTGGGCTGTTGGGCTNONE 
AK101408TTGTGGGCTGTTGGGCTNONE 
AK119286TTGTGGGCTGTTGGGCTNONE 
J013042J24TTGTGGGCTGTTGGGCTNONE 
J033037I12TTGTGGGCTGTTGGGCTNONE 
J043031B12TTGTGGGCTGTTGGGCTNONE 
J065152N10TTGTGGGCTGTTGGGCTNONE 
J090060K17TTGTGGGCTGTTGGGCTNONE 
J090083K14TTGTGGGCTGTTGGGCTNONE 
J100046O13TTGTGGGCTGTTGGGCTNONE 
J100066G22TTGTGGGCTGTTGGGCTNONE 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os04g0665000009-149-A12TGTTGGGCTGGNONE 
AK062995TGTTGGGCTGGCHCH domain containing protein. 
J065017G19TGTTGGGCTGGNONE 
J080301G12TGTTGGGCTGGNONE 
Os04g0669300AK071148GAAGCCCAACADynamin family protein. 
Os04g0692200006-047-H10ATGGCCCAGGCCCAACANONE 
006-107-D08ATGGCCCAGGCCCAACANONE 
009-122-B09ATGGCCCAGGCCCAACANONE 
AK059807ATGGCCCAGGCCCAACANONE 
AK060875ATGGCCCAGGCCCAACANONE 
AK071726ATGGCCCAGGCCCAACAConserved hypothetical protein. 
J023110I24ATGGCCCAGGCCCAACANONE 
J033091O06ATGGCCCAGGCCCAACANONE 
J053027N16ATGGCCCAGGCCCAACANONE 
J053089E19ATGGCCCAGGCCCAACANONE 
J053098H12ATGGCCCAGGCCCAACANONE 
J053099N13ATGGCCCAGGCCCAACANONE 
J075031B15ATGGCCCAGGCCCAACANONE 
J080013D12ATGGCCCAGGCCCAACANONE 
J080013H05ATGGCCCAGGCCCAACANONE 
J080013H07ATGGCCCAGGCCCAACANONE 
J080088I03ATGGCCCAGGCCCAACANONE 
Os04g0692500AK101528GCGGCCCAACANONE 
Os05g0118000AK110694CTGGCCCAACASRR1 domain containing protein. 
Os05g0120800AK066865TCCGGCCCAACAConserved hypothetical protein. 
Os05g0121800AK101222AAGGCCCAACAConserved hypothetical protein. 
J033031D02AAGGCCCAACANONE 
J065078F10AAGGCCCAACANONE 
J065151J16AAGGCCCAACANONE 
J065151K04AAGGCCCAACANONE 
J090057E18AAGGCCCAACANONE 
Os05g0126200AK059554GCGGCCCAACAConserved hypothetical protein. 
AK121734GCGGCCCAACANONE 
J033084B09GCGGCCCAACANONE 
J090010I10GCGGCCCAACANONE 
Os05g0137600AK099427TGTTGGGCTTCConserved hypothetical protein. 
Os05g0148300009-031-A08TGTTGGGCCGTTNONE 
AK062421TGTTGGGCCGTTRibosomal protein S27, mitochondrial family protein. 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0245300AB091471GCCCAACAProtein of unknown function DUF588 family protein. 
J100023O13GCCCAACANONE 
J100063B05GCCCAACANONE 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0304900AK105545TGTTGGGCGlycoside hydrolase, family 10 protein. 
Os05g0335800AK108393CCAAGCCCAACATGF-beta receptor, type I/II extracellular region family protein. 
Os05g0386800009-185-E02GCCCAACANONE 
AK062748GCCCAACANONE 
Os05g0399200AK101507GCCCAACASimilar to Endo-1,3;1,4-beta-D-glucanase precursor (EC 3.2.1.-). 
Os05g0412800AF402803ATGGCCCAACASimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0427200AK070830ACAGCCCAACANONE 
AK106896ACAGCCCAACAGlycosyl transferase, family 31 protein. 
Os05g0456000AK058420AGCCCAACAMitochondrial glycoprotein family protein. 
AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036AGCCCAACANONE 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02AGCCCAACANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0458400AK069936AGCCCAACASimilar to AAA-metalloprotease FtsH. 
Os05g0512500009-036-D05GCCCAACANONE 
AK062441GCCCAACACT20 family protein. 
J080003C10GCCCAACANONE 
J080046G11GCCCAACANONE 
Os05g0554400AK102948CCAGCCCAACANONE 
AK107427CCAGCCCAACAPhosphatidyl serine synthase family protein. 
J023089D16CCAGCCCAACANONE 
Os05g0555300009-032-C03GCGGCCCAACANONE 
009-125-E08GCGGCCCAACANONE 
009-149-C12GCGGCCCAACANONE 
009-172-C01GCGGCCCAACANONE 
AK062890GCGGCCCAACAFerredoxin domain containing protein. 
AK062997GCGGCCCAACANONE 
Os05g0557200AK062090CTTGGGCTCGGCCCAACANONE 
AK102111CTTGGGCTCGGCCCAACAArmadillo-like helical domain containing protein. 
J013047E13CTTGGGCTCGGCCCAACANONE 
J013089P04CTTGGGCTCGGCCCAACANONE 
J013130H17CTTGGGCTCGGCCCAACANONE 
J013132C20CTTGGGCTCGGCCCAACANONE 
J023001E06CTTGGGCTCGGCCCAACANONE 
J023108C09CTTGGGCTCGGCCCAACANONE 
J023125C12CTTGGGCTCGGCCCAACANONE 
J033023O10CTTGGGCTCGGCCCAACANONE 
J033033K16CTTGGGCTCGGCCCAACANONE 
J033064C11CTTGGGCTCGGCCCAACANONE 
J033071P07CTTGGGCTCGGCCCAACANONE 
J033072H14CTTGGGCTCGGCCCAACANONE 
J033084F06CTTGGGCTCGGCCCAACANONE 
J033084H11CTTGGGCTCGGCCCAACANONE 
J033097C05CTTGGGCTCGGCCCAACANONE 
J043009E20CTTGGGCTCGGCCCAACANONE 
J053035M10CTTGGGCTCGGCCCAACANONE 
J053043J22CTTGGGCTCGGCCCAACANONE 
J053082K10CTTGGGCTCGGCCCAACANONE 
J053094N13CTTGGGCTCGGCCCAACANONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
Os05g0571300AK072262CCAGGCCCAACAConserved hypothetical protein. 
AK109853CCAGGCCCAACANONE 
AK111014CCAGGCCCAACANONE 
Os05g0577200AK069756TCAGCCCAACACarboxylesterase, type B family protein. 
Os06g0103200011-003-H09TGTTGGGCCACCAACNONE 
011-017-H05TGTTGGGCCACCAACNONE 
011-027-G08TGTTGGGCCACCAACNONE 
011-059-F08TGTTGGGCCACCAACNONE 
AK103757TGTTGGGCCACCAACTransferase family protein. 
J033143E17TGTTGGGCCACCAACNONE 
Os06g0114700AK061552AGGGCCCAACAProtein of unknown function DUF1218 family protein. 
AK098848AGGGCCCAACANONE 
AK122142AGGGCCCAACANONE 
J013000D16AGGGCCCAACANONE 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0140100011-063-A02AAGGCCCAACANONE 
011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371AAGGCCCAACALeucine carboxyl methyltransferase family protein. 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0144000AK068998TGTTGGGCCGCBRCT domain containing protein. 
J023001F16TGTTGGGCCGCNONE 
Os06g0152800003-125-D04AAAGCCCAACANONE 
AK099578AAAGCCCAACAConserved hypothetical protein. 
Os06g0160800009-164-H06AGCCCAACANONE 
AK063063AGCCCAACAConserved hypothetical protein. 
AK069662AGCCCAACANONE 
J090005A21AGCCCAACANONE 
J090055M15AGCCCAACANONE 
Os06g0327300015-060-C11GCCCAACANONE 
AK106368GCCCAACASimilar to Thioredoxin reductase 1 (EC 1.8.1.9) (NADPH-dependent thioredoxin reductase 1) (NTR 1). 
J100063K19GCCCAACANONE 
J100066D02GCCCAACANONE 
J100082F22GCCCAACANONE 
Os06g0355500AK065914GCTGGGCCGCCCAACABromodomain containing protein. 
Os06g0482200AK119703TGTTGGGCCGCAThioredoxin fold domain containing protein. 
J065014B11TGTTGGGCCGCANONE 
J065055E22TGTTGGGCCGCANONE 
J065092L13TGTTGGGCCGCANONE 
J065113E21TGTTGGGCCGCANONE 
J065191D11TGTTGGGCCGCANONE 
J065214F18TGTTGGGCCGCANONE 
J075104E18TGTTGGGCCGCANONE 
J075149O19TGTTGGGCCGCANONE 
J075170I11TGTTGGGCCGCANONE 
Os06g0496800AK069969TGTTGGGCNONE 
AK105608TGTTGGGCSimilar to S-locus receptor kinase precursor. 
J023038O14TGTTGGGCNONE 
J023067C09TGTTGGGCNONE 
J065040A13TGTTGGGCNONE 
J075041I24TGTTGGGCNONE 
J075088P04TGTTGGGCNONE 
J075114B05TGTTGGGCNONE 
J075155L05TGTTGGGCNONE 
J075169G21TGTTGGGCNONE 
J090049L19TGTTGGGCNONE 
J090075E08TGTTGGGCNONE 
J090092J03TGTTGGGCNONE 
J100054E02TGTTGGGCNONE 
J100079D08TGTTGGGCNONE 
Os06g0530200009-042-B02TGTTGGGCCGGGCCNONE 
009-050-E10TGTTGGGCCGGGCCNONE 
009-060-F07TGTTGGGCCGGGCCNONE 
009-117-H08TGTTGGGCCGGGCCNONE 
009-129-C10TGTTGGGCCGGGCCNONE 
AK073116TGTTGGGCCGGGCCConserved hypothetical protein. 
AK104077TGTTGGGCCGGGCCNONE 
J065032N16TGTTGGGCCGGGCCNONE 
J065153K07TGTTGGGCCGGGCCNONE 
J065169N18TGTTGGGCCGGGCCNONE 
J065190H18TGTTGGGCCGGGCCNONE 
J075127E14TGTTGGGCCGGGCCNONE 
J090008F20TGTTGGGCCGGGCCNONE 
Os06g0567000009-166-G12CAAGGCCCAACANONE 
009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CAAGGCCCAACAProtein of unknown function UPF0197 family protein. 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CAAGGCCCAACANONE 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CAAGGCCCAACANONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CAAGGCCCAACANONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CAAGGCCCAACANONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CAAGGCCCAACANONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CAAGGCCCAACANONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CAAGGCCCAACANONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CAAGGCCCAACANONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CAAGGCCCAACANONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CAAGGCCCAACANONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CAAGGCCCAACANONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CAAGGCCCAACANONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CAAGGCCCAACANONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CAAGGCCCAACANONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CAAGGCCCAACANONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CAAGGCCCAACANONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CAAGGCCCAACANONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CAAGGCCCAACANONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CAAGGCCCAACANONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CAAGGCCCAACANONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CAAGGCCCAACANONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CAAGGCCCAACANONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CAAGGCCCAACANONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CAAGGCCCAACANONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CAAGGCCCAACANONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CAAGGCCCAACANONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CAAGGCCCAACANONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CAAGGCCCAACANONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CAAGGCCCAACANONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CAAGGCCCAACANONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CAAGGCCCAACANONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CAAGGCCCAACANONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CAAGGCCCAACANONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CAAGGCCCAACANONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CAAGGCCCAACANONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CAAGGCCCAACANONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CAAGGCCCAACANONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CAAGGCCCAACANONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CAAGGCCCAACANONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CAAGGCCCAACANONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CAAGGCCCAACANONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CAAGGCCCAACANONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CAAGGCCCAACANONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CAAGGCCCAACANONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CAAGGCCCAACANONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CAAGGCCCAACANONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CAAGGCCCAACANONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CAAGGCCCAACANONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CAAGGCCCAACANONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CAAGGCCCAACANONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CAAGGCCCAACANONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CAAGGCCCAACANONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CAAGGCCCAACANONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CAAGGCCCAACANONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CAAGGCCCAACANONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CAAGGCCCAACANONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CAAGGCCCAACANONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CAAGGCCCAACANONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CAAGGCCCAACANONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CAAGGCCCAACANONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CAAGGCCCAACANONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CAAGGCCCAACANONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0587300AK069419TGTTGGGCCCACAConserved hypothetical protein. 
AK121885TGTTGGGCCCACANONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0611300AK107800GCCCAACAConserved hypothetical protein. 
Os06g0647900AK073750GCGGCCCAACAConserved hypothetical protein. 
AK073750GCGGCCCAACAConserved hypothetical protein. 
J033029K17GCGGCCCAACANONE 
J033029K17GCGGCCCAACANONE 
J033070L21GCGGCCCAACANONE 
J033070L21GCGGCCCAACANONE 
Os06g0667400AK065424GAGGCCCAACAConserved hypothetical protein. 
AK065580GAGGCCCAACANONE 
Os06g0710300AK121344TAAGCCCAACAUncharacterized protein UPF0114 family protein. 
J043016B12TAAGCCCAACANONE 
J065104H21TAAGCCCAACANONE 
Os07g0124500012-092-F01TTGGCCCAACANONE 
AK070529TTGGCCCAACASimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000TTGGCCCAACANONE 
J090007O11TTGGCCCAACANONE 
J090010E02TTGGCCCAACANONE 
J090078C04TTGGCCCAACANONE 
Os07g0146600J075074M15CACGGCCCAACAConserved hypothetical protein. 
J075120F11CACGGCCCAACANONE 
J075170L13CACGGCCCAACANONE 
J080302A21CACGGCCCAACANONE 
J080304J04CACGGCCCAACANONE 
J080308I12CACGGCCCAACANONE 
J080312F11CACGGCCCAACANONE 
J080315M22CACGGCCCAACANONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0240400009-080-C04AGCCCAACANONE 
AK062643AGCCCAACAConserved hypothetical protein. 
Os07g0479200005-017-H08TTCGGCCCAACACGTCACNONE 
AK058326TTCGGCCCAACACGTCACSimilar to SL15-like (Fragment). 
J013092A08TTCGGCCCAACACGTCACNONE 
J033139E04TTCGGCCCAACACGTCACNONE 
J043016M16TTCGGCCCAACACGTCACNONE 
J053050O18TTCGGCCCAACACGTCACNONE 
J053098B03TTCGGCCCAACACGTCACNONE 
J065068G10TTCGGCCCAACACGTCACNONE 
J065091I17TTCGGCCCAACACGTCACNONE 
J065109A03TTCGGCCCAACACGTCACNONE 
J065168B17TTCGGCCCAACACGTCACNONE 
J065177A05TTCGGCCCAACACGTCACNONE 
J065180J01TTCGGCCCAACACGTCACNONE 
J075006F13TTCGGCCCAACACGTCACNONE 
J075022J03TTCGGCCCAACACGTCACNONE 
J075024N09TTCGGCCCAACACGTCACNONE 
J075114B12TTCGGCCCAACACGTCACNONE 
J080023M06TTCGGCCCAACACGTCACNONE 
J080081N24TTCGGCCCAACACGTCACNONE 
J090060N07TTCGGCCCAACACGTCACNONE 
Os07g0516200AK061373CAAGGCCCAACASimilar to Endoribonuclease, L-PSP family. 
Os07g0565700006-106-C01AAAGCCCAACANONE 
AK111937AAAGCCCAACANONE 
AK112115AAAGCCCAACAAlpha/beta hydrolase family protein. 
Os07g0571100AK099771TGTTGGGCNONE 
J013002K17TGTTGGGCNONE 
J013036G13TGTTGGGCNONE 
J013095D13TGTTGGGCNONE 
Os07g0585800006-106-A05TTGGCCCAACANONE 
AK066419TTGGCCCAACANONE 
AK105064TTGGCCCAACASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TTGGCCCAACANONE 
J065085B08TTGGCCCAACANONE 
J065099I23TTGGCCCAACANONE 
J065169A01TTGGCCCAACANONE 
J065187N13TTGGCCCAACANONE 
J065191L18TTGGCCCAACANONE 
J065194D04TTGGCCCAACANONE 
J065211M09TTGGCCCAACANONE 
J065212I02TTGGCCCAACANONE 
J090003C10TTGGCCCAACANONE 
J090025O11TTGGCCCAACANONE 
J090092F10TTGGCCCAACANONE 
J100055A04TTGGCCCAACANONE 
J100064A01TTGGCCCAACANONE 
J100080L02TTGGCCCAACANONE 
Os07g0607200AK065746CTCGGCCCAACAProtein of unknown function DUF751 family protein. 
AK065746TTCGGCCCAACAProtein of unknown function DUF751 family protein. 
J065037B15CTCGGCCCAACANONE 
J065037B15TTCGGCCCAACANONE 
J065042E20CTCGGCCCAACANONE 
J065042E20TTCGGCCCAACANONE 
J065161I08CTCGGCCCAACANONE 
J065161I08TTCGGCCCAACANONE 
Os07g0620200AK099859TGTTGGGCCTTHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04TGTTGGGCCTTNONE 
Os07g0625500AK064628TCTGGCCCAACASimilar to Fimbriata-associated protein (Fragment). 
Os07g0644300AK066726TCGGCCCAACASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TCGGCCCAACANONE 
Os07g0687300AK073043TTTCGGCCCAACASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0101600AB074260TGTTGGGCCGGCGTGGGCTTGSingle-strand DNA endonuclease-1. 
AK102542TGTTGGGCCGGCGTGGGCTTGNONE 
Os08g0107900014-055-C03TGTTGGGCCGCANONE 
J065062G20TGTTGGGCCGCANONE 
Os08g0120000006-042-E02AAACGGCCCAACANONE 
006-051-F06AAACGGCCCAACANONE 
006-052-G03AAACGGCCCAACANONE 
006-095-B11AAACGGCCCAACANONE 
AB017427AAACGGCCCAACANONE 
AB017428AAACGGCCCAACANONE 
AK059789AAACGGCCCAACANONE 
AK059815AAACGGCCCAACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077AAACGGCCCAACANONE 
AK102607AAACGGCCCAACANONE 
AK104303AAACGGCCCAACANONE 
AK104304AAACGGCCCAACANONE 
AK104421AAACGGCCCAACANONE 
D10414AAACGGCCCAACANONE 
J013170D08AAACGGCCCAACANONE 
J023086D16AAACGGCCCAACANONE 
J033099B04AAACGGCCCAACANONE 
J065042P05AAACGGCCCAACANONE 
J065144E22AAACGGCCCAACANONE 
J065162J20AAACGGCCCAACANONE 
J065196N13AAACGGCCCAACANONE 
J090013B11AAACGGCCCAACANONE 
Os08g0127600AK058365TGTTGGGCCTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373TGTTGGGCCTANONE 
J013149L10TGTTGGGCCTANONE 
J075027H17TGTTGGGCCTANONE 
J075060F10TGTTGGGCCTANONE 
Os08g0127700012-086-F03TAGGCCCAACANONE 
AK059350TAGGCCCAACANONE 
AK099242TAGGCCCAACANONE 
AK121348TAGGCCCAACAConserved hypothetical protein. 
J033027J18TAGGCCCAACANONE 
J065012F22TAGGCCCAACANONE 
J065046N17TAGGCCCAACANONE 
J065197B02TAGGCCCAACANONE 
J100018P04TAGGCCCAACANONE 
J100052C14TAGGCCCAACANONE 
J100083A12TAGGCCCAACANONE 
Os08g0164800AK062058GCCCAACANONE 
Os08g0195400006-057-E04TGTTGGGCTGTNONE 
006-060-B10TGTTGGGCTGTNONE 
AK070464TGTTGGGCTGTConserved hypothetical protein. 
AK104389TGTTGGGCTGTNONE 
AK106140TGTTGGGCTGTNONE 
J023013G08TGTTGGGCTGTNONE 
J023054K19TGTTGGGCTGTNONE 
J023089D18TGTTGGGCTGTNONE 
J023092K05TGTTGGGCTGTNONE 
J033025A08TGTTGGGCTGTNONE 
J033067P12TGTTGGGCTGTNONE 
J033098A10TGTTGGGCTGTNONE 
J065219L04TGTTGGGCTGTNONE 
J090021P06TGTTGGGCTGTNONE 
J090062M05TGTTGGGCTGTNONE 
J090079F15TGTTGGGCTGTNONE 
J100041H19TGTTGGGCTGTNONE 
Os08g0220400AK106909TGTTGGGCVirulence factor, pectin lyase fold family protein. 
Os08g0224200AK101331TGTTGGGCCGTGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01GAGGCCCAACANONE 
AK067127GAGGCCCAACAConserved hypothetical protein. 
J013096C05GAGGCCCAACANONE 
J100032D12GAGGCCCAACANONE 
Os08g0271400009-101-A03TGTTGGGCTGGNONE 
AK062750TGTTGGGCTGGConserved hypothetical protein. 
Os08g0280100AK072150GCCCAACANONE 
AK119420GCCCAACASimilar to Phytase. 
Os08g0411500J013050J08ATGGCCCAACANONE 
Os08g0471900015-099-E10ACAGCCCAACAAGGCCCATCGNONE 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
Os08g0517900015-019-D06AAAAGCCCAACANONE 
AK064304AAAAGCCCAACASimilar to 30S ribosomal protein S16. 
Os08g0532300009-122-A05TGTTGGGCNONE 
009-129-H05TGTTGGGCNONE 
AB011262TGTTGGGCNONE 
AK065141TGTTGGGCNONE 
AK119730TGTTGGGCSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14TGTTGGGCNONE 
J013042K23TGTTGGGCNONE 
J023057J08TGTTGGGCNONE 
J023057N10TGTTGGGCNONE 
J023113C21TGTTGGGCNONE 
J053054E03TGTTGGGCNONE 
J053062B07TGTTGGGCNONE 
J053075O17TGTTGGGCNONE 
J053075P09TGTTGGGCNONE 
J065024H05TGTTGGGCNONE 
J065049F22TGTTGGGCNONE 
J065063L03TGTTGGGCNONE 
J065102O07TGTTGGGCNONE 
J065104M12TGTTGGGCNONE 
J065119E04TGTTGGGCNONE 
J065153E10TGTTGGGCNONE 
J065168M24TGTTGGGCNONE 
J065173I10TGTTGGGCNONE 
J065181L04TGTTGGGCNONE 
J065184I18TGTTGGGCNONE 
J065203M15TGTTGGGCNONE 
J075004C21TGTTGGGCNONE 
J075047B11TGTTGGGCNONE 
J075055F18TGTTGGGCNONE 
J075065G09TGTTGGGCNONE 
J075094O14TGTTGGGCNONE 
J075143C22TGTTGGGCNONE 
J075153K18TGTTGGGCNONE 
J075164N10TGTTGGGCNONE 
J075197C11TGTTGGGCNONE 
J080001A01TGTTGGGCNONE 
J080003B11TGTTGGGCNONE 
J080006G17TGTTGGGCNONE 
J080007J06TGTTGGGCNONE 
J080010H12TGTTGGGCNONE 
J080014I01TGTTGGGCNONE 
J080015C16TGTTGGGCNONE 
J080016P19TGTTGGGCNONE 
J080020G24TGTTGGGCNONE 
J080021E12TGTTGGGCNONE 
J080023I11TGTTGGGCNONE 
J080024H24TGTTGGGCNONE 
J080025G18TGTTGGGCNONE 
J080028H08TGTTGGGCNONE 
J080030G08TGTTGGGCNONE 
J080031H20TGTTGGGCNONE 
J080034C20TGTTGGGCNONE 
J080040H13TGTTGGGCNONE 
J080044M04TGTTGGGCNONE 
J080047D02TGTTGGGCNONE 
J080049D17TGTTGGGCNONE 
J080049J17TGTTGGGCNONE 
J080050A05TGTTGGGCNONE 
J080051C11TGTTGGGCNONE 
J080051K06TGTTGGGCNONE 
J080053A07TGTTGGGCNONE 
J080053I08TGTTGGGCNONE 
J080056L12TGTTGGGCNONE 
J080061I19TGTTGGGCNONE 
J080075G09TGTTGGGCNONE 
J080078C23TGTTGGGCNONE 
J080080I21TGTTGGGCNONE 
J080084F04TGTTGGGCNONE 
J080085K16TGTTGGGCNONE 
J080097A12TGTTGGGCNONE 
J080097N01TGTTGGGCNONE 
J090027L10TGTTGGGCNONE 
J100034N17TGTTGGGCNONE 
Os08g0532400AK101608GCCCAACASimilar to AT.I.24-7 protein. 
Os08g0542100AK058490AAAAGCCCAACAGGCCCACTRibosomal protein L7, eukaryotic form family protein. 
AK101416AAAAGCCCAACAGGCCCACTNONE 
J033037N08AAAAGCCCAACAGGCCCACTNONE 
J033086B16AAAAGCCCAACAGGCCCACTNONE 
J043036J02AAAAGCCCAACAGGCCCACTNONE 
J065137E02AAAAGCCCAACAGGCCCACTNONE 
J090015L07AAAAGCCCAACAGGCCCACTNONE 
J100036D02AAAAGCCCAACAGGCCCACTNONE 
Os09g0100800AK072386TGTTGGGCTGTConserved hypothetical protein. 
J023081P06TGTTGGGCTGTNONE 
J090027B17TGTTGGGCTGTNONE 
Os09g0112400AK109186TGTTGGGCCGGCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0122000J075038D18TGTTGGGCCAANONE 
J075080K22TGTTGGGCCAANONE 
J075153J04TGTTGGGCCAANONE 
J075161K18TGTTGGGCCAANONE 
J075163H20TGTTGGGCCAANONE 
J075174C07TGTTGGGCCAAConserved hypothetical protein. 
Os09g0243200AK107718CCCAGCCCAACAZinc finger, RING-type domain containing protein. 
Os09g0338400AK059171CCACGGCCCAACANONE 
AK068798CCACGGCCCAACANONE 
AK072043CCACGGCCCAACANONE 
AK098947CCACGGCCCAACASimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0349700J065099D05GCCCAACAConserved hypothetical protein. 
J065123M23GCCCAACANONE 
Os09g0361300AK110933GCCCAACAConserved hypothetical protein. 
J065113C18GCCCAACANONE 
J100046A19GCCCAACANONE 
J100059L16GCCCAACANONE 
Os09g0363700AK103667TGTTGGGCCGGCCCAAGConserved hypothetical protein. 
J075001L14TGTTGGGCCGGCCCAAGNONE 
J075049M23TGTTGGGCCGGCCCAAGNONE 
J075051I04TGTTGGGCCGGCCCAAGNONE 
J075073L04TGTTGGGCCGGCCCAAGNONE 
J075077E03TGTTGGGCCGGCCCAAGNONE 
J075083J11TGTTGGGCCGGCCCAAGNONE 
J075094J22TGTTGGGCCGGCCCAAGNONE 
J075112E08TGTTGGGCCGGCCCAAGNONE 
J075137J23TGTTGGGCCGGCCCAAGNONE 
J075192E02TGTTGGGCCGGCCCAAGNONE 
J100039K04TGTTGGGCCGGCCCAAGNONE 
Os09g0364500J100031B16AAAGCCCAACAGTP-binding protein, HSR1-related domain containing protein. 
J100052H07AAAGCCCAACANONE 
J100078G03AAAGCCCAACANONE 
Os09g0397100J075141L14CAAGGCCCAACANONE 
J100063H17CAAGGCCCAACAConserved hypothetical protein. 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0415000AK106390GCCCAACAConserved hypothetical protein. 
AK106636GCCCAACANONE 
Os09g0462300J065097M23TGTTGGGCTGTEsterase/lipase/thioesterase domain containing protein. 
J065161K12TGTTGGGCTGTNONE 
Os09g0471900AK073815CAAGGCCCAACABacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0510000AK121614GCAGCCCACTTGTTGGGCCTCConserved hypothetical protein. 
J033043O11GCAGCCCACTTGTTGGGCCTCNONE 
J065113F04GCAGCCCACTTGTTGGGCCTCNONE 
J080044D13GCAGCCCACTTGTTGGGCCTCNONE 
Os09g0516800009-017-A01AAAGCCCAACAConserved hypothetical protein. 
Os09g0532600J013002F02TGTTGGGCNONE 
Os09g0532800J065167K16TGTTGGGCCAAProtein prenyltransferase domain containing protein. 
Os09g0537600006-054-B05AGTGGGCCCAACANONE 
AK061004AGTGGGCCCAACASimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20AGTGGGCCCAACANONE 
J075029H16AGTGGGCCCAACANONE 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os09g0571400AK103109ACAGCCCAACACyclophilin 1. 
J023011A12ACAGCCCAACANONE 
J033119A20ACAGCCCAACANONE 
J053034N16ACAGCCCAACANONE 
J053045N23ACAGCCCAACANONE 
J053052J12ACAGCCCAACANONE 
J053052K04ACAGCCCAACANONE 
J053099M15ACAGCCCAACANONE 
J065071H23ACAGCCCAACANONE 
J065131B16ACAGCCCAACANONE 
J075003F19ACAGCCCAACANONE 
J075116F02ACAGCCCAACANONE 
J075126G05ACAGCCCAACANONE 
J075145E09ACAGCCCAACANONE 
J075149O22ACAGCCCAACANONE 
J075163A09ACAGCCCAACANONE 
J075194A09ACAGCCCAACANONE 
L29471ACAGCCCAACANONE 
Os11g0131200J065024D18AGCCCAACAMpv17/PMP22 family protein. 
J065206C17AGCCCAACANONE 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
Os11g0153700AK058576TAGGCCCATATGTGGGCCCAACASimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0167300AK071335GGGGCCCAACAProtein of unknown function DUF537 family protein. 
AK101314GGGGCCCAACANONE 
Os11g0175500015-087-F02TCAGCCCAACANONE 
AK064320TCAGCCCAACAZinc finger, RING-type domain containing protein. 
AK101592TCAGCCCAACANONE 
Os11g0227600AK101375GAAGCCCAACAConserved hypothetical protein. 
AK102193GAAGCCCAACANONE 
J033087C03GAAGCCCAACANONE 
Os11g0244200AK107883TGTTGGGCCTASimilar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment). 
Os11g0482000006-056-D12CCCGGCCCGGCCCAACANONE 
006-102-C10CCCGGCCCGGCCCAACANONE 
009-005-E07CCCGGCCCGGCCCAACANONE 
014-088-D03CCCGGCCCGGCCCAACANONE 
AK059558CCCGGCCCGGCCCAACASimilar to 40S ribosomal protein S5-1. 
AK103918CCCGGCCCGGCCCAACANONE 
Os11g0483900AK070344TGTTGGGCEngulfment and cell motility, ELM domain containing protein. 
Os11g0549690J065085G07CCAGCCCAACAConserved hypothetical protein. 
J065085G07CCAGCCCAACAConserved hypothetical protein. 
J065218B08CCAGCCCAACANONE 
J065218B08CCAGCCCAACANONE 
J090036H16CCAGCCCAACANONE 
J090036H16CCAGCCCAACANONE 
Os11g0617800009-105-D10CACGGCCCATTCTGGCCCAACANONE 
AK062778CACGGCCCATTCTGGCCCAACAConserved hypothetical protein. 
Os11g0630900AK107482GCCGGCCCAACAMATH domain containing protein. 
Os12g0123900016-031-A06AAAAGCCCAACANONE 
AK061862AAAAGCCCAACAHypothetical protein. 
J013031P10AAAAGCCCAACANONE 
J053034P22AAAAGCCCAACANONE 
J053046O16AAAAGCCCAACANONE 
J053048D20AAAAGCCCAACANONE 
J090031I07AAAAGCCCAACANONE 
J100025B02AAAAGCCCAACANONE 
Os12g0146300J065162K17TGTTGGGCTTTACATGGGCCGAGHypothetical protein. 
Os12g0168700AK065708CCAGGCCCAACAAMP-dependent synthetase and ligase domain containing protein. 
AK065718CCAGGCCCAACANONE 
Os12g0223700J075049J03TGTTGGGCTGGHypothetical protein. 
J075101F23TGTTGGGCTGGNONE 
Os12g0411700AK067639GCCCAACAABC transporter related domain containing protein. 
J080005L02GCCCAACANONE 
J080009H17GCCCAACANONE 
J080025L24GCCCAACANONE 
J080063F18GCCCAACANONE 
J080086M05GCCCAACANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.