version

Summary of OsREG598 (All List)

OrganismOryza sativa  
IDOsREG598  
SequenceGCCCACAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1450  

Entry Sequences (1450 entries)

LocusGene modelSequenceDescription
Os01g0158900AK066765TCAGCCCACACZinc finger, RING-type domain containing protein. 
Os01g0174300012-006-G02CCGTGGGCCCACACNONE 
AK071324CCGTGGGCCCACACNADH:cytochrome b5 reductase (CBR) family protein. 
AK104306CCGTGGGCCCACACNONE 
J023089J04CCGTGGGCCCACACNONE 
J023107J15CCGTGGGCCCACACNONE 
J033084J16CCGTGGGCCCACACNONE 
J065097O20CCGTGGGCCCACACNONE 
J065099J15CCGTGGGCCCACACNONE 
J090006K02CCGTGGGCCCACACNONE 
J090023L17CCGTGGGCCCACACNONE 
J090088G14CCGTGGGCCCACACNONE 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0185200009-146-B06GCGGGCCCACACNONE 
009-163-F01GCGGGCCCACACNONE 
AK062984GCGGGCCCACACNONE 
AK065125GCGGGCCCACACGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222GCGGGCCCACACNONE 
AK111284GCGGGCCCACACNONE 
Os01g0191100009-011-A02TAGGCCCACACGNONE 
009-028-D05TAGGCCCACACGNONE 
009-058-B11TAGGCCCACACGNONE 
009-151-D09TAGGCCCACACGNONE 
013-026-G03TAGGCCCACACGNONE 
013-063-F04TAGGCCCACACGNONE 
013-069-B05TAGGCCCACACGNONE 
014-029-E04TAGGCCCACACGNONE 
014-072-H04TAGGCCCACACGNONE 
014-089-E09TAGGCCCACACGNONE 
015-047-G05TAGGCCCACACGNONE 
016-033-G06TAGGCCCACACGNONE 
AK058815TAGGCCCACACGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08TAGGCCCACACGNONE 
J023077K21TAGGCCCACACGNONE 
J023081F19TAGGCCCACACGNONE 
J033052N11TAGGCCCACACGNONE 
J033058N11TAGGCCCACACGNONE 
J033114G05TAGGCCCACACGNONE 
J033114O17TAGGCCCACACGNONE 
J033129L14TAGGCCCACACGNONE 
J053029I12TAGGCCCACACGNONE 
J065067N19TAGGCCCACACGNONE 
J065084I19TAGGCCCACACGNONE 
J065099O03TAGGCCCACACGNONE 
J065201I08TAGGCCCACACGNONE 
J075035B08TAGGCCCACACGNONE 
J075037B22TAGGCCCACACGNONE 
J075054L16TAGGCCCACACGNONE 
J075059D15TAGGCCCACACGNONE 
J075164I08TAGGCCCACACGNONE 
J075185J01TAGGCCCACACGNONE 
J090042O06TAGGCCCACACGNONE 
J090044F12TAGGCCCACACGNONE 
J090063L02TAGGCCCACACGNONE 
J090073I10TAGGCCCACACGNONE 
J090078E18TAGGCCCACACGNONE 
J100072K16TAGGCCCACACGNONE 
Os01g0192000AK073660GCCCACACNONE 
J033052J05GCCCACACNONE 
Os01g0254900AK068204GCCCACACSimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530GCCCACACNONE 
Os01g0261500AK072194GTTGGTGGTGTGGGCTTTTNONE 
AK101899GTTGGTGGTGTGGGCTTTTConserved hypothetical protein. 
J065041N17GTTGGTGGTGTGGGCTTTTNONE 
Os01g0269100011-080-F08GTGTGGGCCGTANONE 
AK067610GTGTGGGCCGTASimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18GTGTGGGCCGTANONE 
J013112F12GTGTGGGCCGTANONE 
J023002M17GTGTGGGCCGTANONE 
J023022J24GTGTGGGCCGTANONE 
J033050A10GTGTGGGCCGTANONE 
J033091A17GTGTGGGCCGTANONE 
J033123E17GTGTGGGCCGTANONE 
J033143H04GTGTGGGCCGTANONE 
J043005H18GTGTGGGCCGTANONE 
J075038A05GTGTGGGCCGTANONE 
J075091K23GTGTGGGCCGTANONE 
J075118O05GTGTGGGCCGTANONE 
J075195P17GTGTGGGCCGTANONE 
J090027J21GTGTGGGCCGTANONE 
J100024I09GTGTGGGCCGTANONE 
J100032D15GTGTGGGCCGTANONE 
J100071I02GTGTGGGCCGTANONE 
J100080E01GTGTGGGCCGTANONE 
J100086A08GTGTGGGCCGTANONE 
Os01g0276700011-014-A12CCCGGCCCACACNONE 
012-092-G12CCCGGCCCACACNONE 
AK103164CCCGGCCCACACNONE 
AK103465CCCGGCCCACACSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CCCGGCCCACACNONE 
J023084I02CCCGGCCCACACNONE 
J033027F20CCCGGCCCACACNONE 
J033029M06CCCGGCCCACACNONE 
J033039K13CCCGGCCCACACNONE 
J033057C24CCCGGCCCACACNONE 
J033058G20CCCGGCCCACACNONE 
J033060A14CCCGGCCCACACNONE 
J033061M21CCCGGCCCACACNONE 
J033068M10CCCGGCCCACACNONE 
J033074K16CCCGGCCCACACNONE 
J033076C11CCCGGCCCACACNONE 
J033093O13CCCGGCCCACACNONE 
J033119H20CCCGGCCCACACNONE 
J033121D22CCCGGCCCACACNONE 
J033129N11CCCGGCCCACACNONE 
J033131E12CCCGGCCCACACNONE 
J033150L07CCCGGCCCACACNONE 
J053024N17CCCGGCCCACACNONE 
J053034G19CCCGGCCCACACNONE 
J053035E18CCCGGCCCACACNONE 
J053046M01CCCGGCCCACACNONE 
J053047P04CCCGGCCCACACNONE 
J053048B06CCCGGCCCACACNONE 
J053050M22CCCGGCCCACACNONE 
J053053E09CCCGGCCCACACNONE 
J053053I07CCCGGCCCACACNONE 
J053059K03CCCGGCCCACACNONE 
J053059P12CCCGGCCCACACNONE 
J053060C12CCCGGCCCACACNONE 
J053060H24CCCGGCCCACACNONE 
J053064D19CCCGGCCCACACNONE 
J053066L15CCCGGCCCACACNONE 
J053073I02CCCGGCCCACACNONE 
J053083E15CCCGGCCCACACNONE 
J053094D05CCCGGCCCACACNONE 
J053094P18CCCGGCCCACACNONE 
J053095C15CCCGGCCCACACNONE 
J053095C21CCCGGCCCACACNONE 
J053099N16CCCGGCCCACACNONE 
J090025O19CCCGGCCCACACNONE 
J090049N22CCCGGCCCACACNONE 
J090050F17CCCGGCCCACACNONE 
Os01g0531500004-017-G06CGTGTGGGCTGCNONE 
006-022-B04CGTGTGGGCTGCNONE 
006-084-A07CGTGTGGGCTGCNONE 
012-031-G11CGTGTGGGCTGCNONE 
AK059992CGTGTGGGCTGCNONE 
AK104379CGTGTGGGCTGCNONE 
AK106208CGTGTGGGCTGCDienelactone hydrolase domain containing protein. 
J013058J10CGTGTGGGCTGCNONE 
J013153A15CGTGTGGGCTGCNONE 
J033044K14CGTGTGGGCTGCNONE 
Os01g0543100014-039-E10GCCCACACNONE 
AK105363GCCCACACSimilar to Peroxidase 72 precursor (EC 1.11.1.7) (Atperox P72) (PRXR8) (ATP6a). 
Os01g0572100J075122B22GCCCACACGZinc finger, CCCH-type domain containing protein. 
Os01g0596300016-083-D09TTTCGGCCCACACNONE 
AK069151TTTCGGCCCACACCyclin-like F-box domain containing protein. 
J023007D17TTTCGGCCCACACNONE 
J065141M02TTTCGGCCCACACNONE 
Os01g0672700AK121375GTGTGGGCDNA polymerase, beta-like region domain containing protein. 
J023127C22GTGTGGGCNONE 
J033092B05GTGTGGGCNONE 
J033129P21GTGTGGGCNONE 
J065079H18GTGTGGGCNONE 
Os01g0756600AK060989CGTGTGGGCNONE 
AK102373CGTGTGGGCProtein of unknown function DUF642 family protein. 
J090060D10CGTGTGGGCNONE 
J090076J11CGTGTGGGCNONE 
J090088M06CGTGTGGGCNONE 
J090088M08CGTGTGGGCNONE 
Os01g0764800AK102809CGTGTGGGCCACSimilar to Nt-gh3 deduced protein. 
Os01g0767700AK122168ATGGCCCACACGSimilar to DEIH-box RNA/DNA helicase. 
Os01g0823500016-059-D03GCAGCCCACACNONE 
AK064237GCAGCCCACACProtein of unknown function DUF623, plant domain containing protein. 
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE 
AK061475AGATGGGCCCACACTGACAGNONE 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
J065168H17AGATGGGCCCACACTGACAGNONE 
J065211O10AGATGGGCCCACACTGACAGNONE 
Os01g0855600003-004-C02GTGGCCCACACGNONE 
016-023-G11GTGGCCCACACGNONE 
AK099776GTGGCCCACACGSimilar to Hs1pro-1 protein. 
AY224522GTGGCCCACACGNONE 
J013095E24GTGGCCCACACGNONE 
J023041J04GTGGCCCACACGNONE 
J065130B09GTGGCCCACACGNONE 
J075031B02GTGGCCCACACGNONE 
J075069H11GTGGCCCACACGNONE 
J100026O10GTGGCCCACACGNONE 
J100050J01GTGGCCCACACGNONE 
J100052G04GTGGCCCACACGNONE 
J100053D07GTGGCCCACACGNONE 
J100054K16GTGGCCCACACGNONE 
J100067A06GTGGCCCACACGNONE 
J100067G01GTGGCCCACACGNONE 
J100088C18GTGGCCCACACGNONE 
Os01g0876500J053026A07GGGGCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17GGGGCCCACACNONE 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0918300009-036-G04GGGGCCCACACNONE 
009-128-H04GGGGCCCACACNONE 
009-189-D06GGGGCCCACACNONE 
AB016030GGGGCCCACACNONE 
AK058869GGGGCCCACACUbiquitin-like protein SMT3. 
AK069668GGGGCCCACACNONE 
J023026B05GGGGCCCACACNONE 
J053042E12GGGGCCCACACNONE 
J053045P19GGGGCCCACACNONE 
J053078C24GGGGCCCACACNONE 
J065038J05GGGGCCCACACNONE 
J065170B12GGGGCCCACACNONE 
J065174C07GGGGCCCACACNONE 
J075002G06GGGGCCCACACNONE 
J075024O07GGGGCCCACACNONE 
J075068H04GGGGCCCACACNONE 
J075071H14GGGGCCCACACNONE 
J075095G03GGGGCCCACACNONE 
J075117O08GGGGCCCACACNONE 
J075118J23GGGGCCCACACNONE 
J075124P18GGGGCCCACACNONE 
J100057D06GGGGCCCACACNONE 
J100063L03GGGGCCCACACNONE 
X99608GGGGCCCACACNONE 
Os01g0950900AK101121GCCCACACProtein of unknown function DUF221 domain containing protein. 
J023036H24GCCCACACNONE 
J023084G23GCCCACACNONE 
J033025J04GCCCACACNONE 
J033139J18GCCCACACNONE 
J090006A09GCCCACACNONE 
J090036D02GCCCACACNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0133800006-092-D12CGTGTGGGCCCCNONE 
006-111-G01CGTGTGGGCCCCNONE 
AK103646CGTGTGGGCCCCNONE 
AK109376CGTGTGGGCCCCProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CGTGTGGGCCCCNONE 
J033135B19CGTGTGGGCCCCNONE 
J065200F01CGTGTGGGCCCCNONE 
J065213J11CGTGTGGGCCCCNONE 
J075031N16CGTGTGGGCCCCNONE 
J075032N17CGTGTGGGCCCCNONE 
J075047P04CGTGTGGGCCCCNONE 
J075063D01CGTGTGGGCCCCNONE 
J075105F23CGTGTGGGCCCCNONE 
J075121E16CGTGTGGGCCCCNONE 
J075176F10CGTGTGGGCCCCNONE 
J075182M16CGTGTGGGCCCCNONE 
J075190E09CGTGTGGGCCCCNONE 
J075191B14CGTGTGGGCCCCNONE 
J100055J24CGTGTGGGCCCCNONE 
J100066H24CGTGTGGGCCCCNONE 
J100073N01CGTGTGGGCCCCNONE 
Os02g0186500AK068056GCCCACACSimilar to Protein kinase-like protein. 
AK099031GCCCACACNONE 
J013111A12GCCCACACNONE 
J013127K13GCCCACACNONE 
J013132O11GCCCACACNONE 
J023056A11GCCCACACNONE 
J023078M08GCCCACACNONE 
J033081F07GCCCACACNONE 
J090079E24GCCCACACNONE 
J090097I02GCCCACACNONE 
Os02g0192300Os02g0192300GCAGCCCACACGZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0282600AK070262GTGTGGGCCCCACAConserved hypothetical protein. 
J023041L18GTGTGGGCCCCACANONE 
Os02g0289700009-196-H06GTGGCCCAATAGTGTGGGCNONE 
014-005-D09GTGGCCCAATAGTGTGGGCNONE 
AK063231GTGGCCCAATAGTGTGGGCSimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
Os02g0461200012-026-A12GAAGCCCACACGNONE 
AK063459GAAGCCCACACGConserved hypothetical protein. 
J065183F11GAAGCCCACACGNONE 
J075190G18GAAGCCCACACGNONE 
Os02g0468400AK120593GCCCACACLipid-binding START domain containing protein. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein. 
J075034A17GTGTGGGCCCATGANONE 
J075129I09GTGTGGGCCCATGANONE 
Os02g0581800J065071F12AGCCCACACGTGGConserved hypothetical protein. 
Os02g0600200009-154-A06CCCACCCGGGCCCACACNONE 
AK058978CCCACCCGGGCCCACACNONE 
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein. 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
Os02g0672500AK109266ACCGGCCCACACNONE 
Os02g0705000006-069-G11GCCACACGCCCACACNONE 
006-096-C01GCCACACGCCCACACNONE 
006-099-A07GCCACACGCCCACACNONE 
AK068080GCCACACGCCCACACNmrA-like family protein. 
AK104529GCCACACGCCCACACNONE 
AK106021GCCACACGCCCACACNONE 
J013132K15GCCACACGCCCACACNONE 
Os02g0705100012-046-E01GCCCACACNONE 
AK063491GCCCACACEpoxide hydrolase family protein. 
J065184H07GCCCACACNONE 
Os02g0744100006-070-H12AAAGCCCACACNONE 
006-115-C05AAAGCCCACACNONE 
AK061274AAAGCCCACACSAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0771100AB040053TCCACGCCCACACNONE 
AK102740TCCACGCCCACACSimilar to COP1 (Fragment). 
AK111614TCCACGCCCACACNONE 
AK112098TCCACGCCCACACNONE 
J033106E23TCCACGCCCACACNONE 
Os02g0777800AK066978CGTGTGGGCSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0819700AK067374CAAGGCCCACACGZinc finger, Zim17-type family protein. 
AK099160CAAGGCCCACACGNONE 
J100086K17CAAGGCCCACACGNONE 
Os03g0106200AK120128GTGTGGGCTGCConserved hypothetical protein. 
Os03g0113900AK107900GTGTGGGCCCCACCProtein of unknown function DUF584 family protein. 
AK119700GTGTGGGCCCCACCNONE 
Os03g0122000AK101458CGTGTGGGCTProtein kinase-like domain containing protein. 
J013035K10CGTGTGGGCTNONE 
J013050E10CGTGTGGGCTNONE 
J033040C13CGTGTGGGCTNONE 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGGGTGGGCCCACACGNONE 
Os03g0151800AK064955CGGGCCCACACNONE 
AK098874CGGGCCCACACNONE 
AK098980CGGGCCCACACNONE 
AK099712CGGGCCCACACNONE 
AK099889CGGGCCCACACNONE 
AK121641CGGGCCCACACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGGGCCCACACNONE 
J013001D04CGGGCCCACACNONE 
J013121O12CGGGCCCACACNONE 
Os03g0180100AK108326GCCCACACProtein of unknown function DUF1677, plant family protein. 
Os03g0238700AK073387GCCCACACSimilar to Acid phosphatase type 5. 
J033043K11GCCCACACNONE 
Os03g0249200009-103-B08GTGGCCCACACNONE 
AK069944GTGGCCCACACClass I peptide chain release factor domain containing protein. 
J065166E13GTGGCCCACACNONE 
Os03g0263900AK121215ACAGCCCACACGCalcium-binding EF-hand domain containing protein. 
J075115D02ACAGCCCACACGNONE 
J090095P20ACAGCCCACACGNONE 
Os03g0269300011-021-H03CGTGTGGGCTNONE 
011-029-B01CGTGTGGGCTNONE 
AK111855CGTGTGGGCTNONE 
AK111884CGTGTGGGCTAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0277500014-019-A09GTGTGGGCCGTGNONE 
AK063650GTGTGGGCCGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18GTGTGGGCCGTGNONE 
J065092A08GTGTGGGCCGTGNONE 
J065122E17GTGTGGGCCGTGNONE 
J065182K12GTGTGGGCCGTGNONE 
J065197H15GTGTGGGCCGTGNONE 
J075115A05GTGTGGGCCGTGNONE 
Os03g0288101J023001N08GCCCACACNONE 
J033068A04GCCCACACNONE 
J033111P19GCCCACACNONE 
J065131H13GCCCACACHypothetical protein. 
Os03g0297100AK059192AGCCCACACNONE 
AK122143AGCCCACACNONE 
J023012D24AGCCCACACNONE 
J023041A08AGCCCACACNONE 
J033067H08AGCCCACACNONE 
J033131K19AGCCCACACNONE 
J033136J20AGCCCACACNONE 
J053027D07AGCCCACACNONE 
J065191B01AGCCCACACNONE 
J075112A12AGCCCACACNONE 
J075136D05AGCCCACACNONE 
J090073P06AGCCCACACNONE 
J100026B16AGCCCACACNONE 
J100068P21AGCCCACACNONE 
J100088C15AGCCCACACNONE 
Os03g0320800AK103265GCCCACACACCNONE 
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CGTGTGGGCCCGGGCCCGGANONE 
J023036P06CGTGTGGGCCCGGGCCCGGANONE 
J023145E24CGTGTGGGCCCGGGCCCGGANONE 
J033142I11CGTGTGGGCCCGGGCCCGGANONE 
J043003A10CGTGTGGGCCCGGGCCCGGANONE 
J075023H21CGTGTGGGCCCGGGCCCGGANONE 
J075145O10CGTGTGGGCCCGGGCCCGGANONE 
J075149A03CGTGTGGGCCCGGGCCCGGANONE 
J090099B09CGTGTGGGCCCGGGCCCGGANONE 
J100017L14CGTGTGGGCCCGGGCCCGGANONE 
J100050K18CGTGTGGGCCCGGGCCCGGANONE 
J100063P16CGTGTGGGCCCGGGCCCGGANONE 
Os03g0437200006-066-E02CCAGCCCACACNONE 
AK059839CCAGCCCACACZinc finger, C2H2-type domain containing protein. 
AY295345CCAGCCCACACNONE 
Os03g0561249J065016H04GCCCACACConserved hypothetical protein. 
Os03g0608000AK111073GCCACACGCCCACACGHypothetical protein. 
Os03g0673600009-011-C08CGTGTGGGCTTTTNONE 
009-033-C05CGTGTGGGCTTTTNONE 
AK062334CGTGTGGGCTTTTNONE 
AK068539CGTGTGGGCTTTTConserved hypothetical protein. 
Os03g0701700011-034-E06GGTGTGTGGGCCGTGTGGCNONE 
AF013979GGTGTGTGGGCCGTGTGGCNONE 
AK065161GGTGTGTGGGCCGTGTGGCSimilar to Ethylene receptor. 
AK067813GGTGTGTGGGCCGTGTGGCNONE 
J013002C04GGTGTGTGGGCCGTGTGGCNONE 
J013035M07GGTGTGTGGGCCGTGTGGCNONE 
J013049B10GGTGTGTGGGCCGTGTGGCNONE 
J013065F11GGTGTGTGGGCCGTGTGGCNONE 
J013072K18GGTGTGTGGGCCGTGTGGCNONE 
J013073P08GGTGTGTGGGCCGTGTGGCNONE 
J013098F08GGTGTGTGGGCCGTGTGGCNONE 
J013154M13GGTGTGTGGGCCGTGTGGCNONE 
J023001H02GGTGTGTGGGCCGTGTGGCNONE 
J023003D16GGTGTGTGGGCCGTGTGGCNONE 
J023014P17GGTGTGTGGGCCGTGTGGCNONE 
J023036A22GGTGTGTGGGCCGTGTGGCNONE 
J023038N01GGTGTGTGGGCCGTGTGGCNONE 
J023042E11GGTGTGTGGGCCGTGTGGCNONE 
J023058O05GGTGTGTGGGCCGTGTGGCNONE 
J023084D05GGTGTGTGGGCCGTGTGGCNONE 
J023088O17GGTGTGTGGGCCGTGTGGCNONE 
J023138O11GGTGTGTGGGCCGTGTGGCNONE 
J023147A10GGTGTGTGGGCCGTGTGGCNONE 
J033029G18GGTGTGTGGGCCGTGTGGCNONE 
J033031N13GGTGTGTGGGCCGTGTGGCNONE 
J033090D09GGTGTGTGGGCCGTGTGGCNONE 
J033091I06GGTGTGTGGGCCGTGTGGCNONE 
J033096B20GGTGTGTGGGCCGTGTGGCNONE 
J033101A19GGTGTGTGGGCCGTGTGGCNONE 
J033135D03GGTGTGTGGGCCGTGTGGCNONE 
J043001L13GGTGTGTGGGCCGTGTGGCNONE 
J043020A13GGTGTGTGGGCCGTGTGGCNONE 
J053071K24GGTGTGTGGGCCGTGTGGCNONE 
J053092L14GGTGTGTGGGCCGTGTGGCNONE 
J053099F19GGTGTGTGGGCCGTGTGGCNONE 
J065009P22GGTGTGTGGGCCGTGTGGCNONE 
J065046A22GGTGTGTGGGCCGTGTGGCNONE 
J065099K22GGTGTGTGGGCCGTGTGGCNONE 
J065112O22GGTGTGTGGGCCGTGTGGCNONE 
J065119K11GGTGTGTGGGCCGTGTGGCNONE 
J065212B11GGTGTGTGGGCCGTGTGGCNONE 
J090022A11GGTGTGTGGGCCGTGTGGCNONE 
J090054F15GGTGTGTGGGCCGTGTGGCNONE 
J090076B20GGTGTGTGGGCCGTGTGGCNONE 
J090099M22GGTGTGTGGGCCGTGTGGCNONE 
J100032L01GGTGTGTGGGCCGTGTGGCNONE 
J100065H13GGTGTGTGGGCCGTGTGGCNONE 
Os03g0704200AK071176GTGTGGGCZinc finger, MYND-type domain containing protein. 
J023083O08GTGTGGGCNONE 
Os03g0705300AK102312GTGTGGGCNONE 
Os03g0708800009-180-H07GCCCACACNONE 
014-021-A05GCCCACACNONE 
AK063141GCCCACACNONE 
AK063654GCCCACACHypothetical protein. 
AK121625GCCCACACNONE 
J065041G22GCCCACACNONE 
J065063P10GCCCACACNONE 
J065158O11GCCCACACNONE 
Os03g0712800AK063913GCAGCCCACACACACACCSimilar to Glutamine synthetase root isozyme 2 (EC 6.3.1.2) (Glutamate--ammonia ligase). 
AK099290GCAGCCCACACACACACCNONE 
J023127P21GCAGCCCACACACACACCNONE 
Os03g0760700AK060701GCCCACACSimilar to Aspartate-semialdehyde dehydrogenase (EC 1.2.1.11) (Fragment). 
Os03g0765000AK073918GAGGCCCACACSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0793700AK121667CACGGCCCACACCupin 1 domain containing protein. 
AY098743CACGGCCCACACNONE 
Os03g0800500006-075-C12GGTGGGCCCACACNONE 
AK061104GGTGGGCCCACACNONE 
AK070229GGTGGGCCCACACPutative small multi-drug export family protein. 
J065152L13GGTGGGCCCACACNONE 
Os03g0819900006-058-B05GGGCCAGACAGCCCACACNONE 
AK111912GGGCCAGACAGCCCACACNONE 
AK112029GGGCCAGACAGCCCACACSimilar to RAB8C. 
AY576526GGGCCAGACAGCCCACACNONE 
AY579410GGGCCAGACAGCCCACACNONE 
J075041G24GGGCCAGACAGCCCACACNONE 
J100070N08GGGCCAGACAGCCCACACNONE 
Os03g0832600AK120137CGTGTGGGCCAGSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0833700011-060-A10GTGTGGGCCCACAGCCCAGCNONE 
AK121918GTGTGGGCCCACAGCCCAGCRNA 3'-terminal phosphate cyclase family protein. 
Os03g0836800AK061197CGTGTGGGCSimilar to IAA-amino acid hydrolase 1 (EC 3.5.1.-). 
Os03g0837900AK068346ACCGGGCCCACACStreptomyces cyclase/dehydrase family protein. 
Os03g0854800J090007D13ACAGCCCACACNONE 
J090085N22ACAGCCCACACNONE 
Os04g0218600009-123-A05GTGTGGGCCGTCNONE 
AK062873GTGTGGGCCGTCNONE 
AK103472GTGTGGGCCGTCConserved hypothetical protein. 
J090077A20GTGTGGGCCGTCNONE 
Os04g0244800009-066-G06CGTGTGGGCCCCANONE 
011-024-D02CGTGTGGGCCCCANONE 
AK121488CGTGTGGGCCCCAHeavy metal transport/detoxification protein domain containing protein. 
J023095P14CGTGTGGGCCCCANONE 
J023150J09CGTGTGGGCCCCANONE 
J053097G24CGTGTGGGCCCCANONE 
J065001K24CGTGTGGGCCCCANONE 
J065009O13CGTGTGGGCCCCANONE 
J065076M12CGTGTGGGCCCCANONE 
J065081I15CGTGTGGGCCCCANONE 
J065105E10CGTGTGGGCCCCANONE 
J065106G04CGTGTGGGCCCCANONE 
J065123I12CGTGTGGGCCCCANONE 
J065137H16CGTGTGGGCCCCANONE 
J065151I11CGTGTGGGCCCCANONE 
J065164H06CGTGTGGGCCCCANONE 
J065173J07CGTGTGGGCCCCANONE 
J065196F02CGTGTGGGCCCCANONE 
J065198I17CGTGTGGGCCCCANONE 
J065206I11CGTGTGGGCCCCANONE 
J065216J02CGTGTGGGCCCCANONE 
J075076D10CGTGTGGGCCCCANONE 
J075098F06CGTGTGGGCCCCANONE 
J075115A20CGTGTGGGCCCCANONE 
J075184H05CGTGTGGGCCCCANONE 
J075193E17CGTGTGGGCCCCANONE 
J090014L09CGTGTGGGCCCCANONE 
J090015H16CGTGTGGGCCCCANONE 
J090024M04CGTGTGGGCCCCANONE 
J090062K08CGTGTGGGCCCCANONE 
J090082I08CGTGTGGGCCCCANONE 
Os04g0269900J065139P11AGCCCACACNONE 
J100034P12AGCCCACACNONE 
J100045D21AGCCCACACNONE 
Os04g0281900006-042-E01GCCCACACGNONE 
006-085-B12GCCCACACGNONE 
009-029-B04GCCCACACGNONE 
009-092-C08GCCCACACGNONE 
009-168-H08GCCCACACGNONE 
AK060229GCCCACACGNONE 
AK061149GCCCACACGProtein of unknown function DUF588 family protein. 
J065056F11GCCCACACGNONE 
J065136G17GCCCACACGNONE 
J065142I09GCCCACACGNONE 
J065163L07GCCCACACGNONE 
J065191F15GCCCACACGNONE 
J065202P13GCCCACACGNONE 
J075046E09GCCCACACGNONE 
J075086M19GCCCACACGNONE 
J075116D21GCCCACACGNONE 
J075118N02GCCCACACGNONE 
J075181M06GCCCACACGNONE 
J075190I20GCCCACACGNONE 
J075197D04GCCCACACGNONE 
J090047D09GCCCACACGNONE 
Os04g0414500AK121479GCCCACACGConserved hypothetical protein. 
J023149I19GCCCACACGNONE 
J090084C07GCCCACACGNONE 
Os04g0418000006-025-C05TCAGCCCACACNONE 
006-025-D11TCAGCCCACACNONE 
006-045-F02TCAGCCCACACNONE 
006-060-B04TCAGCCCACACNONE 
006-063-E03TCAGCCCACACNONE 
006-070-G08TCAGCCCACACNONE 
006-072-H05TCAGCCCACACNONE 
AK061030TCAGCCCACACNONE 
AK099124TCAGCCCACACNONE 
AK106155TCAGCCCACACConserved hypothetical protein. 
AK119714TCAGCCCACACNONE 
J023039I07TCAGCCCACACNONE 
J065025N03TCAGCCCACACNONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein. 
Os04g0661300AK070723CCCACGGGGCCCACACConserved hypothetical protein. 
AK103942CCCACGGGGCCCACACNONE 
Os04g0673300006-055-C10CGTGTGGGTGTGGGCCCCACCCGNONE 
AK059734CGTGTGGGTGTGGGCCCCACCCGSimilar to ZmRR2 protein (Response regulator 2). 
J065006D12CGTGTGGGTGTGGGCCCCACCCGNONE 
J065218N11CGTGTGGGTGTGGGCCCCACCCGNONE 
Os04g0683900004-009-A11GTGTGGGCNONE 
014-076-H12GTGTGGGCNONE 
AK060880GTGTGGGCNONE 
AK099749GTGTGGGCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GTGTGGGCNONE 
J013050K21GTGTGGGCNONE 
J013092E09GTGTGGGCNONE 
J013095N06GTGTGGGCNONE 
J013095P07GTGTGGGCNONE 
J013130D22GTGTGGGCNONE 
J013134O15GTGTGGGCNONE 
J023022I06GTGTGGGCNONE 
J023062L11GTGTGGGCNONE 
J023078J11GTGTGGGCNONE 
J023086J01GTGTGGGCNONE 
J033125A20GTGTGGGCNONE 
J065023K13GTGTGGGCNONE 
J065045N02GTGTGGGCNONE 
J065129F01GTGTGGGCNONE 
J065164H14GTGTGGGCNONE 
J065192H09GTGTGGGCNONE 
J075064P15GTGTGGGCNONE 
J075088G17GTGTGGGCNONE 
J075199D20GTGTGGGCNONE 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os05g0110700AK102486AAGGCCCACACKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12AAGGCCCACACNONE 
Os05g0164100AF456329CGTGTGGGCCCCACGNONE 
AK065086CGTGTGGGCCCCACGNONE 
AK072243CGTGTGGGCCCCACGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CGTGTGGGCCCCACGNONE 
J013132O12CGTGTGGGCCCCACGNONE 
J023003N09CGTGTGGGCCCCACGNONE 
Os05g0170800AK068085GCCCACACUvrB/UvrC protein domain containing protein. 
J100063G14GCCCACACNONE 
Os05g0184901Os05g0184901GCCCACACGSigma factor, regions 3 and 4 domain containing protein. 
Os05g0230600AK070398CGTGTGGGCProtein of unknown function DUF1620 domain containing protein. 
J023048G06CGTGTGGGCNONE 
J023104B17CGTGTGGGCNONE 
J023117E17CGTGTGGGCNONE 
J033141M04CGTGTGGGCNONE 
J043013P22CGTGTGGGCNONE 
J075106H10CGTGTGGGCNONE 
J090022K02CGTGTGGGCNONE 
J090027E17CGTGTGGGCNONE 
J090057K12CGTGTGGGCNONE 
J090058C13CGTGTGGGCNONE 
J090067E04CGTGTGGGCNONE 
J090069N19CGTGTGGGCNONE 
J090070J02CGTGTGGGCNONE 
J090088H01CGTGTGGGCNONE 
J090099A08CGTGTGGGCNONE 
Os05g0345700AK121350CCAGCCCACACConserved hypothetical protein. 
Os05g0412300AK107782GTGTGGGCCCTHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os05g0429000AK109617TCCACGCCCACACSimilar to Hydroxymethyltransferase. 
Os05g0455200AK100916GCCCACACSimilar to Homeodomain protein JUBEL2. 
Os05g0476100011-031-E09ACAGCCCACACACCNONE 
011-033-E05ACAGCCCACACACCNONE 
011-038-E02ACAGCCCACACACCNONE 
012-053-A09ACAGCCCACACACCNONE 
012-057-E02ACAGCCCACACACCNONE 
AK064010ACAGCCCACACACCProtein of unknown function DUF827, plant family protein. 
AK102615ACAGCCCACACACCNONE 
J033057J03ACAGCCCACACACCNONE 
J033099E14ACAGCCCACACACCNONE 
Os05g0486200009-099-B03CAAGCCCACACNONE 
AK121022CAAGCCCACACConserved hypothetical protein. 
J023049I09CAAGCCCACACNONE 
J033029N07CAAGCCCACACNONE 
J075074I18CAAGCCCACACNONE 
Os05g0488900AK071883TGCGGCCCACACSimilar to Cytochrome b5 reductase. 
AK073699TGCGGCCCACACNONE 
AK105459TGCGGCCCACACNONE 
J080009C06TGCGGCCCACACNONE 
J080021N09TGCGGCCCACACNONE 
J080041K24TGCGGCCCACACNONE 
J080058H15TGCGGCCCACACNONE 
J080064P06TGCGGCCCACACNONE 
J080077B16TGCGGCCCACACNONE 
Os05g0503000AK068335GCCGGCCCACACSimilar to Secretory carrier membrane protein. 
AK104049GCCGGCCCACACNONE 
J013149D04GCCGGCCCACACNONE 
J075085A06GCCGGCCCACACNONE 
Os05g0531400J065101L04CCAGCCCACACGConserved hypothetical protein. 
J065130M24CCAGCCCACACGNONE 
Os05g0552700AK108674GTGTGGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os05g0554400AK102948GCCCACACGNONE 
AK107427GCCCACACGPhosphatidyl serine synthase family protein. 
J023089D16GCCCACACGNONE 
Os05g0566500AK073468CGTGTGGGCCACNONE 
AK099052CGTGTGGGCCACSimilar to Initiation factor 3d (Fragment). 
AK104093CGTGTGGGCCACNONE 
J090025I18CGTGTGGGCCACNONE 
Os05g0579600Os05g0579600GCCCACACHomeodomain-like containing protein. 
Os05g0592400AB037144CAAGGCCCACACNONE 
AK065508CAAGGCCCACACUV-damaged DNA binding protein. 
J013069J24CAAGGCCCACACNONE 
J013075H15CAAGGCCCACACNONE 
J013095H04CAAGGCCCACACNONE 
J013105L19CAAGGCCCACACNONE 
J013152P13CAAGGCCCACACNONE 
J023072O05CAAGGCCCACACNONE 
J033024J22CAAGGCCCACACNONE 
J033030D07CAAGGCCCACACNONE 
J033041D09CAAGGCCCACACNONE 
J033051M16CAAGGCCCACACNONE 
J033126M01CAAGGCCCACACNONE 
J033145H24CAAGGCCCACACNONE 
Os05g0595300011-076-H02GGGGCCCACACGCCACNONE 
012-009-E07GGGGCCCACACGCCACNONE 
012-096-B01GGGGCCCACACGCCACNONE 
AK059614GGGGCCCACACGCCACNONE 
AK121601GGGGCCCACACGCCACSimilar to CONSTANS-like protein. 
J033040P21GGGGCCCACACGCCACNONE 
Os06g0107600AK100838GCCCACACConserved hypothetical protein. 
AK107585GCCCACACNONE 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0114600015-077-E06AGTTGGGCCCACACNONE 
AK067972AGTTGGGCCCACACConserved hypothetical protein. 
Os06g0115200J100029D05TGTGGGGCCCACACNONE 
J100048P05TGTGGGGCCCACACQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0152100009-117-D07GCCCACACNONE 
009-121-G09GCCCACACNONE 
009-197-C04GCCCACACNONE 
AK058798GCCCACACSimilar to Profilin-2. 
AK121519GCCCACACNONE 
J023099A06GCCCACACNONE 
J033028A03GCCCACACNONE 
J033075B12GCCCACACNONE 
J043024F07GCCCACACNONE 
J043026A11GCCCACACNONE 
J043036P06GCCCACACNONE 
J065022D09GCCCACACNONE 
J065068N07GCCCACACNONE 
J065072N05GCCCACACNONE 
J065076A04GCCCACACNONE 
J065092O14GCCCACACNONE 
J065093I03GCCCACACNONE 
J065098B05GCCCACACNONE 
J065111J09GCCCACACNONE 
J065175M02GCCCACACNONE 
J065185G24GCCCACACNONE 
J075003N11GCCCACACNONE 
J075017C10GCCCACACNONE 
J075019H03GCCCACACNONE 
J075027J05GCCCACACNONE 
J075042A22GCCCACACNONE 
J075048G20GCCCACACNONE 
J075054P11GCCCACACNONE 
J075071C14GCCCACACNONE 
J075073F11GCCCACACNONE 
J075081C06GCCCACACNONE 
J075103D12GCCCACACNONE 
J075104K04GCCCACACNONE 
J075108O15GCCCACACNONE 
J075140D08GCCCACACNONE 
J075140J16GCCCACACNONE 
J075144H23GCCCACACNONE 
J075157H07GCCCACACNONE 
J075191H23GCCCACACNONE 
J080308G18GCCCACACNONE 
J090013I10GCCCACACNONE 
J090032I15GCCCACACNONE 
J090050P21GCCCACACNONE 
J090069E07GCCCACACNONE 
J090074K10GCCCACACNONE 
J090076J17GCCCACACNONE 
J090090N15GCCCACACNONE 
J090095B06GCCCACACNONE 
J090097G18GCCCACACNONE 
J100025K16GCCCACACNONE 
J100027P15GCCCACACNONE 
J100036L17GCCCACACNONE 
J100042P12GCCCACACNONE 
J100067O14GCCCACACNONE 
J100070P16GCCCACACNONE 
J100083J02GCCCACACNONE 
J100084M03GCCCACACNONE 
J100086B12GCCCACACNONE 
Os06g0205100009-050-C07GCCCACACNONE 
AK062487GCCCACACNONE 
Y15219GCCCACACSimilar to P-type R2R3 Myb protein (Fragment). 
Os06g0236200J075111M01ACCGGCCCACACConserved hypothetical protein. 
J075171D01ACCGGCCCACACNONE 
Os06g0308300AK059211TGGGGCCCACACGNONE 
AK101549TGGGGCCCACACGNONE 
AK102553TGGGGCCCACACGSimilar to 65kD microtubule associated protein. 
J090014G18TGGGGCCCACACGNONE 
J090082B01TGGGGCCCACACGNONE 
Os06g0356800J053026G06GCCCACACSimilar to Xylanase inhibitor protein I precursor. 
J065162C16GCCCACACNONE 
J075073H15GCCCACACNONE 
Os06g0526100Os06g0526100TGGTGGGCCCACACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0557100AK111851CGTGGGGCCCACACProtein kinase-like domain containing protein. 
AK119892CGTGGGGCCCACACNONE 
J023150C23CGTGGGGCCCACACNONE 
J033108M17CGTGGGGCCCACACNONE 
J065062L01CGTGGGGCCCACACNONE 
J065161G20CGTGGGGCCCACACNONE 
J090062G13CGTGGGGCCCACACNONE 
J090087H11CGTGGGGCCCACACNONE 
J100055H23CGTGGGGCCCACACNONE 
J100063G05CGTGGGGCCCACACNONE 
Os06g0574200Os06g0574200GTGGGTCCCACACGTGTGGGCCCACCCCCACACAGCCGTTGUspA domain containing protein. 
Os06g0597000006-049-F03GCCCACACGNONE 
006-113-H01GCCCACACGNONE 
AK061037GCCCACACGNONE 
AK069376GCCCACACGSimilar to Auxin responsive protein IAA-Re. 
J023012K19GCCCACACGNONE 
Os06g0598900AK100386GCGGCCCACACSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05GCGGCCCACACNONE 
J090043L20GCGGCCCACACNONE 
Os06g0643000AK067701GTGTGGGCTTGPhox-like domain containing protein. 
J013032G04GTGTGGGCTTGNONE 
J013044B17GTGTGGGCTTGNONE 
J013114M13GTGTGGGCTTGNONE 
J023133A02GTGTGGGCTTGNONE 
J043022A07GTGTGGGCTTGNONE 
J075046O21GTGTGGGCTTGNONE 
J075142L01GTGTGGGCTTGNONE 
J090076I16GTGTGGGCTTGNONE 
J100056O17GTGTGGGCTTGNONE 
Os06g0659600AK110885GGTCCAGAGCCCACACConserved hypothetical protein. 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os07g0124100014-015-G11GCGGGCCCACACNONE 
AJ276693GCGGGCCCACACPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GCGGGCCCACACNONE 
Os07g0159800009-100-A07CCCGGGCCCACACGNONE 
009-140-B04CCCGGGCCCACACGNONE 
AK059284CCCGGGCCCACACGNONE 
AK060475CCCGGGCCCACACGE1 protein and Def2/Der2 allergen family protein. 
J023054H06CCCGGGCCCACACGNONE 
J023083L17CCCGGGCCCACACGNONE 
J043005N13CCCGGGCCCACACGNONE 
J065164K01CCCGGGCCCACACGNONE 
J065192C18CCCGGGCCCACACGNONE 
J090058G23CCCGGGCCCACACGNONE 
J100017G10CCCGGGCCCACACGNONE 
J100081F12CCCGGGCCCACACGNONE 
Os07g0171100AF272978CGTGTGGGCTGTNONE 
AK062132CGTGTGGGCTGTNONE 
AK066475CGTGTGGGCTGTTetratricopeptide-like helical domain containing protein. 
J013068C23CGTGTGGGCTGTNONE 
Os07g0252400AK100914GCCCACACACCSimilar to Cellulose synthase-8. 
Os07g0255900J075118F23GCCCACACConserved hypothetical protein. 
Os07g0289800J080305A01GTGTGGGCCGGGConserved hypothetical protein. 
Os07g0413800006-021-H08GCCCACACNONE 
006-030-D01GCCCACACNONE 
006-034-B05GCCCACACNONE 
006-034-G03GCCCACACNONE 
006-040-B11GCCCACACNONE 
006-043-D03GCCCACACNONE 
006-052-B04GCCCACACNONE 
006-054-H11GCCCACACNONE 
006-081-A04GCCCACACNONE 
006-095-D10GCCCACACNONE 
006-102-A01GCCCACACNONE 
006-111-E02GCCCACACNONE 
009-136-D03GCCCACACNONE 
009-163-H08GCCCACACNONE 
009-164-D03GCCCACACNONE 
AK060411GCCCACACNONE 
AK061478GCCCACACConserved hypothetical protein. 
AK104124GCCCACACNONE 
AK104173GCCCACACNONE 
AK120684GCCCACACNONE 
J065112P06GCCCACACNONE 
Os07g0561800AK108426CGTGTGGGCNONE 
AK111334CGTGTGGGCConserved hypothetical protein. 
Os07g0572500AK108612GTGTGGGCConserved hypothetical protein. 
Os07g0581300AK061656GTGTGGGCNONE 
J033129C21GTGTGGGCNONE 
Os07g0582400003-104-B09AGATGGGCCCACACGNONE 
AK059423AGATGGGCCCACACGNONE 
AK102676AGATGGGCCCACACGNONE 
J065001F09AGATGGGCCCACACGNONE 
J065005K22AGATGGGCCCACACGNONE 
J065006D10AGATGGGCCCACACGNONE 
J065006P17AGATGGGCCCACACGNONE 
J065015G23AGATGGGCCCACACGNONE 
J065020F21AGATGGGCCCACACGNONE 
J065028I05AGATGGGCCCACACGNONE 
J065042N09AGATGGGCCCACACGNONE 
J065043P03AGATGGGCCCACACGNONE 
J065059E15AGATGGGCCCACACGNONE 
J065090I12AGATGGGCCCACACGNONE 
J065130I02AGATGGGCCCACACGNONE 
J065131P05AGATGGGCCCACACGNONE 
J065163I24AGATGGGCCCACACGNONE 
J065168I21AGATGGGCCCACACGNONE 
J065174A12AGATGGGCCCACACGNONE 
J065178K16AGATGGGCCCACACGNONE 
J065182P03AGATGGGCCCACACGNONE 
J065186B07AGATGGGCCCACACGNONE 
J065189M13AGATGGGCCCACACGNONE 
J065208J22AGATGGGCCCACACGNONE 
J065211E11AGATGGGCCCACACGNONE 
J075054E08AGATGGGCCCACACGNONE 
J075067K14AGATGGGCCCACACGNONE 
J075104E20AGATGGGCCCACACGNONE 
J075152M07AGATGGGCCCACACGNONE 
Os07g0603100AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
J023077E09GCGGGCCCACACAGCCCACCACNONE 
J023081N15GCGGGCCCACACAGCCCACCACNONE 
J033022N22GCGGGCCCACACAGCCCACCACNONE 
J033024M18GCGGGCCCACACAGCCCACCACNONE 
J033034P09GCGGGCCCACACAGCCCACCACNONE 
J033046A06GCGGGCCCACACAGCCCACCACNONE 
J033051K01GCGGGCCCACACAGCCCACCACNONE 
J033081P09GCGGGCCCACACAGCCCACCACNONE 
J033091B17GCGGGCCCACACAGCCCACCACNONE 
J033092K23GCGGGCCCACACAGCCCACCACNONE 
J033132J09GCGGGCCCACACAGCCCACCACNONE 
J033144A14GCGGGCCCACACAGCCCACCACNONE 
J033145A14GCGGGCCCACACAGCCCACCACNONE 
J043021B20GCGGGCCCACACAGCCCACCACNONE 
J053024D23GCGGGCCCACACAGCCCACCACNONE 
J065212J10GCGGGCCCACACAGCCCACCACNONE 
J090055M05GCGGGCCCACACAGCCCACCACNONE 
J090065E14GCGGGCCCACACAGCCCACCACNONE 
J090092J06GCGGGCCCACACAGCCCACCACNONE 
Os07g0606600AK111621CCCGGCCCACACNONE 
AK112118CCCGGCCCACACSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22CCCGGCCCACACNONE 
Os07g0618500AK068210GGTGTGTGGGCTTAGGGCCGTGNONE 
AK068975GGTGTGTGGGCTTAGGGCCGTGSimilar to Dihydropterin pyrophosphokinase /dihydropteroate synthase precursor (EC 2.5.1.15). 
J013147H17GGTGTGTGGGCTTAGGGCCGTGNONE 
J013170L10GGTGTGTGGGCTTAGGGCCGTGNONE 
J023061I07GGTGTGTGGGCTTAGGGCCGTGNONE 
J043024N01GGTGTGTGGGCTTAGGGCCGTGNONE 
Os07g0623300AK070292GTGTGGGCTSimilar to Splicing factor SC35. 
J023050C05GTGTGGGCTNONE 
J090025O12GTGTGGGCTNONE 
Os07g0631300009-145-C11GTGTGGGCNONE 
AK063855GTGTGGGCConserved hypothetical protein. 
J043012K22GTGTGGGCNONE 
J043020D08GTGTGGGCNONE 
J065015L18GTGTGGGCNONE 
J065021G12GTGTGGGCNONE 
J065021H11GTGTGGGCNONE 
J065042D02GTGTGGGCNONE 
J065067O21GTGTGGGCNONE 
J065078J12GTGTGGGCNONE 
J065094B22GTGTGGGCNONE 
J065106N18GTGTGGGCNONE 
J065150G13GTGTGGGCNONE 
J065157K08GTGTGGGCNONE 
J065164B05GTGTGGGCNONE 
J065172G19GTGTGGGCNONE 
J065173F12GTGTGGGCNONE 
J065174D16GTGTGGGCNONE 
J065185B02GTGTGGGCNONE 
J065207B14GTGTGGGCNONE 
J065207J19GTGTGGGCNONE 
J065212L20GTGTGGGCNONE 
J100053C03GTGTGGGCNONE 
Os07g0633200AK061338GCGGCCCACACSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GCGGCCCACACNONE 
J033096E22GCGGCCCACACNONE 
J033125D06GCGGCCCACACNONE 
J075048C23GCGGCCCACACNONE 
J075050G02GCGGCCCACACNONE 
J075104J04GCGGCCCACACNONE 
J075144N04GCGGCCCACACNONE 
Os07g0640900AK099354AGCCCACACGNONE 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os07g0681700AK103213CCCCACGTCACGCCCACACGlycosyl transferase, family 8 protein. 
Os08g0128200AK120428CGTGTGGGCCCGGGConserved hypothetical protein. 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0136500006-092-G03GCCCACACGNONE 
AK061187GCCCACACGProtein of unknown function DUF26 domain containing protein. 
J065057C18GCCCACACGNONE 
Os08g0139100006-027-E12AGCCCACACNONE 
006-089-E06AGCCCACACNONE 
006-113-G02AGCCCACACNONE 
AK061429AGCCCACACNONE 
AK099590AGCCCACACSimilar to DAG protein, chloroplast precursor. 
AK104727AGCCCACACNONE 
J013043H11AGCCCACACNONE 
J013049N13AGCCCACACNONE 
J065079F01AGCCCACACNONE 
J065122N24AGCCCACACNONE 
J065142J24AGCCCACACNONE 
J065193N03AGCCCACACNONE 
J075041I21AGCCCACACNONE 
J075145E04AGCCCACACNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0173300J065196D12GCCCACACGConserved hypothetical protein. 
Os08g0174700AB188247GCCCACACNONE 
AK103038GCCCACACSimilar to SERK1 (Fragment). 
AY463361GCCCACACNONE 
Os08g0191900AK067587GCCCACACGTGGCProtein prenyltransferase domain containing protein. 
AK099016GCCCACACGTGGCNONE 
J013032I08GCCCACACGTGGCNONE 
J013050I24GCCCACACGTGGCNONE 
J013128E05GCCCACACGTGGCNONE 
Os08g0260600AK108529TCCACGCCCACACGCCACACGCD9/CD37/CD63 antigen family protein. 
Os08g0389733J065044M19GTGTGGGCCGGCCGTCGGATNONE 
J065104D10GTGTGGGCCGGCCGTCGGATNONE 
J065110F18GTGTGGGCCGGCCGTCGGATNONE 
Os08g0425700AK059408GCCCACACSimilar to Annexin-like protein. 
AK104119GCCCACACNONE 
J065063J06GCCCACACNONE 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0474750J075009C13CGTGTGGGCCATNONE 
J075122O14CGTGTGGGCCATHypothetical protein. 
Os08g0474800Os08g0474800CGTGTGGGCCATEsterase/lipase/thioesterase domain containing protein. 
Os08g0478500AK099704CGGGCCCACACPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0502700AK064774GCCACGTCGGACGGGTGTGGGCCCCACGAAAminotransferase, class V family protein. 
AK065126GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
AK099206GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013001P06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013033N17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013070L14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013104J15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013159L20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J033068M20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065039M22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065057C23GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065069O15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065080A01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065081F08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065117F05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065178C01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065178C02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065212F12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075015K06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075062J08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075063O17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075072G05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098H11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098J11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098P09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075133G18GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075137G02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075169K02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080007M21GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080009M17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080011J02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080012I10GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080021K10GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080023P13GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080024C08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080025P11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080027B13GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080032P16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080033G07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080041F17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080041N19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080042C20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080046J24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080047L14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080049O11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080051E15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080052F01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080054A08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080054K14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080057G21GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080059L15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080063H12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080070M24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080071D24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080077O19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080078E08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080078N12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080081I08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080082A17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080087A09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080087F22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080088I08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080090F19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080091H16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080091N06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080092H08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080097H19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302C09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302G05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302K14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080303L01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080304D07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080305G03GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080306B12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080307G07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080315A14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080318H14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100029P15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100042C22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100063F24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100087P16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100088A12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
Os08g0503800AK101954AGCCGTCCGATCTGGTGGGCCCACACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
AK101954ATGGCCCACACGSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0517900015-019-D06AAAAGCCCATTACGGCCCACACNONE 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
Os08g0520100AK059686GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCNONE 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
Os08g0526100011-072-E04CGTGTGGGCNONE 
AK100965CGTGTGGGCNAD-dependent epimerase/dehydratase family protein. 
J023142D13CGTGTGGGCNONE 
J033132L16CGTGTGGGCNONE 
J090006E20CGTGTGGGCNONE 
J100069L13CGTGTGGGCNONE 
Os08g0549100004-006-D12AGGGCCCACACGNONE 
006-085-H05AGGGCCCACACGNONE 
006-101-B02AGGGCCCACACGNONE 
AK070842AGGGCCCACACGSimilar to Peroxisome type ascorbate peroxidase. 
AK104490AGGGCCCACACGNONE 
J013095F24AGGGCCCACACGNONE 
J013111D10AGGGCCCACACGNONE 
J023031C15AGGGCCCACACGNONE 
J023067J02AGGGCCCACACGNONE 
J023074O14AGGGCCCACACGNONE 
J033058F18AGGGCCCACACGNONE 
J033101F12AGGGCCCACACGNONE 
J053026B20AGGGCCCACACGNONE 
J065070G12AGGGCCCACACGNONE 
J065196H18AGGGCCCACACGNONE 
J075021N20AGGGCCCACACGNONE 
J075069K22AGGGCCCACACGNONE 
J075093E22AGGGCCCACACGNONE 
J075110D17AGGGCCCACACGNONE 
J075119D06AGGGCCCACACGNONE 
J075181H15AGGGCCCACACGNONE 
J090038O15AGGGCCCACACGNONE 
J090043K23AGGGCCCACACGNONE 
J090082E12AGGGCCCACACGNONE 
J100022M19AGGGCCCACACGNONE 
J100027E06AGGGCCCACACGNONE 
J100028G17AGGGCCCACACGNONE 
J100061I16AGGGCCCACACGNONE 
J100065G23AGGGCCCACACGNONE 
J100087C13AGGGCCCACACGNONE 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os08g0554000AK111661TGCGGGCCCACACWD-40 repeat containing protein. 
AK112044TGCGGGCCCACACNONE 
J013039N12TGCGGGCCCACACNONE 
J013134D02TGCGGGCCCACACNONE 
J013153B06TGCGGGCCCACACNONE 
J033044L16TGCGGGCCCACACNONE 
J033073P14TGCGGGCCCACACNONE 
Os08g0564100AK063258GTGTGGGCCATSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0111800004-013-C09GTGTGGGCNONE 
006-085-E01GTGTGGGCNONE 
016-037-E02GTGTGGGCNONE 
AK060898GTGTGGGCNONE 
AK069338GTGTGGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013039A09GTGTGGGCNONE 
J023012N03GTGTGGGCNONE 
J033029N15GTGTGGGCNONE 
J033064E17GTGTGGGCNONE 
J080305G19GTGTGGGCNONE 
J080305N02GTGTGGGCNONE 
J080306B09GTGTGGGCNONE 
J080310C20GTGTGGGCNONE 
J080311A20GTGTGGGCNONE 
J080311G17GTGTGGGCNONE 
J080316J11GTGTGGGCNONE 
J090054J05GTGTGGGCNONE 
J090055M10GTGTGGGCNONE 
J090059H08GTGTGGGCNONE 
Os09g0127800AK058402GTGTGGGCNONE 
J090055M24GTGTGGGCNONE 
Os09g0251800006-100-E12CGTGTGGGCCCCACCNONE 
AK061218CGTGTGGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CGTGTGGGCCCCACCNONE 
J065048A02CGTGTGGGCCCCACCNONE 
J065073P10CGTGTGGGCCCCACCNONE 
J065075B09CGTGTGGGCCCCACCNONE 
J065112B05CGTGTGGGCCCCACCNONE 
J090014H10CGTGTGGGCCCCACCNONE 
Os09g0361400006-109-H02AGGGCCCACACGNONE 
006-120-G04AGGGCCCACACGNONE 
AK060652AGGGCCCACACGOuter mitochondrial membrane protein porin (Voltage-dependent anion- selective channel protein) (VDAC). 
AK061261AGGGCCCACACGNONE 
AK072129AGGGCCCACACGNONE 
J023109H05AGGGCCCACACGNONE 
J065052I18AGGGCCCACACGNONE 
J065058M16AGGGCCCACACGNONE 
J065079L08AGGGCCCACACGNONE 
J065107J15AGGGCCCACACGNONE 
J065137A03AGGGCCCACACGNONE 
J090013N18AGGGCCCACACGNONE 
J090064O16AGGGCCCACACGNONE 
J100080N15AGGGCCCACACGNONE 
Y18104AGGGCCCACACGNONE 
Os09g0401000AK064679GCCCACACMyb factor. 
J075155B13GCCCACACNONE 
Y11351GCCCACACNONE 
Os09g0401200AK106846GTGTGGGCCATNONE 
Os09g0418000006-022-F01CCCCCGCGCCCACACACCNONE 
006-038-G10CCCCCGCGCCCACACACCNONE 
006-089-G04CCCCCGCGCCCACACACCNONE 
006-098-F07CCCCCGCGCCCACACACCNONE 
AK061220CCCCCGCGCCCACACACCNONE 
AK061493CCCCCGCGCCCACACACCNONE 
AK100881CCCCCGCGCCCACACACCNONE 
AK119760CCCCCGCGCCCACACACCProtein kinase-like domain containing protein. 
J023127H10CCCCCGCGCCCACACACCNONE 
J033122J01CCCCCGCGCCCACACACCNONE 
J065162D08CCCCCGCGCCCACACACCNONE 
J065214P03CCCCCGCGCCCACACACCNONE 
J090009B17CCCCCGCGCCCACACACCNONE 
J090093C21CCCCCGCGCCCACACACCNONE 
J100067C01CCCCCGCGCCCACACACCNONE 
J100067P06CCCCCGCGCCCACACACCNONE 
Os09g0434200AK062015AAGGCCCACACNONE 
AK103447AAGGCCCACACZinc finger, RING-type domain containing protein. 
Os09g0451500AK062254GTGTGGGCCCAGTTThioredoxin domain 2 containing protein. 
AK072941GTGTGGGCCCAGTTNONE 
Os09g0455200J065041I12GCCCACACGWinged helix repressor DNA-binding domain containing protein. 
J065120N14GCCCACACGNONE 
Os09g0463700016-008-D06TTGGCCCACACGNONE 
AK060708TTGGCCCACACGSimilar to AHM1. 
J090013G05TTGGCCCACACGNONE 
Os09g0464000AK060777GCCCACACNONE 
AK069530GCCCACACSimilar to Carbonate dehydratase-like protein. 
Os09g0471900AK073815CGCGTCTCCAGCCCACACGBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0547200016-021-H03CCCGGGCCCACACACCNONE 
AK073078CCCGGGCCCACACACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CCCGGGCCCACACACCNONE 
J065005L05CCCGGGCCCACACACCNONE 
J065039C06CCCGGGCCCACACACCNONE 
J065116H17CCCGGGCCCACACACCNONE 
J100046A17CCCGGGCCCACACACCNONE 
Os09g0553200003-101-F12CGTGTGGGCNONE 
003-125-E09CGTGTGGGCNONE 
011-031-H12CGTGTGGGCNONE 
012-033-A01CGTGTGGGCNONE 
015-046-H04CGTGTGGGCNONE 
015-056-F04CGTGTGGGCNONE 
016-029-H06CGTGTGGGCNONE 
016-080-D05CGTGTGGGCNONE 
AB062606CGTGTGGGCNONE 
AK065780CGTGTGGGCSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930CGTGTGGGCNONE 
AK104344CGTGTGGGCNONE 
AK119197CGTGTGGGCNONE 
AK119232CGTGTGGGCNONE 
J013039M01CGTGTGGGCNONE 
J013043M01CGTGTGGGCNONE 
J013064F03CGTGTGGGCNONE 
J013066K19CGTGTGGGCNONE 
J013092G12CGTGTGGGCNONE 
J013123P09CGTGTGGGCNONE 
J013155F01CGTGTGGGCNONE 
J013158J12CGTGTGGGCNONE 
J013159H14CGTGTGGGCNONE 
J013169C10CGTGTGGGCNONE 
J013170L23CGTGTGGGCNONE 
J023010J18CGTGTGGGCNONE 
J023019E23CGTGTGGGCNONE 
J023045B14CGTGTGGGCNONE 
J023082K24CGTGTGGGCNONE 
J023086G04CGTGTGGGCNONE 
J023090N09CGTGTGGGCNONE 
J023113C08CGTGTGGGCNONE 
J023125H18CGTGTGGGCNONE 
J033034M08CGTGTGGGCNONE 
J033035K03CGTGTGGGCNONE 
J033039D15CGTGTGGGCNONE 
J033045P18CGTGTGGGCNONE 
J033058P08CGTGTGGGCNONE 
J033061D16CGTGTGGGCNONE 
J033070F14CGTGTGGGCNONE 
J033086F23CGTGTGGGCNONE 
J033095C05CGTGTGGGCNONE 
J033114H22CGTGTGGGCNONE 
J033133M20CGTGTGGGCNONE 
J043026G01CGTGTGGGCNONE 
J043037F17CGTGTGGGCNONE 
J065120K17CGTGTGGGCNONE 
J065123O07CGTGTGGGCNONE 
J080305H06CGTGTGGGCNONE 
J090001F11CGTGTGGGCNONE 
J090020C17CGTGTGGGCNONE 
J090043A19CGTGTGGGCNONE 
J090051J17CGTGTGGGCNONE 
J090068K06CGTGTGGGCNONE 
J090075P19CGTGTGGGCNONE 
J100036G10CGTGTGGGCNONE 
J100084F02CGTGTGGGCNONE 
Os11g0184900011-088-C07GCCCACACGNONE 
015-036-B03GCCCACACGNONE 
016-087-F07GCCCACACGNONE 
AB028184GCCCACACGNONE 
AK063399GCCCACACGSimilar to NAC-domain protein 5-7. 
AK064292GCCCACACGNONE 
AK102475GCCCACACGNONE 
J033094I01GCCCACACGNONE 
J090087J16GCCCACACGNONE 
Os11g0221000AK102073GCCCACACAux/IAA_ARF_dimerisation domain containing protein. 
Os11g0286800AK105077GCCCACACNONE 
Os11g0414000012-012-F01TCAGCCCACACGNONE 
AK071277TCAGCCCACACGeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
J023082M08TCAGCCCACACGNONE 
J023083E17TCAGCCCACACGNONE 
J023128I07TCAGCCCACACGNONE 
J033098J04TCAGCCCACACGNONE 
J033135G10TCAGCCCACACGNONE 
J043007L23TCAGCCCACACGNONE 
J065011N07TCAGCCCACACGNONE 
J065016E01TCAGCCCACACGNONE 
J065162N12TCAGCCCACACGNONE 
J065164O22TCAGCCCACACGNONE 
J065173J06TCAGCCCACACGNONE 
J065200E24TCAGCCCACACGNONE 
J065203K20TCAGCCCACACGNONE 
J075033N16TCAGCCCACACGNONE 
J075047L06TCAGCCCACACGNONE 
J075064J24TCAGCCCACACGNONE 
J075100O07TCAGCCCACACGNONE 
J075121G11TCAGCCCACACGNONE 
J075134A13TCAGCCCACACGNONE 
J075190F20TCAGCCCACACGNONE 
J075190H08TCAGCCCACACGNONE 
J080033L04TCAGCCCACACGNONE 
J080045O09TCAGCCCACACGNONE 
J080064J07TCAGCCCACACGNONE 
J080066N22TCAGCCCACACGNONE 
J080075C09TCAGCCCACACGNONE 
J090002C08TCAGCCCACACGNONE 
J090058G21TCAGCCCACACGNONE 
J090074M07TCAGCCCACACGNONE 
J100090G06TCAGCCCACACGNONE 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os12g0133600AK103096GTGTGGGCTConserved hypothetical protein. 
J033118M03GTGTGGGCTNONE 
Os12g0156400012-065-D02ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK072086ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK099278ACAGCCCACACGTGGCCGTGGGCCCCDcp1-like decapping family protein. 
J013063H09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023125D09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023149G21ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033064E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033093C07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033107E06ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J075172A11ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090009E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090023F13ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090071N18ACAGCCCACACGTGGCCGTGGGCCCCNONE 
Os12g0235800AK071066GCCCACACSimilar to Argininosuccinate synthase (Fragment). 
Os12g0242500J065129F10GTGTGGGCCATNONE 
J090032G12GTGTGGGCCATConserved hypothetical protein. 
Os12g0266000J075093G23TTCGTGGGCCCACACNONE 
Os12g0275500009-200-B09GTGTGGGCNONE 
AK063250GTGTGGGCHypothetical protein. 
Os12g0411700005-018-A10GCCCACACNONE 
Os12g0460800J023003J21GCCCACACGCCACNONE 
Os12g0555000013-022-H11GCCCACACNONE 
AB127580GCCCACACNONE 
AK061606GCCCACACSimilar to Probenazole-inducible protein PBZ1. 
J053084H06GCCCACACNONE 
J053089C04GCCCACACNONE 
J065059O11GCCCACACNONE 
J065207J06GCCCACACNONE 
J065216F04GCCCACACNONE 
J100032C09GCCCACACNONE 
J100033F05GCCCACACNONE 
J100040I22GCCCACACNONE 
J100044P12GCCCACACNONE 
J100067G14GCCCACACNONE 
J100083A06GCCCACACNONE 
Os12g0580600AK108584GTGGGGGCCCACACConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.