version

Summary of OsREG595 (All List)

OrganismOryza sativa  
IDOsREG595  
SequenceGCCCAACC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1108  

Entry Sequences (1108 entries)

LocusGene modelSequenceDescription
Os01g0172000012-070-G06GGTTGGGCCGGANONE 
AK068405GGTTGGGCCGGAALG3 family protein. 
J013149A07GGTTGGGCCGGANONE 
J053047H05GGTTGGGCCGGANONE 
J065075N03GGTTGGGCCGGANONE 
J065093G22GGTTGGGCCGGANONE 
J065130N21GGTTGGGCCGGANONE 
J065143P05GGTTGGGCCGGANONE 
J065216H07GGTTGGGCCGGANONE 
J075013B06GGTTGGGCCGGANONE 
J075196M05GGTTGGGCCGGANONE 
J100039G24GGTTGGGCCGGANONE 
J100041B11GGTTGGGCCGGANONE 
J100069A16GGTTGGGCCGGANONE 
J100069L12GGTTGGGCCGGANONE 
J100074P16GGTTGGGCCGGANONE 
Os01g0188200015-013-B12GGTTGGGCTGGCCGGGCCGNONE 
Os01g0219500AK106863GCCCAACCNONE 
AK109524GCCCAACCPlant lipid transfer protein/Par allergen family protein. 
J075053J18GCCCAACCNONE 
J080023G09GCCCAACCNONE 
J080051F19GCCCAACCNONE 
J080085H15GCCCAACCNONE 
Os01g0257100J100030B03CCAGCCCAACCAACGGTCNONE 
J100046K16CCAGCCCAACCAACGGTCRapid ALkalinization Factor family protein. 
Os01g0276700011-014-A12CCTCGCCCAACCNONE 
012-092-G12CCTCGCCCAACCNONE 
AK103164CCTCGCCCAACCNONE 
AK103465CCTCGCCCAACCSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CCTCGCCCAACCNONE 
J023084I02CCTCGCCCAACCNONE 
J033027F20CCTCGCCCAACCNONE 
J033029M06CCTCGCCCAACCNONE 
J033039K13CCTCGCCCAACCNONE 
J033057C24CCTCGCCCAACCNONE 
J033058G20CCTCGCCCAACCNONE 
J033060A14CCTCGCCCAACCNONE 
J033061M21CCTCGCCCAACCNONE 
J033068M10CCTCGCCCAACCNONE 
J033074K16CCTCGCCCAACCNONE 
J033076C11CCTCGCCCAACCNONE 
J033093O13CCTCGCCCAACCNONE 
J033119H20CCTCGCCCAACCNONE 
J033121D22CCTCGCCCAACCNONE 
J033129N11CCTCGCCCAACCNONE 
J033131E12CCTCGCCCAACCNONE 
J033150L07CCTCGCCCAACCNONE 
J053024N17CCTCGCCCAACCNONE 
J053034G19CCTCGCCCAACCNONE 
J053035E18CCTCGCCCAACCNONE 
J053046M01CCTCGCCCAACCNONE 
J053047P04CCTCGCCCAACCNONE 
J053048B06CCTCGCCCAACCNONE 
J053050M22CCTCGCCCAACCNONE 
J053053E09CCTCGCCCAACCNONE 
J053053I07CCTCGCCCAACCNONE 
J053059K03CCTCGCCCAACCNONE 
J053059P12CCTCGCCCAACCNONE 
J053060C12CCTCGCCCAACCNONE 
J053060H24CCTCGCCCAACCNONE 
J053064D19CCTCGCCCAACCNONE 
J053066L15CCTCGCCCAACCNONE 
J053073I02CCTCGCCCAACCNONE 
J053083E15CCTCGCCCAACCNONE 
J053094D05CCTCGCCCAACCNONE 
J053094P18CCTCGCCCAACCNONE 
J053095C15CCTCGCCCAACCNONE 
J053095C21CCTCGCCCAACCNONE 
J053099N16CCTCGCCCAACCNONE 
J090025O19CCTCGCCCAACCNONE 
J090049N22CCTCGCCCAACCNONE 
J090050F17CCTCGCCCAACCNONE 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
Os01g0303300J053035N19AAAGCCCAACCNONE 
J075042F02AAAGCCCAACCNONE 
J075068E10AAAGCCCAACCNONE 
J075116E19AAAGCCCAACCNONE 
J075131C10AAAGCCCAACCNONE 
J075145J11AAAGCCCAACCNONE 
J075157P20AAAGCCCAACCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12AAAGCCCAACCNONE 
Os01g0350900AK070217GGTTGGGCTTGSimilar to VIP2 protein. 
J065165D23GGTTGGGCTTGNONE 
Os01g0546900AK073801GAGGCCCAACCTranscription factor jumonji/aspartyl beta-hydroxylase domain containing protein. 
Os01g0551000006-104-A04CCCAGCCCGGCCCAACCNONE 
009-183-B08CCCAGCCCGGCCCAACCNONE 
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein. 
AK106034CCCAGCCCGGCCCAACCNONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0618500011-019-D03ATTGGGCCAGGTTGGGCCATNONE 
AK067476ATTGGGCCAGGTTGGGCCATSimilar to RNA helicase (Fragment). 
J013020E19ATTGGGCCAGGTTGGGCCATNONE 
J033046J12ATTGGGCCAGGTTGGGCCATNONE 
J033055D06ATTGGGCCAGGTTGGGCCATNONE 
Os01g0621700AK108938GACGGCCCAACCMyosin tail 2 domain containing protein. 
J100033P13GACGGCCCAACCNONE 
Os01g0710800013-097-E05GGTTGGGCTTGAAGCCCAACNONE 
AK069973GGTTGGGCTTGAAGCCCAACNONE 
AK071099GGTTGGGCTTGAAGCCCAACConserved hypothetical protein. 
J023081K01GGTTGGGCTTGAAGCCCAACNONE 
J023123E16GGTTGGGCTTGAAGCCCAACNONE 
J033066B11GGTTGGGCTTGAAGCCCAACNONE 
J065144G11GGTTGGGCTTGAAGCCCAACNONE 
Os01g0748150J075112I15GCCCAACCCupredoxin domain containing protein. 
J075161H07GCCCAACCNONE 
Os01g0749400AK064990AGCCCAACCNONE 
AK067731AGCCCAACCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775AGCCCAACCNONE 
J023001B06AGCCCAACCNONE 
Os01g0772900011-075-G09GGTTGGGCNONE 
012-036-F01GGTTGGGCNONE 
AK073362GGTTGGGCSimilar to Homocysteine S-methyltransferase 4 (EC 2.1.1.10) (S- methylmethionine:homocysteine methyltransferase 4) (SMM:Hcy S- methyltransferase 4) (ZmHMT-4). 
AK104962GGTTGGGCNONE 
J065037B16GGTTGGGCNONE 
J065037K23GGTTGGGCNONE 
J065079D01GGTTGGGCNONE 
J065104G12GGTTGGGCNONE 
J065156B20GGTTGGGCNONE 
J065167M15GGTTGGGCNONE 
J065208K17GGTTGGGCNONE 
J075076H13GGTTGGGCNONE 
J075078M13GGTTGGGCNONE 
J075093L21GGTTGGGCNONE 
J075124L10GGTTGGGCNONE 
Os01g0800300006-097-C12ATGGCCCAACCNONE 
014-070-C12ATGGCCCAACCNONE 
AK072549ATGGCCCAACCNONE 
AK100942ATGGCCCAACCNONE 
AK100951ATGGCCCAACCConserved hypothetical protein. 
AK106023ATGGCCCAACCNONE 
J023138D05ATGGCCCAACCNONE 
J075097P16ATGGCCCAACCNONE 
J075099F23ATGGCCCAACCNONE 
Os01g0840100006-095-C03GGTTGGGCTGCNONE 
011-075-F07GGTTGGGCTGCNONE 
012-010-A08GGTTGGGCTGCNONE 
012-035-A09GGTTGGGCTGCNONE 
014-010-B01GGTTGGGCTGCNONE 
014-011-H07GGTTGGGCTGCNONE 
014-040-F03GGTTGGGCTGCNONE 
014-077-C11GGTTGGGCTGCNONE 
014-078-C11GGTTGGGCTGCNONE 
014-097-A10GGTTGGGCTGCNONE 
014-097-D02GGTTGGGCTGCNONE 
014-100-D02GGTTGGGCTGCNONE 
015-012-H01GGTTGGGCTGCNONE 
015-049-G07GGTTGGGCTGCNONE 
015-066-C09GGTTGGGCTGCNONE 
016-033-C09GGTTGGGCTGCHeat shock protein Hsp70 family protein. 
016-084-F08GGTTGGGCTGCNONE 
J023037O13GGTTGGGCTGCNONE 
J033116B07GGTTGGGCTGCNONE 
J033121N13GGTTGGGCTGCNONE 
J065057F16GGTTGGGCTGCNONE 
J065112D05GGTTGGGCTGCNONE 
J065157G17GGTTGGGCTGCNONE 
J090014O03GGTTGGGCTGCNONE 
J090015K13GGTTGGGCTGCNONE 
J090021I21GGTTGGGCTGCNONE 
J090048D02GGTTGGGCTGCNONE 
J090054D14GGTTGGGCTGCNONE 
J090060J03GGTTGGGCTGCNONE 
J090063G01GGTTGGGCTGCNONE 
J090063H04GGTTGGGCTGCNONE 
J090063L13GGTTGGGCTGCNONE 
J090074E03GGTTGGGCTGCNONE 
J090096A03GGTTGGGCTGCNONE 
J090096I11GGTTGGGCTGCNONE 
J090099E16GGTTGGGCTGCNONE 
J100050G20GGTTGGGCTGCNONE 
Os01g0876500J053026A07AGGGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17AGGGCCCAACCNONE 
Os01g0880300003-107-C05GCCCATTTGCCCAACCNONE 
AK101962GCCCATTTGCCCAACCSimilar to Pectin methylesterase-like protein. 
AK105682GCCCATTTGCCCAACCNONE 
Os01g0913100AK070387GGTTGGGCProtein of unknown function DUF538 family protein. 
J100090K15GGTTGGGCNONE 
Os01g0929000AK073334GCCCAACCConserved hypothetical protein. 
J033024D22GCCCAACCNONE 
Os01g0962400AK059165AGCCCAACCProtein of unknown function UPF0185 family protein. 
J013157N02AGCCCAACCNONE 
J065169F13AGCCCAACCNONE 
J065192L21AGCCCAACCNONE 
J075016P11AGCCCAACCNONE 
J075023M14AGCCCAACCNONE 
J075051K17AGCCCAACCNONE 
J075053O05AGCCCAACCNONE 
J075080D08AGCCCAACCNONE 
J075080P04AGCCCAACCNONE 
J075088B19AGCCCAACCNONE 
J075137L06AGCCCAACCNONE 
J100029C08AGCCCAACCNONE 
J100067J09AGCCCAACCNONE 
Os02g0119700AK108777TCTGGCCCAACCProtein prenyltransferase domain containing protein. 
Os02g0148100AF216317GCCCAACCNONE 
AF241166GCCCAACCNONE 
AK119650GCCCAACCMAP kinase MAPK2 (MAP kinase 3). 
Os02g0167700AK069128AAAAGCCCAACCGCCCACCTArmadillo-like helical domain containing protein. 
Os02g0175800009-083-C02AGCCCAGCCCAACCNONE 
009-184-H07AGCCCAGCCCAACCNONE 
009-199-D07AGCCCAGCCCAACCNONE 
AK058292AGCCCAGCCCAACCNONE 
AK120215AGCCCAGCCCAACCConserved hypothetical protein. 
J013040G12AGCCCAGCCCAACCNONE 
J065050N21AGCCCAGCCCAACCNONE 
J065077O07AGCCCAGCCCAACCNONE 
J065102G05AGCCCAGCCCAACCNONE 
J065197A04AGCCCAGCCCAACCNONE 
J075024L24AGCCCAGCCCAACCNONE 
J075038K01AGCCCAGCCCAACCNONE 
J075044L04AGCCCAGCCCAACCNONE 
J075063D23AGCCCAGCCCAACCNONE 
J075079P13AGCCCAGCCCAACCNONE 
J075084G03AGCCCAGCCCAACCNONE 
J075135G07AGCCCAGCCCAACCNONE 
J075148D17AGCCCAGCCCAACCNONE 
J075150F13AGCCCAGCCCAACCNONE 
J075157F06AGCCCAGCCCAACCNONE 
J090054A05AGCCCAGCCCAACCNONE 
J090085O04AGCCCAGCCCAACCNONE 
J100023C04AGCCCAGCCCAACCNONE 
J100023H23AGCCCAGCCCAACCNONE 
J100026A16AGCCCAGCCCAACCNONE 
J100035K13AGCCCAGCCCAACCNONE 
Os02g0176400009-099-H11ACAGCCCAACCNONE 
009-099-H11AGCCCAACCAGGGCCCAAATNONE 
AK062746ACAGCCCAACCProtein of unknown function DUF872, eukaryotic family protein. 
AK062746AGCCCAACCAGGGCCCAAATProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0180100005-013-B11GAGGCCCAACCNONE 
AK067359GAGGCCCAACCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700GAGGCCCAACCNONE 
J013090O22GAGGCCCAACCNONE 
J013099P19GAGGCCCAACCNONE 
J090041M21GAGGCCCAACCNONE 
J090049C14GAGGCCCAACCNONE 
Os02g0190950J075001E02TTTTGGGCCCAACCConserved hypothetical protein. 
J075117E23TTTTGGGCCCAACCNONE 
J075117F23TTTTGGGCCCAACCNONE 
J075144M12TTTTGGGCCCAACCNONE 
J075145H10TTTTGGGCCCAACCNONE 
J075186B15TTTTGGGCCCAACCNONE 
Os02g0192700004-020-H12TAGGCCCAACCNONE 
006-024-H06TAGGCCCAACCNONE 
006-042-F06TAGGCCCAACCNONE 
006-050-D04TAGGCCCAACCNONE 
006-059-E10TAGGCCCAACCNONE 
006-070-B02TAGGCCCAACCNONE 
006-084-A09TAGGCCCAACCNONE 
006-114-E11TAGGCCCAACCNONE 
006-117-E05TAGGCCCAACCNONE 
009-126-D11TAGGCCCAACCNONE 
AK061629TAGGCCCAACCSimilar to Thioredoxin peroxidase. 
AK065909TAGGCCCAACCNONE 
J013043E11TAGGCCCAACCNONE 
J065038I09TAGGCCCAACCNONE 
J065078C12TAGGCCCAACCNONE 
J065122O14TAGGCCCAACCNONE 
J065198H04TAGGCCCAACCNONE 
Os02g0193500009-092-G09GCCCAACCNONE 
AK101237GCCCAACCHypothetical protein. 
J033031K13GCCCAACCNONE 
J033034P12GCCCAACCNONE 
J080304L19GCCCAACCNONE 
J100059N21GCCCAACCNONE 
Os02g0194000015-020-A08GGTTGGGCCCAATNONE 
AK064096GGTTGGGCCCAATMyb, DNA-binding domain containing protein. 
J090092L06GGTTGGGCCCAATNONE 
Os02g0256000AK108573GGTTGGGCCTGGConserved hypothetical protein. 
Os02g0266500AK100307GGTTGGGCCTCSimilar to RASPBERRY3. 
Os02g0321000AK121840ACAGCCCAACCTetratricopeptide-like helical domain containing protein. 
Os02g0452800J043024P15AGCCCAACCConserved hypothetical protein. 
Os02g0618250009-115-E10CCAGCCCAACCNONE 
014-076-A03CCAGCCCAACCNONE 
J065096D10CCAGCCCAACCSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CCAGCCCAACCNONE 
J075092J11CCAGCCCAACCNONE 
J075134F02CCAGCCCAACCNONE 
Os02g0621500AK120798TTTCGGCCCAACCZinc finger, RING-type domain containing protein. 
Os02g0628600J100044L04GCCCAACCTranscriptional factor B3 family protein. 
Os02g0634700AK071869AGCCCAACCNONE 
J013129B13AGCCCAACCNONE 
J013134D24AGCCCAACCNONE 
Os02g0639800006-081-G07GGTTGGGCTTTNONE 
012-042-E02GGTTGGGCTTTNONE 
AK070367GGTTGGGCTTTNONE 
AK071904GGTTGGGCTTTZinc finger, RING-type domain containing protein. 
AK105980GGTTGGGCTTTNONE 
Os02g0689700AK063776GAGGCCCAACCRibosomal protein L18P/L5E family protein. 
Os02g0697500AK105680AGCCCAACCSimilar to Selenium-binding protein-like. 
Os02g0723200AK108140GCGGCCCAACCSimilar to Alpha galactosyltransferase (Fragment). 
J090087D22GCGGCCCAACCNONE 
Os02g0752300AK072544AACGGCCCAACCConserved hypothetical protein. 
J023132N16AACGGCCCAACCNONE 
J033069F17AACGGCCCAACCNONE 
Os02g0758200AK111266GCGCGCGAGCCCAACCConserved hypothetical protein. 
Os02g0775900AK119974GGTTGGGCCGGAConserved hypothetical protein. 
Os02g0813600AK107210GGTTGGGCVery-long-chain 3-ketoacyl-CoA synthase family protein. 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os03g0116800AK068678GGTTGGGCNONE 
J013158H22GGTTGGGCNONE 
Os03g0124300AK069148CAAGCCCAACCConserved hypothetical protein. 
AK106076CAAGCCCAACCNONE 
J023003G19CAAGCCCAACCNONE 
Os03g0146500006-036-F10GCCCAACCNONE 
006-082-C03GCCCAACCNONE 
006-098-E04GCCCAACCNONE 
006-110-C03GCCCAACCNONE 
009-057-C11GCCCAACCNONE 
009-182-D02GCCCAACCNONE 
AK059776GCCCAACCGalactose-binding like domain containing protein. 
AK071628GCCCAACCNONE 
AK104105GCCCAACCNONE 
AK104220GCCCAACCNONE 
J065168B02GCCCAACCNONE 
Os03g0148700AK065978GCCCAACCSimilar to Calcium/calmodulin-regulated receptor-like kinase. 
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein. 
AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0151800AK064955AGCCCAACCNONE 
AK098874AGCCCAACCNONE 
AK098980AGCCCAACCNONE 
AK099712AGCCCAACCNONE 
AK099889AGCCCAACCNONE 
AK121641AGCCCAACCSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05AGCCCAACCNONE 
J013001D04AGCCCAACCNONE 
J013121O12AGCCCAACCNONE 
Os03g0161400Os03g0161400TCGGCCCAACCIQ calmodulin-binding region domain containing protein. 
Os03g0168100012-058-G09GCCCAACCNONE 
014-008-F07GCCCAACCNONE 
015-084-D03GCCCAACCNONE 
AK121575GCCCAACCLate embryogenesis abundant protein repeat containing protein. 
J033024H14GCCCAACCNONE 
J033036H02GCCCAACCNONE 
J033044I19GCCCAACCNONE 
J033098F11GCCCAACCNONE 
J033125I22GCCCAACCNONE 
J033128N18GCCCAACCNONE 
J033132L19GCCCAACCNONE 
J033149G13GCCCAACCNONE 
J075052I19GCCCAACCNONE 
J075099H16GCCCAACCNONE 
J075099P11GCCCAACCNONE 
J075122I20GCCCAACCNONE 
J075172K14GCCCAACCNONE 
J075188H01GCCCAACCNONE 
Os03g0178400AK108257GCCCAACCEpoxide hydrolase family protein. 
Os03g0181100AK067971GCCCAACCGCACCGCACNONE 
AK120087GCCCAACCGCACCGCACZIM domain containing protein. 
J013123K19GCCCAACCGCACCGCACNONE 
J100077H14GCCCAACCGCACCGCACNONE 
Os03g0197400AK071413AAGGCCCAACCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905AAGGCCCAACCNONE 
J053023D18AAGGCCCAACCNONE 
Os03g0198400AK059522GGTTGGGCTGTNONE 
AK103101GGTTGGGCTGTSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19GGTTGGGCTGTNONE 
J075036K08GGTTGGGCTGTNONE 
J075040J23GGTTGGGCTGTNONE 
J075041H18GGTTGGGCTGTNONE 
J075053H18GGTTGGGCTGTNONE 
J075055K15GGTTGGGCTGTNONE 
J075111K03GGTTGGGCTGTNONE 
J075125B22GGTTGGGCTGTNONE 
J075195L10GGTTGGGCTGTNONE 
Os03g0211900AK059280GCCCAACCLeucine rich repeat, N-terminal domain containing protein. 
AK121380GCCCAACCNONE 
J033102D09GCCCAACCNONE 
J053089G04GCCCAACCNONE 
J065138D22GCCCAACCNONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0268300AK102684TAGGCCCAAGCCCAACCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TAGGCCCAAGCCCAACCNONE 
J013057J23TAGGCCCAAGCCCAACCNONE 
J013149I10TAGGCCCAAGCCCAACCNONE 
J013149M20TAGGCCCAAGCCCAACCNONE 
J013151D14TAGGCCCAAGCCCAACCNONE 
J013162O11TAGGCCCAAGCCCAACCNONE 
J023001F12TAGGCCCAAGCCCAACCNONE 
J023031B21TAGGCCCAAGCCCAACCNONE 
J023080A07TAGGCCCAAGCCCAACCNONE 
J023081N04TAGGCCCAAGCCCAACCNONE 
J023090C08TAGGCCCAAGCCCAACCNONE 
J023134G05TAGGCCCAAGCCCAACCNONE 
J023139G17TAGGCCCAAGCCCAACCNONE 
J023143I10TAGGCCCAAGCCCAACCNONE 
J023147D04TAGGCCCAAGCCCAACCNONE 
J023147O15TAGGCCCAAGCCCAACCNONE 
J033102K23TAGGCCCAAGCCCAACCNONE 
J033106C17TAGGCCCAAGCCCAACCNONE 
J075033G19TAGGCCCAAGCCCAACCNONE 
J075039J18TAGGCCCAAGCCCAACCNONE 
J075050K20TAGGCCCAAGCCCAACCNONE 
J075075J03TAGGCCCAAGCCCAACCNONE 
J075080E16TAGGCCCAAGCCCAACCNONE 
J075086L08TAGGCCCAAGCCCAACCNONE 
J075091K19TAGGCCCAAGCCCAACCNONE 
J075099O20TAGGCCCAAGCCCAACCNONE 
J075104I06TAGGCCCAAGCCCAACCNONE 
J075137C16TAGGCCCAAGCCCAACCNONE 
J075152G03TAGGCCCAAGCCCAACCNONE 
J075176N12TAGGCCCAAGCCCAACCNONE 
J100086K11TAGGCCCAAGCCCAACCNONE 
Os03g0287900009-074-B07TCCGGGCCAGCCCAACCNONE 
014-027-E07TCCGGGCCAGCCCAACCNONE 
AK063663TCCGGGCCAGCCCAACCSimilar to Protein disulfide isomerase. 
J065009N21TCCGGGCCAGCCCAACCNONE 
Os03g0305500AK070638GGTTGGGCCTTArgininosuccinate lyase domain containing protein. 
Os03g0335300AK098846TAAGCCCAACCNONE 
AK098891TAAGCCCAACCNONE 
AK111509TAAGCCCAACCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847TAAGCCCAACCNONE 
AK121413TAAGCCCAACCNONE 
Os03g0341100009-012-D06TTGGCCCAACCNONE 
AK121580TTGGCCCAACCSimilar to 60S ribosomal protein L18. 
J033037B18TTGGCCCAACCNONE 
J053090K21TTGGCCCAACCNONE 
J065040D12TTGGCCCAACCNONE 
J075106P15TTGGCCCAACCNONE 
J075117P13TTGGCCCAACCNONE 
J075128N02TTGGCCCAACCNONE 
J090031L12TTGGCCCAACCNONE 
J100023E19TTGGCCCAACCNONE 
J100033O21TTGGCCCAACCNONE 
J100070A12TTGGCCCAACCNONE 
J100087M20TTGGCCCAACCNONE 
Os03g0372700AK064323GGTTGGGCCGAAANONE 
AK073312GGTTGGGCCGAAALow temperature viability protein family protein. 
Os03g0393900AK069809AGCCGTTGGTTGGGCSimilar to S.tuberosum patatin (Fragment). 
J023030J03AGCCGTTGGTTGGGCNONE 
Os03g0405100AK108624CCGTGGGCCCAACCRpsU-divergently transcribed family protein. 
Os03g0411500AK058696CCCAGCCCAGCCCAACCNONE 
AK071057CCCAGCCCAGCCCAACCPeptidase S14, ClpP family protein. 
Os03g0576900AK071314AAGGCCCAACCAmino acid/polyamine transporter I family protein. 
J023074L08AAGGCCCAACCNONE 
J023084D13AAGGCCCAACCNONE 
J080011C14AAGGCCCAACCNONE 
J080012F24AAGGCCCAACCNONE 
J080018M05AAGGCCCAACCNONE 
J080021G05AAGGCCCAACCNONE 
J080021N18AAGGCCCAACCNONE 
J080023E19AAGGCCCAACCNONE 
J080024H14AAGGCCCAACCNONE 
J080025E15AAGGCCCAACCNONE 
J080038F19AAGGCCCAACCNONE 
J080044N09AAGGCCCAACCNONE 
J080054D05AAGGCCCAACCNONE 
J080057J16AAGGCCCAACCNONE 
J080060A05AAGGCCCAACCNONE 
J080061M12AAGGCCCAACCNONE 
J080063H13AAGGCCCAACCNONE 
J080065O04AAGGCCCAACCNONE 
J080066I17AAGGCCCAACCNONE 
J080066J06AAGGCCCAACCNONE 
J080089J22AAGGCCCAACCNONE 
J080090I03AAGGCCCAACCNONE 
J080091J23AAGGCCCAACCNONE 
J080091K20AAGGCCCAACCNONE 
J080093G24AAGGCCCAACCNONE 
J080094I08AAGGCCCAACCNONE 
J080096A17AAGGCCCAACCNONE 
J090051G12AAGGCCCAACCNONE 
Os03g0577000012-055-F04AGGGCCCAACCCGCGCNONE 
AK061051AGGGCCCAACCCGCGCSimilar to Ribosomal protein S3 (Fragment). 
AK099146AGGGCCCAACCCGCGCNONE 
J065060A01AGGGCCCAACCCGCGCNONE 
J075079B17AGGGCCCAACCCGCGCNONE 
J075134K12AGGGCCCAACCCGCGCNONE 
J090048F23AGGGCCCAACCCGCGCNONE 
J090072I19AGGGCCCAACCCGCGCNONE 
J100087C19AGGGCCCAACCCGCGCNONE 
J100090C21AGGGCCCAACCCGCGCNONE 
Os03g0647800003-103-H03TCAGCCCAACCNONE 
006-104-G09TCAGCCCAACCNONE 
AK070243TCAGCCCAACCConserved hypothetical protein. 
J100056F22TCAGCCCAACCNONE 
Os03g0669000AK067769GGTTGGGCSimilar to RNA helicase (Fragment). 
AK099820GGTTGGGCNONE 
Os03g0688200015-014-E12GCCCAACCNONE 
AK103539GCCCAACCConserved hypothetical protein. 
Os03g0699200005-016-G07TCAGCCCAACCCAAGGCCCNONE 
AK066652TCAGCCCAACCCAAGGCCCPescadillo, N-terminal domain containing protein. 
AK099383TCAGCCCAACCCAAGGCCCNONE 
J013069A12TCAGCCCAACCCAAGGCCCNONE 
J033085M11TCAGCCCAACCCAAGGCCCNONE 
J033111P09TCAGCCCAACCCAAGGCCCNONE 
J033128H17TCAGCCCAACCCAAGGCCCNONE 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
Os03g0745000AK109590GGTTGGGCNONE 
AY332465GGTTGGGCNONE 
AY344486GGTTGGGCNONE 
AY998118GGTTGGGCWinged helix repressor DNA-binding domain containing protein. 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0782500AK105637GCCCAACCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0791800013-037-A12GGTTGGGCCCCNONE 
AB079798GGTTGGGCCCCNONE 
AK067703GGTTGGGCCCCRad6 (Ubiquitin carrier protein). 
AK120251GGTTGGGCCCCNONE 
J013045G10GGTTGGGCCCCNONE 
J023102B18GGTTGGGCCCCNONE 
J065020J23GGTTGGGCCCCNONE 
J065127I21GGTTGGGCCCCNONE 
J065151E11GGTTGGGCCCCNONE 
J075076B05GGTTGGGCCCCNONE 
J075116C15GGTTGGGCCCCNONE 
J075136A07GGTTGGGCCCCNONE 
J100029G21GGTTGGGCCCCNONE 
J100030K01GGTTGGGCCCCNONE 
J100041J02GGTTGGGCCCCNONE 
J100049C22GGTTGGGCCCCNONE 
J100057G17GGTTGGGCCCCNONE 
J100086L12GGTTGGGCCCCNONE 
Os03g0794800AK070933AGCCCAACCSimilar to XRN3. 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0828100009-088-D04TAGGCCCAACCNONE 
009-125-F01TAGGCCCAACCNONE 
009-169-C06TAGGCCCAACCNONE 
AK059132TAGGCCCAACCNONE 
AK062799TAGGCCCAACCNONE 
AK099043TAGGCCCAACCSimilar to 50S ribosomal protein L18. 
J013146D01TAGGCCCAACCNONE 
J065057J16TAGGCCCAACCNONE 
Os03g0844100AK067164CCAGCCCAACCSimilar to Pti1 kinase-like protein. 
Os04g0195100AK107201GGTTGGGCCATCyclin-like F-box domain containing protein. 
Os04g0208500015-079-C10TTGGCCCAACCNONE 
AK106410TTGGCCCAACCCyclin-like F-box domain containing protein. 
Os04g0313300AK121730GCCCAACCConserved hypothetical protein. 
J033082F07GCCCAACCNONE 
Os04g0337500AK061807GGTTGGGCTTANONE 
Os04g0438600AK065524GCCCAACCConserved hypothetical protein. 
J013031N02GCCCAACCNONE 
J065132H21GCCCAACCNONE 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0552700AK121993GGTTGGGCTTGGZinc finger, C2H2-type domain containing protein. 
J053047K15GGTTGGGCTTGGNONE 
Os04g0558700AK110633GCCCAACCConserved hypothetical protein. 
Os04g0561700AK067397GCCCAACCConserved hypothetical protein. 
Os04g0582900J100040F01GGTTGGGCConserved hypothetical protein. 
Os04g0637500AK108202AGCCCAACCMitochodrial transcription termination factor-related family protein. 
J065163A11AGCCCAACCNONE 
Os04g0639100009-158-D03CGCGTCGCCCAACCNONE 
AK063036CGCGTCGCCCAACCConserved hypothetical protein. 
J075045D14CGCGTCGCCCAACCNONE 
J075047L16CGCGTCGCCCAACCNONE 
J075048D20CGCGTCGCCCAACCNONE 
J075056E20CGCGTCGCCCAACCNONE 
J075074E14CGCGTCGCCCAACCNONE 
J075108F16CGCGTCGCCCAACCNONE 
J075143L19CGCGTCGCCCAACCNONE 
J075146L07CGCGTCGCCCAACCNONE 
J075158I04CGCGTCGCCCAACCNONE 
J075172B20CGCGTCGCCCAACCNONE 
J090061M08CGCGTCGCCCAACCNONE 
Os05g0113000AK067079CAAGTGGGCCCAACCAmino acid-binding ACT domain containing protein. 
Os05g0121000009-181-E02GTTTGGGCCCACTAGGCCCAACCNONE 
AK058867GTTTGGGCCCACTAGGCCCAACCNONE 
AK071341GTTTGGGCCCACTAGGCCCAACCProtein of unknown function DUF1218 family protein. 
J023024H24GTTTGGGCCCACTAGGCCCAACCNONE 
J023090B22GTTTGGGCCCACTAGGCCCAACCNONE 
J023111G15GTTTGGGCCCACTAGGCCCAACCNONE 
J023134K14GTTTGGGCCCACTAGGCCCAACCNONE 
J033057C05GTTTGGGCCCACTAGGCCCAACCNONE 
J033067J15GTTTGGGCCCACTAGGCCCAACCNONE 
J033084L15GTTTGGGCCCACTAGGCCCAACCNONE 
J033088B04GTTTGGGCCCACTAGGCCCAACCNONE 
J043027A08GTTTGGGCCCACTAGGCCCAACCNONE 
J043029L03GTTTGGGCCCACTAGGCCCAACCNONE 
J053031K22GTTTGGGCCCACTAGGCCCAACCNONE 
J053046I01GTTTGGGCCCACTAGGCCCAACCNONE 
J053070B05GTTTGGGCCCACTAGGCCCAACCNONE 
J053072C10GTTTGGGCCCACTAGGCCCAACCNONE 
J065097M22GTTTGGGCCCACTAGGCCCAACCNONE 
J065164I17GTTTGGGCCCACTAGGCCCAACCNONE 
J075058I08GTTTGGGCCCACTAGGCCCAACCNONE 
J075064C09GTTTGGGCCCACTAGGCCCAACCNONE 
J080304C16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304H16GTTTGGGCCCACTAGGCCCAACCNONE 
J080306E17GTTTGGGCCCACTAGGCCCAACCNONE 
J080310L03GTTTGGGCCCACTAGGCCCAACCNONE 
J080316J07GTTTGGGCCCACTAGGCCCAACCNONE 
J080317L23GTTTGGGCCCACTAGGCCCAACCNONE 
J080319A10GTTTGGGCCCACTAGGCCCAACCNONE 
J090060F01GTTTGGGCCCACTAGGCCCAACCNONE 
J100042N16GTTTGGGCCCACTAGGCCCAACCNONE 
J100047F05GTTTGGGCCCACTAGGCCCAACCNONE 
J100075J19GTTTGGGCCCACTAGGCCCAACCNONE 
Os05g0121500006-117-B10GGTTGGGCCATNONE 
009-059-D04GGTTGGGCCATNONE 
J065066C12GGTTGGGCCATConserved hypothetical protein. 
J075013I12GGTTGGGCCATNONE 
J090046D18GGTTGGGCCATNONE 
Os05g0140800AK110652CCAGCCCAACCSimilar to Dormancy related protein (Fragment). 
J075019K14CCAGCCCAACCNONE 
J075020O11CCAGCCCAACCNONE 
J075028P06CCAGCCCAACCNONE 
J075050A16CCAGCCCAACCNONE 
J075051F18CCAGCCCAACCNONE 
J075085K03CCAGCCCAACCNONE 
J075112P22CCAGCCCAACCNONE 
J075118I09CCAGCCCAACCNONE 
J075144H09CCAGCCCAACCNONE 
J075166I07CCAGCCCAACCNONE 
J075191J02CCAGCCCAACCNONE 
J075195I23CCAGCCCAACCNONE 
Os05g0148300009-031-A08CCCAGCCCAACCNONE 
AK062421CCCAGCCCAACCRibosomal protein S27, mitochondrial family protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0465100AK065821AGCCCAACCRabGAP/TBC domain containing protein. 
Os05g0478200J023113C02GCCCAACCTGGCCCACCANONE 
J023150G23GCCCAACCTGGCCCACCANONE 
J033101K13GCCCAACCTGGCCCACCANONE 
Os05g0480700AK100850GGTTGGGCCCATCTSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11GGTTGGGCCCATCTNONE 
Os05g0482400AK109526GCAGCCCAACCCytochrome P450 family protein. 
Os05g0490200016-097-B03CCAGCCCAACCNONE 
AK101147CCAGCCCAACCProtein of unknown function DUF1692 domain containing protein. 
AK105601CCAGCCCAACCNONE 
J033026P06CCAGCCCAACCNONE 
Os05g0509200AK061566GCCCAACCNADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007GCCCAACCNONE 
AK100226GCCCAACCNONE 
J013114B12GCCCAACCNONE 
J023048D09GCCCAACCNONE 
Os05g0524400AK063963AGCCCAACCNONE 
AK072857AGCCCAACCPhosphofructokinase family protein. 
Os05g0531700AK110982GGTTGGGCTGTConserved hypothetical protein. 
Os05g0553400AK108452CTGGGGCCCAACCSimilar to Myb-related transcription factor-like protein (MYB transcription factor). 
Os05g0561500006-066-D12GGTTGGGCCTGGNONE 
AK061788GGTTGGGCCTGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862GGTTGGGCCTGGNONE 
J013000O09GGTTGGGCCTGGNONE 
J033145C24GGTTGGGCCTGGNONE 
Os05g0564400006-023-A05GTGGCCCAACCNONE 
AK073075GTGGCCCAACCSimilar to GTP-binding protein. 
AK109344GTGGCCCAACCNONE 
Os05g0565200004-015-E06AAGGCCCAACCNONE 
004-015-E06AAGGCCCAACCNONE 
004-015-E06GAGGCCCAACCNONE 
004-015-E06TCCGGCCCAACCNONE 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090GAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090TCCGGCCCAACCSimilar to Urease accessory protein G. 
AK104200AAGGCCCAACCNONE 
AK104200AAGGCCCAACCNONE 
AK104200GAGGCCCAACCNONE 
AK104200TCCGGCCCAACCNONE 
AK104368AAGGCCCAACCNONE 
AK104368AAGGCCCAACCNONE 
AK104368GAGGCCCAACCNONE 
AK104368TCCGGCCCAACCNONE 
Os05g0571600Os05g0571600TTTCGGCCCAACCConserved hypothetical protein. 
Os06g0104000AK068490GGTTGGGCConserved hypothetical protein. 
Os06g0113900AK067430CCCAGCCCAACCNONE 
AK102259CCCAGCCCAACCNONE 
AK120464CCCAGCCCAACCConserved hypothetical protein. 
J065144I06CCCAGCCCAACCNONE 
Os06g0124900009-128-B12CCAGGCCCAAGCCCAACCNONE 
009-128-B12GGTTGGGCCAGNONE 
009-186-H09CCAGGCCCAAGCCCAACCNONE 
009-186-H09GGTTGGGCCAGNONE 
AK062901CCAGGCCCAAGCCCAACCConserved hypothetical protein. 
AK062901GGTTGGGCCAGConserved hypothetical protein. 
J013056D13CCAGGCCCAAGCCCAACCNONE 
J013056D13GGTTGGGCCAGNONE 
J013056D17CCAGGCCCAAGCCCAACCNONE 
J013056D17GGTTGGGCCAGNONE 
J013066A13CCAGGCCCAAGCCCAACCNONE 
J013066A13GGTTGGGCCAGNONE 
J013066C03CCAGGCCCAAGCCCAACCNONE 
J013066C03GGTTGGGCCAGNONE 
J013066F01CCAGGCCCAAGCCCAACCNONE 
J013066F01GGTTGGGCCAGNONE 
J023078D03CCAGGCCCAAGCCCAACCNONE 
J023078D03GGTTGGGCCAGNONE 
J033113N02CCAGGCCCAAGCCCAACCNONE 
J033113N02GGTTGGGCCAGNONE 
J065019F09CCAGGCCCAAGCCCAACCNONE 
J065019F09GGTTGGGCCAGNONE 
J065048C21CCAGGCCCAAGCCCAACCNONE 
J065048C21GGTTGGGCCAGNONE 
J065077L13CCAGGCCCAAGCCCAACCNONE 
J065077L13GGTTGGGCCAGNONE 
J065082J09CCAGGCCCAAGCCCAACCNONE 
J065082J09GGTTGGGCCAGNONE 
J065113H16CCAGGCCCAAGCCCAACCNONE 
J065113H16GGTTGGGCCAGNONE 
J065147A20CCAGGCCCAAGCCCAACCNONE 
J065147A20GGTTGGGCCAGNONE 
J065180A13CCAGGCCCAAGCCCAACCNONE 
J065180A13GGTTGGGCCAGNONE 
J065198M18CCAGGCCCAAGCCCAACCNONE 
J065198M18GGTTGGGCCAGNONE 
J065207K19CCAGGCCCAAGCCCAACCNONE 
J065207K19GGTTGGGCCAGNONE 
J075109H13CCAGGCCCAAGCCCAACCNONE 
J075109H13GGTTGGGCCAGNONE 
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0134800014-049-H04AGCCCAACCNONE 
AK063692AGCCCAACCGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0159400AK101286GGTTGGGCTTTU box domain containing protein. 
J033033F04GGTTGGGCTTTNONE 
Os06g0187900009-171-C09CAAGCCCAACCNONE 
AK063879CAAGCCCAACCNONE 
AK071765CAAGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CAAGCCCAACCNONE 
J033098E13CAAGCCCAACCNONE 
J100036J11CAAGCCCAACCNONE 
J100047B19CAAGCCCAACCNONE 
Os06g0210200012-084-E04GCTGGGCTGGTTGGGCCTCNONE 
AK060502GCTGGGCTGGTTGGGCCTCNONE 
AK069709GCTGGGCTGGTTGGGCCTCN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23GCTGGGCTGGTTGGGCCTCNONE 
J023056O05GCTGGGCTGGTTGGGCCTCNONE 
J033075N06GCTGGGCTGGTTGGGCCTCNONE 
J065099C14GCTGGGCTGGTTGGGCCTCNONE 
J065158C17GCTGGGCTGGTTGGGCCTCNONE 
J065214B02GCTGGGCTGGTTGGGCCTCNONE 
J075026E10GCTGGGCTGGTTGGGCCTCNONE 
J075066J06GCTGGGCTGGTTGGGCCTCNONE 
J075121I06GCTGGGCTGGTTGGGCCTCNONE 
J075124L08GCTGGGCTGGTTGGGCCTCNONE 
J100055D09GCTGGGCTGGTTGGGCCTCNONE 
J100055E04GCTGGGCTGGTTGGGCCTCNONE 
J100077L12GCTGGGCTGGTTGGGCCTCNONE 
Os06g0247800AK102187GGCCCGGCCCAACCSimilar to Dynamin-like protein (Fragment). 
AY224491GGCCCGGCCCAACCNONE 
Os06g0353700J065177D24GCCCAACCConserved hypothetical protein. 
Os06g0639000AK102470AGCCCAACCNONE 
J013106M02AGCCCAACCNONE 
J100051K23AGCCCAACCNONE 
Os06g0661500AK099401GCCCAACCConserved hypothetical protein. 
J013001E16GCCCAACCNONE 
Os06g0677600009-200-F02GGTTGGGCCGGANONE 
AK063252GGTTGGGCCGGALike-Sm ribonucleoprotein, core family protein. 
J075028G10GGTTGGGCCGGANONE 
J075189D08GGTTGGGCCGGANONE 
J090045C02GGTTGGGCCGGANONE 
Os06g0682800011-092-E01GGTTGGGCCGCNONE 
AK064816GGTTGGGCCGCZinc finger, CCCH-type domain containing protein. 
J013000E13GGTTGGGCCGCNONE 
J013035J22GGTTGGGCCGCNONE 
J013045M06GGTTGGGCCGCNONE 
J013120A07GGTTGGGCCGCNONE 
J033144H15GGTTGGGCCGCNONE 
J033145H15GGTTGGGCCGCNONE 
J033145N16GGTTGGGCCGCNONE 
J090019J02GGTTGGGCCGCNONE 
Os06g0717600AK061850AGCCCAACCNONE 
AK067113AGCCCAACCZinc finger, RING-type domain containing protein. 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
Os07g0176300AK068207GCCCAACCConserved hypothetical protein. 
J013147L15GCCCAACCNONE 
J013151K17GCCCAACCNONE 
J065197F21GCCCAACCNONE 
J090078I09GCCCAACCNONE 
Os07g0198300006-052-H02GCCCAACCNONE 
009-097-B09GCCCAACCNONE 
009-116-E02GCCCAACCNONE 
009-186-A12GCCCAACCNONE 
AK060951GCCCAACCPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK071830GCCCAACCNONE 
J023117F24GCCCAACCNONE 
J065073D24GCCCAACCNONE 
J065116O11GCCCAACCNONE 
J065122C11GCCCAACCNONE 
Os07g0490300AK068288GCGGCCCACAGCCCAACCSimilar to Preproacrosin. 
J013149P03GCGGCCCACAGCCCAACCNONE 
J065039L14GCGGCCCACAGCCCAACCNONE 
J100024A06GCGGCCCACAGCCCAACCNONE 
Os07g0490400AK067941GGTTGGGCTGTGGGCCGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22GGTTGGGCTGTGGGCCGCNONE 
Os07g0561300AK072982CCCACTCCGCCCAACCCyclin-like F-box domain containing protein. 
J023149I22CCCACTCCGCCCAACCNONE 
J065149C18CCCACTCCGCCCAACCNONE 
J065166N15CCCACTCCGCCCAACCNONE 
J075011J01CCCACTCCGCCCAACCNONE 
J075013I05CCCACTCCGCCCAACCNONE 
J075039H11CCCACTCCGCCCAACCNONE 
J075067J09CCCACTCCGCCCAACCNONE 
J075084E08CCCACTCCGCCCAACCNONE 
J075085E12CCCACTCCGCCCAACCNONE 
J075090D11CCCACTCCGCCCAACCNONE 
J075092D12CCCACTCCGCCCAACCNONE 
J075126N17CCCACTCCGCCCAACCNONE 
J075179F01CCCACTCCGCCCAACCNONE 
J075184P21CCCACTCCGCCCAACCNONE 
Os07g0568100AK099778AAAGCCCAACCSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0572500AK108612ACCGGCCCAACCConserved hypothetical protein. 
Os07g0591400Os07g0591400GGTTGGGCCTACGTGGGCCCCCACNONE 
Os07g0600000006-021-B09CGCGACGCCCAACCNONE 
006-028-D09CGCGACGCCCAACCNONE 
013-065-H09CGCGACGCCCAACCNONE 
AK105907CGCGACGCCCAACCConserved hypothetical protein. 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
Os07g0644300AK066726GGTTGGGCTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483GGTTGGGCTNONE 
Os07g0673500005-016-H01TGCGGCCCAACCNONE 
AK072839TGCGGCCCAACCNONE 
AK106176TGCGGCCCAACCSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TGCGGCCCAACCNONE 
J013153M24TGCGGCCCAACCNONE 
J023129E21TGCGGCCCAACCNONE 
J023141I23TGCGGCCCAACCNONE 
J033069A22TGCGGCCCAACCNONE 
J075021G17TGCGGCCCAACCNONE 
J075022B06TGCGGCCCAACCNONE 
J075049O15TGCGGCCCAACCNONE 
J075060O14TGCGGCCCAACCNONE 
J075073G03TGCGGCCCAACCNONE 
J075095D13TGCGGCCCAACCNONE 
J075120M18TGCGGCCCAACCNONE 
J075130D09TGCGGCCCAACCNONE 
J075152C20TGCGGCCCAACCNONE 
J075158L19TGCGGCCCAACCNONE 
J075199P18TGCGGCCCAACCNONE 
J090011K21TGCGGCCCAACCNONE 
J090078O10TGCGGCCCAACCNONE 
Os07g0686100AK110915GGTTGGGCCCAGCCAGCCCAGSimilar to Abscisic acid responsive elements-binding factor. 
Os08g0127600AK058365CGCGTGGGGCCCAACCCCACCACHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CGCGTGGGGCCCAACCCCACCACNONE 
J013149L10CGCGTGGGGCCCAACCCCACCACNONE 
J075027H17CGCGTGGGGCCCAACCCCACCACNONE 
J075060F10CGCGTGGGGCCCAACCCCACCACNONE 
Os08g0127700012-086-F03GTGGTGGGGTTGGGCCCCACGCGNONE 
AK059350GTGGTGGGGTTGGGCCCCACGCGNONE 
AK099242GTGGTGGGGTTGGGCCCCACGCGNONE 
AK121348GTGGTGGGGTTGGGCCCCACGCGConserved hypothetical protein. 
J033027J18GTGGTGGGGTTGGGCCCCACGCGNONE 
J065012F22GTGGTGGGGTTGGGCCCCACGCGNONE 
J065046N17GTGGTGGGGTTGGGCCCCACGCGNONE 
J065197B02GTGGTGGGGTTGGGCCCCACGCGNONE 
J100018P04GTGGTGGGGTTGGGCCCCACGCGNONE 
J100052C14GTGGTGGGGTTGGGCCCCACGCGNONE 
J100083A12GTGGTGGGGTTGGGCCCCACGCGNONE 
Os08g0161700009-088-D09CCAGCCCAACCNONE 
009-131-H02CCAGCCCAACCNONE 
009-182-D04CCAGCCCAACCNONE 
AK059272CCAGCCCAACCConserved hypothetical protein. 
J075002M21CCAGCCCAACCNONE 
J075090H12CCAGCCCAACCNONE 
J075129C21CCAGCCCAACCNONE 
J075146N03CCAGCCCAACCNONE 
J075178P18CCAGCCCAACCNONE 
J075190M03CCAGCCCAACCNONE 
J090030G01CCAGCCCAACCNONE 
J100088M23CCAGCCCAACCNONE 
Os08g0233300AK067421GGTTGGGCNONE 
AK067421GGTTGGGCNONE 
AK120342GGTTGGGCConserved hypothetical protein. 
AK120342GGTTGGGCConserved hypothetical protein. 
J013061K19GGTTGGGCNONE 
J013061K19GGTTGGGCNONE 
J013106J20GGTTGGGCNONE 
J013106J20GGTTGGGCNONE 
J023022P16GGTTGGGCNONE 
J023022P16GGTTGGGCNONE 
J090015I03GGTTGGGCNONE 
J090015I03GGTTGGGCNONE 
Os08g0316900013-024-A06GTGGCCCAACCNONE 
J033112J20GTGGCCCAACCNONE 
J065025M22GTGGCCCAACCNONE 
J065026E15GTGGCCCAACCNONE 
Os08g0414600AK101578GGTTGGGCCGTGSoluble quinoprotein glucose dehydrogenase domain containing protein. 
AK101579GGTTGGGCCGTGNONE 
Os08g0461300AK065651GACGGCCCAACCCyclin-like F-box domain containing protein. 
Os08g0486200012-094-G01CACGGCCCAACCNONE 
015-022-G01CACGGCCCAACCNONE 
AK064030CACGGCCCAACCSimilar to Splicing factor SC35. 
AK103676CACGGCCCAACCNONE 
J023034B03CACGGCCCAACCNONE 
J033126D21CACGGCCCAACCNONE 
J033136B19CACGGCCCAACCNONE 
J043004H03CACGGCCCAACCNONE 
J080009E16CACGGCCCAACCNONE 
J080020G22CACGGCCCAACCNONE 
J080029L21CACGGCCCAACCNONE 
J080033M18CACGGCCCAACCNONE 
J080043H20CACGGCCCAACCNONE 
J080046N23CACGGCCCAACCNONE 
J080055K10CACGGCCCAACCNONE 
J080059P19CACGGCCCAACCNONE 
J080060G22CACGGCCCAACCNONE 
J080064L15CACGGCCCAACCNONE 
J080065D19CACGGCCCAACCNONE 
J080065J06CACGGCCCAACCNONE 
J080074L14CACGGCCCAACCNONE 
J080076H14CACGGCCCAACCNONE 
J080079A08CACGGCCCAACCNONE 
J080092D09CACGGCCCAACCNONE 
J080093D19CACGGCCCAACCNONE 
J080093F01CACGGCCCAACCNONE 
J080095L16CACGGCCCAACCNONE 
J090073P10CACGGCCCAACCNONE 
Os08g0499200AK120828CCCGGCCCAACCSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os08g0557400006-024-C02TAGGCCCAACCNONE 
AK060067TAGGCCCAACCProtein tyrosine phosphatase-like protein. 
AY224424TAGGCCCAACCNONE 
Os08g0558400AK071334GGTTGGGCCGCAGCCCACAASimilar to Kinesin heavy chain (Fragment). 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0370300AK108199TCAGCCCAACCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0397900AK101306CAAGCCCAACCSimilar to FEG protein. 
Os09g0412700009-027-C06GGTTGGGCTNONE 
009-190-D10GGTTGGGCTNONE 
AK062405GGTTGGGCTConserved hypothetical protein. 
J065027H04GGTTGGGCTNONE 
J065049P11GGTTGGGCTNONE 
J065204H06GGTTGGGCTNONE 
Os09g0498600AK066995AGCCCAACCCGGCCCNONE 
Os09g0510000AK121614TCCGGCCCAACCConserved hypothetical protein. 
J033043O11TCCGGCCCAACCNONE 
J065113F04TCCGGCCCAACCNONE 
J080044D13TCCGGCCCAACCNONE 
Os09g0516800009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0522800015-033-B12GAGGCCCAACCNONE 
015-083-G12GAGGCCCAACCNONE 
AK070906GAGGCCCAACCProtein of unknown function DUF1618 domain containing protein. 
J023065L17GAGGCCCAACCNONE 
J090090P20GAGGCCCAACCNONE 
Os09g0525500AK107918GCCGGCCCAACCYY1 protein precursor. 
D50575GCCGGCCCAACCNONE 
Os09g0526800014-002-D10GCCCAACCNONE 
AK060048GCCCAACCNONE 
AK072174GCCCAACCNONE 
AK105121GCCCAACCNC domain containing protein. 
J013135P13GCCCAACCNONE 
J033135C23GCCCAACCNONE 
J043036C17GCCCAACCNONE 
J065066N16GCCCAACCNONE 
Os09g0527700AK111128ACCGGCCCAACCSimilar to Auxin-induced protein IAA4. 
J065124H12ACCGGCCCAACCNONE 
J065181I07ACCGGCCCAACCNONE 
J065207G14ACCGGCCCAACCNONE 
Os09g0539100AK071977CCAAGCCCAACCTCTCCGCSimilar to 3-dehydroquinate synthase-like protein. 
AK098959CCAAGCCCAACCTCTCCGCNONE 
Os09g0540600AK101798GGTTGGGCNONE 
AK103397GGTTGGGCSimilar to WD-40 repeat protein MSI1. 
Os09g0572200AK072621GGTTGGGCTConserved hypothetical protein. 
AK109639GGTTGGGCTNONE 
Os11g0156401J100027N11ATGGCCCAACCProtein of unknown function DUF623, plant domain containing protein. 
J100042A10ATGGCCCAACCNONE 
J100063F10ATGGCCCAACCNONE 
Os11g0157900AK108705AGCCCAACCConserved hypothetical protein. 
Os11g0231400AK108047GGGCCGTTCCAGCCCAACCProtein of unknown function DUF295 family protein. 
Os11g0255200J075012F24GCCCAACCNONE 
J075060K07GCCCAACCConserved hypothetical protein. 
J075097K19GCCCAACCNONE 
J075155O06GCCCAACCNONE 
Os11g0298400AK068577AGAGTGGGTTGGGCTTTRibulose bisphosphate carboxylase, small chain family protein. 
Os11g0490600AK067664GGTTGGGCCCCConserved hypothetical protein. 
Os11g0558300AK109777AGCCCAACCSimilar to Acyl CoA synthetase (EC 6.2.1.3). 
Os11g0621000AK099685GGTTGGGCNONE 
AK106377GGTTGGGCProtein of unknown function DUF716 family protein. 
Os11g0629200AK065196CCCGGCCCAACCSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0645300003-107-E03ATTTGGGCCAGCCCAACCNONE 
006-108-C01ATTTGGGCCAGCCCAACCNONE 
009-015-H10ATTTGGGCCAGCCCAACCNONE 
009-020-G11ATTTGGGCCAGCCCAACCNONE 
009-047-F04ATTTGGGCCAGCCCAACCNONE 
009-053-A12ATTTGGGCCAGCCCAACCNONE 
009-059-B03ATTTGGGCCAGCCCAACCNONE 
009-067-A06ATTTGGGCCAGCCCAACCNONE 
009-084-C03ATTTGGGCCAGCCCAACCNONE 
009-108-G09ATTTGGGCCAGCCCAACCNONE 
009-122-G05ATTTGGGCCAGCCCAACCNONE 
009-124-D08ATTTGGGCCAGCCCAACCNONE 
009-136-C07ATTTGGGCCAGCCCAACCNONE 
013-049-E07ATTTGGGCCAGCCCAACCNONE 
014-056-G04ATTTGGGCCAGCCCAACCNONE 
AK062126ATTTGGGCCAGCCCAACCNONE 
AK120284ATTTGGGCCAGCCCAACCPlant disease resistance response protein family protein. 
J013043F05ATTTGGGCCAGCCCAACCNONE 
J013049N05ATTTGGGCCAGCCCAACCNONE 
J013050H05ATTTGGGCCAGCCCAACCNONE 
J065053N22ATTTGGGCCAGCCCAACCNONE 
J065218J04ATTTGGGCCAGCCCAACCNONE 
J075064K03ATTTGGGCCAGCCCAACCNONE 
J075073L24ATTTGGGCCAGCCCAACCNONE 
J075108C10ATTTGGGCCAGCCCAACCNONE 
Os12g0151500AK058389GCAGCCCAACCACACACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GCAGCCCAACCACACACCNONE 
Os12g0263100AK102127GCCCAACCSimilar to Zinc finger, DHHC domain containing 4. 
J090099K03GCCCAACCNONE 
Os12g0413201J065083D05GCCCAACCNONE 
J065095J19GCCCAACCNONE 
J065118H21GCCCAACCNONE 
J065162E19GCCCAACCNONE 
J065196J19GCCCAACCConserved hypothetical protein. 
J065196M07GCCCAACCNONE 
J075041N09GCCCAACCNONE 
J075054K04GCCCAACCNONE 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0498800AK067767CACGGCCCAACCConserved hypothetical protein. 
J065073G03CACGGCCCAACCNONE 
J065102I05CACGGCCCAACCNONE 
Os12g0577900015-034-E07TCAGGCCCAACCNONE 
AK106299TCAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os12g0605400009-005-G05CTCGGCCCAACCCAGCCCACCTNONE 
016-024-B01CTCGGCCCAACCCAGCCCACCTNONE 
016-043-A11CTCGGCCCAACCCAGCCCACCTNONE 
AK068060CTCGGCCCAACCCAGCCCACCTSimilar to CROC-1-like protein (Fragment). 
J013130B07CTCGGCCCAACCCAGCCCACCTNONE 
J023141C14CTCGGCCCAACCCAGCCCACCTNONE 
J033037O04CTCGGCCCAACCCAGCCCACCTNONE 
J033081L17CTCGGCCCAACCCAGCCCACCTNONE 
J033108C03CTCGGCCCAACCCAGCCCACCTNONE 
J065079G22CTCGGCCCAACCCAGCCCACCTNONE 
J065082D03CTCGGCCCAACCCAGCCCACCTNONE 
J065207O15CTCGGCCCAACCCAGCCCACCTNONE 
J075027C23CTCGGCCCAACCCAGCCCACCTNONE 
J075037A17CTCGGCCCAACCCAGCCCACCTNONE 
J075056D17CTCGGCCCAACCCAGCCCACCTNONE 
J075064O21CTCGGCCCAACCCAGCCCACCTNONE 
J075096E08CTCGGCCCAACCCAGCCCACCTNONE 
J090036I15CTCGGCCCAACCCAGCCCACCTNONE 
J100018P15CTCGGCCCAACCCAGCCCACCTNONE 
J100074O06CTCGGCCCAACCCAGCCCACCTNONE 
Os12g0608600AK059102GCCCAACCNONE 
AK120712GCCCAACCSimilar to Thiosulfate sulfurtransferase (EC 2.8.1.1) (Mercaptopyruvate sulfurtransferase Mst2/Rdh2) (EC 2.8.1.2). 
Os12g0611000AK111837TTCGGCCCAACCSimilar to Zinc-finger protein Lsd1. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.