version

Summary of OsREG599 (All List)

OrganismOryza sativa  
IDOsREG599  
SequenceGCCCACCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3236  

Entry Sequences (3236 entries)

LocusGene modelSequenceDescription
Os01g0102500011-064-A09CCAGCCCACCAACNONE 
015-011-E06CCAGCCCACCAACNONE 
016-083-H11CCAGCCCACCAACNONE 
AK100002CCAGCCCACCAACConserved hypothetical protein. 
J065063K05CCAGCCCACCAACNONE 
J065191H24CCAGCCCACCAACNONE 
J100079N16CCAGCCCACCAACNONE 
Os01g0103600006-072-A01GTGGTGGGCCCCCACNONE 
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK102848GTGGTGGGCCCCCACNONE 
J033036P20GTGGTGGGCCCCCACNONE 
J065171N21GTGGTGGGCCCCCACNONE 
J065209M02GTGGTGGGCCCCCACNONE 
J075067A03GTGGTGGGCCCCCACNONE 
J075110C09GTGGTGGGCCCCCACNONE 
Os01g0139700J065118K13GCCCACCACConserved hypothetical protein. 
Os01g0147200016-005-F02TCAGCCCACCANONE 
AK106463TCAGCCCACCANONE 
AK121921TCAGCCCACCAIWS1, C-terminal family protein. 
J033098O16TCAGCCCACCANONE 
J033106E16TCAGCCCACCANONE 
J043026D12TCAGCCCACCANONE 
J065070B04TCAGCCCACCANONE 
J065162L03TCAGCCCACCANONE 
J065166F01TCAGCCCACCANONE 
J075030A13TCAGCCCACCANONE 
J075093O12TCAGCCCACCANONE 
J075106K15TCAGCCCACCANONE 
J075107F20TCAGCCCACCANONE 
J090031F21TCAGCCCACCANONE 
J090079E17TCAGCCCACCANONE 
Os01g0155600006-048-F03GCCCACCAATTGGGCNONE 
AK060171GCCCACCAATTGGGCNONE 
AK071635GCCCACCAATTGGGCSimilar to Splicing factor RSZ33. 
J023080A03GCCCACCAATTGGGCNONE 
J023100L15GCCCACCAATTGGGCNONE 
J033075I17GCCCACCAATTGGGCNONE 
J033085O09GCCCACCAATTGGGCNONE 
J033105E15GCCCACCAATTGGGCNONE 
J033132N10GCCCACCAATTGGGCNONE 
J033132P12GCCCACCAATTGGGCNONE 
J033149H12GCCCACCAATTGGGCNONE 
J043026M03GCCCACCAATTGGGCNONE 
J080305J10GCCCACCAATTGGGCNONE 
J080308K03GCCCACCAATTGGGCNONE 
J090023M04GCCCACCAATTGGGCNONE 
J090078F24GCCCACCAATTGGGCNONE 
J100066P05GCCCACCAATTGGGCNONE 
Os01g0164500AK068747GCGGCCCACCASimilar to ATP-dependent RNA helicase-like protein. 
AK103737GCGGCCCACCANONE 
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein. 
Os01g0270100006-096-H09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-009-C10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-054-E06GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
014-085-F09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK073275GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK104155GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J033025K21GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075065H10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075143G10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J100059J02GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
AK104939TTTTGGGCCCACCACNONE 
J033044B03TTTTGGGCCCACCACNONE 
J033060E12TTTTGGGCCCACCACNONE 
J043037E21TTTTGGGCCCACCACNONE 
J065019O18TTTTGGGCCCACCACNONE 
J065025P22TTTTGGGCCCACCACNONE 
J065042P06TTTTGGGCCCACCACNONE 
J065074C19TTTTGGGCCCACCACNONE 
J065074E13TTTTGGGCCCACCACNONE 
J065094E05TTTTGGGCCCACCACNONE 
J065108N08TTTTGGGCCCACCACNONE 
J065134L13TTTTGGGCCCACCACNONE 
J065152N24TTTTGGGCCCACCACNONE 
J065162N24TTTTGGGCCCACCACNONE 
J065170P16TTTTGGGCCCACCACNONE 
J065177M20TTTTGGGCCCACCACNONE 
J065187N01TTTTGGGCCCACCACNONE 
J075012N12TTTTGGGCCCACCACNONE 
J075046C17TTTTGGGCCCACCACNONE 
J075055N06TTTTGGGCCCACCACNONE 
J075141H03TTTTGGGCCCACCACNONE 
J075150M11TTTTGGGCCCACCACNONE 
J090005B16TTTTGGGCCCACCACNONE 
J090079L11TTTTGGGCCCACCACNONE 
J100039F16TTTTGGGCCCACCACNONE 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0348700009-125-H02GCAGCCCACCANONE 
009-156-F08GCAGCCCACCANONE 
009-177-A11GCAGCCCACCANONE 
009-195-D02GCAGCCCACCANONE 
013-040-B06GCAGCCCACCANONE 
013-051-B09GCAGCCCACCANONE 
AK120842GCAGCCCACCASimilar to 60S ribosomal protein L23a (L25). 
J013071O22GCAGCCCACCANONE 
J023022J07GCAGCCCACCANONE 
J033028J08GCAGCCCACCANONE 
J033109M11GCAGCCCACCANONE 
J043022K15GCAGCCCACCANONE 
J043031N11GCAGCCCACCANONE 
J053023I10GCAGCCCACCANONE 
J053045F16GCAGCCCACCANONE 
J053054F22GCAGCCCACCANONE 
J053094P15GCAGCCCACCANONE 
J065048F01GCAGCCCACCANONE 
J075012F16GCAGCCCACCANONE 
J075089C09GCAGCCCACCANONE 
J075179J20GCAGCCCACCANONE 
J080305E19GCAGCCCACCANONE 
J080309B21GCAGCCCACCANONE 
J090017L05GCAGCCCACCANONE 
J090058B11GCAGCCCACCANONE 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0379400016-006-B06GCCCACCATTTGGGCNONE 
AK064420GCCCACCATTTGGGCNONE 
AK102388GCCCACCATTTGGGCNONE 
AK110939GCCCACCATTTGGGCCyclin-like F-box domain containing protein. 
J033092D18GCCCACCATTTGGGCNONE 
J065070N09GCCCACCATTTGGGCNONE 
J065078L01GCCCACCATTTGGGCNONE 
J065083G15GCCCACCATTTGGGCNONE 
Os01g0384800009-073-F04AGCCCACCACNONE 
009-149-E07AGCCCACCACNONE 
AK119688AGCCCACCACConserved hypothetical protein. 
AK120910AGCCCACCACNONE 
J013033N16AGCCCACCACNONE 
J023034B07AGCCCACCACNONE 
J023034J16AGCCCACCACNONE 
J065105O09AGCCCACCACNONE 
J065194F07AGCCCACCACNONE 
J075070L22AGCCCACCACNONE 
J075128L01AGCCCACCACNONE 
J075164C09AGCCCACCACNONE 
J100028M15AGCCCACCACNONE 
J100042M14AGCCCACCACNONE 
J100063D20AGCCCACCACNONE 
J100066A19AGCCCACCACNONE 
J100079K09AGCCCACCACNONE 
J100079K17AGCCCACCACNONE 
Os01g0501800006-021-B07AGCCCACCACNONE 
006-021-E12AGCCCACCACNONE 
006-022-B08AGCCCACCACNONE 
006-022-C09AGCCCACCACNONE 
006-022-C12AGCCCACCACNONE 
006-022-F10AGCCCACCACNONE 
006-023-A09AGCCCACCACNONE 
006-023-D02AGCCCACCACNONE 
006-023-E06AGCCCACCACNONE 
006-023-E11AGCCCACCACNONE 
006-025-A01AGCCCACCACNONE 
006-025-B07AGCCCACCACNONE 
006-025-F04AGCCCACCACNONE 
006-025-F11AGCCCACCACNONE 
006-027-F05AGCCCACCACNONE 
006-028-C02AGCCCACCACNONE 
006-029-B01AGCCCACCACNONE 
006-029-D09AGCCCACCACNONE 
006-029-G02AGCCCACCACNONE 
006-029-H08AGCCCACCACNONE 
006-030-A02AGCCCACCACNONE 
006-030-B05AGCCCACCACNONE 
006-031-A01AGCCCACCACNONE 
006-032-E09AGCCCACCACNONE 
006-032-G10AGCCCACCACNONE 
006-032-H11AGCCCACCACNONE 
006-033-B08AGCCCACCACNONE 
006-033-E11AGCCCACCACNONE 
006-034-H01AGCCCACCACNONE 
006-035-B09AGCCCACCACNONE 
006-035-D08AGCCCACCACNONE 
006-036-F01AGCCCACCACNONE 
006-036-G01AGCCCACCACNONE 
006-037-E12AGCCCACCACNONE 
006-039-D07AGCCCACCACNONE 
006-040-A03AGCCCACCACNONE 
006-042-G11AGCCCACCACNONE 
006-044-F11AGCCCACCACNONE 
006-045-H04AGCCCACCACNONE 
006-046-A09AGCCCACCACNONE 
006-046-C12AGCCCACCACNONE 
006-046-F10AGCCCACCACNONE 
006-046-H08AGCCCACCACNONE 
006-047-G05AGCCCACCACNONE 
006-047-G06AGCCCACCACNONE 
006-048-C05AGCCCACCACNONE 
006-049-A07AGCCCACCACNONE 
006-049-E03AGCCCACCACNONE 
006-050-D08AGCCCACCACNONE 
006-050-E02AGCCCACCACNONE 
006-050-E07AGCCCACCACNONE 
006-050-F11AGCCCACCACNONE 
006-051-D04AGCCCACCACNONE 
006-051-G07AGCCCACCACNONE 
006-052-B06AGCCCACCACNONE 
006-052-B11AGCCCACCACNONE 
006-052-C06AGCCCACCACNONE 
006-053-G03AGCCCACCACNONE 
006-054-C01AGCCCACCACNONE 
006-054-D09AGCCCACCACNONE 
006-056-B11AGCCCACCACNONE 
006-056-C07AGCCCACCACNONE 
006-056-C12AGCCCACCACNONE 
006-057-C05AGCCCACCACNONE 
006-057-E08AGCCCACCACNONE 
006-058-F03AGCCCACCACNONE 
006-059-A03AGCCCACCACNONE 
006-059-C12AGCCCACCACNONE 
006-062-A06AGCCCACCACNONE 
006-062-H04AGCCCACCACNONE 
006-063-B08AGCCCACCACNONE 
006-063-B10AGCCCACCACNONE 
006-063-D11AGCCCACCACNONE 
006-063-H07AGCCCACCACNONE 
006-065-F08AGCCCACCACNONE 
006-067-F07AGCCCACCACNONE 
006-067-G04AGCCCACCACNONE 
006-067-G12AGCCCACCACNONE 
006-068-A12AGCCCACCACNONE 
006-068-E08AGCCCACCACNONE 
006-068-H01AGCCCACCACNONE 
006-069-C01AGCCCACCACNONE 
006-069-E08AGCCCACCACNONE 
006-070-D05AGCCCACCACNONE 
006-070-E10AGCCCACCACNONE 
006-071-A02AGCCCACCACNONE 
006-072-C01AGCCCACCACNONE 
006-073-B07AGCCCACCACNONE 
006-073-D02AGCCCACCACNONE 
006-073-F06AGCCCACCACNONE 
006-075-B10AGCCCACCACNONE 
006-075-C01AGCCCACCACNONE 
006-076-E10AGCCCACCACNONE 
006-076-H12AGCCCACCACNONE 
006-077-B10AGCCCACCACNONE 
006-077-F12AGCCCACCACNONE 
006-078-C04AGCCCACCACNONE 
006-078-C10AGCCCACCACNONE 
006-078-H11AGCCCACCACNONE 
006-079-A05AGCCCACCACNONE 
006-079-C01AGCCCACCACNONE 
006-079-E04AGCCCACCACNONE 
006-079-H06AGCCCACCACNONE 
006-080-G05AGCCCACCACNONE 
006-081-C07AGCCCACCACNONE 
006-081-H07AGCCCACCACNONE 
006-082-A09AGCCCACCACNONE 
006-082-D02AGCCCACCACNONE 
006-084-B11AGCCCACCACNONE 
006-085-G10AGCCCACCACNONE 
006-086-A05AGCCCACCACNONE 
006-086-B05AGCCCACCACNONE 
006-086-F09AGCCCACCACNONE 
006-088-B09AGCCCACCACNONE 
006-088-D02AGCCCACCACNONE 
006-088-D10AGCCCACCACNONE 
006-088-F05AGCCCACCACNONE 
006-089-C06AGCCCACCACNONE 
006-092-C07AGCCCACCACNONE 
006-092-C08AGCCCACCACNONE 
006-092-G09AGCCCACCACNONE 
006-093-D12AGCCCACCACNONE 
006-093-H10AGCCCACCACNONE 
006-094-E07AGCCCACCACNONE 
006-095-G01AGCCCACCACNONE 
006-096-A10AGCCCACCACNONE 
006-097-B06AGCCCACCACNONE 
006-097-H12AGCCCACCACNONE 
006-098-A08AGCCCACCACNONE 
006-098-A10AGCCCACCACNONE 
006-098-C10AGCCCACCACNONE 
006-098-D02AGCCCACCACNONE 
006-098-F10AGCCCACCACNONE 
006-099-B08AGCCCACCACNONE 
006-099-D02AGCCCACCACNONE 
006-099-D05AGCCCACCACNONE 
006-099-G10AGCCCACCACNONE 
006-100-G06AGCCCACCACNONE 
006-102-G09AGCCCACCACNONE 
006-104-F06AGCCCACCACNONE 
006-105-A12AGCCCACCACNONE 
006-105-D04AGCCCACCACNONE 
006-105-F05AGCCCACCACNONE 
006-106-B01AGCCCACCACNONE 
006-106-D05AGCCCACCACNONE 
006-107-B01AGCCCACCACNONE 
006-107-C02AGCCCACCACNONE 
006-107-E01AGCCCACCACNONE 
006-107-G03AGCCCACCACNONE 
006-108-D09AGCCCACCACNONE 
006-109-G01AGCCCACCACNONE 
006-109-H07AGCCCACCACNONE 
006-110-C04AGCCCACCACNONE 
006-111-B11AGCCCACCACNONE 
006-112-A02AGCCCACCACNONE 
006-112-E03AGCCCACCACNONE 
006-112-H04AGCCCACCACNONE 
006-113-B07AGCCCACCACNONE 
006-113-C08AGCCCACCACNONE 
006-114-C12AGCCCACCACNONE 
006-114-D06AGCCCACCACNONE 
006-115-B06AGCCCACCACNONE 
006-116-B01AGCCCACCACNONE 
006-116-C02AGCCCACCACNONE 
006-117-B05AGCCCACCACNONE 
006-117-C06AGCCCACCACNONE 
006-117-D10AGCCCACCACNONE 
006-118-D04AGCCCACCACNONE 
006-118-E12AGCCCACCACNONE 
006-119-A06AGCCCACCACNONE 
006-119-A09AGCCCACCACNONE 
006-119-D02AGCCCACCACNONE 
006-119-G07AGCCCACCACNONE 
006-120-B03AGCCCACCACNONE 
006-120-B07AGCCCACCACNONE 
006-120-C01AGCCCACCACNONE 
006-120-E04AGCCCACCACNONE 
006-120-F11AGCCCACCACNONE 
009-014-E11AGCCCACCACNONE 
009-079-C06AGCCCACCACNONE 
009-101-H06AGCCCACCACNONE 
009-113-F07AGCCCACCACNONE 
009-126-G04AGCCCACCACNONE 
009-138-F01AGCCCACCACNONE 
009-147-H02AGCCCACCACNONE 
009-198-B08AGCCCACCACNONE 
011-011-H03AGCCCACCACNONE 
013-053-A06AGCCCACCACNONE 
AK060886AGCCCACCACNONE 
AK067715AGCCCACCACSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
AK103920AGCCCACCACNONE 
AK103937AGCCCACCACNONE 
AK104080AGCCCACCACNONE 
AK104649AGCCCACCACNONE 
AK104760AGCCCACCACNONE 
AK119163AGCCCACCACNONE 
AK119188AGCCCACCACNONE 
AK119515AGCCCACCACNONE 
J013071M07AGCCCACCACNONE 
J013098E19AGCCCACCACNONE 
J013119C03AGCCCACCACNONE 
J013135O08AGCCCACCACNONE 
J023060H14AGCCCACCACNONE 
J023075M20AGCCCACCACNONE 
J023098P12AGCCCACCACNONE 
J053061C24AGCCCACCACNONE 
J053065C19AGCCCACCACNONE 
J053094K19AGCCCACCACNONE 
J075047M15AGCCCACCACNONE 
J075083H07AGCCCACCACNONE 
J075108K14AGCCCACCACNONE 
J075112B16AGCCCACCACNONE 
J075169L16AGCCCACCACNONE 
J075180P05AGCCCACCACNONE 
J075194D02AGCCCACCACNONE 
J080013D18AGCCCACCACNONE 
J080016G20AGCCCACCACNONE 
J080017E18AGCCCACCACNONE 
J080018J18AGCCCACCACNONE 
J080018N18AGCCCACCACNONE 
J080036G23AGCCCACCACNONE 
J080038O04AGCCCACCACNONE 
J080038P09AGCCCACCACNONE 
J080039N23AGCCCACCACNONE 
J080043F01AGCCCACCACNONE 
J080064J05AGCCCACCACNONE 
J080067C16AGCCCACCACNONE 
J080069B15AGCCCACCACNONE 
J080071H03AGCCCACCACNONE 
J080086L16AGCCCACCACNONE 
J080088H01AGCCCACCACNONE 
J080089B09AGCCCACCACNONE 
J080090K14AGCCCACCACNONE 
J080090N19AGCCCACCACNONE 
J080093H07AGCCCACCACNONE 
J080097B17AGCCCACCACNONE 
J080301J11AGCCCACCACNONE 
J080301K18AGCCCACCACNONE 
J080305K22AGCCCACCACNONE 
J090008D23AGCCCACCACNONE 
J090013H02AGCCCACCACNONE 
J090031N19AGCCCACCACNONE 
J090053G01AGCCCACCACNONE 
Os01g0588200006-052-E10GCCCACCACNONE 
AJ251563GCCCACCACNONE 
AK070745GCCCACCACVoltage-dependent anion channel. 
AK104055GCCCACCACNONE 
AK104419GCCCACCACNONE 
J023057A07GCCCACCACNONE 
J023068C08GCCCACCACNONE 
J023148E24GCCCACCACNONE 
J090045O22GCCCACCACNONE 
J090045P03GCCCACCACNONE 
J090050C18GCCCACCACNONE 
J100023F01GCCCACCACNONE 
J100051I18GCCCACCACNONE 
J100060P17GCCCACCACNONE 
Os01g0618200AK102319CCTGGGCCAGCCCACCAProtein phosphatase 2C family protein. 
Os01g0624700AK111416GCCCACCACSimilar to WRKY transcription factor 12. 
AY676924GCCCACCACNONE 
AY870601GCCCACCACNONE 
Os01g0651100AK119380CCCACGCGCCCATCGCCCACCACProtein prenyltransferase domain containing protein. 
Os01g0654500013-057-E05GCCCACCAACNONE 
AF155333GCCCACCAACNONE 
AK061752GCCCACCAACSimilar to NADP-isocitrate dehydrogenase. 
D21069GCCCACCAACNONE 
Os01g0680400AK067914GCAGCCCACCAAGCCCTAFII28-like protein family protein. 
J065039K13GCAGCCCACCAAGCCCNONE 
J065042K22GCAGCCCACCAAGCCCNONE 
J080016E23GCAGCCCACCAAGCCCNONE 
J080064E22GCAGCCCACCAAGCCCNONE 
Os01g0688200AK120982GCCCACCAAlpha/beta hydrolase family protein. 
Os01g0703300014-015-D07GCCCACCANONE 
AK099917GCCCACCANONE 
Os01g0704100AK072215ATGGCCCACCACSimilar to Membrane transporter. 
AK109776ATGGCCCACCACNONE 
J080037E03ATGGCCCACCACNONE 
J080041H13ATGGCCCACCACNONE 
J080046B15ATGGCCCACCACNONE 
J080058K14ATGGCCCACCACNONE 
J080065E14ATGGCCCACCACNONE 
J080079C08ATGGCCCACCACNONE 
J080088J12ATGGCCCACCACNONE 
J080088M19ATGGCCCACCACNONE 
J100043G11ATGGCCCACCACNONE 
J100059M22ATGGCCCACCACNONE 
Os01g0707300AK059962AGCCCACCACNONE 
AK104463AGCCCACCACSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
Os01g0770400006-112-B08GCCCACGCCCACCACNONE 
AK061253GCCCACGCCCACCACNONE 
AK061585GCCCACGCCCACCACCyclin-like F-box domain containing protein. 
Os01g0778700AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
Os01g0811100006-061-F11TGGTGGGCCGCNONE 
AB026562TGGTGGGCCGCNONE 
AK061784TGGTGGGCCGCNONE 
AK103541TGGTGGGCCGCProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
J013020B12TGGTGGGCCGCNONE 
J013022J21TGGTGGGCCGCNONE 
J013056G19TGGTGGGCCGCNONE 
J013060O07TGGTGGGCCGCNONE 
J013110I07TGGTGGGCCGCNONE 
J013160D19TGGTGGGCCGCNONE 
J090035A13TGGTGGGCCGCNONE 
Os01g0823100AK070463TGGTGGGCTAlpha-expansin OsEXPA2. 
J065162I18TGGTGGGCTNONE 
J090038D18TGGTGGGCTNONE 
U30477TGGTGGGCTNONE 
Os01g0830500006-117-F06GTGGCCCACCACNONE 
AK061475GTGGCCCACCACNONE 
AK105801GTGGCCCACCAC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17GTGGCCCACCACNONE 
J065211O10GTGGCCCACCACNONE 
Os01g0834200AK069188GCCCACCACNONE 
AK100543GCCCACCACSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0847300AK071164AAAGCCCACCAProtein of unknown function DUF588 family protein. 
AK071164GCCCACCAACProtein of unknown function DUF588 family protein. 
AK104027AAAGCCCACCANONE 
AK104027GCCCACCAACNONE 
Os01g0880800AK059526GCCCACCANONE 
AK101524GCCCACCANONE 
AK120809GCCCACCASimilar to Acyl-[acyl-carrier-protein] desaturase, chloroplast precursor (EC 1.14.19.2) (Stearoyl-ACP desaturase). 
J065112H13GCCCACCANONE 
J090098J11GCCCACCANONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0904500AK119437GTGGTGGGCTGGConserved hypothetical protein. 
J065022O22GTGGTGGGCTGGNONE 
J065102M14GTGGTGGGCTGGNONE 
J065192C12GTGGTGGGCTGGNONE 
Os01g0913400AK099881TGGTGGGCTTCProtein prenyltransferase domain containing protein. 
Os01g0913800011-060-B02AACTGGGCCCACCANONE 
016-088-H02AACTGGGCCCACCAProtein prenyltransferase domain containing protein. 
Os01g0949200AK102412CGGACGGCCCACCANONE 
J033093A04CGGACGGCCCACCANONE 
J065053P06CGGACGGCCCACCANONE 
J100086D18CGGACGGCCCACCANONE 
Os01g0952600AK067525GTTGGTGGGCTTANONE 
AK070047GTTGGTGGGCTTASimilar to LacZ (Fragment). 
Os01g0960500AK065423GTGGTGGGCCopine domain containing protein. 
J033099P18GTGGTGGGCNONE 
J043012D04GTGGTGGGCNONE 
J053060F17GTGGTGGGCNONE 
J090019J06GTGGTGGGCNONE 
Os01g0961200011-099-H06CTGGCCCACCAACNONE 
AK105424CTGGCCCACCAACCBS domain containing protein. 
J065169J18CTGGCCCACCAACNONE 
J075109H12CTGGCCCACCAACNONE 
Os01g0965500J075073G20AGCCCACCACNuclear protein SET domain containing protein. 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0976300AK111354TGGTGGGCCTAHeavy metal transport/detoxification protein domain containing protein. 
Os02g0103700009-031-C12AACGGCCCACCANONE 
AK062502AACGGCCCACCANONE 
AK102186AACGGCCCACCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17AACGGCCCACCANONE 
J065161I07AACGGCCCACCANONE 
J065184G15AACGGCCCACCANONE 
J075123E02AACGGCCCACCANONE 
Os02g0115700AK061923GCCCACCACNONE 
AK065094CCCGGGCCCACCACatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231CCCGGGCCCACCANONE 
AK099923CCCGGGCCCACCANONE 
X61626CCCGGGCCCACCANONE 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0169300006-023-D12CCGTGGGCCCACCACNONE 
006-062-B01CCGTGGGCCCACCACNONE 
015-049-F11CCGTGGGCCCACCACNONE 
015-057-G02CCGTGGGCCCACCACNONE 
015-092-F04CCGTGGGCCCACCACNONE 
015-095-H02CCGTGGGCCCACCACNONE 
015-097-B07CCGTGGGCCCACCACNONE 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07CCGTGGGCCCACCACNONE 
J013134H23CCGTGGGCCCACCACNONE 
J013134J23CCGTGGGCCCACCACNONE 
J023036N24CCGTGGGCCCACCACNONE 
J023049C06CCGTGGGCCCACCACNONE 
J023077E10CCGTGGGCCCACCACNONE 
J023077F10CCGTGGGCCCACCACNONE 
J023105N12CCGTGGGCCCACCACNONE 
J033036O12CCGTGGGCCCACCACNONE 
J033064P11CCGTGGGCCCACCACNONE 
J033079F01CCGTGGGCCCACCACNONE 
J033123M22CCGTGGGCCCACCACNONE 
J033143E10CCGTGGGCCCACCACNONE 
J075013D12CCGTGGGCCCACCACNONE 
Os02g0170100006-118-G03AGCCCACCANONE 
AK058912AGCCCACCAGlycine cleavage H-protein family protein. 
AK100893AGCCCACCANONE 
J023055I08AGCCCACCANONE 
J023130P09AGCCCACCANONE 
J023139G13AGCCCACCANONE 
J043016H16AGCCCACCANONE 
J053027E10AGCCCACCANONE 
J053031J16AGCCCACCANONE 
J053061A22AGCCCACCANONE 
J053088J02AGCCCACCANONE 
J053093E17AGCCCACCANONE 
J065028L08AGCCCACCANONE 
J065038K06AGCCCACCANONE 
J065060G19AGCCCACCANONE 
J075037P13AGCCCACCANONE 
J075083I01AGCCCACCANONE 
J080034E20AGCCCACCANONE 
J080044E22AGCCCACCANONE 
J080077F17AGCCCACCANONE 
J080078P05AGCCCACCANONE 
J090007E12AGCCCACCANONE 
J100019B20AGCCCACCANONE 
J100025H05AGCCCACCANONE 
J100045B13AGCCCACCANONE 
J100045C10AGCCCACCANONE 
J100050L07AGCCCACCANONE 
Os02g0188500AK102004CCAGCCCACCANONE 
AK106917CCAGCCCACCAUbiquitin domain containing protein. 
J090039N13CCAGCCCACCANONE 
Os02g0194000015-020-A08TGGTGGGCCGCNONE 
AK064096TGGTGGGCCGCMyb, DNA-binding domain containing protein. 
J090092L06TGGTGGGCCGCNONE 
Os02g0255200AK121591AAAGCCCACCASimilar to Ribosomal protein S15a homolog. 
J033023N03AAAGCCCACCANONE 
J033031C22AAAGCCCACCANONE 
J033037P22AAAGCCCACCANONE 
J090013J10AAAGCCCACCANONE 
J090030I04AAAGCCCACCANONE 
Os02g0316800009-104-A11AAAGCCCACCANONE 
AK062767AAAGCCCACCASimilar to MRNA binding protein precursor. 
Os02g0473000AK065460GTGGTGGGCGAGGRiboflavin biosynthesis protein RibD family protein. 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0555000015-020-G02AAAGCCCACCACNONE 
AK065270AAAGCCCACCACNONE 
AK121253AAAGCCCACCACProtein of unknown function, ATP binding family protein. 
J013002L01AAAGCCCACCACNONE 
J023060A02AAAGCCCACCACNONE 
J023101O11AAAGCCCACCACNONE 
J023140A15AAAGCCCACCACNONE 
J033042H19AAAGCCCACCACNONE 
J033046C02AAAGCCCACCACNONE 
J033080N19AAAGCCCACCACNONE 
J065026I02AAAGCCCACCACNONE 
J065040C18AAAGCCCACCACNONE 
J090004I16AAAGCCCACCACNONE 
Os02g0574900AK073087AGCCCACCACCyclin-like F-box domain containing protein. 
J033023M04AGCCCACCACNONE 
J033117N08AGCCCACCACNONE 
J075008F16AGCCCACCACNONE 
J075075I19AGCCCACCACNONE 
J075079A06AGCCCACCACNONE 
J075086I07AGCCCACCACNONE 
J075088F13AGCCCACCACNONE 
J075093D04AGCCCACCACNONE 
J075163C10AGCCCACCACNONE 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
009-199-B01GGGACCCACCTGGGGCCCACCANONE 
011-015-G12GGGACCCACCTGGGGCCCACCANONE 
J023113C24GGGACCCACCTGGGGCCCACCANONE 
Os02g0593400016-051-C08TGGTGGGCTNONE 
AK064226TGGTGGGCTNONE 
AK072362TGGTGGGCTConserved hypothetical protein. 
AK109015TGGTGGGCTNONE 
J023063B12TGGTGGGCTNONE 
J065192M02TGGTGGGCTNONE 
J075182N05TGGTGGGCTNONE 
Os02g0602300AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0606900J023065M01TGGTGGGCCTANONE 
J075046E14TGGTGGGCCTANONE 
Os02g0618700AK070657GCCCACCALung seven transmembrane receptor family protein. 
J023056H15GCCCACCANONE 
Os02g0625500011-025-C06GCCCACCAACCGCGGGGGNONE 
011-025-C06GTTGGTGGGCNONE 
AB050624GCCCACCAACCGCGGGGGNONE 
AB050624GTTGGTGGGCNONE 
AK059188GCCCACCAACCGCGGGGGNONE 
AK059188GTTGGTGGGCNONE 
AK059771GCCCACCAACCGCGGGGGNONE 
AK059771GTTGGTGGGCNONE 
AK101791GCCCACCAACCGCGGGGGSimilar to Adenosine kinase-like protein (Fragment). 
AK101791GTTGGTGGGCSimilar to Adenosine kinase-like protein (Fragment). 
AY224510GCCCACCAACCGCGGGGGNONE 
AY224510GTTGGTGGGCNONE 
J013152H02GCCCACCAACCGCGGGGGNONE 
J013152H02GTTGGTGGGCNONE 
J023012P09GCCCACCAACCGCGGGGGNONE 
J023012P09GTTGGTGGGCNONE 
J023127D16GCCCACCAACCGCGGGGGNONE 
J023127D16GTTGGTGGGCNONE 
J033024G01GCCCACCAACCGCGGGGGNONE 
J033024G01GTTGGTGGGCNONE 
J033025L19GCCCACCAACCGCGGGGGNONE 
J033025L19GTTGGTGGGCNONE 
J033080M04GCCCACCAACCGCGGGGGNONE 
J033080M04GTTGGTGGGCNONE 
J033101A08GCCCACCAACCGCGGGGGNONE 
J033101A08GTTGGTGGGCNONE 
J033121L12GCCCACCAACCGCGGGGGNONE 
J033121L12GTTGGTGGGCNONE 
J043017N15GCCCACCAACCGCGGGGGNONE 
J043017N15GTTGGTGGGCNONE 
J065207J01GCCCACCAACCGCGGGGGNONE 
J065207J01GTTGGTGGGCNONE 
J090049G12GCCCACCAACCGCGGGGGNONE 
J090049G12GTTGGTGGGCNONE 
J100036A07GCCCACCAACCGCGGGGGNONE 
J100036A07GTTGGTGGGCNONE 
J100076C04GCCCACCAACCGCGGGGGNONE 
J100076C04GTTGGTGGGCNONE 
J100080N22GCCCACCAACCGCGGGGGNONE 
J100080N22GTTGGTGGGCNONE 
Os02g0652100AK072906AGCCCACCACSimilar to WRKY transcription factor 34. 
J075187F06AGCCCACCACNONE 
Os02g0658500AK120166CTGGCCCACCANONE 
Os02g0666200006-021-D11CTGGCCCACCAGGGCCCACGCNONE 
006-022-F02CTGGCCCACCAGGGCCCACGCNONE 
006-022-H11CTGGCCCACCAGGGCCCACGCNONE 
006-024-C03CTGGCCCACCAGGGCCCACGCNONE 
006-026-G05CTGGCCCACCAGGGCCCACGCNONE 
006-027-F11CTGGCCCACCAGGGCCCACGCNONE 
006-028-G06CTGGCCCACCAGGGCCCACGCNONE 
006-028-H05CTGGCCCACCAGGGCCCACGCNONE 
006-030-H06CTGGCCCACCAGGGCCCACGCNONE 
006-030-H12CTGGCCCACCAGGGCCCACGCNONE 
006-031-C07CTGGCCCACCAGGGCCCACGCNONE 
006-031-G01CTGGCCCACCAGGGCCCACGCNONE 
006-033-F09CTGGCCCACCAGGGCCCACGCNONE 
006-035-A01CTGGCCCACCAGGGCCCACGCNONE 
006-035-A12CTGGCCCACCAGGGCCCACGCNONE 
006-035-F04CTGGCCCACCAGGGCCCACGCNONE 
006-036-G09CTGGCCCACCAGGGCCCACGCNONE 
006-038-A01CTGGCCCACCAGGGCCCACGCNONE 
006-038-A03CTGGCCCACCAGGGCCCACGCNONE 
006-039-D08CTGGCCCACCAGGGCCCACGCNONE 
006-042-C11CTGGCCCACCAGGGCCCACGCNONE 
006-042-H06CTGGCCCACCAGGGCCCACGCNONE 
006-044-E01CTGGCCCACCAGGGCCCACGCNONE 
006-045-E05CTGGCCCACCAGGGCCCACGCNONE 
006-046-G05CTGGCCCACCAGGGCCCACGCNONE 
006-047-A03CTGGCCCACCAGGGCCCACGCNONE 
006-048-H08CTGGCCCACCAGGGCCCACGCNONE 
006-052-A07CTGGCCCACCAGGGCCCACGCNONE 
006-053-A05CTGGCCCACCAGGGCCCACGCNONE 
006-054-G06CTGGCCCACCAGGGCCCACGCNONE 
006-056-D10CTGGCCCACCAGGGCCCACGCNONE 
006-057-B07CTGGCCCACCAGGGCCCACGCNONE 
006-058-F12CTGGCCCACCAGGGCCCACGCNONE 
006-060-D01CTGGCCCACCAGGGCCCACGCNONE 
006-061-A12CTGGCCCACCAGGGCCCACGCNONE 
006-062-E02CTGGCCCACCAGGGCCCACGCNONE 
006-063-F11CTGGCCCACCAGGGCCCACGCNONE 
006-063-H02CTGGCCCACCAGGGCCCACGCNONE 
006-066-F12CTGGCCCACCAGGGCCCACGCNONE 
006-067-H12CTGGCCCACCAGGGCCCACGCNONE 
006-068-B09CTGGCCCACCAGGGCCCACGCNONE 
006-068-D08CTGGCCCACCAGGGCCCACGCNONE 
006-071-A12CTGGCCCACCAGGGCCCACGCNONE 
006-072-H06CTGGCCCACCAGGGCCCACGCNONE 
006-074-A02CTGGCCCACCAGGGCCCACGCNONE 
006-074-F10CTGGCCCACCAGGGCCCACGCNONE 
006-077-H10CTGGCCCACCAGGGCCCACGCNONE 
006-078-G02CTGGCCCACCAGGGCCCACGCNONE 
006-081-B03CTGGCCCACCAGGGCCCACGCNONE 
006-084-H01CTGGCCCACCAGGGCCCACGCNONE 
006-084-H02CTGGCCCACCAGGGCCCACGCNONE 
006-084-H04CTGGCCCACCAGGGCCCACGCNONE 
006-087-H08CTGGCCCACCAGGGCCCACGCNONE 
006-090-B08CTGGCCCACCAGGGCCCACGCNONE 
006-091-E10CTGGCCCACCAGGGCCCACGCNONE 
006-093-G02CTGGCCCACCAGGGCCCACGCNONE 
006-094-B12CTGGCCCACCAGGGCCCACGCNONE 
006-094-E03CTGGCCCACCAGGGCCCACGCNONE 
006-095-G07CTGGCCCACCAGGGCCCACGCNONE 
006-095-H07CTGGCCCACCAGGGCCCACGCNONE 
006-097-G08CTGGCCCACCAGGGCCCACGCNONE 
006-098-E12CTGGCCCACCAGGGCCCACGCNONE 
006-099-A04CTGGCCCACCAGGGCCCACGCNONE 
006-099-E08CTGGCCCACCAGGGCCCACGCNONE 
006-103-F12CTGGCCCACCAGGGCCCACGCNONE 
006-104-G02CTGGCCCACCAGGGCCCACGCNONE 
006-105-F02CTGGCCCACCAGGGCCCACGCNONE 
006-107-D12CTGGCCCACCAGGGCCCACGCNONE 
006-108-F10CTGGCCCACCAGGGCCCACGCNONE 
006-108-H05CTGGCCCACCAGGGCCCACGCNONE 
006-110-G11CTGGCCCACCAGGGCCCACGCNONE 
006-111-D10CTGGCCCACCAGGGCCCACGCNONE 
006-111-E03CTGGCCCACCAGGGCCCACGCNONE 
006-111-H01CTGGCCCACCAGGGCCCACGCNONE 
006-113-C12CTGGCCCACCAGGGCCCACGCNONE 
006-114-C10CTGGCCCACCAGGGCCCACGCNONE 
006-115-B02CTGGCCCACCAGGGCCCACGCNONE 
006-117-D11CTGGCCCACCAGGGCCCACGCNONE 
006-117-E01CTGGCCCACCAGGGCCCACGCNONE 
009-131-C02CTGGCCCACCAGGGCCCACGCNONE 
009-133-G05CTGGCCCACCAGGGCCCACGCNONE 
009-152-E01CTGGCCCACCAGGGCCCACGCNONE 
009-154-E08CTGGCCCACCAGGGCCCACGCNONE 
009-196-C11CTGGCCCACCAGGGCCCACGCNONE 
012-010-E10CTGGCCCACCAGGGCCCACGCNONE 
013-018-C05CTGGCCCACCAGGGCCCACGCNONE 
013-074-A06CTGGCCCACCAGGGCCCACGCNONE 
013-078-E06CTGGCCCACCAGGGCCCACGCNONE 
AB009665CTGGCCCACCAGGGCCCACGCNONE 
AF022737CTGGCCCACCAGGGCCCACGCNONE 
AJ224327CTGGCCCACCAGGGCCCACGCNONE 
AK061769CTGGCCCACCAGGGCCCACGCNONE 
AK103807CTGGCCCACCAGGGCCCACGCAquaporin. 
AK104658CTGGCCCACCAGGGCCCACGCNONE 
J013065I12CTGGCCCACCAGGGCCCACGCNONE 
J013067L09CTGGCCCACCAGGGCCCACGCNONE 
J013089I10CTGGCCCACCAGGGCCCACGCNONE 
J013095N22CTGGCCCACCAGGGCCCACGCNONE 
J013130E17CTGGCCCACCAGGGCCCACGCNONE 
J013131A06CTGGCCCACCAGGGCCCACGCNONE 
J013154E06CTGGCCCACCAGGGCCCACGCNONE 
J023004D16CTGGCCCACCAGGGCCCACGCNONE 
J023010A15CTGGCCCACCAGGGCCCACGCNONE 
J023010H04CTGGCCCACCAGGGCCCACGCNONE 
J023049K10CTGGCCCACCAGGGCCCACGCNONE 
J023056H24CTGGCCCACCAGGGCCCACGCNONE 
J023064J12CTGGCCCACCAGGGCCCACGCNONE 
J023078I06CTGGCCCACCAGGGCCCACGCNONE 
J023081D05CTGGCCCACCAGGGCCCACGCNONE 
J023099I19CTGGCCCACCAGGGCCCACGCNONE 
J023100F05CTGGCCCACCAGGGCCCACGCNONE 
J023131F16CTGGCCCACCAGGGCCCACGCNONE 
J033025F16CTGGCCCACCAGGGCCCACGCNONE 
J033028F10CTGGCCCACCAGGGCCCACGCNONE 
J033058H13CTGGCCCACCAGGGCCCACGCNONE 
J033064P18CTGGCCCACCAGGGCCCACGCNONE 
J033070H04CTGGCCCACCAGGGCCCACGCNONE 
J033107P20CTGGCCCACCAGGGCCCACGCNONE 
J033114E09CTGGCCCACCAGGGCCCACGCNONE 
J033125G23CTGGCCCACCAGGGCCCACGCNONE 
J033136G05CTGGCCCACCAGGGCCCACGCNONE 
J033147A07CTGGCCCACCAGGGCCCACGCNONE 
J053048M24CTGGCCCACCAGGGCCCACGCNONE 
J053056K02CTGGCCCACCAGGGCCCACGCNONE 
J053057N24CTGGCCCACCAGGGCCCACGCNONE 
J053060C13CTGGCCCACCAGGGCCCACGCNONE 
J065053C22CTGGCCCACCAGGGCCCACGCNONE 
J065067J11CTGGCCCACCAGGGCCCACGCNONE 
J065085A01CTGGCCCACCAGGGCCCACGCNONE 
J065189K01CTGGCCCACCAGGGCCCACGCNONE 
J075024G24CTGGCCCACCAGGGCCCACGCNONE 
J075060O04CTGGCCCACCAGGGCCCACGCNONE 
J075075M07CTGGCCCACCAGGGCCCACGCNONE 
J075090A10CTGGCCCACCAGGGCCCACGCNONE 
J075110P11CTGGCCCACCAGGGCCCACGCNONE 
J075114H02CTGGCCCACCAGGGCCCACGCNONE 
J075127L13CTGGCCCACCAGGGCCCACGCNONE 
J075151B19CTGGCCCACCAGGGCCCACGCNONE 
J075187M17CTGGCCCACCAGGGCCCACGCNONE 
J075198E22CTGGCCCACCAGGGCCCACGCNONE 
J080006J20CTGGCCCACCAGGGCCCACGCNONE 
J080081J10CTGGCCCACCAGGGCCCACGCNONE 
J080087C03CTGGCCCACCAGGGCCCACGCNONE 
J090029E22CTGGCCCACCAGGGCCCACGCNONE 
J090037C19CTGGCCCACCAGGGCCCACGCNONE 
J090037P10CTGGCCCACCAGGGCCCACGCNONE 
J090047M10CTGGCCCACCAGGGCCCACGCNONE 
J090055K05CTGGCCCACCAGGGCCCACGCNONE 
J090057N19CTGGCCCACCAGGGCCCACGCNONE 
J090062M13CTGGCCCACCAGGGCCCACGCNONE 
J090066F22CTGGCCCACCAGGGCCCACGCNONE 
J090066N12CTGGCCCACCAGGGCCCACGCNONE 
J090071K08CTGGCCCACCAGGGCCCACGCNONE 
J090080F16CTGGCCCACCAGGGCCCACGCNONE 
J090081J21CTGGCCCACCAGGGCCCACGCNONE 
J090083F22CTGGCCCACCAGGGCCCACGCNONE 
J090083I12CTGGCCCACCAGGGCCCACGCNONE 
J090088B16CTGGCCCACCAGGGCCCACGCNONE 
J090088E01CTGGCCCACCAGGGCCCACGCNONE 
J090091C11CTGGCCCACCAGGGCCCACGCNONE 
J090091F17CTGGCCCACCAGGGCCCACGCNONE 
J090097A05CTGGCCCACCAGGGCCCACGCNONE 
J090098B15CTGGCCCACCAGGGCCCACGCNONE 
J100018B04CTGGCCCACCAGGGCCCACGCNONE 
J100021J08CTGGCCCACCAGGGCCCACGCNONE 
J100026M12CTGGCCCACCAGGGCCCACGCNONE 
J100032F02CTGGCCCACCAGGGCCCACGCNONE 
J100034B03CTGGCCCACCAGGGCCCACGCNONE 
J100037D13CTGGCCCACCAGGGCCCACGCNONE 
J100041C16CTGGCCCACCAGGGCCCACGCNONE 
J100044D14CTGGCCCACCAGGGCCCACGCNONE 
J100044E21CTGGCCCACCAGGGCCCACGCNONE 
J100047M16CTGGCCCACCAGGGCCCACGCNONE 
J100051D22CTGGCCCACCAGGGCCCACGCNONE 
J100056M13CTGGCCCACCAGGGCCCACGCNONE 
J100061J12CTGGCCCACCAGGGCCCACGCNONE 
J100065A22CTGGCCCACCAGGGCCCACGCNONE 
J100067L12CTGGCCCACCAGGGCCCACGCNONE 
J100068F06CTGGCCCACCAGGGCCCACGCNONE 
J100070C24CTGGCCCACCAGGGCCCACGCNONE 
J100072N09CTGGCCCACCAGGGCCCACGCNONE 
J100073A10CTGGCCCACCAGGGCCCACGCNONE 
J100073B15CTGGCCCACCAGGGCCCACGCNONE 
J100077F05CTGGCCCACCAGGGCCCACGCNONE 
J100078B03CTGGCCCACCAGGGCCCACGCNONE 
J100078F01CTGGCCCACCAGGGCCCACGCNONE 
J100079B08CTGGCCCACCAGGGCCCACGCNONE 
J100083J06CTGGCCCACCAGGGCCCACGCNONE 
Os02g0673000AK108650TGGTGGGCTProtein of unknown function UPF0005 family protein. 
Os02g0697200015-013-B10ACAGCCCACCACNONE 
AK059475ACAGCCCACCACNONE 
AK102993ACAGCCCACCACConserved hypothetical protein. 
J033079I18ACAGCCCACCACNONE 
J033082A14ACAGCCCACCACNONE 
J065047H08ACAGCCCACCACNONE 
J065131M14ACAGCCCACCACNONE 
Os02g0703900AK102115AGCCCACCAACSimilar to Nodulin-like protein. 
AK121966AGCCCACCAACNONE 
J023109K03AGCCCACCAACNONE 
J033051G23AGCCCACCAACNONE 
J033084H22AGCCCACCAACNONE 
J090056B12AGCCCACCAACNONE 
J090059L13AGCCCACCAACNONE 
J090080M03AGCCCACCAACNONE 
Os02g0728600AK063054GTGGTGGGCSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04GTGGTGGGCNONE 
Os02g0741500AK068867CAGGCCCACCARibbon-helix-helix domain containing protein. 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
Os02g0810300AK059363TGGTGGGCSimilar to NBD-like protein. 
AK099203TGGTGGGCNONE 
Os02g0818000005-003-E01TGGTGGGCCAGNONE 
006-055-D08TGGTGGGCCAGNONE 
006-060-D05TGGTGGGCCAGNONE 
006-086-H02TGGTGGGCCAGNONE 
006-091-B04TGGTGGGCCAGNONE 
009-152-H12TGGTGGGCCAGNONE 
009-184-D08TGGTGGGCCAGNONE 
AK071580TGGTGGGCCAGNONE 
AK104103TGGTGGGCCAGNONE 
AK104525TGGTGGGCCAGNONE 
AK104684TGGTGGGCCAGNONE 
AK104947TGGTGGGCCAGNONE 
J013032M21TGGTGGGCCAGNONE 
J013032M22TGGTGGGCCAGNONE 
J013044P09TGGTGGGCCAGNONE 
J013056P03TGGTGGGCCAGNONE 
J013070P08TGGTGGGCCAGNONE 
J013106H15TGGTGGGCCAGNONE 
J013146O03TGGTGGGCCAGNONE 
J013170F21TGGTGGGCCAGNONE 
J023038I01TGGTGGGCCAGNONE 
J023049P19TGGTGGGCCAGNONE 
J023106O04TGGTGGGCCAGNONE 
J053100K06TGGTGGGCCAGNONE 
J075026E09TGGTGGGCCAGNONE 
J075043L03TGGTGGGCCAGNONE 
J075049B11TGGTGGGCCAGNONE 
J080301G04TGGTGGGCCAGNONE 
J080305H10TGGTGGGCCAGNONE 
J080308H05TGGTGGGCCAGNONE 
J080311I19TGGTGGGCCAGNONE 
J080315G02TGGTGGGCCAGNONE 
J080315J24TGGTGGGCCAGNONE 
J080316D10TGGTGGGCCAGNONE 
J080317H09TGGTGGGCCAGNONE 
J080317J05TGGTGGGCCAGNONE 
J080318H15TGGTGGGCCAGNONE 
J090047M14TGGTGGGCCAGNONE 
J100025F05TGGTGGGCCAGNONE 
J100060C16TGGTGGGCCAGNONE 
J100064H07TGGTGGGCCAGNONE 
J100075N11TGGTGGGCCAGNONE 
J100081E01TGGTGGGCCAGNONE 
J100085G12TGGTGGGCCAGNONE 
Os02g0830100J013032G02CGATGGGCCCACCACNONE 
J013052O21CGATGGGCCCACCACNONE 
J023078A05CGATGGGCCCACCACNONE 
J033114C07CGATGGGCCCACCACNONE 
J033125M07CGATGGGCCCACCACNONE 
J053045C11CGATGGGCCCACCACNONE 
J100055G05CGATGGGCCCACCACNONE 
J100080J22CGATGGGCCCACCACNONE 
Os02g0831800009-150-D09GTTGGTGGGCCATNONE 
AK060519GTTGGTGGGCCATSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2. 
J075143E03GTTGGTGGGCCATNONE 
J100077H12GTTGGTGGGCCATNONE 
Os03g0116800012-097-D10GAAGCCCACCACNONE 
016-024-H10GAAGCCCACCACNONE 
AK066955GAAGCCCACCACConserved hypothetical protein. 
AK068678GAAGCCCACCACNONE 
AK104839GAAGCCCACCACNONE 
J013033G16GAAGCCCACCACNONE 
J013091C10GAAGCCCACCACNONE 
J013158H22GAAGCCCACCACNONE 
J023106K11GAAGCCCACCACNONE 
J065051O15GAAGCCCACCACNONE 
J065129G22GAAGCCCACCACNONE 
J075001K02GAAGCCCACCACNONE 
J075011O03GAAGCCCACCACNONE 
J075024K04GAAGCCCACCACNONE 
J075026E07GAAGCCCACCACNONE 
J075037O14GAAGCCCACCACNONE 
J075071D17GAAGCCCACCACNONE 
J075084M05GAAGCCCACCACNONE 
J075114B06GAAGCCCACCACNONE 
J075128C23GAAGCCCACCACNONE 
J075153A13GAAGCCCACCACNONE 
J075158A15GAAGCCCACCACNONE 
J075165P09GAAGCCCACCACNONE 
J075167M21GAAGCCCACCACNONE 
J075170F11GAAGCCCACCACNONE 
J075186F12GAAGCCCACCACNONE 
J075186L13GAAGCCCACCACNONE 
J075189A01GAAGCCCACCACNONE 
J075192D19GAAGCCCACCACNONE 
Os03g0136900AK067183GCCCACCACGCGTCTCSimilar to Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase). 
Os03g0157900J043036K05GCCCACCAACNONE 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0162200009-031-E05GCCCACCANONE 
013-049-D04GCCCACCANONE 
013-082-E03GCCCACCANONE 
014-039-G04GCCCACCANONE 
014-098-G11GCCCACCANONE 
AK061605GCCCACCANONE 
AK121533GCCCACCASimilar to Histone H2A. 
J033024D06GCCCACCANONE 
J033030P21GCCCACCANONE 
J065063C20GCCCACCANONE 
J065064A18GCCCACCANONE 
J065147G02GCCCACCANONE 
J065204K06GCCCACCANONE 
J090004C22GCCCACCANONE 
J090014K02GCCCACCANONE 
J090074E10GCCCACCANONE 
J090086L09GCCCACCANONE 
Os03g0175200J090059M15GTGGTGGGCNONE 
Os03g0178400AK108257GAAGCCCACCACCAACEpoxide hydrolase family protein. 
Os03g0181600AK067807AGCCCAAGCGGCCCACCASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK067807TAAGCCCACCAACGGCTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197AGCCCAAGCGGCCCACCANONE 
AK101197TAAGCCCACCAACGGCTNONE 
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein. 
Os03g0201100AK102337GCCCACCASimilar to Cyclophilin-like protein PPIL3b. 
J033091A16GCCCACCANONE 
J075063K10GCCCACCANONE 
J075092L23GCCCACCANONE 
J075093A14GCCCACCANONE 
Os03g0244200003-114-A11GCCCACCANONE 
015-089-B03GCCCACCANONE 
016-048-G01GCCCACCANONE 
AK101837GCCCACCASimilar to Thaumatin-like protein. 
AK105771GCCCACCANONE 
AK107182GCCCACCANONE 
J065054I12GCCCACCANONE 
J065208F20GCCCACCANONE 
J075088F18GCCCACCANONE 
J075092G13GCCCACCANONE 
J075120G01GCCCACCANONE 
J075147M20GCCCACCANONE 
J075151J03GCCCACCANONE 
J100064H21GCCCACCANONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0257900009-150-G06CCTCGCCCACCAACNONE 
009-181-H05CCTCGCCCACCAACNONE 
AK063892CCTCGCCCACCAACNONE 
AK100114CCTCGCCCACCAACSimilar to Lectin-like receptor kinase 7;2. 
AK103486CCTCGCCCACCAACNONE 
J023006K11CCTCGCCCACCAACNONE 
J075005E15CCTCGCCCACCAACNONE 
J075007K24CCTCGCCCACCAACNONE 
J075034G06CCTCGCCCACCAACNONE 
J075051I19CCTCGCCCACCAACNONE 
J075076A08CCTCGCCCACCAACNONE 
J075096H04CCTCGCCCACCAACNONE 
J075115I09CCTCGCCCACCAACNONE 
J075132K23CCTCGCCCACCAACNONE 
J075147C17CCTCGCCCACCAACNONE 
J090059O20CCTCGCCCACCAACNONE 
Os03g0259600AK108532AGCCCACCAUbiquitin domain containing protein. 
J065064G04AGCCCACCANONE 
J065116I06AGCCCACCANONE 
J065165C14AGCCCACCANONE 
J075173K24AGCCCACCANONE 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0270700AK119531TGGTGGGCCAANONE 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0279200009-097-C06CGGGCCCACCACNONE 
013-007-B07CGGGCCCACCACNONE 
AK121750CGGGCCCACCACSimilar to Histone H2A. 
J033087I02CGGGCCCACCACNONE 
J065002G20CGGGCCCACCACNONE 
J065102M04CGGGCCCACCACNONE 
J065139A02CGGGCCCACCACNONE 
J075109D21CGGGCCCACCACNONE 
J075191L12CGGGCCCACCACNONE 
J090096C03CGGGCCCACCACNONE 
J100036C23CGGGCCCACCACNONE 
Os03g0279600006-070-A07TAAGCCCACCANONE 
AK061080TAAGCCCACCAConserved hypothetical protein. 
AK071043TAAGCCCACCANONE 
AK103191TAAGCCCACCANONE 
J065077E22TAAGCCCACCANONE 
J065208F22TAAGCCCACCANONE 
J075156K12TAAGCCCACCANONE 
Os03g0288400Os03g0288400GCGGGCCCACCAConserved hypothetical protein. 
Os03g0297400AK060653CCAGCCCACCANONE 
AK061403CCAGCCCACCANONE 
AK101597CCAGCCCACCAMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0310800009-126-C10AGCCCACCAACNONE 
009-156-D02AGCCCACCAACNONE 
AK058663AGCCCACCAACNONE 
AK099476AGCCCACCAACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15AGCCCACCAACNONE 
J075046C12AGCCCACCAACNONE 
J075058D24AGCCCACCAACNONE 
J075151M03AGCCCACCAACNONE 
J075151M04AGCCCACCAACNONE 
J075153I20AGCCCACCAACNONE 
J075167J05AGCCCACCAACNONE 
J075179G06AGCCCACCAACNONE 
J100025I19AGCCCACCAACNONE 
J100025L21AGCCCACCAACNONE 
J100029C06AGCCCACCAACNONE 
J100068E24AGCCCACCAACNONE 
J100070F10AGCCCACCAACNONE 
J100083H23AGCCCACCAACNONE 
J100089H10AGCCCACCAACNONE 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0333300015-069-B02AGCCCACCANONE 
AK063858AGCCCACCANONE 
AK073228AGCCCACCASimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
Os03g0379300006-039-F11CTGGCCCACCACNONE 
AK061515CTGGCCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704CTGGCCCACCACNONE 
J013159M16CTGGCCCACCACNONE 
J090067F01CTGGCCCACCACNONE 
J090083F21CTGGCCCACCACNONE 
J100040M08CTGGCCCACCACNONE 
J100048C03CTGGCCCACCACNONE 
J100056M07CTGGCCCACCACNONE 
J100062N22CTGGCCCACCACNONE 
J100086L07CTGGCCCACCACNONE 
Os03g0379500AK064760TAGGCCCACCASimilar to 40S ribosomal protein S9. 
J080024D11TAGGCCCACCANONE 
J080044J02TAGGCCCACCANONE 
J080050F01TAGGCCCACCANONE 
J080063D21TAGGCCCACCANONE 
J080063G04TAGGCCCACCANONE 
J080078E02TAGGCCCACCANONE 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12TGGTGGGCCCTGGCCCATCANONE 
Os03g0419100AK073482CCCCCGCGCCCACCANONE 
AK119969CCCCCGCGCCCACCAProtein of unknown function DUF1675 family protein. 
Os03g0440900006-025-H04GCCCACCANONE 
006-047-H07GCCCACCANONE 
006-060-H12GCCCACCANONE 
006-070-A03GCCCACCANONE 
006-092-C02GCCCACCANONE 
006-094-G10GCCCACCANONE 
014-077-B09GCCCACCANONE 
AK061730GCCCACCASimilar to LRR protein. 
AK069710GCCCACCANONE 
J013027E23GCCCACCANONE 
J023031G03GCCCACCANONE 
J065166J18GCCCACCANONE 
J075034K19GCCCACCANONE 
J075046I24GCCCACCANONE 
J075176D13GCCCACCANONE 
J090060I21GCCCACCANONE 
J100025G01GCCCACCANONE 
J100025O12GCCCACCANONE 
J100041L24GCCCACCANONE 
J100057B08GCCCACCANONE 
J100060J12GCCCACCANONE 
Os03g0611200AK065587CCCACCCGCCCACCACAldo/keto reductase family protein. 
Os03g0623100014-072-D06GCCCACCACNONE 
014-072-G11GCCCACCACNONE 
AK063716GCCCACCACConserved hypothetical protein. 
J065136O20GCCCACCACNONE 
J075030G11GCCCACCACNONE 
J075034O21GCCCACCACNONE 
J075051D07GCCCACCACNONE 
J075066M05GCCCACCACNONE 
J075095G15GCCCACCACNONE 
Os03g0647800003-103-H03ACCGGCCCACCAACNONE 
006-104-G09ACCGGCCCACCAACNONE 
AK070243ACCGGCCCACCAACConserved hypothetical protein. 
J100056F22ACCGGCCCACCAACNONE 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0670700009-028-B03GCCCACCANONE 
009-028-B03GTGGTGGGCCGCNONE 
009-036-H12GCCCACCANONE 
009-036-H12GTGGTGGGCCGCNONE 
009-053-H05GCCCACCANONE 
009-053-H05GTGGTGGGCCGCNONE 
009-126-B02GCCCACCANONE 
009-126-B02GTGGTGGGCCGCNONE 
009-135-D07GCCCACCANONE 
009-135-D07GTGGTGGGCCGCNONE 
009-148-A03GCCCACCANONE 
009-148-A03GTGGTGGGCCGCNONE 
009-148-A12GCCCACCANONE 
009-148-A12GTGGTGGGCCGCNONE 
009-152-B02GCCCACCANONE 
009-152-B02GTGGTGGGCCGCNONE 
009-153-B06GCCCACCANONE 
009-153-B06GTGGTGGGCCGCNONE 
009-166-G05GCCCACCANONE 
009-166-G05GTGGTGGGCCGCNONE 
009-181-A09GCCCACCANONE 
009-181-A09GTGGTGGGCCGCNONE 
011-061-D07GCCCACCANONE 
011-061-D07GTGGTGGGCCGCNONE 
012-043-C04GCCCACCANONE 
012-043-C04GTGGTGGGCCGCNONE 
013-001-A02GCCCACCANONE 
013-001-A02GTGGTGGGCCGCNONE 
013-004-F05GCCCACCANONE 
013-004-F05GTGGTGGGCCGCNONE 
013-008-C08GCCCACCANONE 
013-008-C08GTGGTGGGCCGCNONE 
013-015-B09GCCCACCANONE 
013-015-B09GTGGTGGGCCGCNONE 
013-016-G05GCCCACCANONE 
013-016-G05GTGGTGGGCCGCNONE 
013-023-A06GCCCACCANONE 
013-023-A06GTGGTGGGCCGCNONE 
013-023-B06GCCCACCANONE 
013-023-B06GTGGTGGGCCGCNONE 
013-032-F09GCCCACCANONE 
013-032-F09GTGGTGGGCCGCNONE 
013-059-C07GCCCACCANONE 
013-059-C07GTGGTGGGCCGCNONE 
013-071-E09GCCCACCANONE 
013-071-E09GTGGTGGGCCGCNONE 
013-073-D06GCCCACCANONE 
013-073-D06GTGGTGGGCCGCNONE 
013-077-C02GCCCACCANONE 
013-077-C02GTGGTGGGCCGCNONE 
013-078-B12GCCCACCANONE 
013-078-B12GTGGTGGGCCGCNONE 
013-093-A01GCCCACCANONE 
013-093-A01GTGGTGGGCCGCNONE 
014-002-B12GCCCACCANONE 
014-002-B12GTGGTGGGCCGCNONE 
014-003-E08GCCCACCANONE 
014-003-E08GTGGTGGGCCGCNONE 
014-004-D06GCCCACCANONE 
014-004-D06GTGGTGGGCCGCNONE 
014-007-C11GCCCACCANONE 
014-007-C11GTGGTGGGCCGCNONE 
014-007-G10GCCCACCANONE 
014-007-G10GTGGTGGGCCGCNONE 
014-019-C04GCCCACCANONE 
014-019-C04GTGGTGGGCCGCNONE 
014-021-F05GCCCACCANONE 
014-021-F05GTGGTGGGCCGCNONE 
014-024-G06GCCCACCANONE 
014-024-G06GTGGTGGGCCGCNONE 
014-027-C07GCCCACCANONE 
014-027-C07GTGGTGGGCCGCNONE 
014-027-D03GCCCACCANONE 
014-027-D03GTGGTGGGCCGCNONE 
014-029-E07GCCCACCANONE 
014-029-E07GTGGTGGGCCGCNONE 
014-031-B04GCCCACCANONE 
014-031-B04GTGGTGGGCCGCNONE 
014-033-B05GCCCACCANONE 
014-033-B05GTGGTGGGCCGCNONE 
014-033-C03GCCCACCANONE 
014-033-C03GTGGTGGGCCGCNONE 
014-033-C12GCCCACCANONE 
014-033-C12GTGGTGGGCCGCNONE 
014-036-F01GCCCACCANONE 
014-036-F01GTGGTGGGCCGCNONE 
014-037-C04GCCCACCANONE 
014-037-C04GTGGTGGGCCGCNONE 
014-040-H02GCCCACCANONE 
014-040-H02GTGGTGGGCCGCNONE 
014-045-H04GCCCACCANONE 
014-045-H04GTGGTGGGCCGCNONE 
014-045-H06GCCCACCANONE 
014-045-H06GTGGTGGGCCGCNONE 
014-052-A08GCCCACCANONE 
014-052-A08GTGGTGGGCCGCNONE 
014-076-G01GCCCACCANONE 
014-076-G01GTGGTGGGCCGCNONE 
014-083-F04GCCCACCANONE 
014-083-F04GTGGTGGGCCGCNONE 
014-086-E01GCCCACCANONE 
014-086-E01GTGGTGGGCCGCNONE 
014-091-D02GCCCACCANONE 
014-091-D02GTGGTGGGCCGCNONE 
014-091-F05GCCCACCANONE 
014-091-F05GTGGTGGGCCGCNONE 
014-093-E10GCCCACCANONE 
014-093-E10GTGGTGGGCCGCNONE 
014-100-C10GCCCACCANONE 
014-100-C10GTGGTGGGCCGCNONE 
015-011-H02GCCCACCANONE 
015-011-H02GTGGTGGGCCGCNONE 
015-073-B03GCCCACCANONE 
015-073-B03GTGGTGGGCCGCNONE 
AF010579GCCCACCANONE 
AF010579GTGGTGGGCCGCNONE 
AK059164GCCCACCASimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK059164GTGGTGGGCCGCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCCCACCANONE 
AK070016GTGGTGGGCCGCNONE 
AK119238GCCCACCANONE 
AK119238GTGGTGGGCCGCNONE 
AK119242GCCCACCANONE 
AK119242GTGGTGGGCCGCNONE 
J023037K17GCCCACCANONE 
J023037K17GTGGTGGGCCGCNONE 
J033136F11GCCCACCANONE 
J033136F11GTGGTGGGCCGCNONE 
J065008C13GCCCACCANONE 
J065008C13GTGGTGGGCCGCNONE 
J065032K18GCCCACCANONE 
J065032K18GTGGTGGGCCGCNONE 
J065043N10GCCCACCANONE 
J065043N10GTGGTGGGCCGCNONE 
J065045E06GCCCACCANONE 
J065045E06GTGGTGGGCCGCNONE 
J065046P21GCCCACCANONE 
J065046P21GTGGTGGGCCGCNONE 
J065048J17GCCCACCANONE 
J065048J17GTGGTGGGCCGCNONE 
J065053I23GCCCACCANONE 
J065053I23GTGGTGGGCCGCNONE 
J065053P03GCCCACCANONE 
J065053P03GTGGTGGGCCGCNONE 
J065054C13GCCCACCANONE 
J065054C13GTGGTGGGCCGCNONE 
J065058I17GCCCACCANONE 
J065058I17GTGGTGGGCCGCNONE 
J065061I12GCCCACCANONE 
J065061I12GTGGTGGGCCGCNONE 
J065062E09GCCCACCANONE 
J065062E09GTGGTGGGCCGCNONE 
J065063P04GCCCACCANONE 
J065063P04GTGGTGGGCCGCNONE 
J065068J07GCCCACCANONE 
J065068J07GTGGTGGGCCGCNONE 
J065076D02GCCCACCANONE 
J065076D02GTGGTGGGCCGCNONE 
J065083O07GCCCACCANONE 
J065083O07GTGGTGGGCCGCNONE 
J065090J02GCCCACCANONE 
J065090J02GTGGTGGGCCGCNONE 
J065093N08GCCCACCANONE 
J065093N08GTGGTGGGCCGCNONE 
J065097F02GCCCACCANONE 
J065097F02GTGGTGGGCCGCNONE 
J065112H17GCCCACCANONE 
J065112H17GTGGTGGGCCGCNONE 
J065121B01GCCCACCANONE 
J065121B01GTGGTGGGCCGCNONE 
J065124F12GCCCACCANONE 
J065124F12GTGGTGGGCCGCNONE 
J065130L03GCCCACCANONE 
J065130L03GTGGTGGGCCGCNONE 
J065131K05GCCCACCANONE 
J065131K05GTGGTGGGCCGCNONE 
J065132C06GCCCACCANONE 
J065132C06GTGGTGGGCCGCNONE 
J065135J18GCCCACCANONE 
J065135J18GTGGTGGGCCGCNONE 
J065138J22GCCCACCANONE 
J065138J22GTGGTGGGCCGCNONE 
J065140G21GCCCACCANONE 
J065140G21GTGGTGGGCCGCNONE 
J065161B19GCCCACCANONE 
J065161B19GTGGTGGGCCGCNONE 
J065162F22GCCCACCANONE 
J065162F22GTGGTGGGCCGCNONE 
J065162M09GCCCACCANONE 
J065162M09GTGGTGGGCCGCNONE 
J065163D03GCCCACCANONE 
J065163D03GTGGTGGGCCGCNONE 
J065163O21GCCCACCANONE 
J065163O21GTGGTGGGCCGCNONE 
J065165H11GCCCACCANONE 
J065165H11GTGGTGGGCCGCNONE 
J065165O16GCCCACCANONE 
J065165O16GTGGTGGGCCGCNONE 
J065167N06GCCCACCANONE 
J065167N06GTGGTGGGCCGCNONE 
J065168I08GCCCACCANONE 
J065168I08GTGGTGGGCCGCNONE 
J065170A14GCCCACCANONE 
J065170A14GTGGTGGGCCGCNONE 
J065170L03GCCCACCANONE 
J065170L03GTGGTGGGCCGCNONE 
J065171C08GCCCACCANONE 
J065171C08GTGGTGGGCCGCNONE 
J065173G11GCCCACCANONE 
J065173G11GTGGTGGGCCGCNONE 
J065173M09GCCCACCANONE 
J065173M09GTGGTGGGCCGCNONE 
J065176P07GCCCACCANONE 
J065176P07GTGGTGGGCCGCNONE 
J065178K24GCCCACCANONE 
J065178K24GTGGTGGGCCGCNONE 
J065185O12GCCCACCANONE 
J065185O12GTGGTGGGCCGCNONE 
J065191E02GCCCACCANONE 
J065191E02GTGGTGGGCCGCNONE 
J065204H10GCCCACCANONE 
J065204H10GTGGTGGGCCGCNONE 
J075033C23GCCCACCANONE 
J075033C23GTGGTGGGCCGCNONE 
J075041M21GCCCACCANONE 
J075041M21GTGGTGGGCCGCNONE 
J075043F13GCCCACCANONE 
J075043F13GTGGTGGGCCGCNONE 
J075044D02GCCCACCANONE 
J075044D02GTGGTGGGCCGCNONE 
J075044J15GCCCACCANONE 
J075044J15GTGGTGGGCCGCNONE 
J075048L07GCCCACCANONE 
J075048L07GTGGTGGGCCGCNONE 
J075054G12GCCCACCANONE 
J075054G12GTGGTGGGCCGCNONE 
J075055J10GCCCACCANONE 
J075055J10GTGGTGGGCCGCNONE 
J075059F09GCCCACCANONE 
J075059F09GTGGTGGGCCGCNONE 
J075066M23GCCCACCANONE 
J075066M23GTGGTGGGCCGCNONE 
J075071O09GCCCACCANONE 
J075071O09GTGGTGGGCCGCNONE 
J075085G23GCCCACCANONE 
J075085G23GTGGTGGGCCGCNONE 
J075086B21GCCCACCANONE 
J075086B21GTGGTGGGCCGCNONE 
J075087L18GCCCACCANONE 
J075087L18GTGGTGGGCCGCNONE 
J075087L21GCCCACCANONE 
J075087L21GTGGTGGGCCGCNONE 
J075087N14GCCCACCANONE 
J075087N14GTGGTGGGCCGCNONE 
J075088O13GCCCACCANONE 
J075088O13GTGGTGGGCCGCNONE 
J075089B06GCCCACCANONE 
J075089B06GTGGTGGGCCGCNONE 
J075089E20GCCCACCANONE 
J075089E20GTGGTGGGCCGCNONE 
J075090J01GCCCACCANONE 
J075090J01GTGGTGGGCCGCNONE 
J075090L05GCCCACCANONE 
J075090L05GTGGTGGGCCGCNONE 
J075091G05GCCCACCANONE 
J075091G05GTGGTGGGCCGCNONE 
J075091N06GCCCACCANONE 
J075091N06GTGGTGGGCCGCNONE 
J075093G08GCCCACCANONE 
J075093G08GTGGTGGGCCGCNONE 
J075094C13GCCCACCANONE 
J075094C13GTGGTGGGCCGCNONE 
J075095K01GCCCACCANONE 
J075095K01GTGGTGGGCCGCNONE 
J075096C02GCCCACCANONE 
J075096C02GTGGTGGGCCGCNONE 
J075097L16GCCCACCANONE 
J075097L16GTGGTGGGCCGCNONE 
J075097O10GCCCACCANONE 
J075097O10GTGGTGGGCCGCNONE 
J075098H24GCCCACCANONE 
J075098H24GTGGTGGGCCGCNONE 
J075099H02GCCCACCANONE 
J075099H02GTGGTGGGCCGCNONE 
J075099J11GCCCACCANONE 
J075099J11GTGGTGGGCCGCNONE 
J075099L08GCCCACCANONE 
J075099L08GTGGTGGGCCGCNONE 
J075109I11GCCCACCANONE 
J075109I11GTGGTGGGCCGCNONE 
J075114F03GCCCACCANONE 
J075114F03GTGGTGGGCCGCNONE 
J075121G07GCCCACCANONE 
J075121G07GTGGTGGGCCGCNONE 
J075122D23GCCCACCANONE 
J075122D23GTGGTGGGCCGCNONE 
J075132O07GCCCACCANONE 
J075132O07GTGGTGGGCCGCNONE 
J075141L21GCCCACCANONE 
J075141L21GTGGTGGGCCGCNONE 
J075142I08GCCCACCANONE 
J075142I08GTGGTGGGCCGCNONE 
J075145A06GCCCACCANONE 
J075145A06GTGGTGGGCCGCNONE 
J075147J15GCCCACCANONE 
J075147J15GTGGTGGGCCGCNONE 
J075150B09GCCCACCANONE 
J075150B09GTGGTGGGCCGCNONE 
J075151E07GCCCACCANONE 
J075151E07GTGGTGGGCCGCNONE 
J075161M16GCCCACCANONE 
J075161M16GTGGTGGGCCGCNONE 
J075190I16GCCCACCANONE 
J075190I16GTGGTGGGCCGCNONE 
J075192L05GCCCACCANONE 
J075192L05GTGGTGGGCCGCNONE 
J075192O03GCCCACCANONE 
J075192O03GTGGTGGGCCGCNONE 
J075192O08GCCCACCANONE 
J075192O08GTGGTGGGCCGCNONE 
J075193L12GCCCACCANONE 
J075193L12GTGGTGGGCCGCNONE 
J080001M24GCCCACCANONE 
J080001M24GTGGTGGGCCGCNONE 
J080004E20GCCCACCANONE 
J080004E20GTGGTGGGCCGCNONE 
J080005K15GCCCACCANONE 
J080005K15GTGGTGGGCCGCNONE 
J080005L05GCCCACCANONE 
J080005L05GTGGTGGGCCGCNONE 
J080014P20GCCCACCANONE 
J080014P20GTGGTGGGCCGCNONE 
J080029D12GCCCACCANONE 
J080029D12GTGGTGGGCCGCNONE 
J080030H09GCCCACCANONE 
J080030H09GTGGTGGGCCGCNONE 
J080039G05GCCCACCANONE 
J080039G05GTGGTGGGCCGCNONE 
J080040E18GCCCACCANONE 
J080040E18GTGGTGGGCCGCNONE 
J080041B02GCCCACCANONE 
J080041B02GTGGTGGGCCGCNONE 
J080041E06GCCCACCANONE 
J080041E06GTGGTGGGCCGCNONE 
J080041G05GCCCACCANONE 
J080041G05GTGGTGGGCCGCNONE 
J080041G24GCCCACCANONE 
J080041G24GTGGTGGGCCGCNONE 
J080041H07GCCCACCANONE 
J080041H07GTGGTGGGCCGCNONE 
J080041K03GCCCACCANONE 
J080041K03GTGGTGGGCCGCNONE 
J080047G01GCCCACCANONE 
J080047G01GTGGTGGGCCGCNONE 
J080052E07GCCCACCANONE 
J080052E07GTGGTGGGCCGCNONE 
J080053B15GCCCACCANONE 
J080053B15GTGGTGGGCCGCNONE 
J080053N01GCCCACCANONE 
J080053N01GTGGTGGGCCGCNONE 
J080054I01GCCCACCANONE 
J080054I01GTGGTGGGCCGCNONE 
J080054N02GCCCACCANONE 
J080054N02GTGGTGGGCCGCNONE 
J080063P03GCCCACCANONE 
J080063P03GTGGTGGGCCGCNONE 
J080064E13GCCCACCANONE 
J080064E13GTGGTGGGCCGCNONE 
J080064G13GCCCACCANONE 
J080064G13GTGGTGGGCCGCNONE 
J080065F02GCCCACCANONE 
J080065F02GTGGTGGGCCGCNONE 
J080065G03GCCCACCANONE 
J080065G03GTGGTGGGCCGCNONE 
J080065K17GCCCACCANONE 
J080065K17GTGGTGGGCCGCNONE 
J080067D06GCCCACCANONE 
J080067D06GTGGTGGGCCGCNONE 
J080067H23GCCCACCANONE 
J080067H23GTGGTGGGCCGCNONE 
J080067M15GCCCACCANONE 
J080067M15GTGGTGGGCCGCNONE 
J080068B20GCCCACCANONE 
J080068B20GTGGTGGGCCGCNONE 
J080068G24GCCCACCANONE 
J080068G24GTGGTGGGCCGCNONE 
J080072K19GCCCACCANONE 
J080072K19GTGGTGGGCCGCNONE 
J080076I24GCCCACCANONE 
J080076I24GTGGTGGGCCGCNONE 
J080092F05GCCCACCANONE 
J080092F05GTGGTGGGCCGCNONE 
J080092K14GCCCACCANONE 
J080092K14GTGGTGGGCCGCNONE 
J080092N22GCCCACCANONE 
J080092N22GTGGTGGGCCGCNONE 
J080093K02GCCCACCANONE 
J080093K02GTGGTGGGCCGCNONE 
J080094C08GCCCACCANONE 
J080094C08GTGGTGGGCCGCNONE 
J080094E09GCCCACCANONE 
J080094E09GTGGTGGGCCGCNONE 
J080094E20GCCCACCANONE 
J080094E20GTGGTGGGCCGCNONE 
J080094G08GCCCACCANONE 
J080094G08GTGGTGGGCCGCNONE 
J080094H18GCCCACCANONE 
J080094H18GTGGTGGGCCGCNONE 
J080094P22GCCCACCANONE 
J080094P22GTGGTGGGCCGCNONE 
J080095J23GCCCACCANONE 
J080095J23GTGGTGGGCCGCNONE 
J080096F14GCCCACCANONE 
J080096F14GTGGTGGGCCGCNONE 
J080097A21GCCCACCANONE 
J080097A21GTGGTGGGCCGCNONE 
J080097I07GCCCACCANONE 
J080097I07GTGGTGGGCCGCNONE 
J080097J02GCCCACCANONE 
J080097J02GTGGTGGGCCGCNONE 
J080097K01GCCCACCANONE 
J080097K01GTGGTGGGCCGCNONE 
J080097K03GCCCACCANONE 
J080097K03GTGGTGGGCCGCNONE 
J080305H18GCCCACCANONE 
J080305H18GTGGTGGGCCGCNONE 
J080306G01GCCCACCANONE 
J080306G01GTGGTGGGCCGCNONE 
J080306O08GCCCACCANONE 
J080306O08GTGGTGGGCCGCNONE 
J080311I01GCCCACCANONE 
J080311I01GTGGTGGGCCGCNONE 
J080315N24GCCCACCANONE 
J080315N24GTGGTGGGCCGCNONE 
J090003K21GCCCACCANONE 
J090003K21GTGGTGGGCCGCNONE 
J090008C20GCCCACCANONE 
J090008C20GTGGTGGGCCGCNONE 
J090008K19GCCCACCANONE 
J090008K19GTGGTGGGCCGCNONE 
J090008P13GCCCACCANONE 
J090008P13GTGGTGGGCCGCNONE 
J090015H22GCCCACCANONE 
J090015H22GTGGTGGGCCGCNONE 
J090016M01GCCCACCANONE 
J090016M01GTGGTGGGCCGCNONE 
J090018E13GCCCACCANONE 
J090018E13GTGGTGGGCCGCNONE 
J090018G03GCCCACCANONE 
J090018G03GTGGTGGGCCGCNONE 
J090018L17GCCCACCANONE 
J090018L17GTGGTGGGCCGCNONE 
J090019H11GCCCACCANONE 
J090019H11GTGGTGGGCCGCNONE 
J090021B19GCCCACCANONE 
J090021B19GTGGTGGGCCGCNONE 
J090021K02GCCCACCANONE 
J090021K02GTGGTGGGCCGCNONE 
J090023H15GCCCACCANONE 
J090023H15GTGGTGGGCCGCNONE 
J090034E03GCCCACCANONE 
J090034E03GTGGTGGGCCGCNONE 
J090045D16GCCCACCANONE 
J090045D16GTGGTGGGCCGCNONE 
J090045I06GCCCACCANONE 
J090045I06GTGGTGGGCCGCNONE 
J090047L09GCCCACCANONE 
J090047L09GTGGTGGGCCGCNONE 
J090048B05GCCCACCANONE 
J090048B05GTGGTGGGCCGCNONE 
J090048D11GCCCACCANONE 
J090048D11GTGGTGGGCCGCNONE 
J090048N11GCCCACCANONE 
J090048N11GTGGTGGGCCGCNONE 
J090050F20GCCCACCANONE 
J090050F20GTGGTGGGCCGCNONE 
J090052M20GCCCACCANONE 
J090052M20GTGGTGGGCCGCNONE 
J090083H03GCCCACCANONE 
J090083H03GTGGTGGGCCGCNONE 
J090084C12GCCCACCANONE 
J090084C12GTGGTGGGCCGCNONE 
J090095B05GCCCACCANONE 
J090095B05GTGGTGGGCCGCNONE 
J090095M18GCCCACCANONE 
J090095M18GTGGTGGGCCGCNONE 
J100024I22GCCCACCANONE 
J100024I22GTGGTGGGCCGCNONE 
J100024J12GCCCACCANONE 
J100024J12GTGGTGGGCCGCNONE 
J100024J22GCCCACCANONE 
J100024J22GTGGTGGGCCGCNONE 
J100025F07GCCCACCANONE 
J100025F07GTGGTGGGCCGCNONE 
J100026B13GCCCACCANONE 
J100026B13GTGGTGGGCCGCNONE 
J100027N03GCCCACCANONE 
J100027N03GTGGTGGGCCGCNONE 
J100029F14GCCCACCANONE 
J100029F14GTGGTGGGCCGCNONE 
J100029L20GCCCACCANONE 
J100029L20GTGGTGGGCCGCNONE 
J100032C22GCCCACCANONE 
J100032C22GTGGTGGGCCGCNONE 
J100032I08GCCCACCANONE 
J100032I08GTGGTGGGCCGCNONE 
J100032O05GCCCACCANONE 
J100032O05GTGGTGGGCCGCNONE 
J100033J24GCCCACCANONE 
J100033J24GTGGTGGGCCGCNONE 
J100033L12GCCCACCANONE 
J100033L12GTGGTGGGCCGCNONE 
J100034K06GCCCACCANONE 
J100034K06GTGGTGGGCCGCNONE 
J100037D09GCCCACCANONE 
J100037D09GTGGTGGGCCGCNONE 
J100038H02GCCCACCANONE 
J100038H02GTGGTGGGCCGCNONE 
J100039A12GCCCACCANONE 
J100039A12GTGGTGGGCCGCNONE 
J100039N12GCCCACCANONE 
J100039N12GTGGTGGGCCGCNONE 
J100039O21GCCCACCANONE 
J100039O21GTGGTGGGCCGCNONE 
J100040K05GCCCACCANONE 
J100040K05GTGGTGGGCCGCNONE 
J100042A02GCCCACCANONE 
J100042A02GTGGTGGGCCGCNONE 
J100042A17GCCCACCANONE 
J100042A17GTGGTGGGCCGCNONE 
J100043C15GCCCACCANONE 
J100043C15GTGGTGGGCCGCNONE 
J100044A17GCCCACCANONE 
J100044A17GTGGTGGGCCGCNONE 
J100044E18GCCCACCANONE 
J100044E18GTGGTGGGCCGCNONE 
J100044I11GCCCACCANONE 
J100044I11GTGGTGGGCCGCNONE 
J100044J15GCCCACCANONE 
J100044J15GTGGTGGGCCGCNONE 
J100045E23GCCCACCANONE 
J100045E23GTGGTGGGCCGCNONE 
J100049B18GCCCACCANONE 
J100049B18GTGGTGGGCCGCNONE 
J100050G04GCCCACCANONE 
J100050G04GTGGTGGGCCGCNONE 
J100051D06GCCCACCANONE 
J100051D06GTGGTGGGCCGCNONE 
J100051H20GCCCACCANONE 
J100051H20GTGGTGGGCCGCNONE 
J100052J01GCCCACCANONE 
J100052J01GTGGTGGGCCGCNONE 
J100052K07GCCCACCANONE 
J100052K07GTGGTGGGCCGCNONE 
J100055I01GCCCACCANONE 
J100055I01GTGGTGGGCCGCNONE 
J100057D02GCCCACCANONE 
J100057D02GTGGTGGGCCGCNONE 
J100059G14GCCCACCANONE 
J100059G14GTGGTGGGCCGCNONE 
J100059G21GCCCACCANONE 
J100059G21GTGGTGGGCCGCNONE 
J100059H03GCCCACCANONE 
J100059H03GTGGTGGGCCGCNONE 
J100059H15GCCCACCANONE 
J100059H15GTGGTGGGCCGCNONE 
J100063E13GCCCACCANONE 
J100063E13GTGGTGGGCCGCNONE 
J100063M02GCCCACCANONE 
J100063M02GTGGTGGGCCGCNONE 
J100064B17GCCCACCANONE 
J100064B17GTGGTGGGCCGCNONE 
J100064F11GCCCACCANONE 
J100064F11GTGGTGGGCCGCNONE 
J100066G12GCCCACCANONE 
J100066G12GTGGTGGGCCGCNONE 
J100066H09GCCCACCANONE 
J100066H09GTGGTGGGCCGCNONE 
J100068B12GCCCACCANONE 
J100068B12GTGGTGGGCCGCNONE 
J100068L16GCCCACCANONE 
J100068L16GTGGTGGGCCGCNONE 
J100068M23GCCCACCANONE 
J100068M23GTGGTGGGCCGCNONE 
J100069A02GCCCACCANONE 
J100069A02GTGGTGGGCCGCNONE 
J100069D07GCCCACCANONE 
J100069D07GTGGTGGGCCGCNONE 
J100069M13GCCCACCANONE 
J100069M13GTGGTGGGCCGCNONE 
J100070C07GCCCACCANONE 
J100070C07GTGGTGGGCCGCNONE 
J100070J11GCCCACCANONE 
J100070J11GTGGTGGGCCGCNONE 
J100070L20GCCCACCANONE 
J100070L20GTGGTGGGCCGCNONE 
J100071H10GCCCACCANONE 
J100071H10GTGGTGGGCCGCNONE 
J100072L14GCCCACCANONE 
J100072L14GTGGTGGGCCGCNONE 
J100072N12GCCCACCANONE 
J100072N12GTGGTGGGCCGCNONE 
J100073A21GCCCACCANONE 
J100073A21GTGGTGGGCCGCNONE 
J100074K17GCCCACCANONE 
J100074K17GTGGTGGGCCGCNONE 
J100074M04GCCCACCANONE 
J100074M04GTGGTGGGCCGCNONE 
J100075F11GCCCACCANONE 
J100075F11GTGGTGGGCCGCNONE 
J100076E23GCCCACCANONE 
J100076E23GTGGTGGGCCGCNONE 
J100076G03GCCCACCANONE 
J100076G03GTGGTGGGCCGCNONE 
J100077K01GCCCACCANONE 
J100077K01GTGGTGGGCCGCNONE 
J100077N23GCCCACCANONE 
J100077N23GTGGTGGGCCGCNONE 
J100079H17GCCCACCANONE 
J100079H17GTGGTGGGCCGCNONE 
J100081N01GCCCACCANONE 
J100081N01GTGGTGGGCCGCNONE 
J100082E04GCCCACCANONE 
J100082E04GTGGTGGGCCGCNONE 
J100082K11GCCCACCANONE 
J100082K11GTGGTGGGCCGCNONE 
J100085H23GCCCACCANONE 
J100085H23GTGGTGGGCCGCNONE 
J100086O18GCCCACCANONE 
J100086O18GTGGTGGGCCGCNONE 
J100087F21GCCCACCANONE 
J100087F21GTGGTGGGCCGCNONE 
J100088E02GCCCACCANONE 
J100088E02GTGGTGGGCCGCNONE 
J100088F08GCCCACCANONE 
J100088F08GTGGTGGGCCGCNONE 
J100088G24GCCCACCANONE 
J100088G24GTGGTGGGCCGCNONE 
J100088K20GCCCACCANONE 
J100088K20GTGGTGGGCCGCNONE 
J100089B19GCCCACCANONE 
J100089B19GTGGTGGGCCGCNONE 
J100089K22GCCCACCANONE 
J100089K22GTGGTGGGCCGCNONE 
J100089N22GCCCACCANONE 
J100089N22GTGGTGGGCCGCNONE 
J100089O17GCCCACCANONE 
J100089O17GTGGTGGGCCGCNONE 
J100090N05GCCCACCANONE 
J100090N05GTGGTGGGCCGCNONE 
Os03g0712600015-008-G03TGGTGGGCCCAGANONE 
AK103705TGGTGGGCCCAGAHypothetical protein. 
J033136N14TGGTGGGCCCAGANONE 
Os03g0719100AK065127GTGGTGGGCTDNA-binding SAP domain containing protein. 
J013001P07GTGGTGGGCTNONE 
J065102J01GTGGTGGGCTNONE 
J065205K05GTGGTGGGCTNONE 
Os03g0770100AK108776AGCCCACCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0780800AK059874GGCCCGGGCCCACCACNONE 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
J065214L21GGCCCGGGCCCACCACNONE 
J075178I24GGCCCGGGCCCACCACNONE 
J075197K14GGCCCGGGCCCACCACNONE 
Os03g0784400AK103474TGGTGGGCTTTProtein of unknown function DUF1692 domain containing protein. 
J023135I15TGGTGGGCTTTNONE 
J033130D12TGGTGGGCTTTNONE 
J043035E20TGGTGGGCTTTNONE 
J065206K15TGGTGGGCTTTNONE 
J075053J20TGGTGGGCTTTNONE 
J075129B11TGGTGGGCTTTNONE 
J090003E22TGGTGGGCTTTNONE 
J100023E23TGGTGGGCTTTNONE 
Os03g0789200015-015-H03CCCGGGCCCACCANONE 
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein. 
AY224542CCCGGGCCCACCANONE 
J023110P10CCCGGGCCCACCANONE 
J075039H19CCCGGGCCCACCANONE 
Os03g0822700005-010-E01TCCGGGCCCACCANONE 
006-088-H12TCCGGGCCCACCANONE 
AK061682TCCGGGCCCACCANONE 
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein. 
J023091N05TCCGGGCCCACCANONE 
Os03g0824500AK058990TTGGCCCACCAConserved hypothetical protein. 
J065057L18TTGGCCCACCANONE 
J065083L02TTGGCCCACCANONE 
J065086L24TTGGCCCACCANONE 
J065121L10TTGGCCCACCANONE 
J065168N03TTGGCCCACCANONE 
J100035J22TTGGCCCACCANONE 
J100050G18TTGGCCCACCANONE 
J100055F15TTGGCCCACCANONE 
Os03g0825300AK072216AAAGCCCACCACNONE 
AK102693AAAGCCCACCACNONE 
AK105593AAAGCCCACCACProtein kinase-like domain containing protein. 
BT014687AAAGCCCACCACNONE 
Os03g0846400AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os04g0266400AK065632GTGGTGGGCCCCACCACNONE 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK072046GTGGTGGGCCCCACCACNONE 
AK105688GTGGTGGGCCCCACCACNONE 
Os04g0293600AK063003GTGGTGGGCHypothetical protein. 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0418500AK121255GTGGTGGGCTTTU box domain containing protein. 
J065172M13GTGGTGGGCTTTNONE 
J100026H21GTGGTGGGCTTTNONE 
J100032D22GTGGTGGGCTTTNONE 
Os04g0434800011-033-F12GCGGCCCACCACNONE 
011-049-F07GCGGCCCACCACNONE 
AB114855GCGGCCCACCACNONE 
AK063934GCGGCCCACCACNONE 
AK103344GCGGCCCACCACSimilar to Thylakoid-bound ascorbate peroxidase (EC 1.11.1.11) (Fragment). 
Os04g0463400AK059730AGGGCCCACCAProtein of unknown function DUF125, transmembrane family protein. 
Os04g0472300AK070339GCCCACCACGlycerophosphoryl diester phosphodiesterase family protein. 
Os04g0477500AK063950CGCACCGCCCACCACNONE 
AK067372CGCACCGCCCACCACGlycosyl transferase, family 17 protein. 
AK100897CGCACCGCCCACCACNONE 
J013106K01CGCACCGCCCACCACNONE 
J043012L06CGCACCGCCCACCACNONE 
J065025M07CGCACCGCCCACCACNONE 
J065025M08CGCACCGCCCACCACNONE 
Os04g0479800AK121430TGGTGGGCCATCyclin-like F-box domain containing protein. 
J033099N03TGGTGGGCCATNONE 
J090035E10TGGTGGGCCATNONE 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
J100049D17TGGTGGGCCCCACCNONE 
J100080K12TGGTGGGCCCCACCNONE 
Os04g0513400012-070-C07GTGGTGGGCNONE 
AK066850GTGGTGGGCNONE 
AK068772GTGGTGGGCSimilar to Beta-glucosidase. 
J065054D24GTGGTGGGCNONE 
J065072G04GTGGTGGGCNONE 
J065190D11GTGGTGGGCNONE 
Os04g0528300AK058387AGCCCACCANONE 
J013000P15AGCCCACCANONE 
Os04g0530000009-106-E11TTCGGCCCACCANONE 
011-012-E12TTCGGCCCACCANONE 
AK066169TTCGGCCCACCAConserved hypothetical protein. 
J013052P20TTCGGCCCACCANONE 
J090060G12TTCGGCCCACCANONE 
J100073H10TTCGGCCCACCANONE 
Os04g0531300016-006-E10TGGTGGGCCACNONE 
AK072647TGGTGGGCCACDihydrouridine synthase, DuS family protein. 
AK103911TGGTGGGCCACNONE 
J013038P22TGGTGGGCCACNONE 
J023130D01TGGTGGGCCACNONE 
J033150P13TGGTGGGCCACNONE 
J043026L14TGGTGGGCCACNONE 
J065049A08TGGTGGGCCACNONE 
J065215C17TGGTGGGCCACNONE 
Os04g0549300AK063296GCCCACCACGGCCSimilar to GA protein (Fragment). 
J065073I11GCCCACCACGGCCNONE 
J065172C13GCCCACCACGGCCNONE 
J090004B10GCCCACCACGGCCNONE 
J090039N18GCCCACCACGGCCNONE 
J090088F09GCCCACCACGGCCNONE 
Os04g0563300AK100487TGGTGGGCCyclin-like F-box domain containing protein. 
J023097O18TGGTGGGCNONE 
J065100E16TGGTGGGCNONE 
J075022C23TGGTGGGCNONE 
J075023L18TGGTGGGCNONE 
J075040N10TGGTGGGCNONE 
J075061L14TGGTGGGCNONE 
J075069B15TGGTGGGCNONE 
J075106C16TGGTGGGCNONE 
J075138P13TGGTGGGCNONE 
J075139H18TGGTGGGCNONE 
J075139L06TGGTGGGCNONE 
J075149B07TGGTGGGCNONE 
J075177N21TGGTGGGCNONE 
Os04g0564700AK111806GTGGTGGGCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0579200AK100603GCCCACCACZinc finger, RING-type domain containing protein. 
Os04g0634800AK107772GCCCACCAConserved hypothetical protein. 
J065046O17GCCCACCANONE 
J065121F10GCCCACCANONE 
J075173G21GCCCACCANONE 
J090081F22GCCCACCANONE 
J100037A09GCCCACCANONE 
J100056M24GCCCACCANONE 
Os04g0636900009-009-D04GCCCACCACNONE 
009-010-G07GCCCACCACNONE 
009-048-H10GCCCACCACNONE 
013-066-B10GCCCACCACNONE 
014-093-G08GCCCACCACNONE 
015-025-C07GCCCACCACNONE 
J013058C15GCCCACCACNONE 
J013058E15GCCCACCACNONE 
J013072N16GCCCACCACNONE 
J013102O16GCCCACCACNONE 
J090069E22GCCCACCACNONE 
J100030G19GCCCACCACNONE 
J100050F15GCCCACCACNONE 
J100050L20GCCCACCACNONE 
J100054F18GCCCACCACNONE 
J100083P05GCCCACCACNONE 
Os04g0661300AK070723GCCCACCAConserved hypothetical protein. 
AK103942GCCCACCANONE 
Os04g0674100J080097J12AAGGCCCACCAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TGGTGGGCCTTNONE 
AK103795TGGTGGGCCTTCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TGGTGGGCCTTNONE 
J065020P20TGGTGGGCCTTNONE 
J065057I21TGGTGGGCCTTNONE 
J065059P11TGGTGGGCCTTNONE 
J065083A22TGGTGGGCCTTNONE 
J065093K10TGGTGGGCCTTNONE 
J065097D03TGGTGGGCCTTNONE 
J065103P05TGGTGGGCCTTNONE 
J065113K09TGGTGGGCCTTNONE 
J065118F23TGGTGGGCCTTNONE 
J065119M06TGGTGGGCCTTNONE 
J065146K17TGGTGGGCCTTNONE 
J065161N12TGGTGGGCCTTNONE 
J065169L02TGGTGGGCCTTNONE 
J065189H12TGGTGGGCCTTNONE 
J065192E24TGGTGGGCCTTNONE 
J065193K17TGGTGGGCCTTNONE 
J065197O21TGGTGGGCCTTNONE 
J065214D09TGGTGGGCCTTNONE 
J065217B11TGGTGGGCCTTNONE 
J075132K07TGGTGGGCCTTNONE 
J100059D14TGGTGGGCCTTNONE 
Os04g0678800AK072212TGGTGGGCTN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065TGGTGGGCTNONE 
Os04g0683500AK071538TGGTGGGCCGAANONE 
AK105871TGGTGGGCCGAANONE 
AK106642TGGTGGGCCGAASimilar to Adenosine deaminase acting on tRNA 1. 
J023095A13TGGTGGGCCGAANONE 
J023099G11TGGTGGGCCGAANONE 
J075125A03TGGTGGGCCGAANONE 
Os05g0115200AK106709GTTGGTGGGCCConserved hypothetical protein. 
Os05g0132800AK108629GTTGGTGGGCTGAConserved hypothetical protein. 
Os05g0152400Os05g0152400AGGGCCCACCACGlycosyl transferase, family 14 protein. 
Os05g0153400AK108071TCAGCCCACCAACProtein prenyltransferase domain containing protein. 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK101218TTCGGCCCACCACNONE 
J065061E13TTCGGCCCACCACNONE 
J090089F18TTCGGCCCACCACNONE 
Os05g0186900AK111403GCCCACCACCACCTGTConserved hypothetical protein. 
Os05g0194900AK071798GTGGTGGGCSimilar to Pyrophosphate-fructose-6-phosphate 1-phosphotransferase-like protein (Pyrophosphate-dependent phosphofructo-1-kinase-like protein). 
J023112B14GTGGTGGGCNONE 
Os05g0208000AK059612AGCCCACCANONE 
AK063666AGCCCACCANONE 
AK071500AGCCCACCASimilar to 2-oxoglutarate/malate translocator. 
Os05g0209000AK111487AGCCCACCACConserved hypothetical protein. 
J075017G20AGCCCACCACNONE 
J075025B12AGCCCACCACNONE 
J075112L13AGCCCACCACNONE 
J075115B08AGCCCACCACNONE 
J075121P06AGCCCACCACNONE 
Os05g0243200009-073-F12GCCCACCACNONE 
AK061317GCCCACCACSimilar to Ribosomal protein L13. 
J065120F21GCCCACCACNONE 
J065185K05GCCCACCACNONE 
Os05g0245300AB091471GCCCACCAProtein of unknown function DUF588 family protein. 
J100023O13GCCCACCANONE 
J100063B05GCCCACCANONE 
Os05g0306000AK071384GCCCACCAACemp24/gp25L/p24 family protein. 
Os05g0311000AK099633ATGGCCCACCANONE 
AK100201ATGGCCCACCANONE 
AK100520ATGGCCCACCAClathrin adaptor complex, medium chain family protein. 
J013047M12ATGGCCCACCANONE 
J013052M03ATGGCCCACCANONE 
J013059B15ATGGCCCACCANONE 
J023099C22ATGGCCCACCANONE 
J023100E05ATGGCCCACCANONE 
J023100J17ATGGCCCACCANONE 
J023101D04ATGGCCCACCANONE 
J023119B18ATGGCCCACCANONE 
J033024B03ATGGCCCACCANONE 
J033036M20ATGGCCCACCANONE 
J033071J05ATGGCCCACCANONE 
J033071O20ATGGCCCACCANONE 
J033111K10ATGGCCCACCANONE 
J033144C21ATGGCCCACCANONE 
J033145C21ATGGCCCACCANONE 
J100043L14ATGGCCCACCANONE 
J100079C01ATGGCCCACCANONE 
Os05g0314100AK105062AGCCCACCANONE 
J023077K01AGCCCACCANONE 
J023147M20AGCCCACCANONE 
J065142K14AGCCCACCANONE 
J075097P11AGCCCACCANONE 
J080031C22AGCCCACCANONE 
J080309A17AGCCCACCANONE 
J090014C21AGCCCACCANONE 
Os05g0330700009-032-H01ACAGCCCACCACNONE 
009-032-H01GCCCACCANONE 
AK062425ACAGCCCACCACConserved hypothetical protein. 
AK062425GCCCACCAConserved hypothetical protein. 
Os05g0350500013-071-D05AGCCCACCANONE 
AF020787AGCCCACCANONE 
AK061712AGCCCACCANONE 
AK102897AGCCCACCAProliferation-associated protein 1 family protein. 
J033060G23AGCCCACCANONE 
J033112P14AGCCCACCANONE 
J033127J04AGCCCACCANONE 
J090015L18AGCCCACCANONE 
J090047K03AGCCCACCANONE 
J090097J17AGCCCACCANONE 
Os05g0370700AK108862GCAGCCCACCACAlpha/beta hydrolase family protein. 
Os05g0381700AK068838GCCCACCACalmodulin-binding, plant family protein. 
J013160I23GCCCACCANONE 
Os05g0387200AK060744CAAGCCCACCAAAAGCCCAAGSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310CAAGCCCACCAAAAGCCCAAGNONE 
Os05g0392700AK058728GCCCACCACNONE 
AK073425GCCCACCACNONE 
AK104407GCCCACCACMitochondrial substrate carrier family protein. 
Os05g0401300009-111-H03AGGGCCCACCANONE 
AK060678AGGGCCCACCATwin-arginine translocation pathway signal domain containing protein. 
Os05g0406100AK070068GGGGCCCACCACNONE 
J023041D03GGGGCCCACCACNONE 
Os05g0429900AK066834GCGGGCCCACCACNONE 
AK099108GCGGGCCCACCACNONE 
AK104053GCGGGCCCACCACNONE 
D88617GCGGGCCCACCACSimilar to MybHv5 (Fragment). 
J090031E22GCGGGCCCACCACNONE 
Os05g0430200J090095K16CAAGCCCACCACNONE 
Os05g0435400AK109595CCAGGCCCACCAAGCCCConserved hypothetical protein. 
Os05g0440100015-006-F06GAGGCCCACCANONE 
015-076-D04GAGGCCCACCANONE 
AK073094GAGGCCCACCANONE 
AK102786GAGGCCCACCAHistone deacetylase superfamily protein. 
J033107M16GAGGCCCACCANONE 
Os05g0447000AK108280TGGTGGGCTGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0458100006-084-A05ATGGCCCACCACNONE 
009-091-H05ATGGCCCACCACNONE 
AJ557547ATGGCCCACCACNONE 
AK059467ATGGCCCACCACNONE 
AK061127ATGGCCCACCACNONE 
AK101652ATGGCCCACCACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06ATGGCCCACCACNONE 
J033057B20ATGGCCCACCACNONE 
J033087A05ATGGCCCACCACNONE 
J043009C05ATGGCCCACCACNONE 
J090009E10ATGGCCCACCACNONE 
Os05g0460000011-074-F09GGGGCCCACCAACGCGTCCNONE 
J023002L01GGGGCCCACCAACGCGTCCNONE 
J023060I12GGGGCCCACCAACGCGTCCNONE 
J023060O12GGGGCCCACCAACGCGTCCNONE 
J023106P08GGGGCCCACCAACGCGTCCNONE 
J023141D17GGGGCCCACCAACGCGTCCNONE 
J023150E11GGGGCCCACCAACGCGTCCSimilar to 70 kDa heat shock cognate protein 1. 
J033030A20GGGGCCCACCAACGCGTCCNONE 
J033039H14GGGGCCCACCAACGCGTCCNONE 
J033101B11GGGGCCCACCAACGCGTCCNONE 
J033101B12GGGGCCCACCAACGCGTCCNONE 
J033114A09GGGGCCCACCAACGCGTCCNONE 
J090037G06GGGGCCCACCAACGCGTCCNONE 
J090048G13GGGGCCCACCAACGCGTCCNONE 
J090090F15GGGGCCCACCAACGCGTCCNONE 
Os05g0461300AK111917CTGGCCCACCAACSimilar to RAB8C. 
AK111946CTGGCCCACCAACNONE 
AK111972CTGGCCCACCAACNONE 
AK112021CTGGCCCACCAACNONE 
J033135H16CTGGCCCACCAACNONE 
J043036O11CTGGCCCACCAACNONE 
Os05g0473300AK102559TGGTGGGCCCACCTGNONE 
AK103822TGGTGGGCCCACCTGNONE 
AK109855TGGTGGGCCCACCTGSimilar to Ethylene response factor 1. 
Os05g0478200J023113C02GCCCAACCTGGCCCACCANONE 
J023150G23GCCCAACCTGGCCCACCANONE 
J033101K13GCCCAACCTGGCCCACCANONE 
Os05g0499400AK059489GCCCACCAHaem peroxidase family protein. 
AK068896GCCCACCANONE 
J013170E20GCCCACCANONE 
Os05g0512500009-036-D05GTGGTGGGCCGGTNONE 
009-036-D05GTGGTGGGCCTCNONE 
AK062441GTGGTGGGCCGGTCT20 family protein. 
AK062441GTGGTGGGCCTCCT20 family protein. 
J080003C10GTGGTGGGCCGGTNONE 
J080003C10GTGGTGGGCCTCNONE 
J080046G11GTGGTGGGCCGGTNONE 
J080046G11GTGGTGGGCCTCNONE 
Os05g0514600AK107211GCCCACCAAC2OG-Fe(II) oxygenase domain containing protein. 
Os05g0543700AK071113TGGTGGGCCCACCTSimilar to Chaperone protein dnaJ. 
AK103912TGGTGGGCCCACCTNONE 
Os05g0553000015-052-H09AGCCCACCANONE 
AK061681AGCCCACCAATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143AGCCCACCANONE 
J013068H04AGCCCACCANONE 
J013124C06AGCCCACCANONE 
J033127N11AGCCCACCANONE 
J100056O04AGCCCACCANONE 
Os05g0589000AK061980GTGGCCCACCANONE 
AK099181GTGGCCCACCAConserved hypothetical protein. 
Os05g0591600Os05g0591600AGGGCCCACCASimilar to Lysine decarboxylase-like protein. 
Os05g0592500AK071878GTGGTGGGCNONE 
AK099566GTGGTGGGCSIT4 phosphatase-associated protein family protein. 
J013021B11GTGGTGGGCNONE 
J013034M16GTGGTGGGCNONE 
J013039A13GTGGTGGGCNONE 
J013055O15GTGGTGGGCNONE 
J013067K22GTGGTGGGCNONE 
J013100G17GTGGTGGGCNONE 
J013104E08GTGGTGGGCNONE 
J023025L16GTGGTGGGCNONE 
J023086C08GTGGTGGGCNONE 
J023086E13GTGGTGGGCNONE 
J033044J02GTGGTGGGCNONE 
J033055J15GTGGTGGGCNONE 
J033123L19GTGGTGGGCNONE 
Os05g0594800AK058332GAAGCCCAGCCCACCAAdhesion regulating molecule family protein. 
AK068013GAAGCCCAGCCCACCANONE 
J013129L24GAAGCCCAGCCCACCANONE 
Os06g0103400009-138-H04AAGGCCCAGGCCCACCANONE 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCAGGCCCACCANONE 
J080307A01AAGGCCCAGGCCCACCANONE 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0136900AK107405TGGTGGGCCCCACTCCProtein of unknown function DUF296 domain containing protein. 
Os06g0199300J065045H01GTGGTGGGCCCCACCCGNONE 
J075177C22GTGGTGGGCCCCACCCGNONE 
J080068H06GTGGTGGGCCCCACCCGNONE 
J090048F01GTGGTGGGCCCCACCCGNONE 
J100066F17GTGGTGGGCCCCACCCGNONE 
Os06g0225200005-009-B07ATGGCCCACCAACNONE 
AK067095ATGGCCCACCAACMitochodrial transcription termination factor-related family protein. 
AK104692ATGGCCCACCAACNONE 
J013096A05ATGGCCCACCAACNONE 
J090092C03ATGGCCCACCAACNONE 
Os06g0298500AK108252AAAAGCCCACCAConserved hypothetical protein. 
J065144C04AAAAGCCCACCANONE 
J075054P09AAAAGCCCACCANONE 
J075165A13AAAAGCCCACCANONE 
J075172E10AAAAGCCCACCANONE 
Os06g0332600AK121615GCCGGCCCACCAConserved hypothetical protein. 
J033044B19GCCGGCCCACCANONE 
Os06g0495800J100069N08GCCCACCACProtein of unknown function DUF617, plant family protein. 
Os06g0506600009-119-E12AGCCCACCACNONE 
J023086A18AGCCCACCACNONE 
J033036I02AGCCCACCACNONE 
J033125C16AGCCCACCACNONE 
J065013I11AGCCCACCACNONE 
J065026O21AGCCCACCACNONE 
J065060H10AGCCCACCACNONE 
J065067A15AGCCCACCACNONE 
J065068F07AGCCCACCACNONE 
J065085N06AGCCCACCACNONE 
J065108N10AGCCCACCACNONE 
J065161O11AGCCCACCACNONE 
J065185J15AGCCCACCACNONE 
J065191H18AGCCCACCACNONE 
J065199J09AGCCCACCACNONE 
J075005G03AGCCCACCACNONE 
J075018C16AGCCCACCACNONE 
J075061K20AGCCCACCACNONE 
J075069J06AGCCCACCACNONE 
J075075H19AGCCCACCACNONE 
J075076D20AGCCCACCACNONE 
J075078D16AGCCCACCACNONE 
J075100J19AGCCCACCACNONE 
J075110M11AGCCCACCACNONE 
J075157N05AGCCCACCACNONE 
J075171F20AGCCCACCACNONE 
J075177G08AGCCCACCACNONE 
J075179G08AGCCCACCACNONE 
Os06g0526100Os06g0526100TGGTGGGCCCACACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0531600AK120456TGGTGGGCCTGANONE 
J013105I19TGGTGGGCCTGANONE 
J090006G02TGGTGGGCCTGANONE 
Os06g0555500016-056-B08GAGGCCCACCANONE 
AK102375GAGGCCCACCANONE 
AK106546GAGGCCCACCAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08GAGGCCCACCANONE 
J033091P04GAGGCCCACCANONE 
J090082P16GAGGCCCACCANONE 
Os06g0592500AK119729CTGGGCTTGGTGGGCCGGTSimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CTGGGCTTGGTGGGCCGGTNONE 
Os06g0643000AK067701GCCGGCCCACCACCAACPhox-like domain containing protein. 
J013032G04GCCGGCCCACCACCAACNONE 
J013044B17GCCGGCCCACCACCAACNONE 
J013114M13GCCGGCCCACCACCAACNONE 
J023133A02GCCGGCCCACCACCAACNONE 
J043022A07GCCGGCCCACCACCAACNONE 
J075046O21GCCGGCCCACCACCAACNONE 
J075142L01GCCGGCCCACCACCAACNONE 
J090076I16GCCGGCCCACCACCAACNONE 
J100056O17GCCGGCCCACCACCAACNONE 
Os06g0647400AK068457GTGGTGGGCTSimilar to Lysosomal Pro-X carboxypeptidase. 
AK103281GTGGTGGGCTNONE 
J013151A14GTGGTGGGCTNONE 
Os06g0683400009-047-C07GAAGCCCACCACNONE 
009-060-B06GAAGCCCACCACNONE 
013-057-F12GAAGCCCACCACNONE 
AK111852GAAGCCCACCACNONE 
AK111897GAAGCCCACCACNONE 
AK112082GAAGCCCACCACSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07GAAGCCCACCACNONE 
J065187J11GAAGCCCACCACNONE 
J065197L08GAAGCCCACCACNONE 
J100045K14GAAGCCCACCACNONE 
J100074M08GAAGCCCACCACNONE 
J100088H21GAAGCCCACCACNONE 
Os06g0687200AK058749TGCGGCCCACCAZinc finger, RING-type domain containing protein. 
Os06g0702800009-039-E05ATGGCCCAGAAGGCCCACCANONE 
AK073948ATGGCCCAGAAGGCCCACCAHypothetical protein. 
J023108K23ATGGCCCAGAAGGCCCACCANONE 
J033072H04ATGGCCCAGAAGGCCCACCANONE 
J065008G05ATGGCCCAGAAGGCCCACCANONE 
J065128J12ATGGCCCAGAAGGCCCACCANONE 
J065131A01ATGGCCCAGAAGGCCCACCANONE 
J065173B12ATGGCCCAGAAGGCCCACCANONE 
Os06g0710900AK073326CTGGCCCACCACConserved hypothetical protein. 
Os06g0711600016-047-G09GAAGCCCACCACNONE 
AK064384GAAGCCCACCACmRNA splicing factor SYF2 family protein. 
AK102831GAAGCCCACCACNONE 
J013072P18GAAGCCCACCACNONE 
J023049G01GAAGCCCACCACNONE 
J023088I01GAAGCCCACCACNONE 
J033023I22GAAGCCCACCACNONE 
J033106I12GAAGCCCACCACNONE 
J033109G07GAAGCCCACCACNONE 
J065030F22GAAGCCCACCACNONE 
J065132H19GAAGCCCACCACNONE 
J080301D07GAAGCCCACCACNONE 
J080305C09GAAGCCCACCACNONE 
J080312C03GAAGCCCACCACNONE 
J080313I15GAAGCCCACCACNONE 
J080315B09GAAGCCCACCACNONE 
J090056N21GAAGCCCACCACNONE 
J100027B07GAAGCCCACCACNONE 
Os06g0716800014-028-E06TGGTGGGCCCACCACNONE 
016-046-F04TGGTGGGCCCACCACNONE 
AK071639TGGTGGGCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
AK103968TGGTGGGCCCACCACNONE 
J023099K10TGGTGGGCCCACCACNONE 
J065036H06TGGTGGGCCCACCACNONE 
J065049K01TGGTGGGCCCACCACNONE 
J065060N02TGGTGGGCCCACCACNONE 
J065204C12TGGTGGGCCCACCACNONE 
J065213P15TGGTGGGCCCACCACNONE 
J080001K17TGGTGGGCCCACCACNONE 
J080006L04TGGTGGGCCCACCACNONE 
J080008A10TGGTGGGCCCACCACNONE 
J080008E16TGGTGGGCCCACCACNONE 
J080010L22TGGTGGGCCCACCACNONE 
J080011N22TGGTGGGCCCACCACNONE 
J080014K12TGGTGGGCCCACCACNONE 
J080018F08TGGTGGGCCCACCACNONE 
J080018N02TGGTGGGCCCACCACNONE 
J080021N10TGGTGGGCCCACCACNONE 
J080029B02TGGTGGGCCCACCACNONE 
J080030D07TGGTGGGCCCACCACNONE 
J080032A16TGGTGGGCCCACCACNONE 
J080034M13TGGTGGGCCCACCACNONE 
J080038F06TGGTGGGCCCACCACNONE 
J080039K15TGGTGGGCCCACCACNONE 
J080042M20TGGTGGGCCCACCACNONE 
J080048N14TGGTGGGCCCACCACNONE 
J080050F23TGGTGGGCCCACCACNONE 
J080051C22TGGTGGGCCCACCACNONE 
J080053B19TGGTGGGCCCACCACNONE 
J080056J19TGGTGGGCCCACCACNONE 
J080056K05TGGTGGGCCCACCACNONE 
J080060C09TGGTGGGCCCACCACNONE 
J080060K21TGGTGGGCCCACCACNONE 
J080065J17TGGTGGGCCCACCACNONE 
J080067A16TGGTGGGCCCACCACNONE 
J080075I03TGGTGGGCCCACCACNONE 
J080076D21TGGTGGGCCCACCACNONE 
J080078G16TGGTGGGCCCACCACNONE 
J080085K15TGGTGGGCCCACCACNONE 
J080089C14TGGTGGGCCCACCACNONE 
J080091N22TGGTGGGCCCACCACNONE 
J080094N12TGGTGGGCCCACCACNONE 
J090032N05TGGTGGGCCCACCACNONE 
Os06g0725000015-061-F03GCCCACCAACNONE 
016-069-A10GCCCACCAACNONE 
AK111790GCCCACCAACSimilar to Ntdin. 
J013089K14GCCCACCAACNONE 
J023095D11GCCCACCAACNONE 
J023114G14GCCCACCAACNONE 
J053091M03GCCCACCAACNONE 
J065006E20GCCCACCAACNONE 
J065042J07GCCCACCAACNONE 
J065054B17GCCCACCAACNONE 
J065057B20GCCCACCAACNONE 
J065078M02GCCCACCAACNONE 
J065176J12GCCCACCAACNONE 
J065177K13GCCCACCAACNONE 
J065184O14GCCCACCAACNONE 
J065190J16GCCCACCAACNONE 
J065205E08GCCCACCAACNONE 
Os07g0100200006-022-D06GTGGTGGGCNONE 
011-025-B06GTGGTGGGCNONE 
012-069-A07GTGGTGGGCNONE 
AK060986GTGGTGGGCNONE 
AK073305GTGGTGGGCSimilar to PDX1-like protein 4. 
J023055C05GTGGTGGGCNONE 
J033024J11GTGGTGGGCNONE 
J065045F14GTGGTGGGCNONE 
J075097C22GTGGTGGGCNONE 
Os07g0171100AF272978TCCGGGCCCACCACNONE 
AK062132TCCGGGCCCACCACNONE 
AK066475TCCGGGCCCACCACTetratricopeptide-like helical domain containing protein. 
J013068C23TCCGGGCCCACCACNONE 
Os07g0182100AK066734TGTGGGCCCACCANONE 
AK104002TGTGGGCCCACCASimilar to Tryptophan synthase alpha chain. 
Os07g0185700012-040-A11CAAGCCCACCACNONE 
AK070572CAAGCCCACCACConserved hypothetical protein. 
J065116D10CAAGCCCACCACNONE 
J065122F20CAAGCCCACCACNONE 
Os07g0217600AK065971GTGGTGGGCCytochrome P450 family protein. 
Os07g0245100J023048C16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J023110L14CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053023B18CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053031L17CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065035I22CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065043D21CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065072L16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065214I23CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
Os07g0418600006-074-A11AATGGGCTGGTGGGCNONE 
009-043-A03AATGGGCTGGTGGGCNONE 
013-024-A10AATGGGCTGGTGGGCNONE 
AK105956AATGGGCTGGTGGGCConserved hypothetical protein. 
J065107I10AATGGGCTGGTGGGCNONE 
J075110E12AATGGGCTGGTGGGCNONE 
Os07g0418700006-065-A10TGGTGGGCNONE 
009-013-C04TGGTGGGCNONE 
AK105945TGGTGGGCConserved hypothetical protein. 
Os07g0442000AK068559GTGGGACCCACGGGCCCACCACyclin-like F-box domain containing protein. 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0546000AF188065CTGACAGGTGGGCCCACCACNONE 
AK061800CTGACAGGTGGGCCCACCACNONE 
AK065871CTGACAGGTGGGCCCACCACSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02CTGACAGGTGGGCCCACCACNONE 
J013035F03CTGACAGGTGGGCCCACCACNONE 
J013044J20CTGACAGGTGGGCCCACCACNONE 
Os07g0546100AK058282GGGGCCCACCANONE 
Os07g0561800AK108426TGGTGGGCNONE 
AK111334TGGTGGGCConserved hypothetical protein. 
Os07g0569800AK108637CCAAGCCCACCACConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0584500003-129-F05TGGTGGGCCCCCACACNONE 
006-119-H08TGGTGGGCCCCCACACNONE 
011-022-G03TGGTGGGCCCCCACACNONE 
AK067725TGGTGGGCCCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109TGGTGGGCCCCCACACNONE 
J013055C05TGGTGGGCCCCCACACNONE 
J013062F12TGGTGGGCCCCCACACNONE 
J013069J22TGGTGGGCCCCCACACNONE 
J013114I11TGGTGGGCCCCCACACNONE 
J023072P12TGGTGGGCCCCCACACNONE 
Os07g0603100AK101352CGCGTGGGGCCCACCANuclear transport factor 2 domain containing protein. 
AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
J023077E09CGCGTGGGGCCCACCANONE 
J023077E09GCGGGCCCACACAGCCCACCACNONE 
J023081N15CGCGTGGGGCCCACCANONE 
J023081N15GCGGGCCCACACAGCCCACCACNONE 
J033022N22CGCGTGGGGCCCACCANONE 
J033022N22GCGGGCCCACACAGCCCACCACNONE 
J033024M18CGCGTGGGGCCCACCANONE 
J033024M18GCGGGCCCACACAGCCCACCACNONE 
J033034P09CGCGTGGGGCCCACCANONE 
J033034P09GCGGGCCCACACAGCCCACCACNONE 
J033046A06CGCGTGGGGCCCACCANONE 
J033046A06GCGGGCCCACACAGCCCACCACNONE 
J033051K01CGCGTGGGGCCCACCANONE 
J033051K01GCGGGCCCACACAGCCCACCACNONE 
J033081P09CGCGTGGGGCCCACCANONE 
J033081P09GCGGGCCCACACAGCCCACCACNONE 
J033091B17CGCGTGGGGCCCACCANONE 
J033091B17GCGGGCCCACACAGCCCACCACNONE 
J033092K23CGCGTGGGGCCCACCANONE 
J033092K23GCGGGCCCACACAGCCCACCACNONE 
J033132J09CGCGTGGGGCCCACCANONE 
J033132J09GCGGGCCCACACAGCCCACCACNONE 
J033144A14CGCGTGGGGCCCACCANONE 
J033144A14GCGGGCCCACACAGCCCACCACNONE 
J033145A14CGCGTGGGGCCCACCANONE 
J033145A14GCGGGCCCACACAGCCCACCACNONE 
J043021B20CGCGTGGGGCCCACCANONE 
J043021B20GCGGGCCCACACAGCCCACCACNONE 
J053024D23CGCGTGGGGCCCACCANONE 
J053024D23GCGGGCCCACACAGCCCACCACNONE 
J065212J10CGCGTGGGGCCCACCANONE 
J065212J10GCGGGCCCACACAGCCCACCACNONE 
J090055M05CGCGTGGGGCCCACCANONE 
J090055M05GCGGGCCCACACAGCCCACCACNONE 
J090065E14CGCGTGGGGCCCACCANONE 
J090065E14GCGGGCCCACACAGCCCACCACNONE 
J090092J06CGCGTGGGGCCCACCANONE 
J090092J06GCGGGCCCACACAGCCCACCACNONE 
Os07g0607800012-042-C02CCAGCCCACCACGCCTCCACGCCNONE 
015-097-B06CCAGCCCACCACGCCTCCACGCCNONE 
AK069010CCAGCCCACCACGCCTCCACGCCNONE 
J013170I18CCAGCCCACCACGCCTCCACGCCNONE 
J090036G23CCAGCCCACCACGCCTCCACGCCNONE 
Os07g0608400AK109447CGATGGGCCGGGGCCCACCASimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0622000005-017-G03AGCCCACCANONE 
AB125303AGCCCACCANONE 
AK070965AGCCCACCASerine/threonine-protein kinase SAPK2 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 2). 
AK103945AGCCCACCANONE 
AY207043AGCCCACCANONE 
J023068H23AGCCCACCANONE 
J065093I04AGCCCACCANONE 
J065184K24AGCCCACCANONE 
Os07g0624600AK109902GTGGTGGGCCATSimilar to Trehalose-6-phosphate phosphatase. 
Os07g0644300AK066726AAGGCCCACCASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483AAGGCCCACCANONE 
Os07g0659500AK073537CAGGCCCACCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0691200AK068807GCCCACCACNONE 
AK072158GCCCACCACNONE 
J013001D13GCCCACCACNONE 
J013022D09GCCCACCACNONE 
J013028C24GCCCACCACNONE 
J013032M14GCCCACCACNONE 
J023097E13GCCCACCACNONE 
J065095A22GCCCACCACNONE 
Os07g0695100AB189039GCGGGCCCACCANONE 
AB189042GCGGGCCCACCANONE 
AK059514GCGGGCCCACCANONE 
AK066112GCGGGCCCACCACheY-like domain containing protein. 
J013051N02GCGGGCCCACCANONE 
J013127M02GCGGGCCCACCANONE 
J023007I05GCGGGCCCACCANONE 
Os08g0107900014-055-C03TGGTGGGCTGANONE 
J065062G20TGGTGGGCTGANONE 
Os08g0112800009-113-D03GTGGTGGGCCCTNONE 
AK121176GTGGTGGGCCCTRickettsia 17 kDa surface antigen family protein. 
J023083C18GTGGTGGGCCCTNONE 
J033074M10GTGGTGGGCCCTNONE 
J033097G10GTGGTGGGCCCTNONE 
J065090F05GTGGTGGGCCCTNONE 
J090001J03GTGGTGGGCCCTNONE 
J090044F23GTGGTGGGCCCTNONE 
J090078H09GTGGTGGGCCCTNONE 
J100088G23GTGGTGGGCCCTNONE 
Os08g0117400006-086-A09GACGGCCCACCANONE 
006-103-C02GACGGCCCACCANONE 
AK059891GACGGCCCACCASimilar to Calmodulin 1 (Fragment). 
AK103863GACGGCCCACCANONE 
AY224521GACGGCCCACCANONE 
J033149E23GACGGCCCACCANONE 
J065062E05GACGGCCCACCANONE 
J065083O05GACGGCCCACCANONE 
J065116D14GACGGCCCACCANONE 
J065158F16GACGGCCCACCANONE 
J065179N16GACGGCCCACCANONE 
J065206N23GACGGCCCACCANONE 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0141300AK058337GTGGTGGGCCCCACCNONE 
AK058337GTGTGGGGCCCACCANONE 
AK067917GTGGTGGGCCCCACCMajor sperm protein domain containing protein. 
AK067917GTGTGGGGCCCACCAMajor sperm protein domain containing protein. 
J100039I03GTGGTGGGCCCCACCNONE 
J100039I03GTGTGGGGCCCACCANONE 
Os08g0143400015-006-A10TGCGGGCCCACCANONE 
AK066792TGCGGGCCCACCANONE 
AK120532TGCGGGCCCACCASWIRM domain containing protein. 
J100083F02TGCGGGCCCACCANONE 
Os08g0156900AJ605583TCCGGCCCACCANONE 
AK073344TCCGGCCCACCASpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397TCCGGCCCACCANONE 
Os08g0299600AK107112CAGGCCCACCACyclin-like F-box domain containing protein. 
Os08g0322400AK120116TGGTGGGCTGCATGGGCTGCNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20TGGTGGGCTGCATGGGCTGCNONE 
J013096J15TGGTGGGCTGCATGGGCTGCNONE 
Os08g0322600AK069839GCCCACCASimilar to PGT-2. 
AK119582GCCCACCANONE 
J023031A12GCCCACCANONE 
Os08g0386300AK059323TGGTGGGCCCATGNONE 
AK070379TGGTGGGCCCATGCytochrome b5 domain containing protein. 
J023054P20TGGTGGGCCCATGNONE 
J033089H01TGGTGGGCCCATGNONE 
J065013I01TGGTGGGCCCATGNONE 
J065212E17TGGTGGGCCCATGNONE 
J080317O15TGGTGGGCCCATGNONE 
J090018O07TGGTGGGCCCATGNONE 
Os08g0387500AK105106GTGGTGGGCCCCACCCGSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0414200AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
J033048B10TGCGGCCCACCAGCCCACCACNONE 
J033071G24TGCGGCCCACCAGCCCACCACNONE 
J033107O17TGCGGCCCACCAGCCCACCACNONE 
Os08g0430700AK101681TGGTGGGCCACSimilar to UVB-resistance protein-like. 
AK102785TGGTGGGCCACNONE 
Os08g0447200AK067377GTGGTGGGCCAGSGT1 family protein. 
J013106M17GTGGTGGGCCAGNONE 
J033133D18GTGGTGGGCCAGNONE 
J033140B09GTGGTGGGCCAGNONE 
J100028I17GTGGTGGGCCAGNONE 
J100086C22GTGGTGGGCCAGNONE 
Os08g0471800AK105281GCCCACCACRemorin, C-terminal region domain containing protein. 
Os08g0490100009-038-D02GTGGTGGGCCCCACANONE 
J065152E11GTGGTGGGCCCCACASimilar to PBF protein. 
J090050K03GTGGTGGGCCCCACANONE 
J090053L01GTGGTGGGCCCCACANONE 
Os08g0493900AK101284CCCGGCCCACCACNONE 
AK111820CCCGGCCCACCACWD40-like domain containing protein. 
Os08g0500200AK059046CCACTGACGTGGTGGGCCCCACCNONE 
AK064018CCACTGACGTGGTGGGCCCCACCConserved hypothetical protein. 
J075091E11CCACTGACGTGGTGGGCCCCACCNONE 
J090039E22CCACTGACGTGGTGGGCCCCACCNONE 
J100072K15CCACTGACGTGGTGGGCCCCACCNONE 
Os08g0503800AK101954AGCCGTCCGATCTGGTGGGCCCACACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0511000AK107578TGGTGGGCCGTAProtein prenyltransferase domain containing protein. 
Os08g0520100AK059686GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCNONE 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
Os08g0522600014-041-A10TGGTGGGCCCACCNONE 
AK105364TGGTGGGCCCACCSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
Os08g0525600AK103172GAAGCCCACCACSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os08g0526100011-072-E04GCCCACCACNONE 
AK100965GCCCACCACNAD-dependent epimerase/dehydratase family protein. 
J023142D13GCCCACCACNONE 
J033132L16GCCCACCACNONE 
J090006E20GCCCACCACNONE 
J100069L13GCCCACCACNONE 
Os08g0536300AF358777TGGTGGGCCCGNONE 
AK099722TGGTGGGCCCGSimilar to Hd1. 
J100054G13TGGTGGGCCCGNONE 
Os08g0548300AK073266CCCAGCCCACCACZinc finger, RING-type domain containing protein. 
J013030C19CCCAGCCCACCACNONE 
J033029A20CCCAGCCCACCACNONE 
J033050L14CCCAGCCCACCACNONE 
J033058F03CCCAGCCCACCACNONE 
J033110K01CCCAGCCCACCACNONE 
J033123D21CCCAGCCCACCACNONE 
Os08g0549300009-008-F01TCAGCCCACCAACNONE 
009-033-G10TCAGCCCACCAACNONE 
AK120938TCAGCCCACCAACSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420TCAGCCCACCAACNONE 
J023037A21TCAGCCCACCAACNONE 
J023066D20TCAGCCCACCAACNONE 
J033099K13TCAGCCCACCAACNONE 
J065116C14TCAGCCCACCAACNONE 
J075009K15TCAGCCCACCAACNONE 
J075071P13TCAGCCCACCAACNONE 
J075080D18TCAGCCCACCAACNONE 
J075124F24TCAGCCCACCAACNONE 
J075198F23TCAGCCCACCAACNONE 
J080006B15TCAGCCCACCAACNONE 
J090078H13TCAGCCCACCAACNONE 
J090089J09TCAGCCCACCAACNONE 
J100017A03TCAGCCCACCAACNONE 
J100023G03TCAGCCCACCAACNONE 
Os09g0309500J100027L22GAGGCCCACCACConserved hypothetical protein. 
Os09g0322100AK107018TCAGCCCACCACConserved hypothetical protein. 
Os09g0370300AK108199AGCCCACCACSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0397900AK101306GGCTGGGCTTTTTGGTGGGCCAASimilar to FEG protein. 
Os09g0436700AK070597CAAGGCCCACCAPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os09g0443800AK107689TGGTGGGCCAAConserved hypothetical protein. 
Os09g0445600AK107839CAGGTGGGGCCCACCACConserved hypothetical protein. 
Os09g0457100Os09g0457100GCCCACCACCytochrome P450 family protein. 
Os09g0459900009-190-G09GCCCACCACACCGCACNONE 
AK063208GCCCACCACACCGCACCyclin-dependent kinase inhibitor family protein. 
AK111010GCCCACCACACCGCACNONE 
Os09g0461500006-107-E02AAAGCCCACCACNONE 
011-089-D02AAAGCCCACCACNONE 
AK063400AAAGCCCACCACNONE 
AK102328AAAGCCCACCACEsterase/lipase/thioesterase domain containing protein. 
J033090L22AAAGCCCACCACNONE 
J065031O14AAAGCCCACCACNONE 
J065083D22AAAGCCCACCACNONE 
J065182N14AAAGCCCACCACNONE 
J065190H22AAAGCCCACCACNONE 
J065219H11AAAGCCCACCACNONE 
J075007O22AAAGCCCACCACNONE 
J075025E09AAAGCCCACCACNONE 
J075041K24AAAGCCCACCACNONE 
J075046F11AAAGCCCACCACNONE 
J090032E12AAAGCCCACCACNONE 
Os09g0474501J065129D17GAGGCCCACCAConserved hypothetical protein. 
Os09g0516600AK070780CCCGGGCCCACCAGCCCAGNONE 
AK103563CCCGGGCCCACCAGCCCAGNONE 
AY054407CCCGGGCCCACCAGCCCAGGlyoxalase II. 
J013058P06CCCGGGCCCACCAGCCCAGNONE 
J013093G04CCCGGGCCCACCAGCCCAGNONE 
J023007G05CCCGGGCCCACCAGCCCAGNONE 
J023091A08CCCGGGCCCACCAGCCCAGNONE 
J023136K23CCCGGGCCCACCAGCCCAGNONE 
J023138D20CCCGGGCCCACCAGCCCAGNONE 
J033022N20CCCGGGCCCACCAGCCCAGNONE 
J033065N15CCCGGGCCCACCAGCCCAGNONE 
J033109L23CCCGGGCCCACCAGCCCAGNONE 
J053073C08CCCGGGCCCACCAGCCCAGNONE 
J075094J24CCCGGGCCCACCAGCCCAGNONE 
J075106P21CCCGGGCCCACCAGCCCAGNONE 
Os09g0519200009-006-A07GTGGTGGGCNONE 
009-092-E11GTGGTGGGCNONE 
009-124-A12GTGGTGGGCNONE 
009-140-E10GTGGTGGGCNONE 
009-151-A11GTGGTGGGCNONE 
AK063004GTGGTGGGCConserved hypothetical protein. 
AK067759GTGGTGGGCNONE 
J080001K23GTGGTGGGCNONE 
J080005M03GTGGTGGGCNONE 
J080010I19GTGGTGGGCNONE 
J080016E11GTGGTGGGCNONE 
J080020C09GTGGTGGGCNONE 
J080021H12GTGGTGGGCNONE 
J080022D22GTGGTGGGCNONE 
J080022H06GTGGTGGGCNONE 
J080028M15GTGGTGGGCNONE 
J080032J10GTGGTGGGCNONE 
J080034F22GTGGTGGGCNONE 
J080040E05GTGGTGGGCNONE 
J080042G22GTGGTGGGCNONE 
J080042N10GTGGTGGGCNONE 
J080050H02GTGGTGGGCNONE 
J080053L12GTGGTGGGCNONE 
J080058G15GTGGTGGGCNONE 
J080062O15GTGGTGGGCNONE 
J080063B17GTGGTGGGCNONE 
J080066C10GTGGTGGGCNONE 
J080066M23GTGGTGGGCNONE 
J080067L18GTGGTGGGCNONE 
J080069F06GTGGTGGGCNONE 
J080069F08GTGGTGGGCNONE 
J080069P19GTGGTGGGCNONE 
J080077P18GTGGTGGGCNONE 
J080079E24GTGGTGGGCNONE 
J080079J12GTGGTGGGCNONE 
J080086C03GTGGTGGGCNONE 
J080089I24GTGGTGGGCNONE 
J080090I06GTGGTGGGCNONE 
J080096D06GTGGTGGGCNONE 
J080096N03GTGGTGGGCNONE 
Os09g0530700AK058211TGGTGGGCCCTConserved hypothetical protein. 
AK100759TGGTGGGCCCTNONE 
J065039L02TGGTGGGCCCTNONE 
J065043O03TGGTGGGCCCTNONE 
J065070M16TGGTGGGCCCTNONE 
Os09g0533900003-104-E05GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
012-076-C03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK067774GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK100449GTGGCCCACCACGCCTCGGCCCCACCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023026E11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023028B20GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023050P11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023052K08GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023075J03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023078E15GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023090P12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023120E01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023142K01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033027K23GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058A09GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058C12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033125A04GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J043040L01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053061D06GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053096N13GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J065193H10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J090075L17GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J100050D10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
Os09g0542100AK105001GGTGGGCCCCACCGCCCACCACPeptidase A1, pepsin family protein. 
J023149B01GGTGGGCCCCACCGCCCACCACNONE 
J100043C13GGTGGGCCCCACCGCCCACCACNONE 
Os09g0547200016-021-H03ACTGGGCCCCGCCCACCACNONE 
AK073078ACTGGGCCCCGCCCACCACProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984ACTGGGCCCCGCCCACCACNONE 
J065005L05ACTGGGCCCCGCCCACCACNONE 
J065039C06ACTGGGCCCCGCCCACCACNONE 
J065116H17ACTGGGCCCCGCCCACCACNONE 
J100046A17ACTGGGCCCCGCCCACCACNONE 
Os09g0553800009-175-D10GCCCACCANONE 
009-198-D11GCCCACCANONE 
J065053G12GCCCACCANONE 
J065078G05GCCCACCANONE 
J065114C03GCCCACCANONE 
J065146M16GCCCACCANONE 
J065181K24GCCCACCANONE 
Os11g0107700AK073061GCCCACCAProtein kinase-like domain containing protein. 
Os11g0114700AK065865TGGTGGGCTNONE 
AK066583TGGTGGGCTNONE 
AK070834TGGTGGGCTPAP/25A core domain containing protein. 
AK072543TGGTGGGCTNONE 
Os11g0119200016-068-E03TGGTGGGCCGTANONE 
AK103124TGGTGGGCCGTAZinc finger, RING-type domain containing protein. 
J033119L05TGGTGGGCCGTANONE 
J065036I18TGGTGGGCCGTANONE 
J065160A20TGGTGGGCCGTANONE 
J065183G16TGGTGGGCCGTANONE 
J065205L01TGGTGGGCCGTANONE 
J065211I07TGGTGGGCCGTANONE 
J065219B08TGGTGGGCCGTANONE 
Os11g0209700012-068-H08TGGTGGGCNONE 
015-016-B07TGGTGGGCNONE 
AK068331TGGTGGGCNONE 
Os11g0237700J100060P16GGATGGGCCCACCACConserved hypothetical protein. 
J100065I12GGATGGGCCCACCACNONE 
Os11g0267000006-024-H12ACAGCCCACCANONE 
006-039-A12ACAGCCCACCANONE 
006-039-B09ACAGCCCACCANONE 
006-044-F05ACAGCCCACCANONE 
006-069-C12ACAGCCCACCANONE 
006-098-E01ACAGCCCACCANONE 
006-099-H05ACAGCCCACCANONE 
006-103-B11ACAGCCCACCANONE 
006-107-A02ACAGCCCACCANONE 
006-109-C12ACAGCCCACCANONE 
009-123-C09ACAGCCCACCANONE 
AK060022ACAGCCCACCANONE 
AK061014ACAGCCCACCAGUN4-like domain containing protein. 
AK100815ACAGCCCACCANONE 
AK104559ACAGCCCACCANONE 
J023122C05ACAGCCCACCANONE 
Os11g0306300006-102-D09GTGGTGGGCTGANONE 
AK109384GTGGTGGGCTGASimilar to Herbicide safener binding protein. 
Os11g0527000J065137N17GTGGTGGGCConserved hypothetical protein. 
Os11g0542100J065162B12GGGGCCCACCACZinc finger, RING-type domain containing protein. 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os11g0602300AK103473ACAGCCCACCACSimilar to HVA22-like protein a (AtHVA22a). 
J033075N24ACAGCCCACCACNONE 
Os11g0648000AK066444GTGGTGGGCCCAGCCSimilar to Na+/H+ antiporter. 
AK072026GTGGTGGGCCCAGCCNONE 
Os11g0657100AK061105TGTGGGGCCCACCAPeptide chain release factor 1 family protein. 
AK066354TGTGGGGCCCACCANONE 
Os11g0704700AK102518TGGTGGGCCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023012E06TGGTGGGCCTCNONE 
J023022M10TGGTGGGCCTCNONE 
J023086E15TGGTGGGCCTCNONE 
J033022B08TGGTGGGCCTCNONE 
J033091K11TGGTGGGCCTCNONE 
J033095N01TGGTGGGCCTCNONE 
J090020H24TGGTGGGCCTCNONE 
Os12g0143150009-090-F09GCCCACCACUbiquitin domain containing protein. 
J013121D01GCCCACCACNONE 
J065129G09GCCCACCACNONE 
J080311D13GCCCACCACNONE 
J090014O10GCCCACCACNONE 
J090045E21GCCCACCACNONE 
J100047D12GCCCACCACNONE 
Os12g0145700AK071391CGGCTCGGCCCACCACPyruvate kinase family protein. 
J023013N02CGGCTCGGCCCACCACNONE 
J033085D15CGGCTCGGCCCACCACNONE 
J043021I09CGGCTCGGCCCACCACNONE 
J100055L05CGGCTCGGCCCACCACNONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0190100AK109819AGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
AK109819AGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
AK109819CAAGGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
AK109819CCAGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0226900AK060453GTGGTGGGCTSimilar to Allyl alcohol dehydrogenase. 
AK071631GTGGTGGGCTNONE 
AK104386GTGGTGGGCTNONE 
Os12g0230600AK072568CTGGCCCACCACCCCCCAProtein of unknown function DUF1685 family protein. 
Os12g0235800AK071066AGCCCACCACSimilar to Argininosuccinate synthase (Fragment). 
Os12g0250700AK069277AGCCCACCAConserved hypothetical protein. 
Os12g0460800J023003J21CGGGCCCACCANONE 
Os12g0488900AK068902GCCCACCACArmadillo-like helical domain containing protein. 
Os12g0527500AK109836GCGGCCCACCACCyclin-like F-box domain containing protein. 
Os12g0564400009-069-F12CCTCGCCCACCAACNONE 
AK059949CCTCGCCCACCAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548CCTCGCCCACCAACNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.