version

Summary of OsREG597 (All List)

OrganismOryza sativa  
IDOsREG597  
SequenceGCCCACAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1426  

Entry Sequences (1426 entries)

LocusGene modelSequenceDescription
Os01g0139600AK073130TTGTGGGCTTGGSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0184500AK060699AGCCCACAADEAD/DEAH box helicase, N-terminal domain containing protein. 
Os01g0196600AK101742AGCCCACAANONE 
U25430AGCCCACAASimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0239700AK067723ACCGGGCCCACAASimilar to Leucine-rich receptor-like protein kinase. 
AK122130ACCGGGCCCACAANONE 
Os01g0299400AK107814GAGGCCCACAASterile alpha motif homology domain containing protein. 
J065112H10GAGGCCCACAANONE 
Os01g0313300AJ575219GCCCACAANONE 
AK111775GCCCACAASimilar to EREBP-3 protein (Fragment). 
J023075G11GCCCACAANONE 
J065086L01GCCCACAANONE 
J065161K09GCCCACAANONE 
J075019P13GCCCACAANONE 
Os01g0348700009-125-H02CAAGGCCCAATCGGCCCACAANONE 
009-156-F08CAAGGCCCAATCGGCCCACAANONE 
009-177-A11CAAGGCCCAATCGGCCCACAANONE 
009-195-D02CAAGGCCCAATCGGCCCACAANONE 
013-040-B06CAAGGCCCAATCGGCCCACAANONE 
013-051-B09CAAGGCCCAATCGGCCCACAANONE 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
J013071O22CAAGGCCCAATCGGCCCACAANONE 
J023022J07CAAGGCCCAATCGGCCCACAANONE 
J033028J08CAAGGCCCAATCGGCCCACAANONE 
J033109M11CAAGGCCCAATCGGCCCACAANONE 
J043022K15CAAGGCCCAATCGGCCCACAANONE 
J043031N11CAAGGCCCAATCGGCCCACAANONE 
J053023I10CAAGGCCCAATCGGCCCACAANONE 
J053045F16CAAGGCCCAATCGGCCCACAANONE 
J053054F22CAAGGCCCAATCGGCCCACAANONE 
J053094P15CAAGGCCCAATCGGCCCACAANONE 
J065048F01CAAGGCCCAATCGGCCCACAANONE 
J075012F16CAAGGCCCAATCGGCCCACAANONE 
J075089C09CAAGGCCCAATCGGCCCACAANONE 
J075179J20CAAGGCCCAATCGGCCCACAANONE 
J080305E19CAAGGCCCAATCGGCCCACAANONE 
J080309B21CAAGGCCCAATCGGCCCACAANONE 
J090017L05CAAGGCCCAATCGGCCCACAANONE 
J090058B11CAAGGCCCAATCGGCCCACAANONE 
Os01g0392600J065002C11ATGGCCCACAANONE 
J065101G17ATGGCCCACAANONE 
J065104H18ATGGCCCACAANONE 
J100041A03ATGGCCCACAANONE 
Os01g0613900014-018-D04ACCGGCCCACAANONE 
AK119181ACCGGCCCACAAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14ACCGGCCCACAANONE 
J065019A15ACCGGCCCACAANONE 
J075090J10ACCGGCCCACAANONE 
J075195H12ACCGGCCCACAANONE 
Os01g0723000AK073592TTGTGGGCCCGSimilar to Elongation factor EF-2 (Fragment). 
AK102586TTGTGGGCCCGNONE 
J033048F11TTGTGGGCCCGNONE 
J033098E24TTGTGGGCCCGNONE 
Os01g0737900012-087-D12TTGTGGGCCCCNONE 
AK072600TTGTGGGCCCCProtein prenyltransferase domain containing protein. 
J023006E12TTGTGGGCCCCNONE 
J023130A18TTGTGGGCCCCNONE 
J023134O05TTGTGGGCCCCNONE 
Os01g0739000AK069568CCAAGCCCACAASimilar to Mitochondrial processing peptidase. 
AK073810CCAAGCCCACAANONE 
J013042N17CCAAGCCCACAANONE 
J023128N16CCAAGCCCACAANONE 
J033024F18CCAAGCCCACAANONE 
J033037D09CCAAGCCCACAANONE 
J033050E17CCAAGCCCACAANONE 
J033065K22CCAAGCCCACAANONE 
J033070E13CCAAGCCCACAANONE 
J033087A13CCAAGCCCACAANONE 
Os01g0757400AB110177TTGTGGGCNONE 
AK058626TTGTGGGCNONE 
AK102585TTGTGGGCNONE 
AK105474TTGTGGGCSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
J033098E22TTGTGGGCNONE 
J033105O19TTGTGGGCNONE 
J065019C21TTGTGGGCNONE 
J090082H11TTGTGGGCNONE 
J100050B19TTGTGGGCNONE 
J100078H19TTGTGGGCNONE 
Os01g0770500AK071653TTGTGGGCNONE 
AK099603TTGTGGGCSimilar to ABC transporter ATP-binding protein. 
Os01g0836400AK068741TTGTGGGCCCAAACNONE 
AK073540TTGTGGGCCCAAACSAC3/GANP family protein. 
J023019D11TTGTGGGCCCAAACNONE 
J023139O22TTGTGGGCCCAAACNONE 
J033042J20TTGTGGGCCCAAACNONE 
J033046M18TTGTGGGCCCAAACNONE 
J033124J09TTGTGGGCCCAAACNONE 
J090015E05TTGTGGGCCCAAACNONE 
J090076J09TTGTGGGCCCAAACNONE 
Os01g0839300AK064685TTGGCCCACAASimilar to 50S ribosomal protein L17. 
J065060I21TTGGCCCACAANONE 
Os01g0853800006-033-H02ACAGCCCACAANONE 
006-037-A10ACAGCCCACAANONE 
006-038-F10ACAGCCCACAANONE 
006-054-E01ACAGCCCACAANONE 
006-067-E10ACAGCCCACAANONE 
012-015-G05ACAGCCCACAANONE 
AK069147ACAGCCCACAAC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929ACAGCCCACAANONE 
AK106144ACAGCCCACAANONE 
AK106186ACAGCCCACAANONE 
J023007P09ACAGCCCACAANONE 
J023007P10ACAGCCCACAANONE 
J065084L10ACAGCCCACAANONE 
J065179B10ACAGCCCACAANONE 
J065186D16ACAGCCCACAANONE 
J075040I08ACAGCCCACAANONE 
J075043K21ACAGCCCACAANONE 
J075051J08ACAGCCCACAANONE 
J075061D24ACAGCCCACAANONE 
J075095H04ACAGCCCACAANONE 
J075145J12ACAGCCCACAANONE 
J075148O18ACAGCCCACAANONE 
J075187J05ACAGCCCACAANONE 
J090042A20ACAGCCCACAANONE 
J100025K01ACAGCCCACAANONE 
Os01g0889000AK103621TTGTGGGCCGGTTetratricopeptide-like helical domain containing protein. 
Os01g0914000AK101364TTGTGGGCTTTConserved hypothetical protein. 
J080302O10TTGTGGGCTTTNONE 
J080305G04TTGTGGGCTTTNONE 
J080316B11TTGTGGGCTTTNONE 
J090049A14TTGTGGGCTTTNONE 
J090066O10TTGTGGGCTTTNONE 
Os01g0924000004-020-C09CGGGCCCACAANONE 
004-020-C09GAAGCCCACAANONE 
005-014-A06CGGGCCCACAANONE 
005-014-A06GAAGCCCACAANONE 
009-085-G12CGGGCCCACAANONE 
009-085-G12GAAGCCCACAANONE 
009-123-A08CGGGCCCACAANONE 
009-123-A08GAAGCCCACAANONE 
009-134-A05CGGGCCCACAANONE 
009-134-A05GAAGCCCACAANONE 
009-137-F06CGGGCCCACAANONE 
009-137-F06GAAGCCCACAANONE 
016-016-B08CGGGCCCACAANONE 
016-016-B08GAAGCCCACAANONE 
AF050674CGGGCCCACAANONE 
AF050674GAAGCCCACAANONE 
AK061690CGGGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK061690GAAGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797CGGGCCCACAANONE 
AK120797GAAGCCCACAANONE 
J013040A15CGGGCCCACAANONE 
J013040A15GAAGCCCACAANONE 
J013104L20CGGGCCCACAANONE 
J013104L20GAAGCCCACAANONE 
J013127E12CGGGCCCACAANONE 
J013127E12GAAGCCCACAANONE 
J013158O05CGGGCCCACAANONE 
J013158O05GAAGCCCACAANONE 
J023012E09CGGGCCCACAANONE 
J023012E09GAAGCCCACAANONE 
J023126L23CGGGCCCACAANONE 
J023126L23GAAGCCCACAANONE 
J023143B03CGGGCCCACAANONE 
J023143B03GAAGCCCACAANONE 
J065005B16CGGGCCCACAANONE 
J065005B16GAAGCCCACAANONE 
J065101J15CGGGCCCACAANONE 
J065101J15GAAGCCCACAANONE 
J065105K16CGGGCCCACAANONE 
J065105K16GAAGCCCACAANONE 
J065155K16CGGGCCCACAANONE 
J065155K16GAAGCCCACAANONE 
J065171M17CGGGCCCACAANONE 
J065171M17GAAGCCCACAANONE 
J065182F07CGGGCCCACAANONE 
J065182F07GAAGCCCACAANONE 
J065187D10CGGGCCCACAANONE 
J065187D10GAAGCCCACAANONE 
J065194I24CGGGCCCACAANONE 
J065194I24GAAGCCCACAANONE 
J065207E24CGGGCCCACAANONE 
J065207E24GAAGCCCACAANONE 
J075001C24CGGGCCCACAANONE 
J075001C24GAAGCCCACAANONE 
J075090O10CGGGCCCACAANONE 
J075090O10GAAGCCCACAANONE 
J075095H17CGGGCCCACAANONE 
J075095H17GAAGCCCACAANONE 
J075109M24CGGGCCCACAANONE 
J075109M24GAAGCCCACAANONE 
J075123C18CGGGCCCACAANONE 
J075123C18GAAGCCCACAANONE 
J075148G22CGGGCCCACAANONE 
J075148G22GAAGCCCACAANONE 
J090009B09CGGGCCCACAANONE 
J090009B09GAAGCCCACAANONE 
J090075K17CGGGCCCACAANONE 
J090075K17GAAGCCCACAANONE 
J090081H23CGGGCCCACAANONE 
J090081H23GAAGCCCACAANONE 
J090097H21CGGGCCCACAANONE 
J090097H21GAAGCCCACAANONE 
J100063P14CGGGCCCACAANONE 
J100063P14GAAGCCCACAANONE 
Os01g0962600009-104-A04AGCCCACAANONE 
AK073846AGCCCACAASimilar to 40S ribosomal protein S10-1. 
J033070I05AGCCCACAANONE 
J065079N18AGCCCACAANONE 
J065122H12AGCCCACAANONE 
J065197O14AGCCCACAANONE 
Os02g0241100Os02g0241100TTGTGGGCTGGProtein kinase-like domain containing protein. 
Os02g0452800J043024P15TTGTGGGCTGCConserved hypothetical protein. 
Os02g0506600AK107967CCTCGCCCACAAConserved hypothetical protein. 
J065142J01CCTCGCCCACAANONE 
J100044B16CCTCGCCCACAANONE 
J100079K18CCTCGCCCACAANONE 
J100086M04CCTCGCCCACAANONE 
Os02g0621600AK071074CACGGCCCACAANONE 
AK108575CACGGCCCACAAConserved hypothetical protein. 
J023078O20CACGGCCCACAANONE 
J075025M01CACGGCCCACAANONE 
J090047L11CACGGCCCACAANONE 
Os02g0643500AK068423TCTCGGCCCACAAPentapeptide repeat containing protein. 
Os02g0666800AK101444TAGGCCCACAAProtein of unknown function DUF788 family protein. 
J033039F09TAGGCCCACAANONE 
J065041E15TAGGCCCACAANONE 
J075087I24TAGGCCCACAANONE 
J100079A10TAGGCCCACAANONE 
Os02g0699700AK072471AGGGCCCACAASimilar to DNA topoisomerase II. 
Os02g0717100014-089-G06AGCCCACAANONE 
AK063741AGCCCACAAEsterase/lipase/thioesterase domain containing protein. 
J065052A22AGCCCACAANONE 
Os02g0725100AK071759TTGTGGGCCCCNONE 
Os02g0725200005-020-F05CCAGCCCACAANONE 
AK058309CCAGCCCACAANONE 
AK103602CCAGCCCACAARubisco methyltransferase family protein. 
J013109C13CCAGCCCACAANONE 
J033133G01CCAGCCCACAANONE 
J075087L23CCAGCCCACAANONE 
J090073J10CCAGCCCACAANONE 
Os02g0733500AK108506TTGTGGGCCCCParvalbumin family protein. 
Os02g0741500AK068867ACAGCCCACAARibbon-helix-helix domain containing protein. 
Os02g0749800013-004-C10TTGTGGGCGTGGANONE 
016-002-A10TTGTGGGCGTGGANONE 
AK064731TTGTGGGCGTGGAMitochodrial transcription termination factor-related family protein. 
AK065868TTGTGGGCGTGGANONE 
J013043F09TTGTGGGCGTGGANONE 
J065005K17TTGTGGGCGTGGANONE 
Os02g0762300AK106684GAAGCCCACAAProtein of unknown function UPF0021 family protein. 
J090060M09GAAGCCCACAANONE 
J100083E05GAAGCCCACAANONE 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0817600006-085-G03TTGTGGGCCCCACANONE 
AJ748648TTGTGGGCCCCACANONE 
AK069892TTGTGGGCCCCACAAUX/IAA protein family protein. 
AK104501TTGTGGGCCCCACANONE 
AK104802TTGTGGGCCCCACANONE 
J013027H10TTGTGGGCCCCACANONE 
J013106L07TTGTGGGCCCCACANONE 
J013118N15TTGTGGGCCCCACANONE 
J013131H01TTGTGGGCCCCACANONE 
J013170C08TTGTGGGCCCCACANONE 
J023060C13TTGTGGGCCCCACANONE 
J033024K10TTGTGGGCCCCACANONE 
J033052I08TTGTGGGCCCCACANONE 
J090010H15TTGTGGGCCCCACANONE 
J090011J11TTGTGGGCCCCACANONE 
J090038P15TTGTGGGCCCCACANONE 
J090060B02TTGTGGGCCCCACANONE 
J100079J16TTGTGGGCCCCACANONE 
Os02g0819700AK067374TCGGCCCACAAZinc finger, Zim17-type family protein. 
AK099160TCGGCCCACAANONE 
J100086K17TCGGCCCACAANONE 
Os02g0826500012-012-E08TTGTGGGCNONE 
AK061860TTGTGGGCNONE 
AK099841TTGTGGGCNONE 
J013038F16TTGTGGGCNONE 
J013092F12TTGTGGGCNONE 
J013092L01TTGTGGGCNONE 
J013099D20TTGTGGGCNONE 
J013102I16TTGTGGGCNONE 
J013157H22TTGTGGGCNONE 
J023049K03TTGTGGGCNONE 
J023067E07TTGTGGGCNONE 
J023068O03TTGTGGGCNONE 
J023121N24TTGTGGGCNONE 
J023128P22TTGTGGGCNONE 
J023145D23TTGTGGGCNONE 
J033040E22TTGTGGGCNONE 
J033076I20TTGTGGGCNONE 
J033076P05TTGTGGGCNONE 
J033094M20TTGTGGGCNONE 
J033105P16TTGTGGGCNONE 
J033121M23TTGTGGGCNONE 
J033126G23TTGTGGGCNONE 
J033126G24TTGTGGGCNONE 
J033136E24TTGTGGGCNONE 
J033143C07TTGTGGGCNONE 
J043004H13TTGTGGGCNONE 
J043010K20TTGTGGGCNONE 
J043027D20TTGTGGGCNONE 
J065033J09TTGTGGGCNONE 
J065043H05TTGTGGGCNONE 
J065044K01TTGTGGGCNONE 
J065168K06TTGTGGGCNONE 
J065176P05TTGTGGGCNONE 
J065211P20TTGTGGGCNONE 
J075081K09TTGTGGGCNONE 
J075114A21TTGTGGGCNONE 
J075153P08TTGTGGGCNONE 
J075166D13TTGTGGGCNONE 
J075198N02TTGTGGGCNONE 
J090009M11TTGTGGGCNONE 
J090011P20TTGTGGGCNONE 
J090013K12TTGTGGGCNONE 
J090016L23TTGTGGGCNONE 
J090032F14TTGTGGGCNONE 
J090033B17TTGTGGGCNONE 
J090047D21TTGTGGGCNONE 
J090062O03TTGTGGGCNONE 
J090075L23TTGTGGGCNONE 
J090081N05TTGTGGGCNONE 
J090096J18TTGTGGGCNONE 
J090097O05TTGTGGGCNONE 
J090098G16TTGTGGGCNONE 
J100049D19TTGTGGGCNONE 
J100064I10TTGTGGGCNONE 
J100071A10TTGTGGGCNONE 
J100074J03TTGTGGGCNONE 
Os03g0101400AK120679TTGTGGGCConserved hypothetical protein. 
J013162J03TTGTGGGCNONE 
Os03g0143000AK073102TTGTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24TTGTGGGCCTCNONE 
Os03g0143400AK073999TAGGCCCACAACCCGGCCCATTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21TAGGCCCACAACCCGGCCCATTNONE 
J033073C08TAGGCCCACAACCCGGCCCATTNONE 
J033094C19TAGGCCCACAACCCGGCCCATTNONE 
J065017L10TAGGCCCACAACCCGGCCCATTNONE 
J065070H22TAGGCCCACAACCCGGCCCATTNONE 
J065079M09TAGGCCCACAACCCGGCCCATTNONE 
J065091N18TAGGCCCACAACCCGGCCCATTNONE 
J065109N03TAGGCCCACAACCCGGCCCATTNONE 
J065113F05TAGGCCCACAACCCGGCCCATTNONE 
J065135D23TAGGCCCACAACCCGGCCCATTNONE 
J065156L16TAGGCCCACAACCCGGCCCATTNONE 
J065207O04TAGGCCCACAACCCGGCCCATTNONE 
J065208F03TAGGCCCACAACCCGGCCCATTNONE 
J090010M15TAGGCCCACAACCCGGCCCATTNONE 
J090056J18TAGGCCCACAACCCGGCCCATTNONE 
Os03g0182800003-126-E06GCCCACAANONE 
AJ304840GCCCACAANONE 
AK073133GCCCACAANONE 
AY323478GCCCACAASimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13GCCCACAANONE 
J033028C22GCCCACAANONE 
J033042J03GCCCACAANONE 
J065022E13GCCCACAANONE 
J065208N24GCCCACAANONE 
J100034B17GCCCACAANONE 
J100035J21GCCCACAANONE 
J100039L16GCCCACAANONE 
J100040A02GCCCACAANONE 
J100051L11GCCCACAANONE 
J100064F07GCCCACAANONE 
J100070J12GCCCACAANONE 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0219200011-045-E01TAGGCCCACAANONE 
AK073785TAGGCCCACAASimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19TAGGCCCACAANONE 
J043009H23TAGGCCCACAANONE 
Os03g0231600AK105963GCCCACAASimilar to Branched-chain-amino-acid aminotransferase 3, chloroplast precursor (EC 2.6.1.42) (Atbcat-3). 
AK120579GCCCACAANONE 
Os03g0240500003-116-E06AGCCCACAANONE 
AK058676AGCCCACAASimilar to Toc34-2 protein. 
AK099032AGCCCACAANONE 
J013128A13AGCCCACAANONE 
J075064H17AGCCCACAANONE 
J075075N03AGCCCACAANONE 
J075079H24AGCCCACAANONE 
J075127D23AGCCCACAANONE 
J075132C09AGCCCACAANONE 
J075159D02AGCCCACAANONE 
J090053O11AGCCCACAANONE 
J090062N04AGCCCACAANONE 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0267800AK069586TTGTGGGCLIM, zinc-binding domain containing protein. 
Os03g0300600003-125-G06AAGGCCCACAANONE 
006-048-C04AAGGCCCACAANONE 
009-044-A09AAGGCCCACAANONE 
AK059801AAGGCCCACAANONE 
AK066250AAGGCCCACAASimilar to Chaperone protein dnaJ. 
AK069897AAGGCCCACAANONE 
AK104186AAGGCCCACAANONE 
J065197D15AAGGCCCACAANONE 
J090031C11AAGGCCCACAANONE 
J100024C23AAGGCCCACAANONE 
J100030B16AAGGCCCACAANONE 
J100033K12AAGGCCCACAANONE 
J100043M19AAGGCCCACAANONE 
J100056N09AAGGCCCACAANONE 
J100058E12AAGGCCCACAANONE 
J100084J08AAGGCCCACAANONE 
Os03g0312300AK111364GCCCACAAProtein of unknown function DUF26 domain containing protein. 
Os03g0316200009-196-H10AGGGCCCACAANONE 
013-011-H03AGGGCCCACAANONE 
014-031-F04AGGGCCCACAANONE 
014-083-C08AGGGCCCACAANONE 
AK071812AGGGCCCACAASimilar to Galactinol synthase (Fragment). 
AK103958AGGGCCCACAANONE 
J023054E12AGGGCCCACAANONE 
J023075G21AGGGCCCACAANONE 
J023113D08AGGGCCCACAANONE 
J065067M09AGGGCCCACAANONE 
J065102E07AGGGCCCACAANONE 
J065103M07AGGGCCCACAANONE 
Os03g0321000AK103653CAAGCCCACAASimilar to Steroid membrane binding protein-like. 
Os03g0331900AK063044AGCCCACAANONE 
AK099570AGCCCACAAConserved hypothetical protein. 
J065064G01AGCCCACAANONE 
Os03g0334800AK101595TTGTGGGCTTTLung seven transmembrane receptor family protein. 
J023110B03TTGTGGGCTTTNONE 
J065102E22TTGTGGGCTTTNONE 
J065102F24TTGTGGGCTTTNONE 
J065140O22TTGTGGGCTTTNONE 
J075001N09TTGTGGGCTTTNONE 
J075057F24TTGTGGGCTTTNONE 
J075197K01TTGTGGGCTTTNONE 
J090080D05TTGTGGGCTTTNONE 
Os03g0352800009-030-G08AAGGCCCACAAGGCCCNONE 
AK059673AAGGCCCACAAGGCCCSimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17AAGGCCCACAAGGCCCNONE 
J075050N19AAGGCCCACAAGGCCCNONE 
J075104J18AAGGCCCACAAGGCCCNONE 
J075142K05AAGGCCCACAAGGCCCNONE 
J100050I19AAGGCCCACAAGGCCCNONE 
J100057N04AAGGCCCACAAGGCCCNONE 
Os03g0390700AB110190GAAGCCCACAANONE 
AK103600GAAGCCCACAASimilar to Transthyretin-like protein. 
J065188H06GAAGCCCACAANONE 
Os03g0418700AK099879GCCCACAANONE 
AK101797GCCCACAAConserved hypothetical protein. 
Os03g0563300006-086-B06TTGTGGGCTTTNONE 
006-102-B09TTGTGGGCTTTNONE 
AK060389TTGTGGGCTTTNONE 
AK070720TTGTGGGCTTTSimilar to Mg-chelatase subunit (Fragment). 
AK071134TTGTGGGCTTTNONE 
AK104435TTGTGGGCTTTNONE 
J013128N14TTGTGGGCTTTNONE 
J023041F09TTGTGGGCTTTNONE 
J023056M13TTGTGGGCTTTNONE 
J023078K03TTGTGGGCTTTNONE 
J023132N12TTGTGGGCTTTNONE 
J023134B01TTGTGGGCTTTNONE 
J033093B14TTGTGGGCTTTNONE 
Os03g0647500015-025-E10CTCGGCCCACAANONE 
AK064308CTCGGCCCACAAConserved hypothetical protein. 
AK103649CTCGGCCCACAANONE 
J033135D01CTCGGCCCACAANONE 
Os03g0725300011-085-E09AGCCCACAANONE 
AK063969AGCCCACAASimilar to Dbr1-prov protein. 
AK073636AGCCCACAANONE 
J033050L15AGCCCACAANONE 
J053082G03AGCCCACAANONE 
Os03g0735200011-051-E04TGTGGGCCCACAANONE 
AK063345TGTGGGCCCACAATetratricopeptide-like helical domain containing protein. 
Os03g0736300AK070408GCCCACAAGCCCCCACSimilar to CEL6=CELLULASE 6 (Fragment). 
AK104929GCCCACAAGCCCCCACNONE 
Os03g0766900AK066137AGCCCACAAAllene oxide synthase. 
AK071361AGCCCACAANONE 
AK103989AGCCCACAANONE 
J023090K09AGCCCACAANONE 
J043022H11AGCCCACAANONE 
J053078F12AGCCCACAANONE 
Os03g0772800009-023-E05GAAGCCCACAANONE 
009-059-F12GAAGCCCACAANONE 
009-114-B08GAAGCCCACAANONE 
009-115-G09GAAGCCCACAANONE 
009-151-D08GAAGCCCACAANONE 
009-158-A10GAAGCCCACAANONE 
009-191-H02GAAGCCCACAANONE 
009-192-E05GAAGCCCACAANONE 
009-197-F11GAAGCCCACAANONE 
AK059576GAAGCCCACAANONE 
AK121608GAAGCCCACAACytochrome c oxidase, subunit VIa family protein. 
J023087H20GAAGCCCACAANONE 
J023105P14GAAGCCCACAANONE 
J033026P15GAAGCCCACAANONE 
J033042K10GAAGCCCACAANONE 
J033133C09GAAGCCCACAANONE 
J065123K13GAAGCCCACAANONE 
J075190D03GAAGCCCACAANONE 
J080310M14GAAGCCCACAANONE 
J080317L14GAAGCCCACAANONE 
J100067J19GAAGCCCACAANONE 
J100079H21GAAGCCCACAANONE 
Os03g0784500AK109744ACAGGTGGGGCCCACAANONE 
Os03g0785200003-116-B06TTGTGGGCCTGANONE 
J013098I23TTGTGGGCCTGANONE 
J023002I24TTGTGGGCCTGAMitochodrial transcription termination factor-related family protein. 
J075150G04TTGTGGGCCTGANONE 
Os03g0822900AK099787CACGGCCCACAAZinc finger, BED-type predicted domain containing protein. 
J013042C24CACGGCCCACAANONE 
J013096O21CACGGCCCACAANONE 
J023109I23CACGGCCCACAANONE 
J033106N09CACGGCCCACAANONE 
J033107H03CACGGCCCACAANONE 
J033118G03CACGGCCCACAANONE 
J033145I24CACGGCCCACAANONE 
J065138D15CACGGCCCACAANONE 
J065140L13CACGGCCCACAANONE 
J065179M13CACGGCCCACAANONE 
J065200F05CACGGCCCACAANONE 
J075104F20CACGGCCCACAANONE 
J075143A15CACGGCCCACAANONE 
J075197J11CACGGCCCACAANONE 
Os03g0829000AK071107TTGTGGGCCATFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTGTGGGCCATNONE 
AK121596TTGTGGGCCATNONE 
J065045C17TTGTGGGCCATNONE 
J065068E23TTGTGGGCCATNONE 
J065083N15TTGTGGGCCATNONE 
J065166P10TTGTGGGCCATNONE 
J065189B13TTGTGGGCCATNONE 
J090082J08TTGTGGGCCATNONE 
J100030P13TTGTGGGCCATNONE 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os03g0851900AK102145TAGGCCCACAAAFG1-like ATPase family protein. 
J033086B08TAGGCCCACAANONE 
Os04g0325300AK071605TTGTGGGCHypothetical protein. 
Os04g0440100AK101324TTGTGGGCTTANONE 
AK105415TTGTGGGCTTANonsense-mediated decay UPF3 domain containing protein. 
Os04g0448600006-043-F06AGCCCACAANONE 
AK068709AGCCCACAAChaC-like protein family protein. 
AK104134AGCCCACAANONE 
J065034G07AGCCCACAANONE 
J065071O11AGCCCACAANONE 
J065120F08AGCCCACAANONE 
J065143K01AGCCCACAANONE 
J065154B20AGCCCACAANONE 
J065158N11AGCCCACAANONE 
J065170A03AGCCCACAANONE 
J065180H19AGCCCACAANONE 
J065192D07AGCCCACAANONE 
J075004F21AGCCCACAANONE 
J075083D04AGCCCACAANONE 
J075092K14AGCCCACAANONE 
J075116G09AGCCCACAANONE 
J075156B11AGCCCACAANONE 
J075197L06AGCCCACAANONE 
J090020M13AGCCCACAANONE 
Os04g0490000AK108365TTGTGGGCCGTASimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0503500AK099404CGGGCCCACAALeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CGGGCCCACAANONE 
Os04g0530300009-053-E04TTGTGGGCNONE 
009-074-E03TTGTGGGCNONE 
AK066705TTGTGGGCConserved hypothetical protein. 
Os04g0539500003-115-C01TTGTGGGCNONE 
009-065-C11TTGTGGGCNONE 
011-097-A01TTGTGGGCNONE 
012-041-A08TTGTGGGCNONE 
015-002-H06TTGTGGGCNONE 
015-003-C08TTGTGGGCNONE 
015-037-F04TTGTGGGCNONE 
015-037-H08TTGTGGGCNONE 
AK060574TTGTGGGCZinc finger, GATA-type domain containing protein. 
AK099144TTGTGGGCNONE 
AK119611TTGTGGGCNONE 
J023055K24TTGTGGGCNONE 
J065171O16TTGTGGGCNONE 
Os04g0550200AK108473CTGGCCCACAAPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0552300006-074-A08GCCCACAANONE 
AK061100GCCCACAANegative regulatory factor PREG family protein. 
Os04g0577500006-039-C03CCCGGCCCACAANONE 
006-043-H01CCCGGCCCACAANONE 
AK061538CCCGGCCCACAANONE 
AK065648CCCGGCCCACAATatD-related deoxyribonuclease family protein. 
AK104763CCCGGCCCACAANONE 
J013035E21CCCGGCCCACAANONE 
J013066M11CCCGGCCCACAANONE 
J100026B02CCCGGCCCACAANONE 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0606800009-159-H11GTGGGGCCCACAAGTCAGTGGNONE 
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein. 
J033070J06GTGGGGCCCACAAGTCAGTGGNONE 
J033119D03GTGGGGCCCACAAGTCAGTGGNONE 
J100043F05GTGGGGCCCACAAGTCAGTGGNONE 
J100050A01GTGGGGCCCACAAGTCAGTGGNONE 
Os04g0619500011-051-B09AGCCCACAANONE 
016-006-B12AGCCCACAANONE 
016-012-H10AGCCCACAANONE 
AK066247AGCCCACAAOvarian tumour, otubain domain containing protein. 
J013052H21AGCCCACAANONE 
J033136I05AGCCCACAANONE 
J090080J12AGCCCACAANONE 
J100065N24AGCCCACAANONE 
J100087L02AGCCCACAANONE 
Os04g0635000009-031-A05GCCCACAANONE 
009-074-F05GCCCACAANONE 
009-163-H03GCCCACAANONE 
AK062619GCCCACAAConserved hypothetical protein. 
Os04g0636900011-028-G03TTGTGGGCTGTTGGGCTNONE 
012-040-G03TTGTGGGCTGTTGGGCTNONE 
AK058405TTGTGGGCTGTTGGGCTNONE 
AK065789TTGTGGGCTGTTGGGCTNONE 
AK101408TTGTGGGCTGTTGGGCTNONE 
AK119286TTGTGGGCTGTTGGGCTNONE 
J013042J24TTGTGGGCTGTTGGGCTNONE 
J033037I12TTGTGGGCTGTTGGGCTNONE 
J043031B12TTGTGGGCTGTTGGGCTNONE 
J065152N10TTGTGGGCTGTTGGGCTNONE 
J090060K17TTGTGGGCTGTTGGGCTNONE 
J090083K14TTGTGGGCTGTTGGGCTNONE 
J100046O13TTGTGGGCTGTTGGGCTNONE 
J100066G22TTGTGGGCTGTTGGGCTNONE 
Os04g0660600009-113-A11TTGTGGGCCCAAACNONE 
AK120899TTGTGGGCCCAAACATPase, V0 complex, subunit H family protein. 
J023030J05TTGTGGGCCCAAACNONE 
J065068M07TTGTGGGCCCAAACNONE 
J065120G22TTGTGGGCCCAAACNONE 
J065168J18TTGTGGGCCCAAACNONE 
J065211M10TTGTGGGCCCAAACNONE 
J075175E21TTGTGGGCCCAAACNONE 
J090021C06TTGTGGGCCCAAACNONE 
J090032P15TTGTGGGCCCAAACNONE 
J090082E05TTGTGGGCCCAAACNONE 
J100090O11TTGTGGGCCCAAACNONE 
Os04g0682300AK061384TTGTGGGCCGGTSimilar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2). 
AK104004TTGTGGGCCGGTNONE 
J033102P12TTGTGGGCCGGTNONE 
J100038F01TTGTGGGCCGGTNONE 
Os05g0119200AK067943GCCCACAAConserved hypothetical protein. 
J013122C02GCCCACAANONE 
J065077M14GCCCACAANONE 
J065108P21GCCCACAANONE 
J065138G20GCCCACAANONE 
J065148H07GCCCACAANONE 
J065205P09GCCCACAANONE 
J075061H16GCCCACAANONE 
J075140H13GCCCACAANONE 
J075153H02GCCCACAANONE 
J075170B14GCCCACAANONE 
Os05g0121000009-181-E02TTGTGGGCCTTNONE 
AK058867TTGTGGGCCTTNONE 
AK071341TTGTGGGCCTTProtein of unknown function DUF1218 family protein. 
J023024H24TTGTGGGCCTTNONE 
J023090B22TTGTGGGCCTTNONE 
J023111G15TTGTGGGCCTTNONE 
J023134K14TTGTGGGCCTTNONE 
J033057C05TTGTGGGCCTTNONE 
J033067J15TTGTGGGCCTTNONE 
J033084L15TTGTGGGCCTTNONE 
J033088B04TTGTGGGCCTTNONE 
J043027A08TTGTGGGCCTTNONE 
J043029L03TTGTGGGCCTTNONE 
J053031K22TTGTGGGCCTTNONE 
J053046I01TTGTGGGCCTTNONE 
J053070B05TTGTGGGCCTTNONE 
J053072C10TTGTGGGCCTTNONE 
J065097M22TTGTGGGCCTTNONE 
J065164I17TTGTGGGCCTTNONE 
J075058I08TTGTGGGCCTTNONE 
J075064C09TTGTGGGCCTTNONE 
J080304C16TTGTGGGCCTTNONE 
J080304H16TTGTGGGCCTTNONE 
J080306E17TTGTGGGCCTTNONE 
J080310L03TTGTGGGCCTTNONE 
J080316J07TTGTGGGCCTTNONE 
J080317L23TTGTGGGCCTTNONE 
J080319A10TTGTGGGCCTTNONE 
J090060F01TTGTGGGCCTTNONE 
J100042N16TTGTGGGCCTTNONE 
J100047F05TTGTGGGCCTTNONE 
J100075J19TTGTGGGCCTTNONE 
Os05g0155100006-075-B02AAGGCCCAAACCAGCCCACAANONE 
AK061929AAGGCCCAAACCAGCCCACAANONE 
AK102810AAGGCCCAAACCAGCCCACAANONE 
AK120877AAGGCCCAAACCAGCCCACAASimilar to 60S ribosomal protein L18. 
J013023E03AAGGCCCAAACCAGCCCACAANONE 
J013038C16AAGGCCCAAACCAGCCCACAANONE 
J013120M14AAGGCCCAAACCAGCCCACAANONE 
J013153B04AAGGCCCAAACCAGCCCACAANONE 
J013159B07AAGGCCCAAACCAGCCCACAANONE 
J023012A02AAGGCCCAAACCAGCCCACAANONE 
J023027F08AAGGCCCAAACCAGCCCACAANONE 
J023027I12AAGGCCCAAACCAGCCCACAANONE 
J023120F05AAGGCCCAAACCAGCCCACAANONE 
J023138O03AAGGCCCAAACCAGCCCACAANONE 
J023142H13AAGGCCCAAACCAGCCCACAANONE 
J023143P06AAGGCCCAAACCAGCCCACAANONE 
J033023P09AAGGCCCAAACCAGCCCACAANONE 
J033035O14AAGGCCCAAACCAGCCCACAANONE 
J033042N19AAGGCCCAAACCAGCCCACAANONE 
J033043B12AAGGCCCAAACCAGCCCACAANONE 
J033065D10AAGGCCCAAACCAGCCCACAANONE 
J033081A12AAGGCCCAAACCAGCCCACAANONE 
J033084N05AAGGCCCAAACCAGCCCACAANONE 
J033085M03AAGGCCCAAACCAGCCCACAANONE 
J033112D15AAGGCCCAAACCAGCCCACAANONE 
J033114O07AAGGCCCAAACCAGCCCACAANONE 
J033119D15AAGGCCCAAACCAGCCCACAANONE 
J033140E06AAGGCCCAAACCAGCCCACAANONE 
J033141K23AAGGCCCAAACCAGCCCACAANONE 
J043040I22AAGGCCCAAACCAGCCCACAANONE 
J053050B21AAGGCCCAAACCAGCCCACAANONE 
J053065I18AAGGCCCAAACCAGCCCACAANONE 
J053074O16AAGGCCCAAACCAGCCCACAANONE 
J065072K13AAGGCCCAAACCAGCCCACAANONE 
J065211I09AAGGCCCAAACCAGCCCACAANONE 
J090004K04AAGGCCCAAACCAGCCCACAANONE 
J090016L06AAGGCCCAAACCAGCCCACAANONE 
J090040F22AAGGCCCAAACCAGCCCACAANONE 
J090063F22AAGGCCCAAACCAGCCCACAANONE 
J090081J09AAGGCCCAAACCAGCCCACAANONE 
J100032A10AAGGCCCAAACCAGCCCACAANONE 
J100037G20AAGGCCCAAACCAGCCCACAANONE 
J100056O10AAGGCCCAAACCAGCCCACAANONE 
J100071D10AAGGCCCAAACCAGCCCACAANONE 
J100075K13AAGGCCCAAACCAGCCCACAANONE 
J100079F16AAGGCCCAAACCAGCCCACAANONE 
J100080O16AAGGCCCAAACCAGCCCACAANONE 
J100086N05AAGGCCCAAACCAGCCCACAANONE 
Os05g0182700003-102-E07TTGTGGGCCGAGATNONE 
011-019-D04TTGTGGGCCGAGATNONE 
013-068-D09TTGTGGGCCGAGATNONE 
014-032-G03TTGTGGGCCGAGATNONE 
AK065911TTGTGGGCCGAGATProtein of unknown function DUF1664 family protein. 
AK104343TTGTGGGCCGAGATNONE 
J013045E01TTGTGGGCCGAGATNONE 
J013156L15TTGTGGGCCGAGATNONE 
J023029P17TTGTGGGCCGAGATNONE 
J023134I24TTGTGGGCCGAGATNONE 
J033099A10TTGTGGGCCGAGATNONE 
J033115L16TTGTGGGCCGAGATNONE 
J090007M24TTGTGGGCCGAGATNONE 
J090019F02TTGTGGGCCGAGATNONE 
Os05g0203800AK111723GAAGCCCACAASimilar to MADS box protein. 
J023023K24GAAGCCCACAANONE 
J023027E19GAAGCCCACAANONE 
Os05g0219800AK102822GGCCCGCAGCCCACAASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0411300014-098-D05TTGTGGGCCCAGATNONE 
015-093-F04TTGTGGGCCCAGATNONE 
AK071931TTGTGGGCCCAGATConserved hypothetical protein. 
AK073142TTGTGGGCCCAGATNONE 
Os05g0415600AK065818GTGGCCCACAAACTGGGCCCTNONE 
AK065818TTGTGGGCNONE 
J013042K21GTGGCCCACAAACTGGGCCCTNONE 
J013042K21TTGTGGGCNONE 
J013114E15GTGGCCCACAAACTGGGCCCTNONE 
J013114E15TTGTGGGCNONE 
J013131H02GTGGCCCACAAACTGGGCCCTNONE 
J013131H02TTGTGGGCNONE 
J023041G06GTGGCCCACAAACTGGGCCCTNONE 
J023041G06TTGTGGGCNONE 
J100037M21GTGGCCCACAAACTGGGCCCTNONE 
J100037M21TTGTGGGCNONE 
Os05g0445500009-021-C05TTGTGGGCTNONE 
009-129-D11TTGTGGGCTNONE 
009-147-E04TTGTGGGCTNONE 
009-169-C11TTGTGGGCTNONE 
AK121459TTGTGGGCTSimilar to 60S acidic ribosomal protein P2B. 
D21114TTGTGGGCTNONE 
J023001K23TTGTGGGCTNONE 
J023107J19TTGTGGGCTNONE 
J023143J09TTGTGGGCTNONE 
J065049D04TTGTGGGCTNONE 
J065092I06TTGTGGGCTNONE 
J065188H04TTGTGGGCTNONE 
Os05g0459900AK058918CAAGCCCACAASimilar to 60S ribosomal protein L36-1. 
AK111268CAAGCCCACAANONE 
J013129N08CAAGCCCACAANONE 
J065191E01CAAGCCCACAANONE 
J065216P03CAAGCCCACAANONE 
J075089K21CAAGCCCACAANONE 
Os05g0470800011-027-A06TTGTGGGCCTCNONE 
AK069780TTGTGGGCCTCBacterial surface antigen (D15) family protein. 
J023007A20TTGTGGGCCTCNONE 
J023028F19TTGTGGGCCTCNONE 
J023081E20TTGTGGGCCTCNONE 
J023089D13TTGTGGGCCTCNONE 
J023115D18TTGTGGGCCTCNONE 
J033087E22TTGTGGGCCTCNONE 
J033143O14TTGTGGGCCTCNONE 
Os05g0494100AK068320GGTGGGGCCCACAAHistone-fold domain containing protein. 
Os05g0534400AK101368GCCCACAASimilar to Calcineurin B-like protein 4 (SALT OVERLY SENSITIVE 3 protein). 
J033035L13GCCCACAANONE 
J065045H07GCCCACAANONE 
Os05g0541500AK101190AGCCCACAACyclin-like F-box domain containing protein. 
AK101531AGCCCACAANONE 
J033030F10AGCCCACAANONE 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os06g0102600J065187I04TTGTGGGCCCTHypothetical protein. 
Os06g0134300AK071534TTGTGGGCTACTGGGCCATConserved hypothetical protein. 
J023106E03TTGTGGGCTACTGGGCCATNONE 
J075172D02TTGTGGGCTACTGGGCCATNONE 
J100047B13TTGTGGGCTACTGGGCCATNONE 
Os06g0168600AK068858GCCCACAASimilar to Ribonucleotide reductase. 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
Os06g0316100011-089-C01TCAGCCCACAANONE 
015-030-D11TCAGCCCACAANONE 
015-044-H10TCAGCCCACAANONE 
AK105260TCAGCCCACAAConserved hypothetical protein. 
AK119646TCAGCCCACAANONE 
Os06g0515400AK071571TTGTGGGCCTGAConserved hypothetical protein. 
Os06g0608500AK060097CTGGCCCACAANONE 
AK070667CTGGCCCACAASnf7 family protein. 
Os06g0633100AK107791GTCGCGTCGCGTCGCGCCCACAAConserved hypothetical protein. 
J065001N11GTCGCGTCGCGTCGCGCCCACAANONE 
Os06g0644100006-034-H12GAAGCCCACAANONE 
009-111-A04GAAGCCCACAANONE 
009-153-H08GAAGCCCACAANONE 
AK059777GAAGCCCACAACarboxypeptidase regulatory region domain containing protein. 
J023011D18GAAGCCCACAANONE 
J043030D15GAAGCCCACAANONE 
J053079B12GAAGCCCACAANONE 
J053079F07GAAGCCCACAANONE 
J065006C11GAAGCCCACAANONE 
J065007D15GAAGCCCACAANONE 
J065012C09GAAGCCCACAANONE 
J065019J01GAAGCCCACAANONE 
J065034K17GAAGCCCACAANONE 
J065040M09GAAGCCCACAANONE 
J065059B09GAAGCCCACAANONE 
J065070A22GAAGCCCACAANONE 
J065099A13GAAGCCCACAANONE 
J065141F08GAAGCCCACAANONE 
J065152G12GAAGCCCACAANONE 
J065181I04GAAGCCCACAANONE 
J065198E17GAAGCCCACAANONE 
J065201N23GAAGCCCACAANONE 
J065202M07GAAGCCCACAANONE 
J065208F11GAAGCCCACAANONE 
J090031B20GAAGCCCACAANONE 
J090099B14GAAGCCCACAANONE 
J100032C05GAAGCCCACAANONE 
J100057O07GAAGCCCACAANONE 
J100077M07GAAGCCCACAANONE 
J100081E21GAAGCCCACAANONE 
Os06g0655500006-087-C07TTGTGGGCNONE 
AK069365TTGTGGGCCyclin-like F-box domain containing protein. 
AK105987TTGTGGGCNONE 
J013159N11TTGTGGGCNONE 
J023014H04TTGTGGGCNONE 
J090094E19TTGTGGGCNONE 
Os06g0695400AK073198AGCCCACAAHaem peroxidase family protein. 
J033022I15AGCCCACAANONE 
Os07g0123000AK070836GCCCATTAGGCCCACAACyclin-like F-box domain containing protein. 
Os07g0256200AK072904GCCCGGCCCACAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCCCGGCCCACAANONE 
Os07g0267200J075099I16GCCCACAAConserved hypothetical protein. 
J075146K01GCCCACAANONE 
J075183F14GCCCACAANONE 
Os07g0437500AK060367GCCCACAANONE 
Os07g0469100009-036-F03TTGTGGGCTCGTGGGCCACNONE 
009-126-D06TTGTGGGCTCGTGGGCCACNONE 
009-190-A01TTGTGGGCTCGTGGGCCACNONE 
AK061626TTGTGGGCTCGTGGGCCACNONE 
AK120365TTGTGGGCTCGTGGGCCACSimilar to Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor. 
J013068P10TTGTGGGCTCGTGGGCCACNONE 
J053066C23TTGTGGGCTCGTGGGCCACNONE 
J065011K15TTGTGGGCTCGTGGGCCACNONE 
J065053E15TTGTGGGCTCGTGGGCCACNONE 
J065167F21TTGTGGGCTCGTGGGCCACNONE 
J075065G04TTGTGGGCTCGTGGGCCACNONE 
J075146A09TTGTGGGCTCGTGGGCCACNONE 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0577400AK100831TTGTGGGCTTGNONE 
J013095B12TTGTGGGCTTGNONE 
J023123D09TTGTGGGCTTGNONE 
J065002E19TTGTGGGCTTGNONE 
J065135H07TTGTGGGCTTGNONE 
J065150N01TTGTGGGCTTGNONE 
Os07g0627700AK070893AAAAGCCCACAASterol desaturase family protein. 
AK110696AAAAGCCCACAANONE 
J065068I04AAAAGCCCACAANONE 
J065121P07AAAAGCCCACAANONE 
Os07g0647100AK065269TTGTGGGCArmadillo-like helical domain containing protein. 
J013002K24TTGTGGGCNONE 
Os08g0118900AK109749AAGGCCCACAAAdenylate kinase family protein. 
Os08g0135100AK108618TTGTGGGCCCAGGSimilar to Phosphate/phosphoenolpyruvate translocator protein-like. 
Os08g0158900AK067062TTGTGGGCTGGGTP1/OBG domain containing protein. 
J013089F04TTGTGGGCTGGNONE 
J013092D16TTGTGGGCTGGNONE 
J033120K14TTGTGGGCTGGNONE 
J033133F24TTGTGGGCTGGNONE 
J033145A10TTGTGGGCTGGNONE 
J033145A11TTGTGGGCTGGNONE 
J053048H24TTGTGGGCTGGNONE 
J053075H10TTGTGGGCTGGNONE 
Os08g0159000AK073617CCAGCCCACAANONE 
AK103973CCAGCCCACAASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CCAGCCCACAANONE 
J033051J11CCAGCCCACAANONE 
J065101C10CCAGCCCACAANONE 
J065168B04CCAGCCCACAANONE 
J065184E22CCAGCCCACAANONE 
J080021D11CCAGCCCACAANONE 
J080025H10CCAGCCCACAANONE 
J080026N19CCAGCCCACAANONE 
J080034A12CCAGCCCACAANONE 
J080040L02CCAGCCCACAANONE 
J080042H19CCAGCCCACAANONE 
J080047B05CCAGCCCACAANONE 
J080047E09CCAGCCCACAANONE 
J080047I01CCAGCCCACAANONE 
J080052H19CCAGCCCACAANONE 
J080062K13CCAGCCCACAANONE 
J080063A22CCAGCCCACAANONE 
J080068G18CCAGCCCACAANONE 
J080068N19CCAGCCCACAANONE 
J080076G08CCAGCCCACAANONE 
J080077H13CCAGCCCACAANONE 
J080077K06CCAGCCCACAANONE 
J080093D15CCAGCCCACAANONE 
J080094D21CCAGCCCACAANONE 
J080097A20CCAGCCCACAANONE 
J080097E21CCAGCCCACAANONE 
J080097N17CCAGCCCACAANONE 
J100071K18CCAGCCCACAANONE 
J100072F09CCAGCCCACAANONE 
Os08g0167500006-063-D04AAGGCCCATATGGGCCCACAANONE 
006-066-G09AAGGCCCATATGGGCCCACAANONE 
AK061061AAGGCCCATATGGGCCCACAAConserved hypothetical protein. 
AK071197AAGGCCCATATGGGCCCACAANONE 
J023082N10AAGGCCCATATGGGCCCACAANONE 
Os08g0237000003-111-F01ACAGCCCACAANONE 
006-022-H07ACAGCCCACAANONE 
006-028-G01ACAGCCCACAANONE 
006-032-D10ACAGCCCACAANONE 
006-039-F08ACAGCCCACAANONE 
006-039-H01ACAGCCCACAANONE 
006-051-E01ACAGCCCACAANONE 
006-053-E11ACAGCCCACAANONE 
006-055-E09ACAGCCCACAANONE 
006-061-H02ACAGCCCACAANONE 
006-062-G07ACAGCCCACAANONE 
006-074-D07ACAGCCCACAANONE 
006-074-F11ACAGCCCACAANONE 
006-076-F03ACAGCCCACAANONE 
006-080-G01ACAGCCCACAANONE 
006-081-A03ACAGCCCACAANONE 
006-084-F05ACAGCCCACAANONE 
006-085-B08ACAGCCCACAANONE 
006-089-C03ACAGCCCACAANONE 
006-090-B12ACAGCCCACAANONE 
006-092-D04ACAGCCCACAANONE 
006-095-E05ACAGCCCACAANONE 
006-100-C12ACAGCCCACAANONE 
006-109-C03ACAGCCCACAANONE 
006-114-E09ACAGCCCACAANONE 
009-033-G02ACAGCCCACAANONE 
009-189-F09ACAGCCCACAANONE 
009-200-A08ACAGCCCACAANONE 
009-200-D07ACAGCCCACAANONE 
AB110604ACAGCCCACAAXyloglucan endotransglycosylase/hydrolase protein 8 precursor (EC 2.4.1.207) (End-xyloglucan transferase) (OsXTH8) (OsXRT5). 
AK060654ACAGCCCACAANONE 
AK104451ACAGCCCACAANONE 
Os08g0333000AK108356GCCCACAASimilar to F7O18.23 protein (SWP1) (Struwwelpeter 1 protein). 
Os08g0387500AK105106TCCACGCCGCCCACAASimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0520100AK059686TTTTGGGCCCACAANONE 
AK120052TTTTGGGCCCACAAPseudouridine synthase domain containing protein. 
Os08g0522300AK111038TTGTGGGCConserved hypothetical protein. 
Os08g0530200009-166-A09AGCCCACAATAATGGGCCAGNONE 
AK062052AGCCCACAATAATGGGCCAGNONE 
AK120448AGCCCACAATAATGGGCCAGSimilar to 60S ribosomal protein L17. 
J013100M19AGCCCACAATAATGGGCCAGNONE 
J023045K22AGCCCACAATAATGGGCCAGNONE 
J033046D13AGCCCACAATAATGGGCCAGNONE 
J033066N01AGCCCACAATAATGGGCCAGNONE 
J033143N05AGCCCACAATAATGGGCCAGNONE 
J053070P13AGCCCACAATAATGGGCCAGNONE 
J065011C18AGCCCACAATAATGGGCCAGNONE 
J065013C23AGCCCACAATAATGGGCCAGNONE 
J065016B09AGCCCACAATAATGGGCCAGNONE 
J065016C21AGCCCACAATAATGGGCCAGNONE 
J065023K18AGCCCACAATAATGGGCCAGNONE 
J065028F12AGCCCACAATAATGGGCCAGNONE 
J065030L02AGCCCACAATAATGGGCCAGNONE 
J065042H15AGCCCACAATAATGGGCCAGNONE 
J065078H02AGCCCACAATAATGGGCCAGNONE 
J065092D07AGCCCACAATAATGGGCCAGNONE 
J065092E01AGCCCACAATAATGGGCCAGNONE 
J065104M21AGCCCACAATAATGGGCCAGNONE 
J065119P21AGCCCACAATAATGGGCCAGNONE 
J065124B15AGCCCACAATAATGGGCCAGNONE 
J065146H09AGCCCACAATAATGGGCCAGNONE 
J065149L09AGCCCACAATAATGGGCCAGNONE 
J065156A09AGCCCACAATAATGGGCCAGNONE 
J065157H23AGCCCACAATAATGGGCCAGNONE 
J065165L14AGCCCACAATAATGGGCCAGNONE 
J065165M18AGCCCACAATAATGGGCCAGNONE 
J065172O03AGCCCACAATAATGGGCCAGNONE 
J065192M18AGCCCACAATAATGGGCCAGNONE 
J065198D21AGCCCACAATAATGGGCCAGNONE 
J065200D05AGCCCACAATAATGGGCCAGNONE 
J065202B20AGCCCACAATAATGGGCCAGNONE 
J065212P11AGCCCACAATAATGGGCCAGNONE 
J065215E08AGCCCACAATAATGGGCCAGNONE 
J065217P19AGCCCACAATAATGGGCCAGNONE 
J075005I19AGCCCACAATAATGGGCCAGNONE 
J075134J06AGCCCACAATAATGGGCCAGNONE 
J075162G12AGCCCACAATAATGGGCCAGNONE 
J075178H07AGCCCACAATAATGGGCCAGNONE 
J075186K01AGCCCACAATAATGGGCCAGNONE 
J080315I17AGCCCACAATAATGGGCCAGNONE 
J080318P19AGCCCACAATAATGGGCCAGNONE 
J090004H16AGCCCACAATAATGGGCCAGNONE 
J090020A16AGCCCACAATAATGGGCCAGNONE 
J090047J12AGCCCACAATAATGGGCCAGNONE 
J090080E07AGCCCACAATAATGGGCCAGNONE 
J090090H23AGCCCACAATAATGGGCCAGNONE 
J100021G24AGCCCACAATAATGGGCCAGNONE 
J100037L04AGCCCACAATAATGGGCCAGNONE 
J100043L09AGCCCACAATAATGGGCCAGNONE 
J100044A10AGCCCACAATAATGGGCCAGNONE 
Os08g0532300009-122-A05CCTGTCAGTTTGTGGGCCCACCTNONE 
009-129-H05CCTGTCAGTTTGTGGGCCCACCTNONE 
AB011262CCTGTCAGTTTGTGGGCCCACCTNONE 
AK065141CCTGTCAGTTTGTGGGCCCACCTNONE 
AK119730CCTGTCAGTTTGTGGGCCCACCTSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CCTGTCAGTTTGTGGGCCCACCTNONE 
J013042K23CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057J08CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J023113C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J053054E03CCTGTCAGTTTGTGGGCCCACCTNONE 
J053062B07CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075O17CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075P09CCTGTCAGTTTGTGGGCCCACCTNONE 
J065024H05CCTGTCAGTTTGTGGGCCCACCTNONE 
J065049F22CCTGTCAGTTTGTGGGCCCACCTNONE 
J065063L03CCTGTCAGTTTGTGGGCCCACCTNONE 
J065102O07CCTGTCAGTTTGTGGGCCCACCTNONE 
J065104M12CCTGTCAGTTTGTGGGCCCACCTNONE 
J065119E04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065153E10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065168M24CCTGTCAGTTTGTGGGCCCACCTNONE 
J065173I10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065181L04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065184I18CCTGTCAGTTTGTGGGCCCACCTNONE 
J065203M15CCTGTCAGTTTGTGGGCCCACCTNONE 
J075004C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J075047B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J075055F18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075065G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J075094O14CCTGTCAGTTTGTGGGCCCACCTNONE 
J075143C22CCTGTCAGTTTGTGGGCCCACCTNONE 
J075153K18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075164N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J075197C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080001A01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080003B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080006G17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080007J06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080010H12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080014I01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080015C16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080016P19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080020G24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080021E12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080023I11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080024H24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080025G18CCTGTCAGTTTGTGGGCCCACCTNONE 
J080028H08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080030G08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080031H20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080034C20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080040H13CCTGTCAGTTTGTGGGCCCACCTNONE 
J080044M04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080047D02CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049D17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049J17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080050A05CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051K06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053A07CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053I08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080056L12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080061I19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080075G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J080078C23CCTGTCAGTTTGTGGGCCCACCTNONE 
J080080I21CCTGTCAGTTTGTGGGCCCACCTNONE 
J080084F04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080085K16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097A12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097N01CCTGTCAGTTTGTGGGCCCACCTNONE 
J090027L10CCTGTCAGTTTGTGGGCCCACCTNONE 
J100034N17CCTGTCAGTTTGTGGGCCCACCTNONE 
Os08g0532400AK101608AGGTGGGCCCACAAACTGACAGGSimilar to AT.I.24-7 protein. 
Os08g0544500AK071354GCAGCCCACAASimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0557000AK059917TCGGCCCACAANONE 
AK100496TCGGCCCACAASimilar to Protein-L-isoaspartate O-methyltransferase. 
Os08g0558400AK071334GGTTGGGCCGCAGCCCACAASimilar to Kinesin heavy chain (Fragment). 
Os09g0247500AK109296GCCCACAAConserved hypothetical protein. 
J065062D13GCCCACAANONE 
J075042H17GCCCACAANONE 
Os09g0313500AK065687TTGTGGGCCCGDisease resistance protein family protein. 
J013039H12TTGTGGGCCCGNONE 
J090060B10TTGTGGGCCCGNONE 
Os09g0392400AK106799TTGTGGGCNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0411700005-017-C05CCAGGCCCACAANONE 
009-163-B01CCAGGCCCACAANONE 
AK058290CCAGGCCCACAAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919CCAGGCCCACAANONE 
AK121091CCAGGCCCACAANONE 
J013039D20CCAGGCCCACAANONE 
J023066F16CCAGGCCCACAANONE 
J023082H09CCAGGCCCACAANONE 
J023088H05CCAGGCCCACAANONE 
J065013G09CCAGGCCCACAANONE 
J065065C12CCAGGCCCACAANONE 
J065111I04CCAGGCCCACAANONE 
J065179H22CCAGGCCCACAANONE 
J075023N14CCAGGCCCACAANONE 
J090041J17CCAGGCCCACAANONE 
J100031J21CCAGGCCCACAANONE 
J100057A18CCAGGCCCACAANONE 
J100068P22CCAGGCCCACAANONE 
Os09g0439500AK067780GCCCACAASimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
Os09g0449400J023086D02GCAGCCCACAAZinc finger, C2H2-type domain containing protein. 
Os09g0457800011-043-E09AGCCCACAANONE 
015-049-D08AGCCCACAANONE 
AK101358AGCCCACAAAlpha-amylase isozyme 3C precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
J043020J09AGCCCACAANONE 
J043034A10AGCCCACAANONE 
J065025A07AGCCCACAANONE 
J065081G01AGCCCACAANONE 
J065111I18AGCCCACAANONE 
J065127L15AGCCCACAANONE 
J065130H08AGCCCACAANONE 
J065146E12AGCCCACAANONE 
J065192N20AGCCCACAANONE 
J065212D06AGCCCACAANONE 
Os09g0491708AK101825TTGTGGGCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK105419TTGTGGGCNONE 
Os09g0517800012-034-H10TTGTGGGCTGCNONE 
AK121391TTGTGGGCTGCCyclin-like F-box domain containing protein. 
J023129D04TTGTGGGCTGCNONE 
J043012D11TTGTGGGCTGCNONE 
Os09g0531900AK073015CCTCGCCCACAAATGGGCCGAAASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0532900AJ311052TTGTGGGCNONE 
AJ311053TTGTGGGCNONE 
AK106039TTGTGGGCNONE 
AK111740TTGTGGGCMyb, DNA-binding domain containing protein. 
AK121023TTGTGGGCNONE 
Os09g0537700006-021-B11GCCCACAANONE 
006-023-D11GCCCACAANONE 
006-023-G04GCCCACAANONE 
006-023-H04GCCCACAANONE 
006-025-H12GCCCACAANONE 
006-026-D06GCCCACAANONE 
006-029-A11GCCCACAANONE 
006-033-B12GCCCACAANONE 
006-033-C11GCCCACAANONE 
006-034-E11GCCCACAANONE 
006-043-D04GCCCACAANONE 
006-049-A09GCCCACAANONE 
006-052-D11GCCCACAANONE 
006-057-F02GCCCACAANONE 
006-062-F09GCCCACAANONE 
006-062-G02GCCCACAANONE 
006-064-H06GCCCACAANONE 
006-065-A07GCCCACAANONE 
006-065-F02GCCCACAANONE 
006-067-B07GCCCACAANONE 
006-071-B02GCCCACAANONE 
006-074-C02GCCCACAANONE 
006-080-F02GCCCACAANONE 
006-081-C01GCCCACAANONE 
006-081-D09GCCCACAANONE 
006-082-C09GCCCACAANONE 
006-082-F04GCCCACAANONE 
006-084-E11GCCCACAANONE 
006-090-C08GCCCACAANONE 
006-090-D06GCCCACAANONE 
006-093-F10GCCCACAANONE 
006-099-D09GCCCACAANONE 
006-099-H08GCCCACAANONE 
006-100-H07GCCCACAANONE 
006-102-E10GCCCACAANONE 
006-104-H12GCCCACAANONE 
006-105-A05GCCCACAANONE 
006-107-B08GCCCACAANONE 
006-108-A11GCCCACAANONE 
006-110-A12GCCCACAANONE 
006-110-F12GCCCACAANONE 
006-110-H12GCCCACAANONE 
006-112-B09GCCCACAANONE 
009-162-C06GCCCACAANONE 
009-188-E03GCCCACAANONE 
AK061438GCCCACAARibonuclease T2 family protein. 
AK098949GCCCACAANONE 
AK104221GCCCACAANONE 
AK104454GCCCACAANONE 
AK104509GCCCACAANONE 
AK104553GCCCACAANONE 
AK104599GCCCACAANONE 
AK104656GCCCACAANONE 
AK104888GCCCACAANONE 
AK119186GCCCACAANONE 
AY056038GCCCACAANONE 
AY061961GCCCACAANONE 
J013057M18GCCCACAANONE 
J065217A09GCCCACAANONE 
Os11g0118000AK100743CTGGCCCACAAEsterase/lipase/thioesterase domain containing protein. 
J023031M08CTGGCCCACAANONE 
J023118F07CTGGCCCACAANONE 
Os11g0127600015-021-H02TTGTGGGCTTCNONE 
016-038-B06TTGTGGGCTTCNONE 
016-079-H06TTGTGGGCTTCNONE 
016-085-G02TTGTGGGCTTCNONE 
016-086-C02TTGTGGGCTTCNONE 
AK067922TTGTGGGCTTCNo apical meristem (NAM) protein domain containing protein. 
J013121J10TTGTGGGCTTCNONE 
Os11g0132700AK103286TTGTGGGCCTCCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
AK103286TTGTGGGCTTCCGGCCCAAATCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0168200005-010-H01TTGTGGGCCAGAGCCCATCCNONE 
009-156-F07TTGTGGGCCAGAGCCCATCCNONE 
012-025-F01TTGTGGGCCAGAGCCCATCCNONE 
012-089-A02TTGTGGGCCAGAGCCCATCCNONE 
016-016-E08TTGTGGGCCAGAGCCCATCCNONE 
AK073392TTGTGGGCCAGAGCCCATCC60S ribosomal protein L3. 
AK099225TTGTGGGCCAGAGCCCATCCNONE 
AK101469TTGTGGGCCAGAGCCCATCCNONE 
AY236158TTGTGGGCCAGAGCCCATCCNONE 
J013152M22TTGTGGGCCAGAGCCCATCCNONE 
J023013N11TTGTGGGCCAGAGCCCATCCNONE 
J023038J11TTGTGGGCCAGAGCCCATCCNONE 
J023054N21TTGTGGGCCAGAGCCCATCCNONE 
J033041E13TTGTGGGCCAGAGCCCATCCNONE 
J033050O09TTGTGGGCCAGAGCCCATCCNONE 
J033093G05TTGTGGGCCAGAGCCCATCCNONE 
J033094J17TTGTGGGCCAGAGCCCATCCNONE 
J033112J24TTGTGGGCCAGAGCCCATCCNONE 
J033113D05TTGTGGGCCAGAGCCCATCCNONE 
J033120K10TTGTGGGCCAGAGCCCATCCNONE 
J033121H19TTGTGGGCCAGAGCCCATCCNONE 
J033129C08TTGTGGGCCAGAGCCCATCCNONE 
J033140H24TTGTGGGCCAGAGCCCATCCNONE 
J065020I18TTGTGGGCCAGAGCCCATCCNONE 
J065058L01TTGTGGGCCAGAGCCCATCCNONE 
J065059G22TTGTGGGCCAGAGCCCATCCNONE 
J065212L09TTGTGGGCCAGAGCCCATCCNONE 
J075047P09TTGTGGGCCAGAGCCCATCCNONE 
J075063C18TTGTGGGCCAGAGCCCATCCNONE 
J075076E07TTGTGGGCCAGAGCCCATCCNONE 
J075077F14TTGTGGGCCAGAGCCCATCCNONE 
J075086C22TTGTGGGCCAGAGCCCATCCNONE 
J075161L09TTGTGGGCCAGAGCCCATCCNONE 
J075177K20TTGTGGGCCAGAGCCCATCCNONE 
J090007L06TTGTGGGCCAGAGCCCATCCNONE 
J090010M02TTGTGGGCCAGAGCCCATCCNONE 
J090013M20TTGTGGGCCAGAGCCCATCCNONE 
J090044I15TTGTGGGCCAGAGCCCATCCNONE 
J090045O06TTGTGGGCCAGAGCCCATCCNONE 
J090060L04TTGTGGGCCAGAGCCCATCCNONE 
J090061C17TTGTGGGCCAGAGCCCATCCNONE 
J090062F10TTGTGGGCCAGAGCCCATCCNONE 
J090066L03TTGTGGGCCAGAGCCCATCCNONE 
J090089E13TTGTGGGCCAGAGCCCATCCNONE 
J090096D21TTGTGGGCCAGAGCCCATCCNONE 
J100039F12TTGTGGGCCAGAGCCCATCCNONE 
J100053N06TTGTGGGCCAGAGCCCATCCNONE 
Os11g0207000AK062074TTGTGGGCTTGNONE 
Os11g0208900AK100040TTGTGGGCNONE 
AK111797TTGTGGGCLeucine rich repeat containing protein kinase. 
J013031B13TTGTGGGCNONE 
J013031E12TTGTGGGCNONE 
J013102B19TTGTGGGCNONE 
J013119E13TTGTGGGCNONE 
J013151E16TTGTGGGCNONE 
J023022C12TTGTGGGCNONE 
J023102H15TTGTGGGCNONE 
J065077B10TTGTGGGCNONE 
J065160K21TTGTGGGCNONE 
Os11g0209100016-063-F03ATGGCCCACGCTTGTGGGCCTGNONE 
AK064391ATGGCCCACGCTTGTGGGCCTGCyclin-like F-box domain containing protein. 
J075027K02ATGGCCCACGCTTGTGGGCCTGNONE 
J075154K15ATGGCCCACGCTTGTGGGCCTGNONE 
Os11g0227600AK101375TTGTGGGCCGCAConserved hypothetical protein. 
AK102193TTGTGGGCCGCANONE 
J033087C03TTGTGGGCCGCANONE 
Os11g0242800006-026-C12CATGGGCCCACAANONE 
006-027-E07CATGGGCCCACAANONE 
006-060-A11CATGGGCCCACAANONE 
006-097-F07CATGGGCCCACAANONE 
006-102-B06CATGGGCCCACAANONE 
009-021-H11CATGGGCCCACAANONE 
009-057-A07CATGGGCCCACAANONE 
AK061295CATGGGCCCACAASimilar to ASCAB9-A (ASCAB9-B) (Fragment). 
AK098872CATGGGCCCACAANONE 
AK104824CATGGGCCCACAANONE 
J013001B10CATGGGCCCACAANONE 
J013046D18CATGGGCCCACAANONE 
J013047P13CATGGGCCCACAANONE 
J013109A01CATGGGCCCACAANONE 
J013155M11CATGGGCCCACAANONE 
J023029I09CATGGGCCCACAANONE 
J023043A13CATGGGCCCACAANONE 
J023050C07CATGGGCCCACAANONE 
J023062G03CATGGGCCCACAANONE 
J023063A04CATGGGCCCACAANONE 
J023067A08CATGGGCCCACAANONE 
J023079D02CATGGGCCCACAANONE 
J023080I10CATGGGCCCACAANONE 
J023112D03CATGGGCCCACAANONE 
J023114E15CATGGGCCCACAANONE 
J023117C14CATGGGCCCACAANONE 
J023120L05CATGGGCCCACAANONE 
J023126C08CATGGGCCCACAANONE 
J023143A07CATGGGCCCACAANONE 
J033107J22CATGGGCCCACAANONE 
J065051P10CATGGGCCCACAANONE 
J065204H19CATGGGCCCACAANONE 
J075004E22CATGGGCCCACAANONE 
J075014D01CATGGGCCCACAANONE 
J075021B03CATGGGCCCACAANONE 
J075024L01CATGGGCCCACAANONE 
J075028K23CATGGGCCCACAANONE 
J075059G21CATGGGCCCACAANONE 
J075072K15CATGGGCCCACAANONE 
J075115M14CATGGGCCCACAANONE 
J075116I04CATGGGCCCACAANONE 
J075117D23CATGGGCCCACAANONE 
J075128N14CATGGGCCCACAANONE 
J075132P13CATGGGCCCACAANONE 
J075134M02CATGGGCCCACAANONE 
J090079D09CATGGGCCCACAANONE 
Os11g0282900AK111488GCCCACAAConserved hypothetical protein. 
Os11g0549690J065085G07GCCCACAAConserved hypothetical protein. 
J065218B08GCCCACAANONE 
J090036H16GCCCACAANONE 
Os11g0567800AK065753TTGTGGGCSimilar to HcrVf2 protein. 
Os11g0575600AK073570TAAGCCCACAASimilar to Lipoxygenase (Fragment). 
Os11g0595200009-005-A06AGCCCACAATGTGGGCCCCACGNONE 
AK071115AGCCCACAATGTGGGCCCCACGNONE 
AK106159AGCCCACAATGTGGGCCCCACGPAP fibrillin family protein. 
AY387683AGCCCACAATGTGGGCCCCACGNONE 
AY387684AGCCCACAATGTGGGCCCCACGNONE 
J065166K17AGCCCACAATGTGGGCCCCACGNONE 
Os11g0610900AK106831GCCCACAASimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Fragment). 
Os12g0111600009-151-A07GCGGCCCACAANONE 
AK119685GCGGCCCACAANONE 
AK120264GCGGCCCACAAHypoxia induced protein conserved region family protein. 
J013047D01GCGGCCCACAANONE 
J023111D22GCGGCCCACAANONE 
J023128C07GCGGCCCACAANONE 
J065170J03GCGGCCCACAANONE 
J065198L01GCGGCCCACAANONE 
J100037I18GCGGCCCACAANONE 
J100073O19GCGGCCCACAANONE 
Os12g0131300J090086B06TTGTGGGCTTCCGGCCCAAATHypothetical protein. 
Os12g0133600AK103096TTGTGGGCCTTGConserved hypothetical protein. 
J033118M03TTGTGGGCCTTGNONE 
Os12g0150100009-047-B11GAAGCCCACAANONE 
AK105075GAAGCCCACAASimilar to 60S ribosomal protein L26A. 
J013067G22GAAGCCCACAANONE 
J033103F08GAAGCCCACAANONE 
J065029P11GAAGCCCACAANONE 
J065043B18GAAGCCCACAANONE 
J065123E16GAAGCCCACAANONE 
J065141O20GAAGCCCACAANONE 
J065161O04GAAGCCCACAANONE 
J065201M07GAAGCCCACAANONE 
J075058I23GAAGCCCACAANONE 
J075172J08GAAGCCCACAANONE 
J100040L13GAAGCCCACAANONE 
Os12g0204500011-012-A10TGGGGCCCACAANONE 
011-044-C12TGGGGCCCACAANONE 
AK069867TGGGGCCCACAAProtein of unknown function DUF579, plant family protein. 
J013039L02TGGGGCCCACAANONE 
J023038F14TGGGGCCCACAANONE 
J075123I24TGGGGCCCACAANONE 
Os12g0278900AK106816GAAGCCCACAAPeptidase C1A, papain family protein. 
Os12g0292900AK067612TTGTGGGCConserved hypothetical protein. 
Os12g0408000AK109709ATGGCCCACAAProtein of unknown function DUF594 family protein. 
J075021B20ATGGCCCACAANONE 
J075034G20ATGGCCCACAANONE 
J075087F21ATGGCCCACAANONE 
J075177E12ATGGCCCACAANONE 
J075194D14ATGGCCCACAANONE 
Os12g0572400016-084-F04ATGGCCCACAANONE 
AK065531ATGGCCCACAASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03ATGGCCCACAANONE 
J013034H02ATGGCCCACAANONE 
J033117N05ATGGCCCACAANONE 
J065027L09ATGGCCCACAANONE 
J065037D09ATGGCCCACAANONE 
J065197I09ATGGCCCACAANONE 
J090045C01ATGGCCCACAANONE 
J100031E11ATGGCCCACAANONE 
Os12g0607100006-108-B01GCCCACAANONE 
Os12g0633200009-073-D03TTGTGGGCTGANONE 
AK062615TTGTGGGCTGAErg28-like family protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.