version

Summary of OsREG596 (All List)

OrganismOryza sativa  
IDOsREG596  
SequenceGCCCAATA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1487  

Entry Sequences (1487 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0104800AK067602GAAGCCCAATASas10/Utp3 family protein. 
J013109E04GAAGCCCAATANONE 
J033057M05GAAGCCCAATANONE 
J043021M24GAAGCCCAATANONE 
J090014N05GAAGCCCAATANONE 
J090077H23GAAGCCCAATANONE 
J090084H08GAAGCCCAATANONE 
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0175000AK061797TATTGGGCNONE 
AK101698TATTGGGCNONE 
AK106131TATTGGGCPhospholipase/Carboxylesterase family protein. 
Os01g0220300009-063-C12TATTGGGCTTTNONE 
AK105167TATTGGGCTTTConserved hypothetical protein. 
J065124E17TATTGGGCTTTNONE 
J090096L11TATTGGGCTTTNONE 
Os01g0250600J075046P13CAGGCCCAATANONE 
Os01g0270100006-096-H09ATGGCCCAATANONE 
009-009-C10ATGGCCCAATANONE 
009-054-E06ATGGCCCAATANONE 
014-085-F09ATGGCCCAATANONE 
AK073275ATGGCCCAATANONE 
AK104155ATGGCCCAATANONE 
AK119511ATGGCCCAATASimilar to Cysteine protease inhibitor. 
J033025K21ATGGCCCAATANONE 
J075065H10ATGGCCCAATANONE 
J075143G10ATGGCCCAATANONE 
J100059J02ATGGCCCAATANONE 
Os01g0328400006-092-H09GCGGCCCAATANONE 
009-085-A02GCGGCCCAATANONE 
012-078-B03GCGGCCCAATANONE 
AK061988GCGGCCCAATAUbiquitin. 
J013073B13GCGGCCCAATANONE 
J023135L09GCGGCCCAATANONE 
J023135O07GCGGCCCAATANONE 
J033027B12GCGGCCCAATANONE 
J033084P17GCGGCCCAATANONE 
J065010M05GCGGCCCAATANONE 
J065021N11GCGGCCCAATANONE 
J065021N12GCGGCCCAATANONE 
J065031K11GCGGCCCAATANONE 
J065072P04GCGGCCCAATANONE 
J065098D05GCGGCCCAATANONE 
J065122N23GCGGCCCAATANONE 
J065129L13GCGGCCCAATANONE 
J065135N13GCGGCCCAATANONE 
J065215N10GCGGCCCAATANONE 
J075120N22GCGGCCCAATANONE 
J090011G23GCGGCCCAATANONE 
J090014F06GCGGCCCAATANONE 
J090040G23GCGGCCCAATANONE 
J090075I20GCGGCCCAATANONE 
J090075N01GCGGCCCAATANONE 
J090089B04GCGGCCCAATANONE 
J090090F08GCGGCCCAATANONE 
J090091M17GCGGCCCAATANONE 
J090094L03GCGGCCCAATANONE 
J090099L06GCGGCCCAATANONE 
J100018A18GCGGCCCAATANONE 
J100027H13GCGGCCCAATANONE 
J100069C05GCGGCCCAATANONE 
J100086L10GCGGCCCAATANONE 
Os01g0329300AK110223GCCCAATAVirulence factor, pectin lyase fold family protein. 
Os01g0389200006-065-G12GCCCAATANONE 
006-091-F03GCCCAATANONE 
AK061076GCCCAATAProtein of unknown function DUF679 family protein. 
J065034P08GCCCAATANONE 
J065132P04GCCCAATANONE 
J065214D12GCCCAATANONE 
Os01g0600000014-098-H06GCCCAATANONE 
AK121212GCCCAATASimilar to Copia-like retroelement pol polyprotein. 
J023089H03GCCCAATANONE 
J033140E12GCCCAATANONE 
J033142E12GCCCAATANONE 
J043040N09GCCCAATANONE 
J065014M23GCCCAATANONE 
J065017B07GCCCAATANONE 
J065019E11GCCCAATANONE 
J065049F16GCCCAATANONE 
J065053P17GCCCAATANONE 
J065083C04GCCCAATANONE 
J065093P06GCCCAATANONE 
J065146L22GCCCAATANONE 
J065203F18GCCCAATANONE 
J065217E22GCCCAATANONE 
J075003E06GCCCAATANONE 
J075005I23GCCCAATANONE 
J075020P07GCCCAATANONE 
J075049I18GCCCAATANONE 
J075086G02GCCCAATANONE 
J075101C05GCCCAATANONE 
J075110G23GCCCAATANONE 
J075144E01GCCCAATANONE 
J090061N03GCCCAATANONE 
J090068M03GCCCAATANONE 
J100084N22GCCCAATANONE 
Os01g0626300016-070-G04GCAGCCCAATANONE 
AK122071GCAGCCCAATASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04GCAGCCCAATANONE 
J033117J08GCAGCCCAATANONE 
J065007O12GCAGCCCAATANONE 
J065020K12GCAGCCCAATANONE 
J065142D24GCAGCCCAATANONE 
J065157K19GCAGCCCAATANONE 
J080307H19GCAGCCCAATANONE 
J080311D16GCAGCCCAATANONE 
J080316C12GCAGCCCAATANONE 
J080316E03GCAGCCCAATANONE 
J100033K16GCAGCCCAATANONE 
J100042J21GCAGCCCAATANONE 
J100051E06GCAGCCCAATANONE 
J100071E22GCAGCCCAATANONE 
Os01g0679600009-061-F03AAAGCCCAATAGGCCCAATANONE 
014-055-H04AAAGCCCAATAGGCCCAATANONE 
AK062530AAAGCCCAATAGGCCCAATAConserved hypothetical protein. 
J065015E10AAAGCCCAATAGGCCCAATANONE 
J065061F21AAAGCCCAATAGGCCCAATANONE 
J065128F13AAAGCCCAATAGGCCCAATANONE 
J065189E14AAAGCCCAATAGGCCCAATANONE 
J075006F04AAAGCCCAATAGGCCCAATANONE 
J075017A20AAAGCCCAATAGGCCCAATANONE 
J075075H02AAAGCCCAATAGGCCCAATANONE 
J075104C06AAAGCCCAATAGGCCCAATANONE 
J075154F23AAAGCCCAATAGGCCCAATANONE 
J075168N01AAAGCCCAATAGGCCCAATANONE 
J075189L15AAAGCCCAATAGGCCCAATANONE 
J075192J18AAAGCCCAATAGGCCCAATANONE 
J100062M10AAAGCCCAATAGGCCCAATANONE 
J100064C23AAAGCCCAATAGGCCCAATANONE 
J100080M16AAAGCCCAATAGGCCCAATANONE 
Os01g0688200AK120982AAAGCCCAATAAlpha/beta hydrolase family protein. 
Os01g0700200AK100961GCCCAATASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11GCCCAATANONE 
Os01g0710000AK111794TTGGCCCAATASimilar to WD-repeat protein RBAP1. 
J023006D22TTGGCCCAATANONE 
J065106P04TTGGCCCAATANONE 
J100036G13TTGGCCCAATANONE 
Os01g0715800011-061-G06AGCCCAATANONE 
AK063369AGCCCAATAConserved hypothetical protein. 
J065194O22AGCCCAATANONE 
Os01g0728200AK060469GCCCAATAConserved hypothetical protein. 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0838800AK066366CCAGCCCAATANONE 
AK073775CCAGCCCAATAClathrin adaptor complex, small chain family protein. 
J013067M01CCAGCCCAATANONE 
J033030I24CCAGCCCAATANONE 
J090089A10CCAGCCCAATANONE 
Os01g0866400AB007193GCCCAATASimilar to Fructose-1,6-bisphosphatase (EC 3.1.3.11) (Fragment). 
AF378183GCCCAATANONE 
AK070516GCCCAATANONE 
AK119536GCCCAATANONE 
J023057C24GCCCAATANONE 
J023078G07GCCCAATANONE 
J065015D23GCCCAATANONE 
J065050J17GCCCAATANONE 
J065058B03GCCCAATANONE 
J065119C16GCCCAATANONE 
J065134N01GCCCAATANONE 
J065174B10GCCCAATANONE 
J075046D04GCCCAATANONE 
J075172N05GCCCAATANONE 
Os01g0915800AK103859TACGGCCCAATASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TACGGCCCAATANONE 
J090056H03TACGGCCCAATANONE 
J090058L14TACGGCCCAATANONE 
J090058P16TACGGCCCAATANONE 
J090076C19TACGGCCCAATANONE 
J100086P14TACGGCCCAATANONE 
Os01g0945300003-104-D07TATTGGGCCTANONE 
AK065371TATTGGGCCTAAmino acid/polyamine transporter I family protein. 
AK072189TATTGGGCCTANONE 
J013023D09TATTGGGCCTANONE 
J013055J18TATTGGGCCTANONE 
J013146P21TATTGGGCCTANONE 
J075109G14TATTGGGCCTANONE 
J075158O19TATTGGGCCTANONE 
Os02g0103700009-031-C12TAGGCCCAATANONE 
AK062502TAGGCCCAATANONE 
AK102186TAGGCCCAATASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17TAGGCCCAATANONE 
J065161I07TAGGCCCAATANONE 
J065184G15TAGGCCCAATANONE 
J075123E02TAGGCCCAATANONE 
Os02g0119700AK108777CCACGGCCCAATAProtein prenyltransferase domain containing protein. 
Os02g0163600AK068043ACAGCCCAATAConserved hypothetical protein. 
J013131O20ACAGCCCAATANONE 
J065006E03ACAGCCCAATANONE 
Os02g0219000AK064689GCCCACGCCCAATAInterferon-related developmental regulator domain containing protein. 
Os02g0252100AF139211TATTGGGCCTGANONE 
AK062577TATTGGGCCTGASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TATTGGGCCTGANONE 
J013156E01TATTGGGCCTGANONE 
J065001D02TATTGGGCCTGANONE 
J065042A05TATTGGGCCTGANONE 
J065116H01TATTGGGCCTGANONE 
J065167P13TATTGGGCCTGANONE 
J065168N07TATTGGGCCTGANONE 
J075093G21TATTGGGCCTGANONE 
J075109H15TATTGGGCCTGANONE 
J075194P17TATTGGGCCTGANONE 
Os02g0289700009-196-H06GTGGCCCAATANONE 
009-196-H06GTGGCCCAATAGTGTGGGCNONE 
014-005-D09GTGGCCCAATANONE 
014-005-D09GTGGCCCAATAGTGTGGGCNONE 
AK063231GTGGCCCAATASimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
AK063231GTGGCCCAATAGTGTGGGCSimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
Os02g0593900Os02g0593900TATTGGGCCGAAAMethyltransferases-related family protein. 
Os02g0606900J023065M01TAGGCCCAATANONE 
J075046E14TAGGCCCAATANONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
Os02g0643500AK068423AGCCCAATAPentapeptide repeat containing protein. 
Os02g0670400009-189-H11AAGGCCCAATANONE 
AB079636AAGGCCCAATASimilar to HMGc1 protein. 
J090001B08AAGGCCCAATANONE 
Os02g0672600AK070286TATTGGGCCCGCSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174TATTGGGCCCGCNONE 
Os02g0673000AK108650CCAGCCCAATAProtein of unknown function UPF0005 family protein. 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0725200005-020-F05AAGGCCCAATANONE 
AK058309AAGGCCCAATANONE 
AK103602AAGGCCCAATARubisco methyltransferase family protein. 
J013109C13AAGGCCCAATANONE 
J033133G01AAGGCCCAATANONE 
J075087L23AAGGCCCAATANONE 
J090073J10AAGGCCCAATANONE 
Os02g0727400AK068514TATTGGGCCTTConserved hypothetical protein. 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0754500AK069965TATTGGGCCCACGANONE 
AK105696TATTGGGCCCACGAAmidase family protein. 
Os02g0754700AK066904TTGGCCCAATASimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TTGGCCCAATANONE 
Os02g0771200011-006-B07AGCCCAATANONE 
AK066823AGCCCAATAConserved hypothetical protein. 
AK071059AGCCCAATANONE 
J013075K03AGCCCAATANONE 
Os02g0772500AK100349GAGGCCCAATAProtein prenyltransferase domain containing protein. 
J023082M21GAGGCCCAATANONE 
J065047H11GAGGCCCAATANONE 
J065055F20GAGGCCCAATANONE 
J065082I22GAGGCCCAATANONE 
J100074B04GAGGCCCAATANONE 
Os02g0787100Os02g0787100CAAGCCCAATAProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0788400AK060351TAGGCCCAATANONE 
AK103497TAGGCCCAATASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0791400009-106-F11TATTGGGCTTCNONE 
AK062787TATTGGGCTTCCytochrome oxidase c, subunit VIb family protein. 
Os02g0800000J100043O08TATTGGGCCTGNONE 
J100064O18TATTGGGCCTGNONE 
Os02g0814800AK109850TATTGGGCCTGGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0819100AK100156TAGGCCCAATAZinc finger, DHHC-type domain containing protein. 
J013088C21TAGGCCCAATANONE 
Os02g0819700AK067374TATTGGGCTZinc finger, Zim17-type family protein. 
AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160TATTGGGCTNONE 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17TATTGGGCTNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os02g0827600AK068455TATTGGGCCTTGConserved hypothetical protein. 
Os02g0828200AK071199TGCGGCCCACAGCCCAATANONE 
Os03g0108500AK108704CCTCGCCCAATASimilar to 4,4-dimethyl-sterol C4-methyl-oxidase (Fragment). 
Os03g0115200009-112-E09TTTCGGCCCAATANONE 
AK071287TTTCGGCCCAATASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TTTCGGCCCAATANONE 
J065075D17TTTCGGCCCAATANONE 
J065108G15TTTCGGCCCAATANONE 
J065165A16TTTCGGCCCAATANONE 
J075015O12TTTCGGCCCAATANONE 
J075022O06TTTCGGCCCAATANONE 
J075031H14TTTCGGCCCAATANONE 
J075033D10TTTCGGCCCAATANONE 
J075070A04TTTCGGCCCAATANONE 
J075127A05TTTCGGCCCAATANONE 
J100070B16TTTCGGCCCAATANONE 
Os03g0116500AF106844GCCGGCCCAATANONE 
AK101870GCCGGCCCAATAConstitutive photomorphogenic 11. 
J023055L16GCCGGCCCAATANONE 
J023088I16GCCGGCCCAATANONE 
J033070E21GCCGGCCCAATANONE 
J065124N22GCCGGCCCAATANONE 
J075152A19GCCGGCCCAATANONE 
J075181J21GCCGGCCCAATANONE 
J090011F23GCCGGCCCAATANONE 
Os03g0117100005-014-F09GAGGCCCAATANONE 
006-027-C07GAGGCCCAATANONE 
006-036-G11GAGGCCCAATANONE 
006-038-H10GAGGCCCAATANONE 
006-044-D08GAGGCCCAATANONE 
006-105-H12GAGGCCCAATANONE 
009-190-G08GAGGCCCAATANONE 
AK070213GAGGCCCAATAPeroxisomal biogenesis factor 11 family protein. 
AK104570GAGGCCCAATANONE 
AK104706GAGGCCCAATANONE 
J013055H24GAGGCCCAATANONE 
J023044I05GAGGCCCAATANONE 
J075111G05GAGGCCCAATANONE 
J080002K23GAGGCCCAATANONE 
J080002N12GAGGCCCAATANONE 
J080004B01GAGGCCCAATANONE 
J080007H19GAGGCCCAATANONE 
J080008M18GAGGCCCAATANONE 
J080011D18GAGGCCCAATANONE 
J080012J01GAGGCCCAATANONE 
J080018C19GAGGCCCAATANONE 
J080022C20GAGGCCCAATANONE 
J080022I05GAGGCCCAATANONE 
J080022M12GAGGCCCAATANONE 
J080023P03GAGGCCCAATANONE 
J080025A05GAGGCCCAATANONE 
J080029C02GAGGCCCAATANONE 
J080036H08GAGGCCCAATANONE 
J080039P12GAGGCCCAATANONE 
J080040H05GAGGCCCAATANONE 
J080045I23GAGGCCCAATANONE 
J080057O04GAGGCCCAATANONE 
J080059K18GAGGCCCAATANONE 
J080061E04GAGGCCCAATANONE 
J080062C20GAGGCCCAATANONE 
J080062F10GAGGCCCAATANONE 
J080062L05GAGGCCCAATANONE 
J080068L06GAGGCCCAATANONE 
J080069N09GAGGCCCAATANONE 
J080071M14GAGGCCCAATANONE 
J080072K17GAGGCCCAATANONE 
J080080A09GAGGCCCAATANONE 
J080086A18GAGGCCCAATANONE 
J080088O14GAGGCCCAATANONE 
J080089O04GAGGCCCAATANONE 
J080092G21GAGGCCCAATANONE 
J080094K09GAGGCCCAATANONE 
Os03g0174300AK067994GCCCAATAExostosin-like family protein. 
Os03g0181400012-051-B05CAAGCCCAATANONE 
015-065-E09CAAGCCCAATANONE 
AK064006CAAGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0204900009-041-G04GCCGGCCCAATANONE 
AK062601GCCGGCCCAATASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0232500AK110980TATTGGGCCTAGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TATTGGGCCTANONE 
Os03g0249900AK058379GCAGCCCAATAConserved hypothetical protein. 
Os03g0253100AK119618AAGGCCCAATAPhosphomevalonate kinase Erg8 family protein. 
J033052A14AAGGCCCAATANONE 
Os03g0254700AK112052GCCCAATANONE 
Os03g0282900006-088-H05AGCCCAATANONE 
AK061166AGCCCAATANONE 
AK102161AGCCCAATAConserved hypothetical protein. 
AK104514AGCCCAATANONE 
Os03g0287900009-074-B07TCTGGGCCCAATANONE 
014-027-E07TCTGGGCCCAATANONE 
AK063663TCTGGGCCCAATASimilar to Protein disulfide isomerase. 
J065009N21TCTGGGCCCAATANONE 
Os03g0288400Os03g0288400GAGGCCCATTGGCCCAATAConserved hypothetical protein. 
Os03g0321000AK103653CCAGGCCCAATASimilar to Steroid membrane binding protein-like. 
Os03g0338000AK121399TATTGGGCTSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0343500009-042-G06GAGGCCCAATANONE 
009-063-D01GAGGCCCAATANONE 
009-156-H09GAGGCCCAATANONE 
AB117995GAGGCCCAATANONE 
AK058737GAGGCCCAATANONE 
AK059599GAGGCCCAATASimilar to 60S ribosomal protein L22-2. 
AK121502GAGGCCCAATANONE 
J023082D10GAGGCCCAATANONE 
J033022G11GAGGCCCAATANONE 
J075048M16GAGGCCCAATANONE 
J075049O20GAGGCCCAATANONE 
J075082I02GAGGCCCAATANONE 
J075105G01GAGGCCCAATANONE 
J075131K05GAGGCCCAATANONE 
J080002H01GAGGCCCAATANONE 
J080003H01GAGGCCCAATANONE 
J080005G08GAGGCCCAATANONE 
J080011M13GAGGCCCAATANONE 
J080020M02GAGGCCCAATANONE 
J080026N24GAGGCCCAATANONE 
J080028L09GAGGCCCAATANONE 
J080032O14GAGGCCCAATANONE 
J080033J12GAGGCCCAATANONE 
J080035D05GAGGCCCAATANONE 
J080039H01GAGGCCCAATANONE 
J080044B07GAGGCCCAATANONE 
J080044E23GAGGCCCAATANONE 
J080049N11GAGGCCCAATANONE 
J080050A21GAGGCCCAATANONE 
J080055L24GAGGCCCAATANONE 
J080059N20GAGGCCCAATANONE 
J080061F04GAGGCCCAATANONE 
J080078I16GAGGCCCAATANONE 
J080079G24GAGGCCCAATANONE 
J080080K13GAGGCCCAATANONE 
J080083G20GAGGCCCAATANONE 
J080087B08GAGGCCCAATANONE 
J080091L19GAGGCCCAATANONE 
J080094D06GAGGCCCAATANONE 
J090038L06GAGGCCCAATANONE 
J090075H06GAGGCCCAATANONE 
J090081D12GAGGCCCAATANONE 
Os03g0343900009-077-C03TCCGGCCCAATANONE 
AK105813TCCGGCCCAATAPhotosystem II protein PsbX family protein. 
J100059N03TCCGGCCCAATANONE 
J100079C20TCCGGCCCAATANONE 
Os03g0345100AK065579TATTGGGCCACRad9 family protein. 
J100033H02TATTGGGCCACNONE 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J023030J03TATTGGGCTTCCATGGGCCTCNONE 
Os03g0438400AK070383AAGGCCCAAGCCCAATAConserved hypothetical protein. 
J023054E02AAGGCCCAAGCCCAATANONE 
Os03g0604600J090093K23AAAAGCCCAATAConserved hypothetical protein. 
Os03g0634400AK111510GCCCAATAProtein kinase-like domain containing protein. 
J013001I04GCCCAATANONE 
J013095I16GCCCAATANONE 
J075033B12GCCCAATANONE 
J100037D03GCCCAATANONE 
J100038H07GCCCAATANONE 
J100043B08GCCCAATANONE 
J100043B17GCCCAATANONE 
J100062L16GCCCAATANONE 
J100072L12GCCCAATANONE 
J100075N21GCCCAATANONE 
J100078P05GCCCAATANONE 
J100088J07GCCCAATANONE 
J100089A22GCCCAATANONE 
Os03g0669000AK067769CAGGCCCAATASimilar to RNA helicase (Fragment). 
AK099820CAGGCCCAATANONE 
Os03g0685900009-026-A09TATTGGGCCGGTNONE 
009-145-C09TATTGGGCCGGTNONE 
AK062981TATTGGGCCGGTConserved hypothetical protein. 
J065001D12TATTGGGCCGGTNONE 
J065023B10TATTGGGCCGGTNONE 
J065041E10TATTGGGCCGGTNONE 
J065046C01TATTGGGCCGGTNONE 
J065146I22TATTGGGCCGGTNONE 
J065184F20TATTGGGCCGGTNONE 
J075011E15TATTGGGCCGGTNONE 
J075048H17TATTGGGCCGGTNONE 
J075070H15TATTGGGCCGGTNONE 
J075133C01TATTGGGCCGGTNONE 
J075170D02TATTGGGCCGGTNONE 
J090001G08TATTGGGCCGGTNONE 
J090026B09TATTGGGCCGGTNONE 
J100055M03TATTGGGCCGGTNONE 
Os03g0687800AK106820GAGGCCCAATAConserved hypothetical protein. 
AK106820TAGGCCCAATAConserved hypothetical protein. 
Os03g0709000009-027-F11GTGGCCCAATANONE 
009-147-F02GTGGCCCAATANONE 
015-068-A04GTGGCCCAATANONE 
AK062406GTGGCCCAATAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0740700011-093-H12TATTGGGCCAANONE 
AK102723TATTGGGCCAAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19TATTGGGCCAANONE 
J013126N16TATTGGGCCAANONE 
J033105J16TATTGGGCCAANONE 
J090059D19TATTGGGCCAANONE 
Os03g0751400AK069033TATTGGGCTTCSimilar to 50S ribosomal protein l6. 
J023004G24TATTGGGCTTCNONE 
J065176D08TATTGGGCTTCNONE 
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein. 
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
J053100E14TATTGGGCCACATGGGCCTCNONE 
J075111A12TATTGGGCCACATGGGCCTCNONE 
Os03g0786600AK109838TACGGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0803800012-043-D10TCTCGGCCCAATANONE 
AK063484TCTCGGCCCAATAConserved hypothetical protein. 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0809300011-024-C02TATTGGGCCCAGATNONE 
011-024-C02TATTGGGCTTANONE 
016-071-E09TATTGGGCCCAGATNONE 
016-071-E09TATTGGGCTTANONE 
AK103140TATTGGGCCCAGATProtein phosphatase 2C-like domain containing protein. 
AK103140TATTGGGCTTAProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCCCAGATNONE 
J013030O08TATTGGGCTTANONE 
J013108D19TATTGGGCCCAGATNONE 
J013108D19TATTGGGCTTANONE 
J013124D15TATTGGGCCCAGATNONE 
J013124D15TATTGGGCTTANONE 
J013128F17TATTGGGCCCAGATNONE 
J013128F17TATTGGGCTTANONE 
J013146J06TATTGGGCCCAGATNONE 
J013146J06TATTGGGCTTANONE 
J013149D12TATTGGGCCCAGATNONE 
J013149D12TATTGGGCTTANONE 
J013154P12TATTGGGCCCAGATNONE 
J013154P12TATTGGGCTTANONE 
J013162N01TATTGGGCCCAGATNONE 
J013162N01TATTGGGCTTANONE 
J013170G15TATTGGGCCCAGATNONE 
J013170G15TATTGGGCTTANONE 
J013170H16TATTGGGCCCAGATNONE 
J013170H16TATTGGGCTTANONE 
J023022I09TATTGGGCCCAGATNONE 
J023022I09TATTGGGCTTANONE 
J023072B19TATTGGGCCCAGATNONE 
J023072B19TATTGGGCTTANONE 
J023106H09TATTGGGCCCAGATNONE 
J023106H09TATTGGGCTTANONE 
J023135C03TATTGGGCCCAGATNONE 
J023135C03TATTGGGCTTANONE 
J023141C09TATTGGGCCCAGATNONE 
J023141C09TATTGGGCTTANONE 
J033091K23TATTGGGCCCAGATNONE 
J033091K23TATTGGGCTTANONE 
J033107I05TATTGGGCCCAGATNONE 
J033107I05TATTGGGCTTANONE 
J033112M18TATTGGGCCCAGATNONE 
J033112M18TATTGGGCTTANONE 
J033120G10TATTGGGCCCAGATNONE 
J033120G10TATTGGGCTTANONE 
J033144G06TATTGGGCCCAGATNONE 
J033144G06TATTGGGCTTANONE 
J043017L21TATTGGGCCCAGATNONE 
J043017L21TATTGGGCTTANONE 
J043024O10TATTGGGCCCAGATNONE 
J043024O10TATTGGGCTTANONE 
J053023K04TATTGGGCCCAGATNONE 
J053023K04TATTGGGCTTANONE 
J053035D01TATTGGGCCCAGATNONE 
J053035D01TATTGGGCTTANONE 
J053037P10TATTGGGCCCAGATNONE 
J053037P10TATTGGGCTTANONE 
J053042K15TATTGGGCCCAGATNONE 
J053042K15TATTGGGCTTANONE 
J053047C14TATTGGGCCCAGATNONE 
J053047C14TATTGGGCTTANONE 
J053054A06TATTGGGCCCAGATNONE 
J053054A06TATTGGGCTTANONE 
J053071H03TATTGGGCCCAGATNONE 
J053071H03TATTGGGCTTANONE 
J053073G08TATTGGGCCCAGATNONE 
J053073G08TATTGGGCTTANONE 
J053090D04TATTGGGCCCAGATNONE 
J053090D04TATTGGGCTTANONE 
J053095E17TATTGGGCCCAGATNONE 
J053095E17TATTGGGCTTANONE 
J090007O03TATTGGGCCCAGATNONE 
J090007O03TATTGGGCTTANONE 
J090024G24TATTGGGCCCAGATNONE 
J090024G24TATTGGGCTTANONE 
J090042M08TATTGGGCCCAGATNONE 
J090042M08TATTGGGCTTANONE 
J090045I16TATTGGGCCCAGATNONE 
J090045I16TATTGGGCTTANONE 
J090051E13TATTGGGCCCAGATNONE 
J090051E13TATTGGGCTTANONE 
J090073B15TATTGGGCCCAGATNONE 
J090073B15TATTGGGCTTANONE 
J090096F19TATTGGGCCCAGATNONE 
J090096F19TATTGGGCTTANONE 
J100030M23TATTGGGCCCAGATNONE 
J100030M23TATTGGGCTTANONE 
Os03g0820100011-030-A10TCGGCCCAATAGGCCCAAGNONE 
011-031-C01TCGGCCCAATAGGCCCAAGNONE 
AK111534TCGGCCCAATAGGCCCAAGSimilar to Auxin-resistance protein AXR1. 
J013033L14TCGGCCCAATAGGCCCAAGNONE 
J013034D14TCGGCCCAATAGGCCCAAGNONE 
J013065N20TCGGCCCAATAGGCCCAAGNONE 
J013127A04TCGGCCCAATAGGCCCAAGNONE 
J013146A11TCGGCCCAATAGGCCCAAGNONE 
J023025D19TCGGCCCAATAGGCCCAAGNONE 
J023083K15TCGGCCCAATAGGCCCAAGNONE 
J033037N01TCGGCCCAATAGGCCCAAGNONE 
J033041H02TCGGCCCAATAGGCCCAAGNONE 
J043009M22TCGGCCCAATAGGCCCAAGNONE 
J090039L03TCGGCCCAATAGGCCCAAGNONE 
J090050L08TCGGCCCAATAGGCCCAAGNONE 
J090053J21TCGGCCCAATAGGCCCAAGNONE 
J090088G07TCGGCCCAATAGGCCCAAGNONE 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0850600AK067191TATTGGGCCGGAConserved hypothetical protein. 
J013095N12TATTGGGCCGGANONE 
J065214L06TATTGGGCCGGANONE 
J075093J10TATTGGGCCGGANONE 
Os04g0115400015-048-B05TACGGCCCAATANONE 
AK070523TACGGCCCAATAD111/G-patch domain containing protein. 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0413600009-142-B05CTCGGCCCAATANONE 
AK121192CTCGGCCCAATASimilar to 40S ribosomal protein S14 (Clone MCH2). 
J023086F11CTCGGCCCAATANONE 
J065085D06CTCGGCCCAATANONE 
J075062H12CTCGGCCCAATANONE 
J075072I22CTCGGCCCAATANONE 
J075074H21CTCGGCCCAATANONE 
J075087L16CTCGGCCCAATANONE 
J075088D11CTCGGCCCAATANONE 
J075115N15CTCGGCCCAATANONE 
J100064G10CTCGGCCCAATANONE 
J100080E09CTCGGCCCAATANONE 
Os04g0440000AK073064TATTGGGCCTCNONE 
AK101691TATTGGGCCTCConserved hypothetical protein. 
AK102407TATTGGGCCTCNONE 
Os04g0451100AK106764AGCCCAATAConserved hypothetical protein. 
Os04g0461100009-136-H10GCTGGGCCATATTGGGCTTTNONE 
009-147-H12GCTGGGCCATATTGGGCTTTNONE 
AK068022GCTGGGCCATATTGGGCTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24GCTGGGCCATATTGGGCTTTNONE 
J065019D10GCTGGGCCATATTGGGCTTTNONE 
J065168O21GCTGGGCCATATTGGGCTTTNONE 
J075051G06GCTGGGCCATATTGGGCTTTNONE 
J075148G11GCTGGGCCATATTGGGCTTTNONE 
Os04g0475300AK066351TATTGGGCTTTGAGGCCCATAConserved hypothetical protein. 
J065138J21TATTGGGCTTTGAGGCCCATANONE 
Os04g0476000Os04g0476000ACCGGGCCCAATATetratricopeptide-like helical domain containing protein. 
Os04g0539000009-165-H09ACAGCCCAATANONE 
014-012-F10ACAGCCCAATANONE 
AK105343ACAGCCCAATALambda integrase-like, N-terminal domain containing protein. 
Os04g0611300009-006-G08TATTGGGCTGGCCCAATTNONE 
009-011-C01TATTGGGCTGGCCCAATTNONE 
009-036-B09TATTGGGCTGGCCCAATTNONE 
009-116-G09TATTGGGCTGGCCCAATTNONE 
009-126-E09TATTGGGCTGGCCCAATTNONE 
009-132-F09TATTGGGCTGGCCCAATTNONE 
009-151-G07TATTGGGCTGGCCCAATTNONE 
009-155-C07TATTGGGCTGGCCCAATTNONE 
009-163-G01TATTGGGCTGGCCCAATTNONE 
009-169-G08TATTGGGCTGGCCCAATTNONE 
009-191-B02TATTGGGCTGGCCCAATTNONE 
009-196-A08TATTGGGCTGGCCCAATTNONE 
009-198-E07TATTGGGCTGGCCCAATTNONE 
014-015-F04TATTGGGCTGGCCCAATTNONE 
015-087-H04TATTGGGCTGGCCCAATTNONE 
AK062605TATTGGGCTGGCCCAATTNONE 
AK063022TATTGGGCTGGCCCAATTConserved hypothetical protein. 
AK066749TATTGGGCTGGCCCAATTNONE 
AK104924TATTGGGCTGGCCCAATTNONE 
J065002M20TATTGGGCTGGCCCAATTNONE 
J065045L23TATTGGGCTGGCCCAATTNONE 
J065101E05TATTGGGCTGGCCCAATTNONE 
J065140J23TATTGGGCTGGCCCAATTNONE 
J065179G11TATTGGGCTGGCCCAATTNONE 
J065191B18TATTGGGCTGGCCCAATTNONE 
J065192E03TATTGGGCTGGCCCAATTNONE 
J065199H21TATTGGGCTGGCCCAATTNONE 
J075067F01TATTGGGCTGGCCCAATTNONE 
J075089L01TATTGGGCTGGCCCAATTNONE 
J075147K22TATTGGGCTGGCCCAATTNONE 
J080069G23TATTGGGCTGGCCCAATTNONE 
J100053D10TATTGGGCTGGCCCAATTNONE 
J100078C10TATTGGGCTGGCCCAATTNONE 
Os04g0640800AK065522TATTGGGCCGGAProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0653100014-075-B07TATTGGGCNONE 
016-077-E05TATTGGGCNONE 
AK067094TATTGGGCProtein of unknown function UPF0136, Transmembrane family protein. 
AK111420TATTGGGCNONE 
J013098P05TATTGGGCNONE 
J075001K22TATTGGGCNONE 
J075198O04TATTGGGCNONE 
Os04g0674100J080097J12TATTGGGCCTAThioredoxin-like fold domain containing protein. 
Os04g0674350J065104O14CTGGCCCAATANONE 
J065118J19CTGGCCCAATANONE 
J065167I12CTGGCCCAATAHypothetical protein. 
Os04g0674400015-042-B08TATTGGGCCAGNONE 
AK102124TATTGGGCCAGSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22TATTGGGCCAGNONE 
J023022I24TATTGGGCCAGNONE 
J023120A15TATTGGGCCAGNONE 
J023123P20TATTGGGCCAGNONE 
J033068P09TATTGGGCCAGNONE 
J033107G22TATTGGGCCAGNONE 
J033116G12TATTGGGCCAGNONE 
J033133F03TATTGGGCCAGNONE 
J033143B20TATTGGGCCAGNONE 
J043006G12TATTGGGCCAGNONE 
J043027M18TATTGGGCCAGNONE 
J043034H17TATTGGGCCAGNONE 
J090091E20TATTGGGCCAGNONE 
J100035H09TATTGGGCCAGNONE 
J100037J04TATTGGGCCAGNONE 
J100047J24TATTGGGCCAGNONE 
J100059G06TATTGGGCCAGNONE 
J100066O12TATTGGGCCAGNONE 
J100074G23TATTGGGCCAGNONE 
J100077M12TATTGGGCCAGNONE 
Os04g0684500AK066014TATTGGGCCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0692200006-047-H10CCAGGCCCAATANONE 
006-107-D08CCAGGCCCAATANONE 
009-122-B09CCAGGCCCAATANONE 
AK059807CCAGGCCCAATANONE 
AK060875CCAGGCCCAATANONE 
AK071726CCAGGCCCAATAConserved hypothetical protein. 
J023110I24CCAGGCCCAATANONE 
J033091O06CCAGGCCCAATANONE 
J053027N16CCAGGCCCAATANONE 
J053089E19CCAGGCCCAATANONE 
J053098H12CCAGGCCCAATANONE 
J053099N13CCAGGCCCAATANONE 
J075031B15CCAGGCCCAATANONE 
J080013D12CCAGGCCCAATANONE 
J080013H05CCAGGCCCAATANONE 
J080013H07CCAGGCCCAATANONE 
J080088I03CCAGGCCCAATANONE 
Os05g0103500AK060306AAAAGCCCAATACHCH domain containing protein. 
AK102829AAAAGCCCAATANONE 
J033109D16AAAAGCCCAATANONE 
J043016E20AAAAGCCCAATANONE 
J065001C14AAAAGCCCAATANONE 
J065116L24AAAAGCCCAATANONE 
J075018E04AAAAGCCCAATANONE 
J075045E18AAAAGCCCAATANONE 
J075093G20AAAAGCCCAATANONE 
J075171A09AAAAGCCCAATANONE 
J100029F18AAAAGCCCAATANONE 
J100046I24AAAAGCCCAATANONE 
Os05g0110700AK102486ATCTGGGCCTAAGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
AK102486GAGGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12ATCTGGGCCTAAGCCCAATANONE 
J065089I12GAGGCCCAATANONE 
Os05g0144800AK099724TATTGGGCCATSimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0193800AK058865TATTGGGCCAGCCCATGNONE 
AK067940TATTGGGCCAGCCCATGConserved hypothetical protein. 
J065043K19TATTGGGCCAGCCCATGNONE 
J065095O10TATTGGGCCAGCCCATGNONE 
J065095O12TATTGGGCCAGCCCATGNONE 
J080002K02TATTGGGCCAGCCCATGNONE 
J080012L17TATTGGGCCAGCCCATGNONE 
J080013J02TATTGGGCCAGCCCATGNONE 
J080013O11TATTGGGCCAGCCCATGNONE 
J080020A17TATTGGGCCAGCCCATGNONE 
J080028E18TATTGGGCCAGCCCATGNONE 
J080036P11TATTGGGCCAGCCCATGNONE 
J080042E10TATTGGGCCAGCCCATGNONE 
J080042L10TATTGGGCCAGCCCATGNONE 
J080047B11TATTGGGCCAGCCCATGNONE 
J080048N05TATTGGGCCAGCCCATGNONE 
J080057E20TATTGGGCCAGCCCATGNONE 
J080057K13TATTGGGCCAGCCCATGNONE 
J080058L03TATTGGGCCAGCCCATGNONE 
J080063H07TATTGGGCCAGCCCATGNONE 
J080066L23TATTGGGCCAGCCCATGNONE 
J080069G22TATTGGGCCAGCCCATGNONE 
J080072E12TATTGGGCCAGCCCATGNONE 
J080076D06TATTGGGCCAGCCCATGNONE 
J080077A22TATTGGGCCAGCCCATGNONE 
J080081A01TATTGGGCCAGCCCATGNONE 
J080090M13TATTGGGCCAGCCCATGNONE 
J080093G07TATTGGGCCAGCCCATGNONE 
J080094O20TATTGGGCCAGCCCATGNONE 
J080097F13TATTGGGCCAGCCCATGNONE 
Os05g0194600AK102487AATGGGCTATTGGGCCGAPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01AATGGGCTATTGGGCCGANONE 
J100041A08AATGGGCTATTGGGCCGANONE 
Os05g0219800AK102822CACGGCCCAATASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0227100009-045-C06TAAGCCCAATANONE 
009-109-A08TAAGCCCAATANONE 
J075072D22TAAGCCCAATAHypothetical protein. 
Os05g0227300Os05g0227300TAAGCCCAATANONE 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0273800AK060563GCCCAATASimilar to Soluble epoxide hydrolase. 
Os05g0323100AK109472AAAGCCCAATARhodanese-like domain containing protein. 
Os05g0383100AK121835TATTGGGCTTCClathrin adaptor complex, medium chain family protein. 
Os05g0429900AK066834CCAAGCCCAATANONE 
AK099108CCAAGCCCAATANONE 
AK104053CCAAGCCCAATANONE 
D88617CCAAGCCCAATASimilar to MybHv5 (Fragment). 
J090031E22CCAAGCCCAATANONE 
Os05g0509200AK061566TATTGGGCCGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007TATTGGGCCGANONE 
AK100226TATTGGGCCGANONE 
J013114B12TATTGGGCCGANONE 
J023048D09TATTGGGCCGANONE 
Os05g0518300003-113-E09AGCCCAATANONE 
006-088-A08AGCCCAATANONE 
011-046-H04AGCCCAATANONE 
013-059-A09AGCCCAATANONE 
014-094-H08AGCCCAATANONE 
015-008-B01AGCCCAATANONE 
015-062-H06AGCCCAATANONE 
016-057-H02AGCCCAATANONE 
AK061147AGCCCAATALipolytic enzyme, G-D-S-L family protein. 
J065171N11AGCCCAATANONE 
J065186B12AGCCCAATANONE 
Os05g0521500AK066030TATTGGGCTGTPeptidase S16, lon N-terminal domain containing protein. 
Os05g0540800AK060731AGTTGGGCCGGCCCAATANONE 
AK071090AGTTGGGCCGGCCCAATAHomeodomain-like containing protein. 
J013095F03AGTTGGGCCGGCCCAATANONE 
J023079C11AGTTGGGCCGGCCCAATANONE 
J033080E08AGTTGGGCCGGCCCAATANONE 
Os05g0545500AK101095TATTGGGCTTTConserved hypothetical protein. 
AK119499TATTGGGCTTTNONE 
Os05g0558000015-029-G05GAGGCCCAATANONE 
AK073857GAGGCCCAATARibosomal protein L1 family protein. 
J033074P11GAGGCCCAATANONE 
J090060I16GAGGCCCAATANONE 
Os05g0565200004-015-E06TATTGGGCCGCANONE 
004-015-E06TATTGGGCCTCNONE 
AK067090TATTGGGCCGCASimilar to Urease accessory protein G. 
AK067090TATTGGGCCTCSimilar to Urease accessory protein G. 
AK104200TATTGGGCCGCANONE 
AK104200TATTGGGCCTCNONE 
AK104368TATTGGGCCGCANONE 
AK104368TATTGGGCCTCNONE 
Os05g0567300013-039-F11TATTGGGCCGGCCCAAGNONE 
AK112068TATTGGGCCGGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0571100006-092-E08TATTGGGCTTANONE 
006-120-A03TATTGGGCTTANONE 
015-030-F01TATTGGGCTTANONE 
AK068658TATTGGGCTTAProtein of unknown function DUF860, plant family protein. 
AK104438TATTGGGCTTANONE 
Os05g0578600AK108477TTGGCCCAATASimilar to Polygalacturonase PG2. 
Os05g0587400AK102121TATTGGGCCTAPrefoldin domain containing protein. 
J033084N12TATTGGGCCTANONE 
Os06g0105900AK072638CAAGCCCAGGCCCAATAConserved hypothetical protein. 
Os06g0106800006-036-B11TATTGGGCTNONE 
006-046-F11TATTGGGCTNONE 
011-014-C09TATTGGGCTNONE 
011-060-G08TATTGGGCTNONE 
AK073364TATTGGGCTNONE 
AK105650TATTGGGCTNONE 
AK105782TATTGGGCTNONE 
AK105911TATTGGGCTNONE 
AK122178TATTGGGCTConserved hypothetical protein. 
J033023K09TATTGGGCTNONE 
J033093J16TATTGGGCTNONE 
J033148N22TATTGGGCTNONE 
J100054L15TATTGGGCTNONE 
Os06g0116800AK058985CACGGCCCAATASimilar to GFA2. 
AK120746CACGGCCCAATANONE 
Os06g0130000AK064427TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK070084TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK119321TATTGGGCTCAGCCCATGAGCCCATGTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0135340J065061D17TCAGCCCAATANONE 
J065159A10TCAGCCCAATAConserved hypothetical protein. 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
AK121504TATTGGGCCGGCCCSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGATTTGGGCTGTNONE 
J033022L20TATTGGGCCGGCCCNONE 
J075033D09TATTGGGCCGATTTGGGCTGTNONE 
J075033D09TATTGGGCCGGCCCNONE 
Os06g0199500AK060939ACAGCCCAATANONE 
AK064613ACAGCCCAATASimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138ACAGCCCAATANONE 
Os06g0292400J065040E24TATTGGGCCTGAConserved hypothetical protein. 
Os06g0332600AK121615CTCGGCCCAATAConserved hypothetical protein. 
J033044B19CTCGGCCCAATANONE 
Os06g0482200AK119703TTGGCCCAATAThioredoxin fold domain containing protein. 
J065014B11TTGGCCCAATANONE 
J065055E22TTGGCCCAATANONE 
J065092L13TTGGCCCAATANONE 
J065113E21TTGGCCCAATANONE 
J065191D11TTGGCCCAATANONE 
J065214F18TTGGCCCAATANONE 
J075104E18TTGGCCCAATANONE 
J075149O19TTGGCCCAATANONE 
J075170I11TTGGCCCAATANONE 
Os06g0542200AK058589CCAGCCCAATANADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0625500006-034-A05CCAGGCCCAATACGCGTCCNONE 
AK058459CCAGGCCCAATACGCGTCCSimilar to Thioredoxin peroxidase. 
AK068955CCAGGCCCAATACGCGTCCNONE 
AK104130CCAGGCCCAATACGCGTCCNONE 
J023003C09CCAGGCCCAATACGCGTCCNONE 
J033043I02CCAGGCCCAATACGCGTCCNONE 
J065063E05CCAGGCCCAATACGCGTCCNONE 
J065190D24CCAGGCCCAATACGCGTCCNONE 
J065198I01CCAGGCCCAATACGCGTCCNONE 
J075107A02CCAGGCCCAATACGCGTCCNONE 
Os06g0673500J100018J12GCCCAATANONE 
J100072F13GCCCAATASimilar to Ubiquitin. 
Os06g0704900AK103054AGCCCAATASimilar to Cell division-like protein. 
AK103054TATTGGGCCTGASimilar to Cell division-like protein. 
J033117I21AGCCCAATANONE 
J033117I21TATTGGGCCTGANONE 
Os06g0710300AK121344ATGGCCCAATAUncharacterized protein UPF0114 family protein. 
J043016B12ATGGCCCAATANONE 
J065104H21ATGGCCCAATANONE 
Os07g0100200006-022-D06TATTGGGCTNONE 
011-025-B06TATTGGGCTNONE 
012-069-A07TATTGGGCTNONE 
AK060986TATTGGGCTNONE 
AK073305TATTGGGCTSimilar to PDX1-like protein 4. 
J023055C05TATTGGGCTNONE 
J033024J11TATTGGGCTNONE 
J065045F14TATTGGGCTNONE 
J075097C22TATTGGGCTNONE 
Os07g0108000J065139H23TATTGGGCNONE 
J065198A14TATTGGGCNONE 
J075070C03TATTGGGCConserved hypothetical protein. 
J075111K14TATTGGGCNONE 
J075119C03TATTGGGCNONE 
J075128G16TATTGGGCNONE 
J075153K08TATTGGGCNONE 
J075177A18TATTGGGCNONE 
J075177N18TATTGGGCNONE 
J090004J03TATTGGGCNONE 
Os07g0110100009-059-D11TATTGGGCCGGANONE 
AK071499TATTGGGCCGGAConserved hypothetical protein. 
J065064P17TATTGGGCCGGANONE 
J065111B09TATTGGGCCGGANONE 
J075099A14TATTGGGCCGGANONE 
J075139C23TATTGGGCCGGANONE 
Os07g0142600009-115-C09TATTGGGCCACNONE 
AK062842TATTGGGCCACConserved hypothetical protein. 
Os07g0155200006-036-E03TATTGGGCCTTNONE 
006-036-E04TATTGGGCCTTNONE 
AK061006TATTGGGCCTTProtein of unknown function DUF150 family protein. 
AK104606TATTGGGCCTTNONE 
Os07g0486000AK069343TATTGGGCTTCSimilar to MSH4. 
Os07g0565600AK071983TATTGGGCTTTGGGCTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481TATTGGGCTTTGGGCTNONE 
Os07g0568900009-083-H02TAATGGGCCTTATTGGGCTTANONE 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0585800006-106-A05CAGCCCAATANONE 
AK066419CAGCCCAATANONE 
AK105064CAGCCCAATASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01CAGCCCAATANONE 
J065085B08CAGCCCAATANONE 
J065099I23CAGCCCAATANONE 
J065169A01CAGCCCAATANONE 
J065187N13CAGCCCAATANONE 
J065191L18CAGCCCAATANONE 
J065194D04CAGCCCAATANONE 
J065211M09CAGCCCAATANONE 
J065212I02CAGCCCAATANONE 
J090003C10CAGCCCAATANONE 
J090025O11CAGCCCAATANONE 
J090092F10CAGCCCAATANONE 
J100055A04CAGCCCAATANONE 
J100064A01CAGCCCAATANONE 
J100080L02CAGCCCAATANONE 
Os07g0618400AK111671GCCCAATANONE 
AK111826GCCCAATASimilar to Leucine-rich repeat transmembrane protein kinase 1 (Fragment). 
J065217K18GCCCAATANONE 
Os07g0633800AK103878TATTGGGCCACConserved hypothetical protein. 
AK103878TATTGGGCCTCConserved hypothetical protein. 
J033025K08TATTGGGCCACNONE 
J033025K08TATTGGGCCTCNONE 
J033026N04TATTGGGCCACNONE 
J033026N04TATTGGGCCTCNONE 
J090062M09TATTGGGCCACNONE 
J090062M09TATTGGGCCTCNONE 
J090087F04TATTGGGCCACNONE 
J090087F04TATTGGGCCTCNONE 
Os07g0688300AK068325TATTGGGCCAASimilar to Importin alpha 1. 
AK099611TATTGGGCCAANONE 
Os08g0130500006-024-B12AGCCCAATAAGGCCCATCTNONE 
006-032-F11AGCCCAATAAGGCCCATCTNONE 
006-047-B12AGCCCAATAAGGCCCATCTNONE 
006-058-H06AGCCCAATAAGGCCCATCTNONE 
006-062-D07AGCCCAATAAGGCCCATCTNONE 
006-083-F11AGCCCAATAAGGCCCATCTNONE 
006-084-A11AGCCCAATAAGGCCCATCTNONE 
006-096-F12AGCCCAATAAGGCCCATCTNONE 
006-105-A04AGCCCAATAAGGCCCATCTNONE 
006-110-D11AGCCCAATAAGGCCCATCTNONE 
011-022-D11AGCCCAATAAGGCCCATCTNONE 
AK064857AGCCCAATAAGGCCCATCT60S acidic ribosomal protein P0. 
D21130AGCCCAATAAGGCCCATCTNONE 
J013000H12AGCCCAATAAGGCCCATCTNONE 
J013024M17AGCCCAATAAGGCCCATCTNONE 
J013028H09AGCCCAATAAGGCCCATCTNONE 
J013045N22AGCCCAATAAGGCCCATCTNONE 
J013092K19AGCCCAATAAGGCCCATCTNONE 
J013106L12AGCCCAATAAGGCCCATCTNONE 
J013107A03AGCCCAATAAGGCCCATCTNONE 
J013109E12AGCCCAATAAGGCCCATCTNONE 
J013114N08AGCCCAATAAGGCCCATCTNONE 
J013120J12AGCCCAATAAGGCCCATCTNONE 
J013121E21AGCCCAATAAGGCCCATCTNONE 
J013135P20AGCCCAATAAGGCCCATCTNONE 
J023006J08AGCCCAATAAGGCCCATCTNONE 
J023014L16AGCCCAATAAGGCCCATCTNONE 
J023020N03AGCCCAATAAGGCCCATCTNONE 
J023027M24AGCCCAATAAGGCCCATCTNONE 
J023029D18AGCCCAATAAGGCCCATCTNONE 
J023030A14AGCCCAATAAGGCCCATCTNONE 
J023041G23AGCCCAATAAGGCCCATCTNONE 
J023049H05AGCCCAATAAGGCCCATCTNONE 
J023060I23AGCCCAATAAGGCCCATCTNONE 
J023099D07AGCCCAATAAGGCCCATCTNONE 
J023104A20AGCCCAATAAGGCCCATCTNONE 
J023105F18AGCCCAATAAGGCCCATCTNONE 
J023112D21AGCCCAATAAGGCCCATCTNONE 
J023122M18AGCCCAATAAGGCCCATCTNONE 
J023139J20AGCCCAATAAGGCCCATCTNONE 
J023149L20AGCCCAATAAGGCCCATCTNONE 
J023150G04AGCCCAATAAGGCCCATCTNONE 
J033036G02AGCCCAATAAGGCCCATCTNONE 
J033045P13AGCCCAATAAGGCCCATCTNONE 
J033046A22AGCCCAATAAGGCCCATCTNONE 
J033086H16AGCCCAATAAGGCCCATCTNONE 
J033087D07AGCCCAATAAGGCCCATCTNONE 
J033089M14AGCCCAATAAGGCCCATCTNONE 
J033095F14AGCCCAATAAGGCCCATCTNONE 
J033108M01AGCCCAATAAGGCCCATCTNONE 
J033117A17AGCCCAATAAGGCCCATCTNONE 
J033122F03AGCCCAATAAGGCCCATCTNONE 
J033126A04AGCCCAATAAGGCCCATCTNONE 
J033144D13AGCCCAATAAGGCCCATCTNONE 
J033145D13AGCCCAATAAGGCCCATCTNONE 
J043022M09AGCCCAATAAGGCCCATCTNONE 
J053025I11AGCCCAATAAGGCCCATCTNONE 
J053027K06AGCCCAATAAGGCCCATCTNONE 
J053029D15AGCCCAATAAGGCCCATCTNONE 
J053048I22AGCCCAATAAGGCCCATCTNONE 
J053055I01AGCCCAATAAGGCCCATCTNONE 
J053079P07AGCCCAATAAGGCCCATCTNONE 
J053090J23AGCCCAATAAGGCCCATCTNONE 
J053094C24AGCCCAATAAGGCCCATCTNONE 
J065023F18AGCCCAATAAGGCCCATCTNONE 
J065029I12AGCCCAATAAGGCCCATCTNONE 
J065044B18AGCCCAATAAGGCCCATCTNONE 
J065045C07AGCCCAATAAGGCCCATCTNONE 
J065063K22AGCCCAATAAGGCCCATCTNONE 
J065093D11AGCCCAATAAGGCCCATCTNONE 
J065096P09AGCCCAATAAGGCCCATCTNONE 
J065099N04AGCCCAATAAGGCCCATCTNONE 
J065103K24AGCCCAATAAGGCCCATCTNONE 
J065110H12AGCCCAATAAGGCCCATCTNONE 
J065132F24AGCCCAATAAGGCCCATCTNONE 
J065157K16AGCCCAATAAGGCCCATCTNONE 
J065185D11AGCCCAATAAGGCCCATCTNONE 
J065202E16AGCCCAATAAGGCCCATCTNONE 
J065217D07AGCCCAATAAGGCCCATCTNONE 
J075053I19AGCCCAATAAGGCCCATCTNONE 
J075055L24AGCCCAATAAGGCCCATCTNONE 
J075056H24AGCCCAATAAGGCCCATCTNONE 
J075070D02AGCCCAATAAGGCCCATCTNONE 
J075084O15AGCCCAATAAGGCCCATCTNONE 
J075090F24AGCCCAATAAGGCCCATCTNONE 
J075135E03AGCCCAATAAGGCCCATCTNONE 
J075174A01AGCCCAATAAGGCCCATCTNONE 
J075188F05AGCCCAATAAGGCCCATCTNONE 
J075192C17AGCCCAATAAGGCCCATCTNONE 
J080001B02AGCCCAATAAGGCCCATCTNONE 
J080001C08AGCCCAATAAGGCCCATCTNONE 
J080002D15AGCCCAATAAGGCCCATCTNONE 
J080002I03AGCCCAATAAGGCCCATCTNONE 
J080003E24AGCCCAATAAGGCCCATCTNONE 
J080004M10AGCCCAATAAGGCCCATCTNONE 
J080005C18AGCCCAATAAGGCCCATCTNONE 
J080006A12AGCCCAATAAGGCCCATCTNONE 
J080006F04AGCCCAATAAGGCCCATCTNONE 
J080006M11AGCCCAATAAGGCCCATCTNONE 
J080008J11AGCCCAATAAGGCCCATCTNONE 
J080008J22AGCCCAATAAGGCCCATCTNONE 
J080009F14AGCCCAATAAGGCCCATCTNONE 
J080010B12AGCCCAATAAGGCCCATCTNONE 
J080010G14AGCCCAATAAGGCCCATCTNONE 
J080010N07AGCCCAATAAGGCCCATCTNONE 
J080011D04AGCCCAATAAGGCCCATCTNONE 
J080011G10AGCCCAATAAGGCCCATCTNONE 
J080011O19AGCCCAATAAGGCCCATCTNONE 
J080013K23AGCCCAATAAGGCCCATCTNONE 
J080013M09AGCCCAATAAGGCCCATCTNONE 
J080013N12AGCCCAATAAGGCCCATCTNONE 
J080013O15AGCCCAATAAGGCCCATCTNONE 
J080014C13AGCCCAATAAGGCCCATCTNONE 
J080014D21AGCCCAATAAGGCCCATCTNONE 
J080014F08AGCCCAATAAGGCCCATCTNONE 
J080014N08AGCCCAATAAGGCCCATCTNONE 
J080014P19AGCCCAATAAGGCCCATCTNONE 
J080015L09AGCCCAATAAGGCCCATCTNONE 
J080015P15AGCCCAATAAGGCCCATCTNONE 
J080018P10AGCCCAATAAGGCCCATCTNONE 
J080020C06AGCCCAATAAGGCCCATCTNONE 
J080022C14AGCCCAATAAGGCCCATCTNONE 
J080022E01AGCCCAATAAGGCCCATCTNONE 
J080022P04AGCCCAATAAGGCCCATCTNONE 
J080022P10AGCCCAATAAGGCCCATCTNONE 
J080023B20AGCCCAATAAGGCCCATCTNONE 
J080023G19AGCCCAATAAGGCCCATCTNONE 
J080024N15AGCCCAATAAGGCCCATCTNONE 
J080025E11AGCCCAATAAGGCCCATCTNONE 
J080025G24AGCCCAATAAGGCCCATCTNONE 
J080026B01AGCCCAATAAGGCCCATCTNONE 
J080026B05AGCCCAATAAGGCCCATCTNONE 
J080027L17AGCCCAATAAGGCCCATCTNONE 
J080028K02AGCCCAATAAGGCCCATCTNONE 
J080029L23AGCCCAATAAGGCCCATCTNONE 
J080030D08AGCCCAATAAGGCCCATCTNONE 
J080031C03AGCCCAATAAGGCCCATCTNONE 
J080031K02AGCCCAATAAGGCCCATCTNONE 
J080032C16AGCCCAATAAGGCCCATCTNONE 
J080033F10AGCCCAATAAGGCCCATCTNONE 
J080033G12AGCCCAATAAGGCCCATCTNONE 
J080033K03AGCCCAATAAGGCCCATCTNONE 
J080034B03AGCCCAATAAGGCCCATCTNONE 
J080034N21AGCCCAATAAGGCCCATCTNONE 
J080034O03AGCCCAATAAGGCCCATCTNONE 
J080035G10AGCCCAATAAGGCCCATCTNONE 
J080038E14AGCCCAATAAGGCCCATCTNONE 
J080039A19AGCCCAATAAGGCCCATCTNONE 
J080039G10AGCCCAATAAGGCCCATCTNONE 
J080039J01AGCCCAATAAGGCCCATCTNONE 
J080039J09AGCCCAATAAGGCCCATCTNONE 
J080040F07AGCCCAATAAGGCCCATCTNONE 
J080040H18AGCCCAATAAGGCCCATCTNONE 
J080041E08AGCCCAATAAGGCCCATCTNONE 
J080041E16AGCCCAATAAGGCCCATCTNONE 
J080041L08AGCCCAATAAGGCCCATCTNONE 
J080042A07AGCCCAATAAGGCCCATCTNONE 
J080044E02AGCCCAATAAGGCCCATCTNONE 
J080045K03AGCCCAATAAGGCCCATCTNONE 
J080046O03AGCCCAATAAGGCCCATCTNONE 
J080047F08AGCCCAATAAGGCCCATCTNONE 
J080048H01AGCCCAATAAGGCCCATCTNONE 
J080048I05AGCCCAATAAGGCCCATCTNONE 
J080048N06AGCCCAATAAGGCCCATCTNONE 
J080050A07AGCCCAATAAGGCCCATCTNONE 
J080050B04AGCCCAATAAGGCCCATCTNONE 
J080050E21AGCCCAATAAGGCCCATCTNONE 
J080051J01AGCCCAATAAGGCCCATCTNONE 
J080051K02AGCCCAATAAGGCCCATCTNONE 
J080051L02AGCCCAATAAGGCCCATCTNONE 
J080052C20AGCCCAATAAGGCCCATCTNONE 
J080052I22AGCCCAATAAGGCCCATCTNONE 
J080052J21AGCCCAATAAGGCCCATCTNONE 
J080052K22AGCCCAATAAGGCCCATCTNONE 
J080055A05AGCCCAATAAGGCCCATCTNONE 
J080055I12AGCCCAATAAGGCCCATCTNONE 
J080056A21AGCCCAATAAGGCCCATCTNONE 
J080056N11AGCCCAATAAGGCCCATCTNONE 
J080057D02AGCCCAATAAGGCCCATCTNONE 
J080058H21AGCCCAATAAGGCCCATCTNONE 
J080058P16AGCCCAATAAGGCCCATCTNONE 
J080059M03AGCCCAATAAGGCCCATCTNONE 
J080059N17AGCCCAATAAGGCCCATCTNONE 
J080060F13AGCCCAATAAGGCCCATCTNONE 
J080060H06AGCCCAATAAGGCCCATCTNONE 
J080060J03AGCCCAATAAGGCCCATCTNONE 
J080060O09AGCCCAATAAGGCCCATCTNONE 
J080060P22AGCCCAATAAGGCCCATCTNONE 
J080061F06AGCCCAATAAGGCCCATCTNONE 
J080061H21AGCCCAATAAGGCCCATCTNONE 
J080061O13AGCCCAATAAGGCCCATCTNONE 
J080062J07AGCCCAATAAGGCCCATCTNONE 
J080063A08AGCCCAATAAGGCCCATCTNONE 
J080063F19AGCCCAATAAGGCCCATCTNONE 
J080063O18AGCCCAATAAGGCCCATCTNONE 
J080065D15AGCCCAATAAGGCCCATCTNONE 
J080066E13AGCCCAATAAGGCCCATCTNONE 
J080068L01AGCCCAATAAGGCCCATCTNONE 
J080068P07AGCCCAATAAGGCCCATCTNONE 
J080069I21AGCCCAATAAGGCCCATCTNONE 
J080070M04AGCCCAATAAGGCCCATCTNONE 
J080071E01AGCCCAATAAGGCCCATCTNONE 
J080071J08AGCCCAATAAGGCCCATCTNONE 
J080071M23AGCCCAATAAGGCCCATCTNONE 
J080072A03AGCCCAATAAGGCCCATCTNONE 
J080072G18AGCCCAATAAGGCCCATCTNONE 
J080075A04AGCCCAATAAGGCCCATCTNONE 
J080075E19AGCCCAATAAGGCCCATCTNONE 
J080075P18AGCCCAATAAGGCCCATCTNONE 
J080076N11AGCCCAATAAGGCCCATCTNONE 
J080077A11AGCCCAATAAGGCCCATCTNONE 
J080077D22AGCCCAATAAGGCCCATCTNONE 
J080077H18AGCCCAATAAGGCCCATCTNONE 
J080077L03AGCCCAATAAGGCCCATCTNONE 
J080078D02AGCCCAATAAGGCCCATCTNONE 
J080078L05AGCCCAATAAGGCCCATCTNONE 
J080078N20AGCCCAATAAGGCCCATCTNONE 
J080079I20AGCCCAATAAGGCCCATCTNONE 
J080081D04AGCCCAATAAGGCCCATCTNONE 
J080082A07AGCCCAATAAGGCCCATCTNONE 
J080082E24AGCCCAATAAGGCCCATCTNONE 
J080084A22AGCCCAATAAGGCCCATCTNONE 
J080084E15AGCCCAATAAGGCCCATCTNONE 
J080084G06AGCCCAATAAGGCCCATCTNONE 
J080086A05AGCCCAATAAGGCCCATCTNONE 
J080086F09AGCCCAATAAGGCCCATCTNONE 
J080087B11AGCCCAATAAGGCCCATCTNONE 
J080087H12AGCCCAATAAGGCCCATCTNONE 
J080088I05AGCCCAATAAGGCCCATCTNONE 
J080088N08AGCCCAATAAGGCCCATCTNONE 
J080088P07AGCCCAATAAGGCCCATCTNONE 
J080089A09AGCCCAATAAGGCCCATCTNONE 
J080089D21AGCCCAATAAGGCCCATCTNONE 
J080089F24AGCCCAATAAGGCCCATCTNONE 
J080089H22AGCCCAATAAGGCCCATCTNONE 
J080089I04AGCCCAATAAGGCCCATCTNONE 
J080090D01AGCCCAATAAGGCCCATCTNONE 
J080091F09AGCCCAATAAGGCCCATCTNONE 
J080091G18AGCCCAATAAGGCCCATCTNONE 
J080091L24AGCCCAATAAGGCCCATCTNONE 
J080091M12AGCCCAATAAGGCCCATCTNONE 
J080091N12AGCCCAATAAGGCCCATCTNONE 
J080093A15AGCCCAATAAGGCCCATCTNONE 
J080093C08AGCCCAATAAGGCCCATCTNONE 
J080093I08AGCCCAATAAGGCCCATCTNONE 
J080093P21AGCCCAATAAGGCCCATCTNONE 
J080094E18AGCCCAATAAGGCCCATCTNONE 
J080094F15AGCCCAATAAGGCCCATCTNONE 
J080094J21AGCCCAATAAGGCCCATCTNONE 
J080095A09AGCCCAATAAGGCCCATCTNONE 
J080096G05AGCCCAATAAGGCCCATCTNONE 
J080096K07AGCCCAATAAGGCCCATCTNONE 
J080097M17AGCCCAATAAGGCCCATCTNONE 
J080097P21AGCCCAATAAGGCCCATCTNONE 
J080302B15AGCCCAATAAGGCCCATCTNONE 
J080306J15AGCCCAATAAGGCCCATCTNONE 
J080306O13AGCCCAATAAGGCCCATCTNONE 
J080307C15AGCCCAATAAGGCCCATCTNONE 
J080307I04AGCCCAATAAGGCCCATCTNONE 
J080307L05AGCCCAATAAGGCCCATCTNONE 
J080308F11AGCCCAATAAGGCCCATCTNONE 
J080311C04AGCCCAATAAGGCCCATCTNONE 
J080311I07AGCCCAATAAGGCCCATCTNONE 
J080312C01AGCCCAATAAGGCCCATCTNONE 
J080312O08AGCCCAATAAGGCCCATCTNONE 
J080315F14AGCCCAATAAGGCCCATCTNONE 
J080318K13AGCCCAATAAGGCCCATCTNONE 
J080319A17AGCCCAATAAGGCCCATCTNONE 
J090001I01AGCCCAATAAGGCCCATCTNONE 
J090002O18AGCCCAATAAGGCCCATCTNONE 
J090007A08AGCCCAATAAGGCCCATCTNONE 
J090007F22AGCCCAATAAGGCCCATCTNONE 
J090008D09AGCCCAATAAGGCCCATCTNONE 
J090008L07AGCCCAATAAGGCCCATCTNONE 
J090008O08AGCCCAATAAGGCCCATCTNONE 
J090012N11AGCCCAATAAGGCCCATCTNONE 
J090013M05AGCCCAATAAGGCCCATCTNONE 
J090020E08AGCCCAATAAGGCCCATCTNONE 
J090020O20AGCCCAATAAGGCCCATCTNONE 
J090021I10AGCCCAATAAGGCCCATCTNONE 
J090023D07AGCCCAATAAGGCCCATCTNONE 
J090023K22AGCCCAATAAGGCCCATCTNONE 
J090023O08AGCCCAATAAGGCCCATCTNONE 
J090028D21AGCCCAATAAGGCCCATCTNONE 
J090029H14AGCCCAATAAGGCCCATCTNONE 
J090029L12AGCCCAATAAGGCCCATCTNONE 
J090030C05AGCCCAATAAGGCCCATCTNONE 
J090031D18AGCCCAATAAGGCCCATCTNONE 
J090032G10AGCCCAATAAGGCCCATCTNONE 
J090034J22AGCCCAATAAGGCCCATCTNONE 
J090034K16AGCCCAATAAGGCCCATCTNONE 
J090036D10AGCCCAATAAGGCCCATCTNONE 
J090037N17AGCCCAATAAGGCCCATCTNONE 
J090043P17AGCCCAATAAGGCCCATCTNONE 
J090044L20AGCCCAATAAGGCCCATCTNONE 
J090045N16AGCCCAATAAGGCCCATCTNONE 
J090048K03AGCCCAATAAGGCCCATCTNONE 
J090048K10AGCCCAATAAGGCCCATCTNONE 
J090049O07AGCCCAATAAGGCCCATCTNONE 
J090055H23AGCCCAATAAGGCCCATCTNONE 
J090056G12AGCCCAATAAGGCCCATCTNONE 
J090056G16AGCCCAATAAGGCCCATCTNONE 
J090059B16AGCCCAATAAGGCCCATCTNONE 
J090066H21AGCCCAATAAGGCCCATCTNONE 
J090067D22AGCCCAATAAGGCCCATCTNONE 
J090072M07AGCCCAATAAGGCCCATCTNONE 
J090073J21AGCCCAATAAGGCCCATCTNONE 
J090075A15AGCCCAATAAGGCCCATCTNONE 
J090079J09AGCCCAATAAGGCCCATCTNONE 
J090080L07AGCCCAATAAGGCCCATCTNONE 
J090084A03AGCCCAATAAGGCCCATCTNONE 
J090085B07AGCCCAATAAGGCCCATCTNONE 
J090088H11AGCCCAATAAGGCCCATCTNONE 
J090090J12AGCCCAATAAGGCCCATCTNONE 
J090091I21AGCCCAATAAGGCCCATCTNONE 
J090091L02AGCCCAATAAGGCCCATCTNONE 
J090093G18AGCCCAATAAGGCCCATCTNONE 
J090094D23AGCCCAATAAGGCCCATCTNONE 
J090098L19AGCCCAATAAGGCCCATCTNONE 
J100017I22AGCCCAATAAGGCCCATCTNONE 
J100018F08AGCCCAATAAGGCCCATCTNONE 
J100018G19AGCCCAATAAGGCCCATCTNONE 
J100019B05AGCCCAATAAGGCCCATCTNONE 
J100019J18AGCCCAATAAGGCCCATCTNONE 
J100019L04AGCCCAATAAGGCCCATCTNONE 
J100023M06AGCCCAATAAGGCCCATCTNONE 
J100024J23AGCCCAATAAGGCCCATCTNONE 
J100024P09AGCCCAATAAGGCCCATCTNONE 
J100027I05AGCCCAATAAGGCCCATCTNONE 
J100029G03AGCCCAATAAGGCCCATCTNONE 
J100029K08AGCCCAATAAGGCCCATCTNONE 
J100031J17AGCCCAATAAGGCCCATCTNONE 
J100037L16AGCCCAATAAGGCCCATCTNONE 
J100038C05AGCCCAATAAGGCCCATCTNONE 
J100039D19AGCCCAATAAGGCCCATCTNONE 
J100041L02AGCCCAATAAGGCCCATCTNONE 
J100045B08AGCCCAATAAGGCCCATCTNONE 
J100045B15AGCCCAATAAGGCCCATCTNONE 
J100047G07AGCCCAATAAGGCCCATCTNONE 
J100047P19AGCCCAATAAGGCCCATCTNONE 
J100048I15AGCCCAATAAGGCCCATCTNONE 
J100049M16AGCCCAATAAGGCCCATCTNONE 
J100049P18AGCCCAATAAGGCCCATCTNONE 
J100050E21AGCCCAATAAGGCCCATCTNONE 
J100051N02AGCCCAATAAGGCCCATCTNONE 
J100052M02AGCCCAATAAGGCCCATCTNONE 
J100055M24AGCCCAATAAGGCCCATCTNONE 
J100056K11AGCCCAATAAGGCCCATCTNONE 
J100059F20AGCCCAATAAGGCCCATCTNONE 
J100059J15AGCCCAATAAGGCCCATCTNONE 
J100068C19AGCCCAATAAGGCCCATCTNONE 
J100068G06AGCCCAATAAGGCCCATCTNONE 
J100069N02AGCCCAATAAGGCCCATCTNONE 
J100073N04AGCCCAATAAGGCCCATCTNONE 
J100074B05AGCCCAATAAGGCCCATCTNONE 
J100080P13AGCCCAATAAGGCCCATCTNONE 
J100083P09AGCCCAATAAGGCCCATCTNONE 
J100084B11AGCCCAATAAGGCCCATCTNONE 
J100085B07AGCCCAATAAGGCCCATCTNONE 
J100086O20AGCCCAATAAGGCCCATCTNONE 
J100087B02AGCCCAATAAGGCCCATCTNONE 
J100089B14AGCCCAATAAGGCCCATCTNONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0143500006-072-G06TATTGGGCCTANONE 
016-053-H02TATTGGGCCTANONE 
AK061094TATTGGGCCTANONE 
AK071122TATTGGGCCTAGlycosyl transferase, family 14 protein. 
J023081E17TATTGGGCCTANONE 
J023106O18TATTGGGCCTANONE 
J043001N22TATTGGGCCTANONE 
J065062D05TATTGGGCCTANONE 
J065099M15TATTGGGCCTANONE 
J065180K12TATTGGGCCTANONE 
J090045L23TATTGGGCCTANONE 
J100088K05TATTGGGCCTANONE 
Os08g0161700009-088-D09AAATGGGCCTTATTGGGCCGGGCCNONE 
009-131-H02AAATGGGCCTTATTGGGCCGGGCCNONE 
009-182-D04AAATGGGCCTTATTGGGCCGGGCCNONE 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
J075002M21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075090H12AAATGGGCCTTATTGGGCCGGGCCNONE 
J075129C21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075146N03AAATGGGCCTTATTGGGCCGGGCCNONE 
J075178P18AAATGGGCCTTATTGGGCCGGGCCNONE 
J075190M03AAATGGGCCTTATTGGGCCGGGCCNONE 
J090030G01AAATGGGCCTTATTGGGCCGGGCCNONE 
J100088M23AAATGGGCCTTATTGGGCCGGGCCNONE 
Os08g0178100AK101717TATTGGGCTTCPep3/Vps18/deep orange domain containing protein. 
Os08g0335600006-111-H02TATTGGGCNONE 
AK106063TATTGGGCDOMON related domain containing protein. 
Os08g0441400011-033-F01AGCCCAATANONE 
015-084-B04AGCCCAATANONE 
AK063317AGCCCAATANONE 
AK064141AGCCCAATAConserved hypothetical protein. 
J065060F06AGCCCAATANONE 
J075110A22AGCCCAATANONE 
J080307P11AGCCCAATANONE 
J090041E06AGCCCAATANONE 
Os08g0450800AK102479TATTGGGCTPhosphatidylinositol-4-phosphate 5-kinase family protein. 
Os08g0451101009-086-F06TATTGGGCCCCAProtein of unknown function DUF581 family protein. 
J065021F04TATTGGGCCCCANONE 
J080014E10TATTGGGCCCCANONE 
Os08g0500900AK102314TATTGGGCCTTSimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0511000AK107578TATTGGGCCTGGProtein prenyltransferase domain containing protein. 
Os08g0535600AK121683ATGGCCCAATAZinc finger, Tim10/DDP-type family protein. 
J065077E05ATGGCCCAATANONE 
J075088M24ATGGCCCAATANONE 
J075140B03ATGGCCCAATANONE 
J090014B14ATGGCCCAATANONE 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os09g0240500009-064-F01TATTGGGCCGCNONE 
009-169-F01TATTGGGCCGCNONE 
AK062192TATTGGGCCGCNONE 
Os09g0321300AK122141TATTGGGCCAGATTGGGCCATNONE 
Os09g0380400009-200-D01TATTGGGCNONE 
AK063909TATTGGGCNONE 
AK072517TATTGGGCConserved hypothetical protein. 
AK073073TATTGGGCNONE 
J065205F20TATTGGGCNONE 
J100036D22TATTGGGCNONE 
J100047M01TATTGGGCNONE 
J100071G04TATTGGGCNONE 
Os09g0437900AK107833CTGGCCCAATASimilar to Adrenodoxin. 
Os09g0471900AK073815TATTGGGCBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0497400AK058354CTCGGCCCAATANONE 
AK068677CTCGGCCCAATAProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19CTCGGCCCAATANONE 
J023011D22CTCGGCCCAATANONE 
J023081K05CTCGGCCCAATANONE 
J033060O14CTCGGCCCAATANONE 
J075020I08CTCGGCCCAATANONE 
J075034J03CTCGGCCCAATANONE 
J075049M15CTCGGCCCAATANONE 
J075065K02CTCGGCCCAATANONE 
J075099L06CTCGGCCCAATANONE 
Os09g0516800009-017-A01AAAGCCCAATAConserved hypothetical protein. 
Os09g0528100009-173-A08TATTGGGCCAANONE 
009-190-G12TATTGGGCCAANONE 
AK059096TATTGGGCCAASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0534000AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0538700Os09g0538700GCGGCCCACGCCCAATAGlutelin family protein. 
Os11g0127700AK103742AAAAGCCCAATAHypothetical protein. 
J090083M11AAAAGCCCAATANONE 
Os11g0132700AK103286GCCCAATACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0146700AK065900GAAGCCCAATANONE 
AK072412GAAGCCCAATARED-like, C-terminal family protein. 
Os11g0153700AK058576AAAGCCCAATAGGGCCCATATSimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0163500AK101154GAGGCCCAATAHomeodomain-like containing protein. 
Os11g0219400AK069850TATTGGGCCGTGCCTGGGCCGTGAnkyrin repeat containing protein. 
AK099123TATTGGGCCGTGCCTGGGCCGTGNONE 
J023143G18TATTGGGCCGTGCCTGGGCCGTGNONE 
Os11g0545000011-025-F09CCCGGCCCAACTCAGCCCAATANONE 
AK058871CCCGGCCCAACTCAGCCCAATAConserved hypothetical protein. 
AK063297CCCGGCCCAACTCAGCCCAATANONE 
AK100607CCCGGCCCAACTCAGCCCAATANONE 
Os11g0640000Os11g0640000TCGGCCCAATANB-ARC domain containing protein. 
Os12g0112250J013069O10TATTGGGCCGCASaposin B domain containing protein. 
J065206G04TATTGGGCCGCANONE 
J080302C06TATTGGGCCGCANONE 
J080306K06TATTGGGCCGCANONE 
J080307O09TATTGGGCCGCANONE 
J080310J07TATTGGGCCGCANONE 
J080311G18TATTGGGCCGCANONE 
J080318C07TATTGGGCCGCANONE 
Os12g0131300J090086B06GCCCAATAHypothetical protein. 
Os12g0133600AK103096TATTGGGCCGCAConserved hypothetical protein. 
J033118M03TATTGGGCCGCANONE 
Os12g0136200AK068700TATTGGGCTGANONE 
AK069493TATTGGGCTGAWD40-like domain containing protein. 
Os12g0178800014-070-H03AGCCCAATANONE 
AK063709AGCCCAATAConserved hypothetical protein. 
Os12g0506600015-086-B07GCCCAATANONE 
AK106422GCCCAATAConserved hypothetical protein. 
Os12g0527850Os12g0527850TATTGGGCProtein prenyltransferase domain containing protein. 
Os12g0554400AK104059TATTGGGCTTTNONE 
Os12g0610100Os12g0610100TACGGCCCAATAConserved hypothetical protein. 
Os12g0615300AK119448TATTGGGCCGCAEGF-like calcium-binding domain containing protein. 
Os12g0618300AK060811TATTGGGCNONE 
J013109C17TATTGGGCNONE 
J013170J06TATTGGGCNONE 
J023138D11TATTGGGCNONE 
J033024P07TATTGGGCNONE 
J033040I12TATTGGGCNONE 
J075161G03TATTGGGCNONE 
J100025A17TATTGGGCNONE 
J100090G08TATTGGGCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.