version

Summary of OsREG600 (All List)

OrganismOryza sativa  
IDOsREG600  
SequenceGCCCACCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2310  

Entry Sequences (2310 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03GGGTGGGCCCACGCGTNONE 
006-030-A03GTGGCCCACCCGNONE 
006-049-C10GGGTGGGCCCACGCGTNONE 
006-049-C10GTGGCCCACCCGNONE 
006-054-E02GGGTGGGCCCACGCGTNONE 
006-054-E02GTGGCCCACCCGNONE 
011-035-H02GGGTGGGCCCACGCGTNONE 
011-035-H02GTGGCCCACCCGNONE 
011-036-E04GGGTGGGCCCACGCGTNONE 
011-036-E04GTGGCCCACCCGNONE 
012-047-C08GGGTGGGCCCACGCGTNONE 
012-047-C08GTGGCCCACCCGNONE 
012-079-F08GGGTGGGCCCACGCGTNONE 
012-079-F08GTGGCCCACCCGNONE 
012-097-C02GGGTGGGCCCACGCGTNONE 
012-097-C02GTGGCCCACCCGNONE 
012-100-A07GGGTGGGCCCACGCGTNONE 
012-100-A07GTGGCCCACCCGNONE 
013-015-H05GGGTGGGCCCACGCGTNONE 
013-015-H05GTGGCCCACCCGNONE 
013-047-A03GGGTGGGCCCACGCGTNONE 
013-047-A03GTGGCCCACCCGNONE 
013-051-B05GGGTGGGCCCACGCGTNONE 
013-051-B05GTGGCCCACCCGNONE 
013-061-G02GGGTGGGCCCACGCGTNONE 
013-061-G02GTGGCCCACCCGNONE 
013-077-H02GGGTGGGCCCACGCGTNONE 
013-077-H02GTGGCCCACCCGNONE 
015-005-D04GGGTGGGCCCACGCGTNONE 
015-005-D04GTGGCCCACCCGNONE 
015-064-B06GGGTGGGCCCACGCGTNONE 
015-064-B06GTGGCCCACCCGNONE 
015-072-D02GGGTGGGCCCACGCGTNONE 
015-072-D02GTGGCCCACCCGNONE 
016-073-E09GGGTGGGCCCACGCGTNONE 
016-073-E09GTGGCCCACCCGNONE 
016-088-H03GGGTGGGCCCACGCGTNONE 
016-088-H03GTGGCCCACCCGNONE 
AK062063GGGTGGGCCCACGCGTNONE 
AK062063GTGGCCCACCCGNONE 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GTGGCCCACCCGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277GGGTGGGCCCACGCGTNONE 
AK102277GTGGCCCACCCGNONE 
AK119645GGGTGGGCCCACGCGTNONE 
AK119645GTGGCCCACCCGNONE 
AY341828GGGTGGGCCCACGCGTNONE 
AY341828GTGGCCCACCCGNONE 
J013036O08GGGTGGGCCCACGCGTNONE 
J013036O08GTGGCCCACCCGNONE 
J013037M17GGGTGGGCCCACGCGTNONE 
J013037M17GTGGCCCACCCGNONE 
J013039B11GGGTGGGCCCACGCGTNONE 
J013039B11GTGGCCCACCCGNONE 
J013039L20GGGTGGGCCCACGCGTNONE 
J013039L20GTGGCCCACCCGNONE 
J013047B20GGGTGGGCCCACGCGTNONE 
J013047B20GTGGCCCACCCGNONE 
J013048E23GGGTGGGCCCACGCGTNONE 
J013048E23GTGGCCCACCCGNONE 
J013051E12GGGTGGGCCCACGCGTNONE 
J013051E12GTGGCCCACCCGNONE 
J013051F12GGGTGGGCCCACGCGTNONE 
J013051F12GTGGCCCACCCGNONE 
J013056B05GGGTGGGCCCACGCGTNONE 
J013056B05GTGGCCCACCCGNONE 
J013057N24GGGTGGGCCCACGCGTNONE 
J013057N24GTGGCCCACCCGNONE 
J013064D21GGGTGGGCCCACGCGTNONE 
J013064D21GTGGCCCACCCGNONE 
J013065G24GGGTGGGCCCACGCGTNONE 
J013065G24GTGGCCCACCCGNONE 
J013075L13GGGTGGGCCCACGCGTNONE 
J013075L13GTGGCCCACCCGNONE 
J013075L24GGGTGGGCCCACGCGTNONE 
J013075L24GTGGCCCACCCGNONE 
J013092F04GGGTGGGCCCACGCGTNONE 
J013092F04GTGGCCCACCCGNONE 
J013092F10GGGTGGGCCCACGCGTNONE 
J013092F10GTGGCCCACCCGNONE 
J013092M16GGGTGGGCCCACGCGTNONE 
J013092M16GTGGCCCACCCGNONE 
J013096K06GGGTGGGCCCACGCGTNONE 
J013096K06GTGGCCCACCCGNONE 
J013111F10GGGTGGGCCCACGCGTNONE 
J013111F10GTGGCCCACCCGNONE 
J013120B17GGGTGGGCCCACGCGTNONE 
J013120B17GTGGCCCACCCGNONE 
J013120P07GGGTGGGCCCACGCGTNONE 
J013120P07GTGGCCCACCCGNONE 
J013122F18GGGTGGGCCCACGCGTNONE 
J013122F18GTGGCCCACCCGNONE 
J013122H23GGGTGGGCCCACGCGTNONE 
J013122H23GTGGCCCACCCGNONE 
J013126I15GGGTGGGCCCACGCGTNONE 
J013126I15GTGGCCCACCCGNONE 
J013126L17GGGTGGGCCCACGCGTNONE 
J013126L17GTGGCCCACCCGNONE 
J013129C15GGGTGGGCCCACGCGTNONE 
J013129C15GTGGCCCACCCGNONE 
J013146A04GGGTGGGCCCACGCGTNONE 
J013146A04GTGGCCCACCCGNONE 
J013146A06GGGTGGGCCCACGCGTNONE 
J013146A06GTGGCCCACCCGNONE 
J013153F01GGGTGGGCCCACGCGTNONE 
J013153F01GTGGCCCACCCGNONE 
J013156O06GGGTGGGCCCACGCGTNONE 
J013156O06GTGGCCCACCCGNONE 
J013162D05GGGTGGGCCCACGCGTNONE 
J013162D05GTGGCCCACCCGNONE 
J023008N04GGGTGGGCCCACGCGTNONE 
J023008N04GTGGCCCACCCGNONE 
J023010D06GGGTGGGCCCACGCGTNONE 
J023010D06GTGGCCCACCCGNONE 
J023011I23GGGTGGGCCCACGCGTNONE 
J023011I23GTGGCCCACCCGNONE 
J023023I15GGGTGGGCCCACGCGTNONE 
J023023I15GTGGCCCACCCGNONE 
J023025C08GGGTGGGCCCACGCGTNONE 
J023025C08GTGGCCCACCCGNONE 
J023029H02GGGTGGGCCCACGCGTNONE 
J023029H02GTGGCCCACCCGNONE 
J023033C18GGGTGGGCCCACGCGTNONE 
J023033C18GTGGCCCACCCGNONE 
J023037D21GGGTGGGCCCACGCGTNONE 
J023037D21GTGGCCCACCCGNONE 
J023049F17GGGTGGGCCCACGCGTNONE 
J023049F17GTGGCCCACCCGNONE 
J023052B15GGGTGGGCCCACGCGTNONE 
J023052B15GTGGCCCACCCGNONE 
J023061D03GGGTGGGCCCACGCGTNONE 
J023061D03GTGGCCCACCCGNONE 
J023062M01GGGTGGGCCCACGCGTNONE 
J023062M01GTGGCCCACCCGNONE 
J023089D24GGGTGGGCCCACGCGTNONE 
J023089D24GTGGCCCACCCGNONE 
J023109J20GGGTGGGCCCACGCGTNONE 
J023109J20GTGGCCCACCCGNONE 
J023109M21GGGTGGGCCCACGCGTNONE 
J023109M21GTGGCCCACCCGNONE 
J023120N04GGGTGGGCCCACGCGTNONE 
J023120N04GTGGCCCACCCGNONE 
J023122A04GGGTGGGCCCACGCGTNONE 
J023122A04GTGGCCCACCCGNONE 
J023134F23GGGTGGGCCCACGCGTNONE 
J023134F23GTGGCCCACCCGNONE 
J023149E20GGGTGGGCCCACGCGTNONE 
J023149E20GTGGCCCACCCGNONE 
J033022A12GGGTGGGCCCACGCGTNONE 
J033022A12GTGGCCCACCCGNONE 
J033022C04GGGTGGGCCCACGCGTNONE 
J033022C04GTGGCCCACCCGNONE 
J033024K06GGGTGGGCCCACGCGTNONE 
J033024K06GTGGCCCACCCGNONE 
J033026F23GGGTGGGCCCACGCGTNONE 
J033026F23GTGGCCCACCCGNONE 
J033029J19GGGTGGGCCCACGCGTNONE 
J033029J19GTGGCCCACCCGNONE 
J033040H20GGGTGGGCCCACGCGTNONE 
J033040H20GTGGCCCACCCGNONE 
J033042P21GGGTGGGCCCACGCGTNONE 
J033042P21GTGGCCCACCCGNONE 
J033043F14GGGTGGGCCCACGCGTNONE 
J033043F14GTGGCCCACCCGNONE 
J033044G11GGGTGGGCCCACGCGTNONE 
J033044G11GTGGCCCACCCGNONE 
J033052L10GGGTGGGCCCACGCGTNONE 
J033052L10GTGGCCCACCCGNONE 
J033052O03GGGTGGGCCCACGCGTNONE 
J033052O03GTGGCCCACCCGNONE 
J033052P03GGGTGGGCCCACGCGTNONE 
J033052P03GTGGCCCACCCGNONE 
J033079B20GGGTGGGCCCACGCGTNONE 
J033079B20GTGGCCCACCCGNONE 
J033089D21GGGTGGGCCCACGCGTNONE 
J033089D21GTGGCCCACCCGNONE 
J033094P04GGGTGGGCCCACGCGTNONE 
J033094P04GTGGCCCACCCGNONE 
J033103N02GGGTGGGCCCACGCGTNONE 
J033103N02GTGGCCCACCCGNONE 
J033110J19GGGTGGGCCCACGCGTNONE 
J033110J19GTGGCCCACCCGNONE 
J033114E17GGGTGGGCCCACGCGTNONE 
J033114E17GTGGCCCACCCGNONE 
J033115K04GGGTGGGCCCACGCGTNONE 
J033115K04GTGGCCCACCCGNONE 
J033119I06GGGTGGGCCCACGCGTNONE 
J033119I06GTGGCCCACCCGNONE 
J033121L10GGGTGGGCCCACGCGTNONE 
J033121L10GTGGCCCACCCGNONE 
J033123H14GGGTGGGCCCACGCGTNONE 
J033123H14GTGGCCCACCCGNONE 
J033136H10GGGTGGGCCCACGCGTNONE 
J033136H10GTGGCCCACCCGNONE 
J033139L07GGGTGGGCCCACGCGTNONE 
J033139L07GTGGCCCACCCGNONE 
J033143G23GGGTGGGCCCACGCGTNONE 
J033143G23GTGGCCCACCCGNONE 
J043021F16GGGTGGGCCCACGCGTNONE 
J043021F16GTGGCCCACCCGNONE 
J080304G01GGGTGGGCCCACGCGTNONE 
J080304G01GTGGCCCACCCGNONE 
J080305H24GGGTGGGCCCACGCGTNONE 
J080305H24GTGGCCCACCCGNONE 
J080309B11GGGTGGGCCCACGCGTNONE 
J080309B11GTGGCCCACCCGNONE 
J080315N09GGGTGGGCCCACGCGTNONE 
J080315N09GTGGCCCACCCGNONE 
J080319J20GGGTGGGCCCACGCGTNONE 
J080319J20GTGGCCCACCCGNONE 
J090014D01GGGTGGGCCCACGCGTNONE 
J090014D01GTGGCCCACCCGNONE 
J090067F08GGGTGGGCCCACGCGTNONE 
J090067F08GTGGCCCACCCGNONE 
J090079P18GGGTGGGCCCACGCGTNONE 
J090079P18GTGGCCCACCCGNONE 
J090082K13GGGTGGGCCCACGCGTNONE 
J090082K13GTGGCCCACCCGNONE 
J090093K17GGGTGGGCCCACGCGTNONE 
J090093K17GTGGCCCACCCGNONE 
J090099G18GGGTGGGCCCACGCGTNONE 
J090099G18GTGGCCCACCCGNONE 
J100022K14GGGTGGGCCCACGCGTNONE 
J100022K14GTGGCCCACCCGNONE 
J100052G17GGGTGGGCCCACGCGTNONE 
J100052G17GTGGCCCACCCGNONE 
Os01g0132800AK068422GCCCACCCPeptidyl-tRNA hydrolase family protein. 
Os01g0185200009-146-B06CCCGTGGGCCCACCCNONE 
009-163-F01CCCGTGGGCCCACCCNONE 
AK062984CCCGTGGGCCCACCCNONE 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222CCCGTGGGCCCACCCNONE 
AK111284CCCGTGGGCCCACCCNONE 
Os01g0239100Os01g0239100AGCCCACCCHeat shock protein DnaJ family protein. 
Os01g0244400J075054J20AGCCCACCCGCCCAAACProtein of unknown function DUF1618 domain containing protein. 
J075101O11AGCCCACCCGCCCAAACNONE 
J075123K08AGCCCACCCGCCCAAACNONE 
Os01g0266600AK058396GCCCACCCNONE 
AK069749GCCCACCCRedoxin domain containing protein. 
J023030N01GCCCACCCNONE 
J065065E03GCCCACCCNONE 
J075006N11GCCCACCCNONE 
J075017G04GCCCACCCNONE 
J075023L15GCCCACCCNONE 
J075126F05GCCCACCCNONE 
Os01g0273300Os01g0273300CTGGGGCCCACCCBSD domain containing protein. 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0305200009-022-C01GCCCACCCNONE 
009-022-C01GCTCAGCTGCCCACCCGNONE 
AK062385GCCCACCCLg106-like family protein. 
AK062385GCTCAGCTGCCCACCCGLg106-like family protein. 
J075005A20GCCCACCCNONE 
J075005A20GCTCAGCTGCCCACCCGNONE 
J075028K05GCCCACCCNONE 
J075028K05GCTCAGCTGCCCACCCGNONE 
J075060H07GCCCACCCNONE 
J075060H07GCTCAGCTGCCCACCCGNONE 
J075090G07GCCCACCCNONE 
J075090G07GCTCAGCTGCCCACCCGNONE 
J075117E20GCCCACCCNONE 
J075117E20GCTCAGCTGCCCACCCGNONE 
J075153F17GCCCACCCNONE 
J075153F17GCTCAGCTGCCCACCCGNONE 
J075179J10GCCCACCCNONE 
J075179J10GCTCAGCTGCCCACCCGNONE 
J075183G15GCCCACCCNONE 
J075183G15GCTCAGCTGCCCACCCGNONE 
Os01g0323600J023095C13GGGTGGGCCCCACTCCNONE 
Os01g0346400J100032G11TCAGCCCACCCConserved hypothetical protein. 
Os01g0507300AK099867GGGTGGGCProtein of unknown function DUF92, transmembrane family protein. 
Os01g0513400AK069619GGGGCCCACCCGProtein of unknown function DUF789 family protein. 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
J013033M01GGGTGGGCCCCACACGNONE 
J013159H24GGGTGGGCCCCACACGNONE 
J023008E13GGGTGGGCCCCACACGNONE 
J023030I11GGGTGGGCCCCACACGNONE 
J065137G08GGGTGGGCCCCACACGNONE 
J065139H16GGGTGGGCCCCACACGNONE 
J065154K13GGGTGGGCCCCACACGNONE 
J075176C02GGGTGGGCCCCACACGNONE 
Os01g0558600006-120-G12GGGTGGGCCCCACGNONE 
J013100N20GGGTGGGCCCCACGNONE 
J033043P09GGGTGGGCCCCACGNONE 
J033125M18GGGTGGGCCCCACGNONE 
J053043N11GGGTGGGCCCCACGNONE 
J065008E07GGGTGGGCCCCACGNONE 
J065080O16GGGTGGGCCCCACGNONE 
J075002G24GGGTGGGCCCCACGNONE 
J075123C09GGGTGGGCCCCACGNONE 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0560200AK102003GGGTGGGCCCACCSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06GGGTGGGCCCACCNONE 
J065092F14GGGTGGGCCCACCNONE 
J065106D04GGGTGGGCCCACCNONE 
J065194K23GGGTGGGCCCACCNONE 
Os01g0590300014-089-E04CGGGTGGGCCGGGNONE 
AK063740CGGGTGGGCCGGGConserved hypothetical protein. 
Os01g0679400AK107970GCCCACCCConserved hypothetical protein. 
Os01g0689900AK100606GCCCACCCNONE 
J023045G13GCCCACCCNONE 
J023050F21GCCCACCCNONE 
J023107H09GCCCACCCNONE 
J100036A05GCCCACCCNONE 
J100043E07GCCCACCCNONE 
Os01g0723600AK109735GCCCACCCGRibose-phosphate pyrophosphokinase 3 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 3). 
Os01g0736600009-105-F04GCCCACCCNONE 
014-035-D08GCCCACCCNONE 
AK099546GCCCACCCZinc finger, RING-type domain containing protein. 
AK105189GCCCACCCNONE 
J065155B14GCCCACCCNONE 
J075007F01GCCCACCCNONE 
Os01g0757200AB092485GAGGCCCACCCNONE 
AK060666GAGGCCCACCCNONE 
AK060714GAGGCCCACCCNONE 
AK099350GAGGCCCACCCNONE 
AK101713GAGGCCCACCCSimilar to GA 2-oxidase 4. 
Os01g0764000006-021-G03GACGGCCCACCCACCAACNONE 
006-025-C07GACGGCCCACCCACCAACNONE 
006-029-G11GACGGCCCACCCACCAACNONE 
006-030-C04GACGGCCCACCCACCAACNONE 
006-035-E05GACGGCCCACCCACCAACNONE 
006-037-G01GACGGCCCACCCACCAACNONE 
006-038-C01GACGGCCCACCCACCAACNONE 
006-039-G05GACGGCCCACCCACCAACNONE 
006-042-E11GACGGCCCACCCACCAACNONE 
006-044-H04GACGGCCCACCCACCAACNONE 
006-045-A10GACGGCCCACCCACCAACNONE 
006-045-C05GACGGCCCACCCACCAACNONE 
006-047-A11GACGGCCCACCCACCAACNONE 
006-048-H10GACGGCCCACCCACCAACNONE 
006-050-C01GACGGCCCACCCACCAACNONE 
006-050-H11GACGGCCCACCCACCAACNONE 
006-051-G10GACGGCCCACCCACCAACNONE 
006-051-G11GACGGCCCACCCACCAACNONE 
006-056-B04GACGGCCCACCCACCAACNONE 
006-063-F04GACGGCCCACCCACCAACNONE 
006-063-H12GACGGCCCACCCACCAACNONE 
006-065-G09GACGGCCCACCCACCAACNONE 
006-067-F11GACGGCCCACCCACCAACNONE 
006-073-D10GACGGCCCACCCACCAACNONE 
006-074-G09GACGGCCCACCCACCAACNONE 
006-075-D04GACGGCCCACCCACCAACNONE 
006-077-C10GACGGCCCACCCACCAACNONE 
006-082-A10GACGGCCCACCCACCAACNONE 
006-084-C12GACGGCCCACCCACCAACNONE 
006-085-F05GACGGCCCACCCACCAACNONE 
006-087-H12GACGGCCCACCCACCAACNONE 
006-092-E10GACGGCCCACCCACCAACNONE 
006-094-C06GACGGCCCACCCACCAACNONE 
006-096-G11GACGGCCCACCCACCAACNONE 
006-097-H11GACGGCCCACCCACCAACNONE 
006-101-A07GACGGCCCACCCACCAACNONE 
006-101-G08GACGGCCCACCCACCAACNONE 
006-110-E08GACGGCCCACCCACCAACNONE 
006-111-D04GACGGCCCACCCACCAACNONE 
006-116-H04GACGGCCCACCCACCAACNONE 
AK058894GACGGCCCACCCACCAACNONE 
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GACGGCCCACCCACCAACNONE 
J013119N15GACGGCCCACCCACCAACNONE 
J013123P15GACGGCCCACCCACCAACNONE 
J023055F24GACGGCCCACCCACCAACNONE 
J023125K17GACGGCCCACCCACCAACNONE 
J053050A20GACGGCCCACCCACCAACNONE 
J053056P10GACGGCCCACCCACCAACNONE 
J053074D19GACGGCCCACCCACCAACNONE 
J053078A14GACGGCCCACCCACCAACNONE 
J053086P10GACGGCCCACCCACCAACNONE 
J053094N23GACGGCCCACCCACCAACNONE 
J053095M23GACGGCCCACCCACCAACNONE 
J065006D02GACGGCCCACCCACCAACNONE 
J065030A17GACGGCCCACCCACCAACNONE 
J065030K04GACGGCCCACCCACCAACNONE 
J065035L12GACGGCCCACCCACCAACNONE 
J065046E12GACGGCCCACCCACCAACNONE 
J065065H19GACGGCCCACCCACCAACNONE 
J065073C01GACGGCCCACCCACCAACNONE 
J065105F01GACGGCCCACCCACCAACNONE 
J065131N16GACGGCCCACCCACCAACNONE 
J065144O13GACGGCCCACCCACCAACNONE 
J065160E12GACGGCCCACCCACCAACNONE 
J065160K02GACGGCCCACCCACCAACNONE 
J065163F09GACGGCCCACCCACCAACNONE 
J065165E18GACGGCCCACCCACCAACNONE 
J065174E04GACGGCCCACCCACCAACNONE 
J065175O08GACGGCCCACCCACCAACNONE 
J065191N24GACGGCCCACCCACCAACNONE 
J065193D19GACGGCCCACCCACCAACNONE 
J065198D04GACGGCCCACCCACCAACNONE 
J065200G09GACGGCCCACCCACCAACNONE 
J075016L06GACGGCCCACCCACCAACNONE 
J075017J11GACGGCCCACCCACCAACNONE 
J075019L08GACGGCCCACCCACCAACNONE 
J075028M08GACGGCCCACCCACCAACNONE 
J075029K05GACGGCCCACCCACCAACNONE 
J075039K04GACGGCCCACCCACCAACNONE 
J075047J22GACGGCCCACCCACCAACNONE 
J075079H13GACGGCCCACCCACCAACNONE 
J075095K14GACGGCCCACCCACCAACNONE 
J075111D21GACGGCCCACCCACCAACNONE 
J075131A19GACGGCCCACCCACCAACNONE 
J075147G20GACGGCCCACCCACCAACNONE 
J075158F11GACGGCCCACCCACCAACNONE 
J075166N10GACGGCCCACCCACCAACNONE 
J075196G09GACGGCCCACCCACCAACNONE 
J075198I24GACGGCCCACCCACCAACNONE 
J090001L08GACGGCCCACCCACCAACNONE 
J090026G07GACGGCCCACCCACCAACNONE 
J090050M15GACGGCCCACCCACCAACNONE 
J090071A01GACGGCCCACCCACCAACNONE 
J090072P16GACGGCCCACCCACCAACNONE 
J090078D22GACGGCCCACCCACCAACNONE 
J090089C18GACGGCCCACCCACCAACNONE 
J100019B07GACGGCCCACCCACCAACNONE 
J100019H15GACGGCCCACCCACCAACNONE 
J100019P09GACGGCCCACCCACCAACNONE 
J100023A16GACGGCCCACCCACCAACNONE 
J100023B09GACGGCCCACCCACCAACNONE 
J100026O18GACGGCCCACCCACCAACNONE 
J100027E09GACGGCCCACCCACCAACNONE 
J100028F22GACGGCCCACCCACCAACNONE 
J100029P05GACGGCCCACCCACCAACNONE 
J100031M19GACGGCCCACCCACCAACNONE 
J100032A11GACGGCCCACCCACCAACNONE 
J100036G19GACGGCCCACCCACCAACNONE 
J100038E22GACGGCCCACCCACCAACNONE 
J100040A12GACGGCCCACCCACCAACNONE 
J100040L02GACGGCCCACCCACCAACNONE 
J100043O13GACGGCCCACCCACCAACNONE 
J100045E20GACGGCCCACCCACCAACNONE 
J100046H18GACGGCCCACCCACCAACNONE 
J100047E08GACGGCCCACCCACCAACNONE 
J100050E08GACGGCCCACCCACCAACNONE 
J100050P14GACGGCCCACCCACCAACNONE 
J100051G10GACGGCCCACCCACCAACNONE 
J100052L12GACGGCCCACCCACCAACNONE 
J100056G24GACGGCCCACCCACCAACNONE 
J100066B15GACGGCCCACCCACCAACNONE 
J100068O15GACGGCCCACCCACCAACNONE 
J100070J16GACGGCCCACCCACCAACNONE 
J100074I22GACGGCCCACCCACCAACNONE 
J100075M12GACGGCCCACCCACCAACNONE 
J100077M09GACGGCCCACCCACCAACNONE 
J100077O14GACGGCCCACCCACCAACNONE 
J100079J08GACGGCCCACCCACCAACNONE 
J100080I16GACGGCCCACCCACCAACNONE 
Os01g0764300J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0810100AK071916TGGATGGGTGGGCRibonuclease III domain containing protein. 
AK099056TGGATGGGTGGGCNONE 
AK104320TGGATGGGTGGGCNONE 
Os01g0830000012-056-G03GCCCACCCGCGCNONE 
015-092-H05GCCCACCCGCGCNONE 
AK121100GCCCACCCGCGCSimilar to Plastid sufB (Fragment). 
J023069G03GCCCACCCGCGCNONE 
J090047G13GCCCACCCGCGCNONE 
J090059K22GCCCACCCGCGCNONE 
Os01g0830100AK069755GCGCGGGTGGGCPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
J065005C19CGGGTGGGCCCGGCNONE 
J065025H20CGGGTGGGCCCGGCNONE 
J065061E22CGGGTGGGCCCGGCNONE 
J065065F14CGGGTGGGCCCGGCNONE 
J065083O21CGGGTGGGCCCGGCNONE 
J065201G05CGGGTGGGCCCGGCNONE 
Os01g0841000009-005-A12GCCCACCCGNONE 
AK059601GCCCACCCGENTH/VHS domain containing protein. 
AK103342GCCCACCCGNONE 
J023022C02GCCCACCCGNONE 
J023030C09GCCCACCCGNONE 
J033075D24GCCCACCCGNONE 
J033123O16GCCCACCCGNONE 
J033126C16GCCCACCCGNONE 
J065120M23GCCCACCCGNONE 
J065190I23GCCCACCCGNONE 
J090090G01GCCCACCCGNONE 
Os01g0846300AK065949CGGGTGGGCCCCSimilar to Protein phosphatase 2C. 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0858700015-026-G10GGGTGGGCNONE 
015-049-A05GGGTGGGCNONE 
016-076-F02GGGTGGGCNONE 
AK070663GGGTGGGCNONE 
AK119765GGGTGGGCConserved hypothetical protein. 
J023056F20GGGTGGGCNONE 
J023150I15GGGTGGGCNONE 
J033111A07GGGTGGGCNONE 
Os01g0867900AK061366CGGCCCACCCGProtein of unknown function DUF502 family protein. 
Os01g0884400AK072566GCCCACCCU box domain containing protein. 
Os01g0896400AK107067CGTGTGGCCCACCCGConserved hypothetical protein. 
Os01g0914400009-180-F10GGGTGGGCNONE 
AK063138GGGTGGGCConserved hypothetical protein. 
J065039D15GGGTGGGCNONE 
J080084C09GGGTGGGCNONE 
Os01g0952600AK067525ACCGGGCCCACCCNONE 
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment). 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0190950J075001E02GTGGCCCACCCConserved hypothetical protein. 
J075117E23GTGGCCCACCCNONE 
J075117F23GTGGCCCACCCNONE 
J075144M12GTGGCCCACCCNONE 
J075145H10GTGGCCCACCCNONE 
J075186B15GTGGCCCACCCNONE 
Os02g0197600003-113-H08CCCGGGCCCACCCNONE 
003-129-H06CCCGGGCCCACCCNONE 
006-021-H09CCCGGGCCCACCCNONE 
006-022-B05CCCGGGCCCACCCNONE 
006-022-G12CCCGGGCCCACCCNONE 
006-023-A02CCCGGGCCCACCCNONE 
006-023-C02CCCGGGCCCACCCNONE 
006-023-G09CCCGGGCCCACCCNONE 
006-024-D12CCCGGGCCCACCCNONE 
006-025-C09CCCGGGCCCACCCNONE 
006-025-E01CCCGGGCCCACCCNONE 
006-026-A11CCCGGGCCCACCCNONE 
006-026-A12CCCGGGCCCACCCNONE 
006-028-E11CCCGGGCCCACCCNONE 
006-028-G03CCCGGGCCCACCCNONE 
006-029-A09CCCGGGCCCACCCNONE 
006-029-A12CCCGGGCCCACCCNONE 
006-029-D01CCCGGGCCCACCCNONE 
006-029-F12CCCGGGCCCACCCNONE 
006-029-G12CCCGGGCCCACCCNONE 
006-030-A08CCCGGGCCCACCCNONE 
006-030-C09CCCGGGCCCACCCNONE 
006-030-G06CCCGGGCCCACCCNONE 
006-031-D06CCCGGGCCCACCCNONE 
006-032-C01CCCGGGCCCACCCNONE 
006-034-B07CCCGGGCCCACCCNONE 
006-035-G01CCCGGGCCCACCCNONE 
006-036-H12CCCGGGCCCACCCNONE 
006-040-C01CCCGGGCCCACCCNONE 
006-041-G12CCCGGGCCCACCCNONE 
006-041-H02CCCGGGCCCACCCNONE 
006-041-H11CCCGGGCCCACCCNONE 
006-042-B01CCCGGGCCCACCCNONE 
006-042-F10CCCGGGCCCACCCNONE 
006-043-C04CCCGGGCCCACCCNONE 
006-044-D10CCCGGGCCCACCCNONE 
006-048-D11CCCGGGCCCACCCNONE 
006-049-D07CCCGGGCCCACCCNONE 
006-050-H05CCCGGGCCCACCCNONE 
006-051-D10CCCGGGCCCACCCNONE 
006-051-E05CCCGGGCCCACCCNONE 
006-053-C07CCCGGGCCCACCCNONE 
006-054-B10CCCGGGCCCACCCNONE 
006-054-C12CCCGGGCCCACCCNONE 
006-054-G08CCCGGGCCCACCCNONE 
006-055-D12CCCGGGCCCACCCNONE 
006-056-C04CCCGGGCCCACCCNONE 
006-056-H06CCCGGGCCCACCCNONE 
006-057-E07CCCGGGCCCACCCNONE 
006-058-C12CCCGGGCCCACCCNONE 
006-059-B06CCCGGGCCCACCCNONE 
006-059-B09CCCGGGCCCACCCNONE 
006-059-D05CCCGGGCCCACCCNONE 
006-060-D07CCCGGGCCCACCCNONE 
006-061-D01CCCGGGCCCACCCNONE 
006-061-G09CCCGGGCCCACCCNONE 
006-062-A12CCCGGGCCCACCCNONE 
006-062-D04CCCGGGCCCACCCNONE 
006-062-G01CCCGGGCCCACCCNONE 
006-063-C10CCCGGGCCCACCCNONE 
006-064-A10CCCGGGCCCACCCNONE 
006-067-E04CCCGGGCCCACCCNONE 
006-067-H11CCCGGGCCCACCCNONE 
006-069-G08CCCGGGCCCACCCNONE 
006-071-G06CCCGGGCCCACCCNONE 
006-073-E06CCCGGGCCCACCCNONE 
006-074-B12CCCGGGCCCACCCNONE 
006-074-F06CCCGGGCCCACCCNONE 
006-074-H01CCCGGGCCCACCCNONE 
006-076-D12CCCGGGCCCACCCNONE 
006-077-C08CCCGGGCCCACCCNONE 
006-083-H01CCCGGGCCCACCCNONE 
006-083-H09CCCGGGCCCACCCNONE 
006-084-C02CCCGGGCCCACCCNONE 
006-086-D05CCCGGGCCCACCCNONE 
006-086-E09CCCGGGCCCACCCNONE 
006-087-D04CCCGGGCCCACCCNONE 
006-087-E12CCCGGGCCCACCCNONE 
006-088-A01CCCGGGCCCACCCNONE 
006-088-H09CCCGGGCCCACCCNONE 
006-089-G01CCCGGGCCCACCCNONE 
006-090-G01CCCGGGCCCACCCNONE 
006-092-H10CCCGGGCCCACCCNONE 
006-096-G12CCCGGGCCCACCCNONE 
006-097-C04CCCGGGCCCACCCNONE 
006-098-B06CCCGGGCCCACCCNONE 
006-099-A02CCCGGGCCCACCCNONE 
006-099-B05CCCGGGCCCACCCNONE 
006-100-F02CCCGGGCCCACCCNONE 
006-100-F07CCCGGGCCCACCCNONE 
006-104-A01CCCGGGCCCACCCNONE 
006-107-F06CCCGGGCCCACCCNONE 
006-109-A05CCCGGGCCCACCCNONE 
006-110-G03CCCGGGCCCACCCNONE 
006-111-A06CCCGGGCCCACCCNONE 
006-111-C12CCCGGGCCCACCCNONE 
006-112-B03CCCGGGCCCACCCNONE 
006-113-A02CCCGGGCCCACCCNONE 
006-113-H06CCCGGGCCCACCCNONE 
006-115-D11CCCGGGCCCACCCNONE 
006-116-F11CCCGGGCCCACCCNONE 
006-117-A10CCCGGGCCCACCCNONE 
006-117-C01CCCGGGCCCACCCNONE 
006-117-D08CCCGGGCCCACCCNONE 
006-118-B12CCCGGGCCCACCCNONE 
006-118-D08CCCGGGCCCACCCNONE 
006-118-E11CCCGGGCCCACCCNONE 
006-118-H08CCCGGGCCCACCCNONE 
006-119-C10CCCGGGCCCACCCNONE 
006-120-H11CCCGGGCCCACCCNONE 
009-025-G09CCCGGGCCCACCCNONE 
009-061-H06CCCGGGCCCACCCNONE 
009-070-E02CCCGGGCCCACCCNONE 
009-077-A07CCCGGGCCCACCCNONE 
009-114-A07CCCGGGCCCACCCNONE 
009-115-G02CCCGGGCCCACCCNONE 
009-123-C06CCCGGGCCCACCCNONE 
009-125-H03CCCGGGCCCACCCNONE 
009-127-H11CCCGGGCCCACCCNONE 
009-136-G03CCCGGGCCCACCCNONE 
009-154-B05CCCGGGCCCACCCNONE 
009-162-B02CCCGGGCCCACCCNONE 
009-176-D09CCCGGGCCCACCCNONE 
009-178-F10CCCGGGCCCACCCNONE 
009-190-F05CCCGGGCCCACCCNONE 
009-200-C08CCCGGGCCCACCCNONE 
011-064-H10CCCGGGCCCACCCNONE 
AK060143CCCGGGCCCACCCNONE 
AK060970CCCGGGCCCACCCNONE 
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK104096CCCGGGCCCACCCNONE 
AK104215CCCGGGCCCACCCNONE 
AK104348CCCGGGCCCACCCNONE 
AK104385CCCGGGCCCACCCNONE 
AK104392CCCGGGCCCACCCNONE 
AK104446CCCGGGCCCACCCNONE 
AK104458CCCGGGCCCACCCNONE 
AK104469CCCGGGCCCACCCNONE 
AK104522CCCGGGCCCACCCNONE 
AK104535CCCGGGCCCACCCNONE 
AK104557CCCGGGCCCACCCNONE 
AK104636CCCGGGCCCACCCNONE 
AK104646CCCGGGCCCACCCNONE 
AK104734CCCGGGCCCACCCNONE 
AK106085CCCGGGCCCACCCNONE 
AK109398CCCGGGCCCACCCNONE 
AK119554CCCGGGCCCACCCNONE 
J013044I21CCCGGGCCCACCCNONE 
J013090N21CCCGGGCCCACCCNONE 
J013130I24CCCGGGCCCACCCNONE 
J023038D09CCCGGGCCCACCCNONE 
J023064C23CCCGGGCCCACCCNONE 
J023088A09CCCGGGCCCACCCNONE 
J023105K12CCCGGGCCCACCCNONE 
J065022M15CCCGGGCCCACCCNONE 
J075062L23CCCGGGCCCACCCNONE 
J075069B05CCCGGGCCCACCCNONE 
J075072D15CCCGGGCCCACCCNONE 
J075090E24CCCGGGCCCACCCNONE 
J075126D14CCCGGGCCCACCCNONE 
J075154L21CCCGGGCCCACCCNONE 
J075165F23CCCGGGCCCACCCNONE 
J075166D04CCCGGGCCCACCCNONE 
J080003O05CCCGGGCCCACCCNONE 
J080005L07CCCGGGCCCACCCNONE 
J080008K15CCCGGGCCCACCCNONE 
J080009A07CCCGGGCCCACCCNONE 
J080009F05CCCGGGCCCACCCNONE 
J080010M06CCCGGGCCCACCCNONE 
J080011E06CCCGGGCCCACCCNONE 
J080011H20CCCGGGCCCACCCNONE 
J080018I05CCCGGGCCCACCCNONE 
J080021N17CCCGGGCCCACCCNONE 
J080036E20CCCGGGCCCACCCNONE 
J080040E22CCCGGGCCCACCCNONE 
J080044D19CCCGGGCCCACCCNONE 
J080045C21CCCGGGCCCACCCNONE 
J080047B08CCCGGGCCCACCCNONE 
J080048E24CCCGGGCCCACCCNONE 
J080053D19CCCGGGCCCACCCNONE 
J080053N09CCCGGGCCCACCCNONE 
J080054A19CCCGGGCCCACCCNONE 
J080061O16CCCGGGCCCACCCNONE 
J080064P15CCCGGGCCCACCCNONE 
J080065M06CCCGGGCCCACCCNONE 
J080067G11CCCGGGCCCACCCNONE 
J080072M09CCCGGGCCCACCCNONE 
J080079I15CCCGGGCCCACCCNONE 
J080082I12CCCGGGCCCACCCNONE 
J080083K21CCCGGGCCCACCCNONE 
J080096H12CCCGGGCCCACCCNONE 
J080096J10CCCGGGCCCACCCNONE 
J080097O13CCCGGGCCCACCCNONE 
J080305P05CCCGGGCCCACCCNONE 
J080311C21CCCGGGCCCACCCNONE 
J080317C16CCCGGGCCCACCCNONE 
Os02g0252100AF139211AGCCCACCCNONE 
AK062577AGCCCACCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051AGCCCACCCNONE 
J013156E01AGCCCACCCNONE 
J065001D02AGCCCACCCNONE 
J065042A05AGCCCACCCNONE 
J065116H01AGCCCACCCNONE 
J065167P13AGCCCACCCNONE 
J065168N07AGCCCACCCNONE 
J075093G21AGCCCACCCNONE 
J075109H15AGCCCACCCNONE 
J075194P17AGCCCACCCNONE 
Os02g0266800AK070674CGGGTGGGCNONE 
L34551CGGGTGGGCTranscriptional activator protein. 
Os02g0301100006-029-F04GGGTGGGCCCGGCNONE 
012-005-F07GGGTGGGCCCGGCNONE 
013-093-H10GGGTGGGCCCGGCNONE 
015-042-B01GGGTGGGCCCGGCNONE 
016-017-F09GGGTGGGCCCGGCNONE 
016-079-B07GGGTGGGCCCGGCNONE 
016-079-G03GGGTGGGCCCGGCNONE 
016-087-F11GGGTGGGCCCGGCNONE 
AK071676GGGTGGGCCCGGCNONE 
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein. 
AK104411GGGTGGGCCCGGCNONE 
AK104467GGGTGGGCCCGGCNONE 
J023069G02GGGTGGGCCCGGCNONE 
J023108F17GGGTGGGCCCGGCNONE 
J033042B04GGGTGGGCCCGGCNONE 
J033128D06GGGTGGGCCCGGCNONE 
J033138I12GGGTGGGCCCGGCNONE 
J053064K16GGGTGGGCCCGGCNONE 
J065088A12GGGTGGGCCCGGCNONE 
J065102L08GGGTGGGCCCGGCNONE 
J065104L14GGGTGGGCCCGGCNONE 
J065117M20GGGTGGGCCCGGCNONE 
J065117N14GGGTGGGCCCGGCNONE 
J065120H23GGGTGGGCCCGGCNONE 
J065135F06GGGTGGGCCCGGCNONE 
J065138J17GGGTGGGCCCGGCNONE 
J065138P06GGGTGGGCCCGGCNONE 
J065156G16GGGTGGGCCCGGCNONE 
J065163M20GGGTGGGCCCGGCNONE 
J065176A14GGGTGGGCCCGGCNONE 
J065182C02GGGTGGGCCCGGCNONE 
J065200C05GGGTGGGCCCGGCNONE 
J065213J22GGGTGGGCCCGGCNONE 
J065217D24GGGTGGGCCCGGCNONE 
J075009H03GGGTGGGCCCGGCNONE 
J075020D10GGGTGGGCCCGGCNONE 
J075026L24GGGTGGGCCCGGCNONE 
J075028L01GGGTGGGCCCGGCNONE 
J075057O09GGGTGGGCCCGGCNONE 
J075089A20GGGTGGGCCCGGCNONE 
J075094J15GGGTGGGCCCGGCNONE 
J075103B11GGGTGGGCCCGGCNONE 
J075143L13GGGTGGGCCCGGCNONE 
J075153K15GGGTGGGCCCGGCNONE 
J075161P22GGGTGGGCCCGGCNONE 
J075166J06GGGTGGGCCCGGCNONE 
J075177G06GGGTGGGCCCGGCNONE 
J075198N06GGGTGGGCCCGGCNONE 
Os02g0485000016-062-B12GGGTGGGCTNONE 
AK064246GGGTGGGCTTransferase family protein. 
Os02g0498100009-180-H04GGGTGGGCNONE 
AK112058GGGTGGGCConserved hypothetical protein. 
Os02g0517531AK121247GGGTGGGCCGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0530600AK102681GGGTGGGCTACGTGTCGBRCT domain containing protein. 
Os02g0556700AK073875GCCCACCCT-complex 11 family protein. 
Os02g0594700AK111339GGGTGGGCSimilar to Non-phototropic hypocotyl 3. 
J100037B14GGGTGGGCNONE 
J100038E24GGGTGGGCNONE 
Os02g0595800Os02g0595800AAAGCCCACCCSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0651500AK066333CGGGTGGGCTGGGNONE 
AK121865CGGGTGGGCTGGGHypothetical protein. 
J090038J11CGGGTGGGCTGGGNONE 
Os02g0653000AK062922GCCCACCCConserved hypothetical protein. 
Os02g0671100012-049-H09GGGTGGGCNONE 
015-077-A04GGGTGGGCNONE 
AK100120GGGTGGGCNONE 
AK109758GGGTGGGCProtein of unknown function DUF295 family protein. 
J023007K16GGGTGGGCNONE 
J065139P07GGGTGGGCNONE 
J065181I06GGGTGGGCNONE 
J065186I20GGGTGGGCNONE 
J075052H09GGGTGGGCNONE 
J075065J01GGGTGGGCNONE 
J075069J15GGGTGGGCNONE 
J100036N09GGGTGGGCNONE 
J100054J19GGGTGGGCNONE 
J100055A12GGGTGGGCNONE 
J100065P09GGGTGGGCNONE 
J100074E08GGGTGGGCNONE 
J100074N13GGGTGGGCNONE 
J100087G18GGGTGGGCNONE 
Os02g0671200J065152N20GCCCACCCCGCGACGCNONE 
J075053E22GCCCACCCCGCGACGCConserved hypothetical protein. 
Os02g0744700AF395537ATGGCCCACCCNONE 
AJ308110ATGGCCCACCCNONE 
AK066446ATGGCCCACCCSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE 
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE 
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE 
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE 
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE 
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE 
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE 
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE 
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE 
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE 
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE 
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE 
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE 
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE 
Os02g0768600006-034-F01GGGTGGGCCCACCTGNONE 
006-046-G07GGGTGGGCCCACCTGNONE 
006-054-C07GGGTGGGCCCACCTGNONE 
006-056-F07GGGTGGGCCCACCTGNONE 
006-100-C02GGGTGGGCCCACCTGNONE 
AK059725GGGTGGGCCCACCTGNONE 
AK098996GGGTGGGCCCACCTGNONE 
AK099120GGGTGGGCCCACCTGNONE 
AK104659GGGTGGGCCCACCTGNONE 
J065043H04GGGTGGGCCCACCTGNONE 
J075034N21GGGTGGGCCCACCTGNONE 
J075145C18GGGTGGGCCCACCTGNONE 
J080016H01GGGTGGGCCCACCTGNONE 
J080040F01GGGTGGGCCCACCTGNONE 
J080047L23GGGTGGGCCCACCTGNONE 
J080049B22GGGTGGGCCCACCTGNONE 
J080062J16GGGTGGGCCCACCTGNONE 
J080064C23GGGTGGGCCCACCTGNONE 
J080064L22GGGTGGGCCCACCTGNONE 
J080077N01GGGTGGGCCCACCTGNONE 
J080097G17GGGTGGGCCCACCTGNONE 
J100065L15GGGTGGGCCCACCTGNONE 
J100066K23GGGTGGGCCCACCTGNONE 
J100088C07GGGTGGGCCCACCTGNONE 
J100090H09GGGTGGGCCCACCTGNONE 
Os02g0776800AB042415AGATGGGCCGGCCCACCCGNONE 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK101212AGATGGGCCGGCCCACCCGNONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
Os02g0814700AK121994GCCCACCC60S ribosomal protein L17 [Oryza sativa (japonica cultivar-group)]. 
J023140L16GCCCACCCNONE 
J033085M14GCCCACCCNONE 
J033093H05GCCCACCCNONE 
J033108E24GCCCACCCNONE 
J033109P19GCCCACCCNONE 
J033143G22GCCCACCCNONE 
J043026N13GCCCACCCNONE 
J065035E13GCCCACCCNONE 
J065037M11GCCCACCCNONE 
J065050L17GCCCACCCNONE 
J065076C05GCCCACCCNONE 
J065128C21GCCCACCCNONE 
J065169O10GCCCACCCNONE 
J065170P10GCCCACCCNONE 
J075079G10GCCCACCCNONE 
J075172K22GCCCACCCNONE 
J090005E03GCCCACCCNONE 
J090005H14GCCCACCCNONE 
J090011G20GCCCACCCNONE 
J090031D14GCCCACCCNONE 
J090063K12GCCCACCCNONE 
J090065N01GCCCACCCNONE 
J090079B08GCCCACCCNONE 
J090079G17GCCCACCCNONE 
J100028I22GCCCACCCNONE 
J100030E19GCCCACCCNONE 
J100042B15GCCCACCCNONE 
J100051E12GCCCACCCNONE 
J100069O12GCCCACCCNONE 
J100073K08GCCCACCCNONE 
J100075O03GCCCACCCNONE 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
J013047E20CGGGTGGGCCCCAGNONE 
J065026F21CGGGTGGGCCCCAGNONE 
J065047B03CGGGTGGGCCCCAGNONE 
J065054J12CGGGTGGGCCCCAGNONE 
J065079M24CGGGTGGGCCCCAGNONE 
J065093M07CGGGTGGGCCCCAGNONE 
J065153F02CGGGTGGGCCCCAGNONE 
J065155E21CGGGTGGGCCCCAGNONE 
J065179H15CGGGTGGGCCCCAGNONE 
J075019N02CGGGTGGGCCCCAGNONE 
J075089E01CGGGTGGGCCCCAGNONE 
J090066I18CGGGTGGGCCCCAGNONE 
J090087K20CGGGTGGGCCCCAGNONE 
J100079F05CGGGTGGGCCCCAGNONE 
Os03g0123300003-131-G09GCCCACCCNONE 
AK058595GCCCACCCNONE 
J075056B01GCCCACCCNONE 
Os03g0130500AK058465GGGTGGGCTNONE 
Os03g0131300015-095-G06GGTCCACGTGGGGGCCCACCCNONE 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
J033140O12GGTCCACGTGGGGGCCCACCCNONE 
J065112C14GGTCCACGTGGGGGCCCACCCNONE 
J090070D10GGTCCACGTGGGGGCCCACCCNONE 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGGGTGGGCCCACACGNONE 
Os03g0156500011-075-F02CGCGGGGGGGTGGGCCCCACACNONE 
012-077-G10CGCGGGGGGGTGGGCCCCACACNONE 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
J013088H17CGCGGGGGGGTGGGCCCCACACNONE 
J013135G21CGCGGGGGGGTGGGCCCCACACNONE 
J033050E10CGCGGGGGGGTGGGCCCCACACNONE 
J033050J01CGCGGGGGGGTGGGCCCCACACNONE 
J033129N23CGCGGGGGGGTGGGCCCCACACNONE 
J065085L16CGCGGGGGGGTGGGCCCCACACNONE 
J065101B19CGCGGGGGGGTGGGCCCCACACNONE 
J065167N03CGCGGGGGGGTGGGCCCCACACNONE 
J090009O21CGCGGGGGGGTGGGCCCCACACNONE 
J090049D11CGCGGGGGGGTGGGCCCCACACNONE 
J100017F23CGCGGGGGGGTGGGCCCCACACNONE 
J100040E12CGCGGGGGGGTGGGCCCCACACNONE 
J100055O18CGCGGGGGGGTGGGCCCCACACNONE 
J100061K08CGCGGGGGGGTGGGCCCCACACNONE 
J100072M05CGCGGGGGGGTGGGCCCCACACNONE 
J100077B08CGCGGGGGGGTGGGCCCCACACNONE 
J100086G03CGCGGGGGGGTGGGCCCCACACNONE 
Os03g0169500Os03g0169500GGGTGGGCSimilar to Cellulose synthase-like A4. 
Os03g0181100AK067971GCCCACCCNONE 
AK120087GCCCACCCZIM domain containing protein. 
J013123K19GCCCACCCNONE 
J100077H14GCCCACCCNONE 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0206400AK066494GCCCACCCConserved hypothetical protein. 
AK066494GGGTGGGCCCGCConserved hypothetical protein. 
AK107011GCCCACCCNONE 
AK107011GGGTGGGCCCGCNONE 
J065162G04GCCCACCCNONE 
J065162G04GGGTGGGCCCGCNONE 
Os03g0248600AK073611CGGGTGGGCCCTSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CGGGTGGGCCCTNONE 
AK104877CGGGTGGGCCCTNONE 
J013026L10CGGGTGGGCCCTNONE 
J013055P12CGGGTGGGCCCTNONE 
J023091A14CGGGTGGGCCCTNONE 
J033034G07CGGGTGGGCCCTNONE 
J033048H19CGGGTGGGCCCTNONE 
J033128D07CGGGTGGGCCCTNONE 
J065060L24CGGGTGGGCCCTNONE 
J065176A19CGGGTGGGCCCTNONE 
J090018K08CGGGTGGGCCCTNONE 
J090023C03CGGGTGGGCCCTNONE 
Os03g0254700AK112052GCCCACCCNONE 
Os03g0255900009-164-C12GGGTGGGCNONE 
AK063057GGGTGGGCConserved hypothetical protein. 
Os03g0266900013-080-C12TATGGGCTACAGCCCACCCNONE 
014-010-A09TATGGGCTACAGCCCACCCNONE 
014-013-G10TATGGGCTACAGCCCACCCNONE 
014-019-D06TATGGGCTACAGCCCACCCNONE 
014-030-F08TATGGGCTACAGCCCACCCNONE 
014-039-C05TATGGGCTACAGCCCACCCNONE 
014-053-H08TATGGGCTACAGCCCACCCNONE 
014-089-F06TATGGGCTACAGCCCACCCNONE 
014-094-A05TATGGGCTACAGCCCACCCNONE 
014-098-C12TATGGGCTACAGCCCACCCNONE 
AK119243TATGGGCTACAGCCCACCCLow molecular mass heat shock protein Oshsp17.3. 
AK119717TATGGGCTACAGCCCACCCNONE 
D12635TATGGGCTACAGCCCACCCNONE 
M80186TATGGGCTACAGCCCACCCNONE 
Os03g0271500AK068546GCGGGCCCACCCACCGCACGCGNONE 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
J013157P04GCGGGCCCACCCACCGCACGCGNONE 
J075041K23GCGGGCCCACCCACCGCACGCGNONE 
Os03g0275500AK065232GCCCACCCGEpsin, N-terminal domain containing protein. 
J013002H14GCCCACCCGNONE 
J013047G17GCCCACCCGNONE 
J013050M23GCCCACCCGNONE 
J013066D16GCCCACCCGNONE 
J013088C16GCCCACCCGNONE 
J023026P14GCCCACCCGNONE 
J023031E04GCCCACCCGNONE 
J023045C06GCCCACCCGNONE 
J023086K13GCCCACCCGNONE 
J023119G16GCCCACCCGNONE 
J033079G11GCCCACCCGNONE 
J033090O21GCCCACCCGNONE 
J033103H08GCCCACCCGNONE 
J033103M23GCCCACCCGNONE 
J033106J17GCCCACCCGNONE 
J033141M15GCCCACCCGNONE 
J090029G22GCCCACCCGNONE 
J090032O20GCCCACCCGNONE 
J090034P11GCCCACCCGNONE 
J090087D18GCCCACCCGNONE 
J100078E18GCCCACCCGNONE 
J100081C12GCCCACCCGNONE 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0320800AK103265GGGTGGGCNONE 
Os03g0327800J023133J12GGGGCCCACCCCCGCGNONE 
J065118C24GGGGCCCACCCCCGCGNONE 
J065136O13GGGGCCCACCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
J065184M03GGGGCCCACCCCCGCGNONE 
J075105K14GGGGCCCACCCCCGCGNONE 
J075115E14GGGGCCCACCCCCGCGNONE 
J075166M18GGGGCCCACCCCCGCGNONE 
J075178F01GGGGCCCACCCCCGCGNONE 
J090008O14GGGGCCCACCCCCGCGNONE 
J090075F12GGGGCCCACCCCCGCGNONE 
J100019F12GGGGCCCACCCCCGCGNONE 
J100074P18GGGGCCCACCCCCGCGNONE 
J100075D15GGGGCCCACCCCCGCGNONE 
Os03g0335300AK098846GGTGGGGCCCACCCNONE 
AK098891GGTGGGGCCCACCCNONE 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847GGTGGGGCCCACCCNONE 
AK121413GGTGGGGCCCACCCNONE 
Os03g0363500AK062124GCCCACCCNONE 
AK066510GCCCACCCNONE 
J013068L16GCCCACCCNONE 
Os03g0413000009-180-E02CGGGCCCACCCNONE 
009-188-B06CGGGCCCACCCNONE 
AK060225CGGGCCCACCCNONE 
AY062181CGGGCCCACCCSimilar to Potential histone-like transcription factor. 
Os03g0439700AK065720GCCCACCCGProtein of unknown function DUF1230 family protein. 
J013041G12GCCCACCCGNONE 
J065030N09GCCCACCCGNONE 
J065084A03GCCCACCCGNONE 
J065167B14GCCCACCCGNONE 
J100025F06GCCCACCCGNONE 
J100032J16GCCCACCCGNONE 
J100040L01GCCCACCCGNONE 
J100074M13GCCCACCCGNONE 
Os03g0445700AK071624GCCCACCCSimilar to LOB domain protein 39. 
J023106M18GCCCACCCNONE 
J065178J05GCCCACCCNONE 
J065196F10GCCCACCCNONE 
Os03g0583800AK064786GCCCACCCCATCCAMpv17/PMP22 family protein. 
AK099233GCCCACCCCATCCANONE 
J013000B17GCCCACCCCATCCANONE 
J013071N13GCCCACCCCATCCANONE 
J013095M11GCCCACCCCATCCANONE 
J080068F05GCCCACCCCATCCANONE 
J080069C02GCCCACCCCATCCANONE 
J080072E22GCCCACCCCATCCANONE 
J100052H10GCCCACCCCATCCANONE 
J100053H09GCCCACCCCATCCANONE 
J100056G03GCCCACCCCATCCANONE 
Os03g0626800015-067-B09GGGTGGGCTGTTCGTGGGCCTCNONE 
AK111916GGGTGGGCTGTTCGTGGGCCTCNONE 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
J075016C21GGGTGGGCTGTTCGTGGGCCTCNONE 
Os03g0633800AK073044GCCCACCCSimilar to IAA6 (Fragment). 
AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GCCCACCCNONE 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GCCCACCCNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0684400AK100086GCAGCCCACCCMg2+ transporter protein, CorA-like family protein. 
Os03g0687800AK106820GCCCACCCConserved hypothetical protein. 
Os03g0701000J075172J23CCCGGGCCCACCCGNONE 
Os03g0719300AK119254GCCCACCCSimilar to Dihydroxyacetone/glycerone kinase-like protein. 
J043001K12GCCCACCCNONE 
J065209H21GCCCACCCNONE 
Os03g0752800AB041020ATGGCCCACCCNONE 
AF058697ATGGCCCACCCMADS14 protein. 
AF139664ATGGCCCACCCNONE 
AK121171ATGGCCCACCCNONE 
AY332478ATGGCCCACCCNONE 
AY551916ATGGCCCACCCNONE 
J023081C04ATGGCCCACCCNONE 
Os03g0758800AJ252135GCCGTTGGGTGGGCCCCACGTNONE 
AJ312906GCCGTTGGGTGGGCCCCACGTNONE 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GCCGTTGGGTGGGCCCCACGTNONE 
J023109G09GCCGTTGGGTGGGCCCCACGTNONE 
J033038B14GCCGTTGGGTGGGCCCCACGTNONE 
J043013C09GCCGTTGGGTGGGCCCCACGTNONE 
J053096E21GCCGTTGGGTGGGCCCCACGTNONE 
J065026B08GCCGTTGGGTGGGCCCCACGTNONE 
J065062B16GCCGTTGGGTGGGCCCCACGTNONE 
J065066E03GCCGTTGGGTGGGCCCCACGTNONE 
J065091J12GCCGTTGGGTGGGCCCCACGTNONE 
J065164A06GCCGTTGGGTGGGCCCCACGTNONE 
J075014I20GCCGTTGGGTGGGCCCCACGTNONE 
J075117N07GCCGTTGGGTGGGCCCCACGTNONE 
J075142M03GCCGTTGGGTGGGCCCCACGTNONE 
J075175D04GCCGTTGGGTGGGCCCCACGTNONE 
J075188M01GCCGTTGGGTGGGCCCCACGTNONE 
J075199I20GCCGTTGGGTGGGCCCCACGTNONE 
J090010J12GCCGTTGGGTGGGCCCCACGTNONE 
J090025O16GCCGTTGGGTGGGCCCCACGTNONE 
J090041H05GCCGTTGGGTGGGCCCCACGTNONE 
J090078P07GCCGTTGGGTGGGCCCCACGTNONE 
J100031K10GCCGTTGGGTGGGCCCCACGTNONE 
J100055F23GCCGTTGGGTGGGCCCCACGTNONE 
J100064G05GCCGTTGGGTGGGCCCCACGTNONE 
J100080C24GCCGTTGGGTGGGCCCCACGTNONE 
J100080O07GCCGTTGGGTGGGCCCCACGTNONE 
J100090F01GCCGTTGGGTGGGCCCCACGTNONE 
Os03g0764200Os03g0764200GGGTGGGCGCACCGCNONE 
Os03g0764600AK105625GCCCACCCHomeodomain-like containing protein. 
Os03g0801500AK122059GCCCACCCConserved hypothetical protein. 
J033115B08GCCCACCCNONE 
J075092K04GCCCACCCNONE 
J090005N01GCCCACCCNONE 
Os03g0802200009-047-D08GCCCACCCNONE 
013-057-D02GCCCACCCNONE 
013-089-F02GCCCACCCNONE 
014-079-D02GCCCACCCNONE 
016-004-A11GCCCACCCNONE 
AK111769GCCCACCCConserved hypothetical protein. 
J075006H18GCCCACCCNONE 
J075060G07GCCCACCCNONE 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0836200009-165-F07GGGTGGGCCCCACCTGNONE 
015-092-G01GGGTGGGCCCCACCTGNONE 
AK058443GGGTGGGCCCCACCTGNONE 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
AK101225GGGTGGGCCCCACCTGNONE 
J013092A03GGGTGGGCCCCACCTGNONE 
J013095N17GGGTGGGCCCCACCTGNONE 
J013147J18GGGTGGGCCCCACCTGNONE 
J023019O10GGGTGGGCCCCACCTGNONE 
J023065N18GGGTGGGCCCCACCTGNONE 
J033113E18GGGTGGGCCCCACCTGNONE 
J033133E03GGGTGGGCCCCACCTGNONE 
J065059J15GGGTGGGCCCCACCTGNONE 
J065075O11GGGTGGGCCCCACCTGNONE 
J065119I07GGGTGGGCCCCACCTGNONE 
J065171J03GGGTGGGCCCCACCTGNONE 
J090016D21GGGTGGGCCCCACCTGNONE 
J090081O03GGGTGGGCCCCACCTGNONE 
J100040G18GGGTGGGCCCCACCTGNONE 
J100040L10GGGTGGGCCCCACCTGNONE 
J100055H13GGGTGGGCCCCACCTGNONE 
J100059I22GGGTGGGCCCCACCTGNONE 
J100078A08GGGTGGGCCCCACCTGNONE 
Os04g0303950J065204E07GGGTGGGCCGAANONE 
J075044A07GGGTGGGCCGAANONE 
Os04g0343900AK107841TAAGCCCACCCConserved hypothetical protein. 
Os04g0352200AK103395GCCCACCCConserved hypothetical protein. 
J033127M23GCCCACCCNONE 
Os04g0387600009-148-E01ATGGCCCACCCGNONE 
009-155-A11ATGGCCCACCCGNONE 
009-175-F04ATGGCCCACCCGNONE 
AK063862ATGGCCCACCCGConserved hypothetical protein. 
J065035F12ATGGCCCACCCGNONE 
J065162C13ATGGCCCACCCGNONE 
J065169L19ATGGCCCACCCGNONE 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
Os04g0464200AK103582GCCCACCCBetaine-aldehyde dehydrogenase (EC 1.2.1.8) (BADH). 
J033133A13GCCCACCCNONE 
J090026I06GCCCACCCNONE 
J090096B12GCCCACCCNONE 
Os04g0475500Os04g0475500CTGGCCCACCCConserved hypothetical protein. 
Os04g0502900AK059306GAGGCCCACCCGEF-Hand type domain containing protein. 
AK099122GAGGCCCACCCGNONE 
Os04g0509800AK072717GCGCGGGTGGGCConserved hypothetical protein. 
Os04g0528100009-090-G06TACGGCCCACCCNONE 
009-168-C11TACGGCCCACCCNONE 
AK065957TACGGCCCACCCConserved hypothetical protein. 
J013039G20TACGGCCCACCCNONE 
J013044D08TACGGCCCACCCNONE 
J065013L14TACGGCCCACCCNONE 
J065143H08TACGGCCCACCCNONE 
J065146C14TACGGCCCACCCNONE 
J065149K22TACGGCCCACCCNONE 
J065156B18TACGGCCCACCCNONE 
J065201A04TACGGCCCACCCNONE 
J065209A04TACGGCCCACCCNONE 
Os04g0649600009-019-A10GCCCAGTTGCCCACCCGCGCNONE 
009-059-G07GCCCAGTTGCCCACCCGCGCNONE 
009-068-D06GCCCAGTTGCCCACCCGCGCNONE 
AK105164GCCCAGTTGCCCACCCGCGCConserved hypothetical protein. 
J100056J15GCCCAGTTGCCCACCCGCGCNONE 
Os04g0653100014-075-B07GGGGCCCACCCNONE 
016-077-E05GGGGCCCACCCNONE 
AK067094GGGGCCCACCCProtein of unknown function UPF0136, Transmembrane family protein. 
AK111420GGGGCCCACCCNONE 
J013098P05GGGGCCCACCCNONE 
J075001K22GGGGCCCACCCNONE 
J075198O04GGGGCCCACCCNONE 
Os04g0665400015-079-G11GGGTGGGCNONE 
AF383876GGGTGGGCSimilar to FtsZ1. 
AK073455GGGTGGGCNONE 
AK103448GGGTGGGCNONE 
AK105869GGGTGGGCNONE 
J090047H14GGGTGGGCNONE 
J090060F08GGGTGGGCNONE 
Os04g0683900004-009-A11GCCCACCCAGCCCATCCNONE 
014-076-H12GCCCACCCAGCCCATCCNONE 
AK060880GCCCACCCAGCCCATCCNONE 
AK099749GCCCACCCAGCCCATCCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GCCCACCCAGCCCATCCNONE 
J013050K21GCCCACCCAGCCCATCCNONE 
J013092E09GCCCACCCAGCCCATCCNONE 
J013095N06GCCCACCCAGCCCATCCNONE 
J013095P07GCCCACCCAGCCCATCCNONE 
J013130D22GCCCACCCAGCCCATCCNONE 
J013134O15GCCCACCCAGCCCATCCNONE 
J023022I06GCCCACCCAGCCCATCCNONE 
J023062L11GCCCACCCAGCCCATCCNONE 
J023078J11GCCCACCCAGCCCATCCNONE 
J023086J01GCCCACCCAGCCCATCCNONE 
J033125A20GCCCACCCAGCCCATCCNONE 
J065023K13GCCCACCCAGCCCATCCNONE 
J065045N02GCCCACCCAGCCCATCCNONE 
J065129F01GCCCACCCAGCCCATCCNONE 
J065164H14GCCCACCCAGCCCATCCNONE 
J065192H09GCCCACCCAGCCCATCCNONE 
J075064P15GCCCACCCAGCCCATCCNONE 
J075088G17GCCCACCCAGCCCATCCNONE 
J075199D20GCCCACCCAGCCCATCCNONE 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os05g0102500009-183-E08GGGGCCCACCCNONE 
AK063894GGGGCCCACCCNONE 
AK073341GGGGCCCACCCConserved hypothetical protein. 
J023022C11GGGGCCCACCCNONE 
J065095B14GGGGCCCACCCNONE 
J065130O12GGGGCCCACCCNONE 
J065142P07GGGGCCCACCCNONE 
J065155L18GGGGCCCACCCNONE 
Os05g0111200009-033-A06CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
J065006E13CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075001D12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075005J18CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075009L08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075012M21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075019K17CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075020D07CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075041D11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075051C03CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075060C05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075079N09CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075094B04CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075108E08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075115G05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075147L21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075161G12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168J11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168L11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075174F22CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
J033091I05GTTTGGGCCTAGGCCCACCCGNONE 
Os05g0148600003-016-C11CGGGTGGGCCCCACACACACCNONE 
AK066168CGGGTGGGCCCCACACACACCNONE 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
AY360145CGGGTGGGCCCCACACACACCNONE 
J013055J22CGGGTGGGCCCCACACACACCNONE 
J013057M24CGGGTGGGCCCCACACACACCNONE 
J013074N03CGGGTGGGCCCCACACACACCNONE 
J013158A22CGGGTGGGCCCCACACACACCNONE 
J075118H09CGGGTGGGCCCCACACACACCNONE 
Os05g0164100AF456329CGGGTGGGGCCCACCCGNONE 
AK065086CGGGTGGGGCCCACCCGNONE 
AK072243CGGGTGGGGCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CGGGTGGGGCCCACCCGNONE 
J013132O12CGGGTGGGGCCCACCCGNONE 
J023003N09CGGGTGGGGCCCACCCGNONE 
Os05g0176100AF030052CCCGGGCCCACCCNONE 
AK067850CCCGGGCCCACCCNONE 
AK067967CCCGGGCCCACCCNONE 
AK098978CCCGGGCCCACCCNONE 
AK099228CCCGGGCCCACCCNONE 
AK099281CCCGGGCCCACCCNONE 
AK100188CCCGGGCCCACCCSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140CCCGGGCCCACCCNONE 
Os05g0207700AK102665TGCGGGCCCACCCCCACTCCNONE 
AK103861TGCGGGCCCACCCCCACTCCSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os05g0213500003-114-G10GGGTGGGCCCCACCACNONE 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
J013002L23GGGTGGGCCCCACCACNONE 
J023056H04GGGTGGGCCCCACCACNONE 
J075051G09GGGTGGGCCCCACCACNONE 
J075139N23GGGTGGGCCCCACCACNONE 
J100031B01GGGTGGGCCCCACCACNONE 
J100075M20GGGTGGGCCCCACCACNONE 
Os05g0325400AK111393AGCCCACCCNONE 
Os05g0350500013-071-D05GTGGCCCACCCNONE 
AF020787GTGGCCCACCCNONE 
AK061712GTGGCCCACCCNONE 
AK102897GTGGCCCACCCProliferation-associated protein 1 family protein. 
J033060G23GTGGCCCACCCNONE 
J033112P14GTGGCCCACCCNONE 
J033127J04GTGGCCCACCCNONE 
J090015L18GTGGCCCACCCNONE 
J090047K03GTGGCCCACCCNONE 
J090097J17GTGGCCCACCCNONE 
Os05g0354400AK065144CAGGTGGGCCCACCCProtein of unknown function DUF231, plant domain containing protein. 
Os05g0357850J065118C17GCCCACCCHypothetical protein. 
J065159C03GCCCACCCNONE 
Os05g0391500AK119412GCCCACCCSimilar to Endo-beta-mannosidase. 
Os05g0395300AK066212GTGGCCCACCCProtein of unknown function DUF21 domain containing protein. 
Os05g0408200AK100057GCGGGCCCACCCGSBP domain containing protein. 
J065182F20GCGGGCCCACCCGNONE 
Os05g0420200AK067880GCCCACCCACCAACProtein of unknown function DUF179 family protein. 
Os05g0438500006-102-F01GCGGCCCACCCNONE 
AK059951GCGGCCCACCCSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
Os05g0493800AK110589CTGGCCCACCCSimilar to MtN21 nodulin protein-like. 
Os05g0495100AK108028TCAGCCCACCCConserved hypothetical protein. 
Os05g0524500AK073571TAGGCCCACCCGProtein kinase-like domain containing protein. 
Os05g0566800AK065748GCCCACCCGCold acclimation protein COR413-TM1. 
AY181210GCCCACCCGNONE 
Os05g0567500AK073046CGGGTGGGCCCACGCGNONE 
AK121133CGGGTGGGCCCACGCGDNA glycosylase family protein. 
J023075P20CGGGTGGGCCCACGCGNONE 
Os05g0585900AK062575CGGGCCCACCCGMitochondrial substrate carrier family protein. 
AK098854CGGGCCCACCCGNONE 
J013000H16CGGGCCCACCCGNONE 
J033118D07CGGGCCCACCCGNONE 
Os06g0101600AF093636GGGTGGGCNONE 
AF093636GTGTGGGGGTGGGCCCACCTNONE 
AK070447GGGTGGGCPlastocyanin, chloroplast precursor. 
AK070447GTGTGGGGGTGGGCCCACCTPlastocyanin, chloroplast precursor. 
J065001A20GGGTGGGCNONE 
J065001A20GTGTGGGGGTGGGCCCACCTNONE 
J065019M17GGGTGGGCNONE 
J065019M17GTGTGGGGGTGGGCCCACCTNONE 
J065021H18GGGTGGGCNONE 
J065021H18GTGTGGGGGTGGGCCCACCTNONE 
J065061A17GGGTGGGCNONE 
J065061A17GTGTGGGGGTGGGCCCACCTNONE 
J065073L02GGGTGGGCNONE 
J065073L02GTGTGGGGGTGGGCCCACCTNONE 
J065099F17GGGTGGGCNONE 
J065099F17GTGTGGGGGTGGGCCCACCTNONE 
J065101C23GGGTGGGCNONE 
J065101C23GTGTGGGGGTGGGCCCACCTNONE 
J065121E23GGGTGGGCNONE 
J065121E23GTGTGGGGGTGGGCCCACCTNONE 
J065122N04GGGTGGGCNONE 
J065122N04GTGTGGGGGTGGGCCCACCTNONE 
J065141N05GGGTGGGCNONE 
J065141N05GTGTGGGGGTGGGCCCACCTNONE 
J065143N21GGGTGGGCNONE 
J065143N21GTGTGGGGGTGGGCCCACCTNONE 
J065161H09GGGTGGGCNONE 
J065161H09GTGTGGGGGTGGGCCCACCTNONE 
J065161J04GGGTGGGCNONE 
J065161J04GTGTGGGGGTGGGCCCACCTNONE 
J065162P20GGGTGGGCNONE 
J065162P20GTGTGGGGGTGGGCCCACCTNONE 
J065182K10GGGTGGGCNONE 
J065182K10GTGTGGGGGTGGGCCCACCTNONE 
J065184M05GGGTGGGCNONE 
J065184M05GTGTGGGGGTGGGCCCACCTNONE 
J065186H24GGGTGGGCNONE 
J065186H24GTGTGGGGGTGGGCCCACCTNONE 
J065189G21GGGTGGGCNONE 
J065189G21GTGTGGGGGTGGGCCCACCTNONE 
J065190N14GGGTGGGCNONE 
J065190N14GTGTGGGGGTGGGCCCACCTNONE 
J065191H08GGGTGGGCNONE 
J065191H08GTGTGGGGGTGGGCCCACCTNONE 
J065205H17GGGTGGGCNONE 
J065205H17GTGTGGGGGTGGGCCCACCTNONE 
J075001E03GGGTGGGCNONE 
J075001E03GTGTGGGGGTGGGCCCACCTNONE 
J075001H21GGGTGGGCNONE 
J075001H21GTGTGGGGGTGGGCCCACCTNONE 
J075003J23GGGTGGGCNONE 
J075003J23GTGTGGGGGTGGGCCCACCTNONE 
J075003K01GGGTGGGCNONE 
J075003K01GTGTGGGGGTGGGCCCACCTNONE 
J075005I11GGGTGGGCNONE 
J075005I11GTGTGGGGGTGGGCCCACCTNONE 
J075007F16GGGTGGGCNONE 
J075007F16GTGTGGGGGTGGGCCCACCTNONE 
J075017I11GGGTGGGCNONE 
J075017I11GTGTGGGGGTGGGCCCACCTNONE 
J075018O05GGGTGGGCNONE 
J075018O05GTGTGGGGGTGGGCCCACCTNONE 
J075019G24GGGTGGGCNONE 
J075019G24GTGTGGGGGTGGGCCCACCTNONE 
J075032D04GGGTGGGCNONE 
J075032D04GTGTGGGGGTGGGCCCACCTNONE 
J075032N13GGGTGGGCNONE 
J075032N13GTGTGGGGGTGGGCCCACCTNONE 
J075033C09GGGTGGGCNONE 
J075033C09GTGTGGGGGTGGGCCCACCTNONE 
J075033D11GGGTGGGCNONE 
J075033D11GTGTGGGGGTGGGCCCACCTNONE 
J075039A20GGGTGGGCNONE 
J075039A20GTGTGGGGGTGGGCCCACCTNONE 
J075058P12GGGTGGGCNONE 
J075058P12GTGTGGGGGTGGGCCCACCTNONE 
J075062E10GGGTGGGCNONE 
J075062E10GTGTGGGGGTGGGCCCACCTNONE 
J075062P16GGGTGGGCNONE 
J075062P16GTGTGGGGGTGGGCCCACCTNONE 
J075063C17GGGTGGGCNONE 
J075063C17GTGTGGGGGTGGGCCCACCTNONE 
J075066E07GGGTGGGCNONE 
J075066E07GTGTGGGGGTGGGCCCACCTNONE 
J075066I20GGGTGGGCNONE 
J075066I20GTGTGGGGGTGGGCCCACCTNONE 
J075075K21GGGTGGGCNONE 
J075075K21GTGTGGGGGTGGGCCCACCTNONE 
J075078F03GGGTGGGCNONE 
J075078F03GTGTGGGGGTGGGCCCACCTNONE 
J075082F10GGGTGGGCNONE 
J075082F10GTGTGGGGGTGGGCCCACCTNONE 
J075086G16GGGTGGGCNONE 
J075086G16GTGTGGGGGTGGGCCCACCTNONE 
J075087E07GGGTGGGCNONE 
J075087E07GTGTGGGGGTGGGCCCACCTNONE 
J075087K06GGGTGGGCNONE 
J075087K06GTGTGGGGGTGGGCCCACCTNONE 
J075087L04GGGTGGGCNONE 
J075087L04GTGTGGGGGTGGGCCCACCTNONE 
J075088B16GGGTGGGCNONE 
J075088B16GTGTGGGGGTGGGCCCACCTNONE 
J075088D02GGGTGGGCNONE 
J075088D02GTGTGGGGGTGGGCCCACCTNONE 
J075094H21GGGTGGGCNONE 
J075094H21GTGTGGGGGTGGGCCCACCTNONE 
J075094I24GGGTGGGCNONE 
J075094I24GTGTGGGGGTGGGCCCACCTNONE 
J075094K10GGGTGGGCNONE 
J075094K10GTGTGGGGGTGGGCCCACCTNONE 
J075095C18GGGTGGGCNONE 
J075095C18GTGTGGGGGTGGGCCCACCTNONE 
J075097B05GGGTGGGCNONE 
J075097B05GTGTGGGGGTGGGCCCACCTNONE 
J075099C13GGGTGGGCNONE 
J075099C13GTGTGGGGGTGGGCCCACCTNONE 
J075099H22GGGTGGGCNONE 
J075099H22GTGTGGGGGTGGGCCCACCTNONE 
J075099L16GGGTGGGCNONE 
J075099L16GTGTGGGGGTGGGCCCACCTNONE 
J075104K08GGGTGGGCNONE 
J075104K08GTGTGGGGGTGGGCCCACCTNONE 
J075118O06GGGTGGGCNONE 
J075118O06GTGTGGGGGTGGGCCCACCTNONE 
J075119E15GGGTGGGCNONE 
J075119E15GTGTGGGGGTGGGCCCACCTNONE 
J075124N06GGGTGGGCNONE 
J075124N06GTGTGGGGGTGGGCCCACCTNONE 
J075126G02GGGTGGGCNONE 
J075126G02GTGTGGGGGTGGGCCCACCTNONE 
J075127L24GGGTGGGCNONE 
J075127L24GTGTGGGGGTGGGCCCACCTNONE 
J075131E23GGGTGGGCNONE 
J075131E23GTGTGGGGGTGGGCCCACCTNONE 
J075140H06GGGTGGGCNONE 
J075140H06GTGTGGGGGTGGGCCCACCTNONE 
J075146I20GGGTGGGCNONE 
J075146I20GTGTGGGGGTGGGCCCACCTNONE 
J075146N24GGGTGGGCNONE 
J075146N24GTGTGGGGGTGGGCCCACCTNONE 
J075147I19GGGTGGGCNONE 
J075147I19GTGTGGGGGTGGGCCCACCTNONE 
J075155K07GGGTGGGCNONE 
J075155K07GTGTGGGGGTGGGCCCACCTNONE 
J075156C05GGGTGGGCNONE 
J075156C05GTGTGGGGGTGGGCCCACCTNONE 
J075161G07GGGTGGGCNONE 
J075161G07GTGTGGGGGTGGGCCCACCTNONE 
J075164G01GGGTGGGCNONE 
J075164G01GTGTGGGGGTGGGCCCACCTNONE 
J075170J18GGGTGGGCNONE 
J075170J18GTGTGGGGGTGGGCCCACCTNONE 
J075172G17GGGTGGGCNONE 
J075172G17GTGTGGGGGTGGGCCCACCTNONE 
J075176G10GGGTGGGCNONE 
J075176G10GTGTGGGGGTGGGCCCACCTNONE 
J075178C05GGGTGGGCNONE 
J075178C05GTGTGGGGGTGGGCCCACCTNONE 
J075179G01GGGTGGGCNONE 
J075179G01GTGTGGGGGTGGGCCCACCTNONE 
J075181E24GGGTGGGCNONE 
J075181E24GTGTGGGGGTGGGCCCACCTNONE 
J080029D19GGGTGGGCNONE 
J080029D19GTGTGGGGGTGGGCCCACCTNONE 
J080034L11GGGTGGGCNONE 
J080034L11GTGTGGGGGTGGGCCCACCTNONE 
J080039G07GGGTGGGCNONE 
J080039G07GTGTGGGGGTGGGCCCACCTNONE 
J080062M23GGGTGGGCNONE 
J080062M23GTGTGGGGGTGGGCCCACCTNONE 
J080302A01GGGTGGGCNONE 
J080302A01GTGTGGGGGTGGGCCCACCTNONE 
J100042I15GGGTGGGCNONE 
J100042I15GTGTGGGGGTGGGCCCACCTNONE 
J100043G22GGGTGGGCNONE 
J100043G22GTGTGGGGGTGGGCCCACCTNONE 
J100056L12GGGTGGGCNONE 
J100056L12GTGTGGGGGTGGGCCCACCTNONE 
J100061A12GGGTGGGCNONE 
J100061A12GTGTGGGGGTGGGCCCACCTNONE 
J100073O20GGGTGGGCNONE 
J100073O20GTGTGGGGGTGGGCCCACCTNONE 
J100082I08GGGTGGGCNONE 
J100082I08GTGTGGGGGTGGGCCCACCTNONE 
Os06g0103300J013002E07GCCCACCCNONE 
J013002E07GCCCACCCNONE 
J013023I23GCCCACCCNONE 
J013023I23GCCCACCCNONE 
J013060A05GCCCACCCNONE 
J013060A05GCCCACCCNONE 
J013073D13GCCCACCCNONE 
J013073D13GCCCACCCNONE 
J013099M03GCCCACCCNONE 
J013099M03GCCCACCCNONE 
J013159F14GCCCACCCNONE 
J013159F14GCCCACCCNONE 
J023075L07GCCCACCCNONE 
J023075L07GCCCACCCNONE 
J023092H16GCCCACCCNONE 
J023092H16GCCCACCCNONE 
J043010E16GCCCACCCNONE 
J043010E16GCCCACCCNONE 
J065165A10GCCCACCCNONE 
J065165A10GCCCACCCNONE 
J065199B20GCCCACCCNONE 
J065199B20GCCCACCCNONE 
J075057M22GCCCACCCNONE 
J075057M22GCCCACCCNONE 
J075072J24GCCCACCCNONE 
J075072J24GCCCACCCNONE 
J075188E23GCCCACCCNONE 
J075188E23GCCCACCCNONE 
J080302M13GCCCACCCNONE 
J080302M13GCCCACCCNONE 
J080304K17GCCCACCCNONE 
J080304K17GCCCACCCNONE 
J080318E11GCCCACCCNONE 
J080318E11GCCCACCCNONE 
J080319F02GCCCACCCNONE 
J080319F02GCCCACCCNONE 
J090087B14GCCCACCCNONE 
J090087B14GCCCACCCNONE 
J090088C02GCCCACCCNONE 
J090088C02GCCCACCCNONE 
J100062A06GCCCACCCNONE 
J100062A06GCCCACCCNONE 
J100078H05GCCCACCCNONE 
J100078H05GCCCACCCNONE 
Os06g0109300AK059047GCCCACCCProtein of unknown function DUF6, transmembrane domain containing protein. 
J065069L08GCCCACCCNONE 
J065139L22GCCCACCCNONE 
Os06g0116900009-176-D04GGGTGGGCTGTNONE 
AK063112GGGTGGGCTGTConserved hypothetical protein. 
Os06g0132100012-025-C11GCCCACCCNONE 
AK072859GCCCACCCLung seven transmembrane receptor family protein. 
AK100206GCCCACCCNONE 
AK105429GCCCACCCNONE 
J023042H07GCCCACCCNONE 
J023062I04GCCCACCCNONE 
J023143I01GCCCACCCNONE 
J053027J22GCCCACCCNONE 
J053027P18GCCCACCCNONE 
J053035D09GCCCACCCNONE 
J053079P13GCCCACCCNONE 
J053094E24GCCCACCCNONE 
J075125J21GCCCACCCNONE 
J100080J04GCCCACCCNONE 
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0153200AK072625GCCCCCACCGGGTGGGGCCCACCCCCACCACNONE 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0154200AK107102GCCCACCCNONE 
Os06g0168600AK068858GGGTGGGCSimilar to Ribonucleotide reductase. 
Os06g0217700009-074-A04AGCCCACCCNONE 
AK062617AGCCCACCCConserved hypothetical protein. 
Os06g0320500004-013-F05GGGTGGGCNONE 
006-021-B06GGGTGGGCNONE 
006-021-D12GGGTGGGCNONE 
006-022-A12GGGTGGGCNONE 
006-024-B10GGGTGGGCNONE 
006-029-F07GGGTGGGCNONE 
006-029-H12GGGTGGGCNONE 
006-031-A05GGGTGGGCNONE 
006-033-C03GGGTGGGCNONE 
006-036-B12GGGTGGGCNONE 
006-048-C08GGGTGGGCNONE 
006-050-F03GGGTGGGCNONE 
006-051-C12GGGTGGGCNONE 
006-054-C03GGGTGGGCNONE 
006-057-D12GGGTGGGCNONE 
006-067-F01GGGTGGGCNONE 
006-071-G12GGGTGGGCNONE 
006-072-G11GGGTGGGCNONE 
006-072-H01GGGTGGGCNONE 
006-081-E02GGGTGGGCNONE 
006-082-A11GGGTGGGCNONE 
006-084-A04GGGTGGGCNONE 
006-085-C08GGGTGGGCNONE 
006-086-D03GGGTGGGCNONE 
006-088-B05GGGTGGGCNONE 
006-088-G02GGGTGGGCNONE 
006-092-G10GGGTGGGCNONE 
006-094-D11GGGTGGGCNONE 
006-094-E04GGGTGGGCNONE 
006-103-G12GGGTGGGCNONE 
006-106-G08GGGTGGGCNONE 
006-111-E06GGGTGGGCNONE 
006-114-C07GGGTGGGCNONE 
006-115-A04GGGTGGGCNONE 
006-117-G11GGGTGGGCNONE 
006-118-G09GGGTGGGCNONE 
009-010-F03GGGTGGGCNONE 
009-076-G01GGGTGGGCNONE 
009-134-E10GGGTGGGCNONE 
009-193-D07GGGTGGGCNONE 
AF094776GGGTGGGCNONE 
AK060904GGGTGGGCSimilar to Light-harvesting complex I (Fragment). 
AK098864GGGTGGGCNONE 
J013001A03GGGTGGGCNONE 
J013098P14GGGTGGGCNONE 
J013127B16GGGTGGGCNONE 
J013169J24GGGTGGGCNONE 
J023084H23GGGTGGGCNONE 
J023093F05GGGTGGGCNONE 
J033041I05GGGTGGGCNONE 
J065196G15GGGTGGGCNONE 
J075019K01GGGTGGGCNONE 
J075053H16GGGTGGGCNONE 
J075055M09GGGTGGGCNONE 
J075099G10GGGTGGGCNONE 
J075099L23GGGTGGGCNONE 
J075127I09GGGTGGGCNONE 
J080001C14GGGTGGGCNONE 
J080016B11GGGTGGGCNONE 
J080029C14GGGTGGGCNONE 
J080029I17GGGTGGGCNONE 
J080034F13GGGTGGGCNONE 
J080039E02GGGTGGGCNONE 
J080040N05GGGTGGGCNONE 
J080042O17GGGTGGGCNONE 
J080043N15GGGTGGGCNONE 
J080056K02GGGTGGGCNONE 
J080063N15GGGTGGGCNONE 
J080069H05GGGTGGGCNONE 
J080070N15GGGTGGGCNONE 
J080075J22GGGTGGGCNONE 
J080076F12GGGTGGGCNONE 
J080086G05GGGTGGGCNONE 
J090046G07GGGTGGGCNONE 
J090059H01GGGTGGGCNONE 
J090099C09GGGTGGGCNONE 
J100028E12GGGTGGGCNONE 
J100048J04GGGTGGGCNONE 
J100054O05GGGTGGGCNONE 
J100062C09GGGTGGGCNONE 
J100075C17GGGTGGGCNONE 
J100075C23GGGTGGGCNONE 
J100075I23GGGTGGGCNONE 
Os06g0326400AK065052GGTGGGCCCACCCNONE 
AK121116GGTGGGCCCACCCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23GGTGGGCCCACCCNONE 
J013129K13GGTGGGCCCACCCNONE 
J023010F22GGTGGGCCCACCCNONE 
J023120K19GGTGGGCCCACCCNONE 
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE 
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein. 
AK121899GCAGCCCACCCGACTGGGCCGGTNONE 
Os06g0574200Os06g0574200GTGGGTCCCACACGTGTGGGCCCACCCCCACACAGCCGTTGUspA domain containing protein. 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
J033042P11GCCCACCCGGCCCACGCNONE 
J033072G12GCCCACCCGGCCCACGCNONE 
J090050C02GCCCACCCGGCCCACGCNONE 
Os06g0666400AK108002GGGGCCCACCCACCACVQ domain containing protein. 
J065043C22GGGGCCCACCCACCACNONE 
J065120O19GGGGCCCACCCACCACNONE 
J075197D23GGGGCCCACCCACCACNONE 
J100030E22GGGGCCCACCCACCACNONE 
J100031I22GGGGCCCACCCACCACNONE 
J100072I12GGGGCCCACCCACCACNONE 
Os06g0709300AK108588ACATGGGCCCACCCFAR1 domain containing protein. 
AK108588AGCCCACCCFAR1 domain containing protein. 
Os06g0711600016-047-G09GGGTGGGCCAANONE 
AK064384GGGTGGGCCAAmRNA splicing factor SYF2 family protein. 
AK102831GGGTGGGCCAANONE 
J013072P18GGGTGGGCCAANONE 
J023049G01GGGTGGGCCAANONE 
J023088I01GGGTGGGCCAANONE 
J033023I22GGGTGGGCCAANONE 
J033106I12GGGTGGGCCAANONE 
J033109G07GGGTGGGCCAANONE 
J065030F22GGGTGGGCCAANONE 
J065132H19GGGTGGGCCAANONE 
J080301D07GGGTGGGCCAANONE 
J080305C09GGGTGGGCCAANONE 
J080312C03GGGTGGGCCAANONE 
J080313I15GGGTGGGCCAANONE 
J080315B09GGGTGGGCCAANONE 
J090056N21GGGTGGGCCAANONE 
J100027B07GGGTGGGCCAANONE 
Os07g0153400AK069618GTGGGGGCCCACCCCyclin-like F-box domain containing protein. 
J013023C22GTGGGGGCCCACCCNONE 
J013034M12GTGGGGGCCCACCCNONE 
J013048B10GTGGGGGCCCACCCNONE 
J013052P04GTGGGGGCCCACCCNONE 
J013091E22GTGGGGGCCCACCCNONE 
J013096D02GTGGGGGCCCACCCNONE 
J013098A08GTGGGGGCCCACCCNONE 
J013106B13GTGGGGGCCCACCCNONE 
J013109C09GTGGGGGCCCACCCNONE 
J013121H14GTGGGGGCCCACCCNONE 
J023002G10GTGGGGGCCCACCCNONE 
J023019I24GTGGGGGCCCACCCNONE 
J023025H16GTGGGGGCCCACCCNONE 
J023037K24GTGGGGGCCCACCCNONE 
J023041J02GTGGGGGCCCACCCNONE 
J023056G02GTGGGGGCCCACCCNONE 
J023073H18GTGGGGGCCCACCCNONE 
J023082F08GTGGGGGCCCACCCNONE 
J023104J01GTGGGGGCCCACCCNONE 
J023105F21GTGGGGGCCCACCCNONE 
J033038A08GTGGGGGCCCACCCNONE 
J033040I21GTGGGGGCCCACCCNONE 
J033111M19GTGGGGGCCCACCCNONE 
J043010N11GTGGGGGCCCACCCNONE 
J075018B18GTGGGGGCCCACCCNONE 
J075043E08GTGGGGGCCCACCCNONE 
J075045H12GTGGGGGCCCACCCNONE 
J075048P08GTGGGGGCCCACCCNONE 
J075056M23GTGGGGGCCCACCCNONE 
J075061J22GTGGGGGCCCACCCNONE 
J075085K04GTGGGGGCCCACCCNONE 
J075118N16GTGGGGGCCCACCCNONE 
J075120O11GTGGGGGCCCACCCNONE 
J075133J08GTGGGGGCCCACCCNONE 
J075186O13GTGGGGGCCCACCCNONE 
J100047B15GTGGGGGCCCACCCNONE 
Os07g0166800006-038-C11TGCGGGCCCACCCACGGGNONE 
012-080-F02TGCGGGCCCACCCACGGGNONE 
AK070524TGCGGGCCCACCCACGGGRad6 (Ubiquitin carrier protein). 
AK121382TGCGGGCCCACCCACGGGNONE 
J023022D19TGCGGGCCCACCCACGGGNONE 
J023055G02TGCGGGCCCACCCACGGGNONE 
J023073E02TGCGGGCCCACCCACGGGNONE 
J023125B08TGCGGGCCCACCCACGGGNONE 
J023127H21TGCGGGCCCACCCACGGGNONE 
J033052G01TGCGGGCCCACCCACGGGNONE 
J033067F13TGCGGGCCCACCCACGGGNONE 
J065046L14TGCGGGCCCACCCACGGGNONE 
J065178D11TGCGGGCCCACCCACGGGNONE 
J065205N17TGCGGGCCCACCCACGGGNONE 
J075006K17TGCGGGCCCACCCACGGGNONE 
J075051D20TGCGGGCCCACCCACGGGNONE 
J075109L04TGCGGGCCCACCCACGGGNONE 
J090024K15TGCGGGCCCACCCACGGGNONE 
J090025N04TGCGGGCCCACCCACGGGNONE 
J090049N09TGCGGGCCCACCCACGGGNONE 
J090070N12TGCGGGCCCACCCACGGGNONE 
J090078O21TGCGGGCCCACCCACGGGNONE 
J090083L07TGCGGGCCCACCCACGGGNONE 
J100063K16TGCGGGCCCACCCACGGGNONE 
J100083D14TGCGGGCCCACCCACGGGNONE 
Os07g0188700011-058-D09CAGGTGGGGCCCACCCNONE 
AK063957CAGGTGGGGCCCACCCNONE 
AK073755CAGGTGGGGCCCACCCSimilar to EXO. 
AK107609CAGGTGGGGCCCACCCNONE 
J033066N03CAGGTGGGGCCCACCCNONE 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0243200AK121036GCCCACCCSimilar to ADP-glucose pyrophosphorylase large subunit 2 (EC 2.7.7.27) (Fragment). 
D21272GCCCACCCNONE 
Os07g0246200012-046-B07CTGGCCCACCCGCGCNONE 
012-046-B07GCCGGGCCCACCCGNONE 
AB021259CTGGCCCACCCGCGCNONE 
AB021259GCCGGGCCCACCCGNONE 
AK065341CTGGCCCACCCGCGCSimilar to Calreticulin (Fragment). 
AK065341GCCGGGCCCACCCGSimilar to Calreticulin (Fragment). 
AK099348CTGGCCCACCCGCGCNONE 
AK099348GCCGGGCCCACCCGNONE 
AK104328CTGGCCCACCCGCGCNONE 
AK104328GCCGGGCCCACCCGNONE 
AK104826CTGGCCCACCCGCGCNONE 
AK104826GCCGGGCCCACCCGNONE 
J013000E04CTGGCCCACCCGCGCNONE 
J013000E04GCCGGGCCCACCCGNONE 
J013093M19CTGGCCCACCCGCGCNONE 
J013093M19GCCGGGCCCACCCGNONE 
J013108J08CTGGCCCACCCGCGCNONE 
J013108J08GCCGGGCCCACCCGNONE 
J013118G03CTGGCCCACCCGCGCNONE 
J013118G03GCCGGGCCCACCCGNONE 
J013121I07CTGGCCCACCCGCGCNONE 
J013121I07GCCGGGCCCACCCGNONE 
J013153K07CTGGCCCACCCGCGCNONE 
J013153K07GCCGGGCCCACCCGNONE 
J023028N07CTGGCCCACCCGCGCNONE 
J023028N07GCCGGGCCCACCCGNONE 
J023034F12CTGGCCCACCCGCGCNONE 
J023034F12GCCGGGCCCACCCGNONE 
J023043J11CTGGCCCACCCGCGCNONE 
J023043J11GCCGGGCCCACCCGNONE 
J023087A03CTGGCCCACCCGCGCNONE 
J023087A03GCCGGGCCCACCCGNONE 
J023099N05CTGGCCCACCCGCGCNONE 
J023099N05GCCGGGCCCACCCGNONE 
J023105B02CTGGCCCACCCGCGCNONE 
J023105B02GCCGGGCCCACCCGNONE 
J023110H02CTGGCCCACCCGCGCNONE 
J023110H02GCCGGGCCCACCCGNONE 
J023112E15CTGGCCCACCCGCGCNONE 
J023112E15GCCGGGCCCACCCGNONE 
J023132C20CTGGCCCACCCGCGCNONE 
J023132C20GCCGGGCCCACCCGNONE 
J023134G12CTGGCCCACCCGCGCNONE 
J023134G12GCCGGGCCCACCCGNONE 
J023138O12CTGGCCCACCCGCGCNONE 
J023138O12GCCGGGCCCACCCGNONE 
J033031E05CTGGCCCACCCGCGCNONE 
J033031E05GCCGGGCCCACCCGNONE 
J033032C03CTGGCCCACCCGCGCNONE 
J033032C03GCCGGGCCCACCCGNONE 
J033039K10CTGGCCCACCCGCGCNONE 
J033039K10GCCGGGCCCACCCGNONE 
J033050P09CTGGCCCACCCGCGCNONE 
J033050P09GCCGGGCCCACCCGNONE 
J033074D03CTGGCCCACCCGCGCNONE 
J033074D03GCCGGGCCCACCCGNONE 
J033075G14CTGGCCCACCCGCGCNONE 
J033075G14GCCGGGCCCACCCGNONE 
J033075I23CTGGCCCACCCGCGCNONE 
J033075I23GCCGGGCCCACCCGNONE 
J033081H23CTGGCCCACCCGCGCNONE 
J033081H23GCCGGGCCCACCCGNONE 
J033087N08CTGGCCCACCCGCGCNONE 
J033087N08GCCGGGCCCACCCGNONE 
J033110B03CTGGCCCACCCGCGCNONE 
J033110B03GCCGGGCCCACCCGNONE 
J033148H22CTGGCCCACCCGCGCNONE 
J033148H22GCCGGGCCCACCCGNONE 
J043027F13CTGGCCCACCCGCGCNONE 
J043027F13GCCGGGCCCACCCGNONE 
J043031H01CTGGCCCACCCGCGCNONE 
J043031H01GCCGGGCCCACCCGNONE 
J080003O10CTGGCCCACCCGCGCNONE 
J080003O10GCCGGGCCCACCCGNONE 
J080022D10CTGGCCCACCCGCGCNONE 
J080022D10GCCGGGCCCACCCGNONE 
J080029I12CTGGCCCACCCGCGCNONE 
J080029I12GCCGGGCCCACCCGNONE 
J080034A09CTGGCCCACCCGCGCNONE 
J080034A09GCCGGGCCCACCCGNONE 
J080035H20CTGGCCCACCCGCGCNONE 
J080035H20GCCGGGCCCACCCGNONE 
J080049C10CTGGCCCACCCGCGCNONE 
J080049C10GCCGGGCCCACCCGNONE 
J080053G14CTGGCCCACCCGCGCNONE 
J080053G14GCCGGGCCCACCCGNONE 
J080055J22CTGGCCCACCCGCGCNONE 
J080055J22GCCGGGCCCACCCGNONE 
J080058J04CTGGCCCACCCGCGCNONE 
J080058J04GCCGGGCCCACCCGNONE 
J080069E14CTGGCCCACCCGCGCNONE 
J080069E14GCCGGGCCCACCCGNONE 
J080069M23CTGGCCCACCCGCGCNONE 
J080069M23GCCGGGCCCACCCGNONE 
J080072E19CTGGCCCACCCGCGCNONE 
J080072E19GCCGGGCCCACCCGNONE 
J080072I03CTGGCCCACCCGCGCNONE 
J080072I03GCCGGGCCCACCCGNONE 
J080075B13CTGGCCCACCCGCGCNONE 
J080075B13GCCGGGCCCACCCGNONE 
J080078I11CTGGCCCACCCGCGCNONE 
J080078I11GCCGGGCCCACCCGNONE 
J080081F16CTGGCCCACCCGCGCNONE 
J080081F16GCCGGGCCCACCCGNONE 
J080088O10CTGGCCCACCCGCGCNONE 
J080088O10GCCGGGCCCACCCGNONE 
J080089G18CTGGCCCACCCGCGCNONE 
J080089G18GCCGGGCCCACCCGNONE 
J090009C10CTGGCCCACCCGCGCNONE 
J090009C10GCCGGGCCCACCCGNONE 
J090022D23CTGGCCCACCCGCGCNONE 
J090022D23GCCGGGCCCACCCGNONE 
J090023A15CTGGCCCACCCGCGCNONE 
J090023A15GCCGGGCCCACCCGNONE 
J090024M10CTGGCCCACCCGCGCNONE 
J090024M10GCCGGGCCCACCCGNONE 
J090038F24CTGGCCCACCCGCGCNONE 
J090038F24GCCGGGCCCACCCGNONE 
J090039O13CTGGCCCACCCGCGCNONE 
J090039O13GCCGGGCCCACCCGNONE 
J090040N12CTGGCCCACCCGCGCNONE 
J090040N12GCCGGGCCCACCCGNONE 
J090054I18CTGGCCCACCCGCGCNONE 
J090054I18GCCGGGCCCACCCGNONE 
J090061C16CTGGCCCACCCGCGCNONE 
J090061C16GCCGGGCCCACCCGNONE 
J090063H23CTGGCCCACCCGCGCNONE 
J090063H23GCCGGGCCCACCCGNONE 
J090067F21CTGGCCCACCCGCGCNONE 
J090067F21GCCGGGCCCACCCGNONE 
J090075A01CTGGCCCACCCGCGCNONE 
J090075A01GCCGGGCCCACCCGNONE 
J090076K11CTGGCCCACCCGCGCNONE 
J090076K11GCCGGGCCCACCCGNONE 
J090078L11CTGGCCCACCCGCGCNONE 
J090078L11GCCGGGCCCACCCGNONE 
J090079P03CTGGCCCACCCGCGCNONE 
J090079P03GCCGGGCCCACCCGNONE 
J090087D23CTGGCCCACCCGCGCNONE 
J090087D23GCCGGGCCCACCCGNONE 
J090087G22CTGGCCCACCCGCGCNONE 
J090087G22GCCGGGCCCACCCGNONE 
J090089F03CTGGCCCACCCGCGCNONE 
J090089F03GCCGGGCCCACCCGNONE 
J090092A04CTGGCCCACCCGCGCNONE 
J090092A04GCCGGGCCCACCCGNONE 
J100024L17CTGGCCCACCCGCGCNONE 
J100024L17GCCGGGCCCACCCGNONE 
J100031P13CTGGCCCACCCGCGCNONE 
J100031P13GCCGGGCCCACCCGNONE 
J100032H05CTGGCCCACCCGCGCNONE 
J100032H05GCCGGGCCCACCCGNONE 
J100036P03CTGGCCCACCCGCGCNONE 
J100036P03GCCGGGCCCACCCGNONE 
J100038L07CTGGCCCACCCGCGCNONE 
J100038L07GCCGGGCCCACCCGNONE 
J100043I20CTGGCCCACCCGCGCNONE 
J100043I20GCCGGGCCCACCCGNONE 
J100069A21CTGGCCCACCCGCGCNONE 
J100069A21GCCGGGCCCACCCGNONE 
J100078G06CTGGCCCACCCGCGCNONE 
J100078G06GCCGGGCCCACCCGNONE 
J100081J24CTGGCCCACCCGCGCNONE 
J100081J24GCCGGGCCCACCCGNONE 
J100081N04CTGGCCCACCCGCGCNONE 
J100081N04GCCGGGCCCACCCGNONE 
J100084K16CTGGCCCACCCGCGCNONE 
J100084K16GCCGGGCCCACCCGNONE 
J100085O06CTGGCCCACCCGCGCNONE 
J100085O06GCCGGGCCCACCCGNONE 
J100088L13CTGGCCCACCCGCGCNONE 
J100088L13GCCGGGCCCACCCGNONE 
J100090O21CTGGCCCACCCGCGCNONE 
J100090O21GCCGGGCCCACCCGNONE 
Os07g0274700J065002G18TCTCGGCCCACCCGNONE 
J065092L19TCTCGGCCCACCCGNONE 
J065099K11TCTCGGCCCACCCGNONE 
J065103L08TCTCGGCCCACCCGNONE 
J065185I19TCTCGGCCCACCCGNONE 
J075004L22TCTCGGCCCACCCGNONE 
J075007G03TCTCGGCCCACCCGNONE 
J075020E09TCTCGGCCCACCCGNONE 
J075046B02TCTCGGCCCACCCGNONE 
J075070D08TCTCGGCCCACCCGNONE 
J075118L24TCTCGGCCCACCCGNONE 
J075140C15TCTCGGCCCACCCGNONE 
J075157A21TCTCGGCCCACCCGNONE 
J075165J01TCTCGGCCCACCCGNONE 
J075172J18TCTCGGCCCACCCGNONE 
J075177P10TCTCGGCCCACCCGNONE 
J100042D15TCTCGGCCCACCCGNONE 
J100053M21TCTCGGCCCACCCGNONE 
J100067M12TCTCGGCCCACCCGNONE 
Os07g0419500J065210A06GCCACGTGGGTGGGCCCCACCCCCACCCGCGCNONE 
Os07g0438800AK060412GCCGGCCCGGGCCCACCCNONE 
AK100065GCCGGCCCGGGCCCACCCSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195GCCGGCCCGGGCCCACCCNONE 
AY224478GCCGGCCCGGGCCCACCCNONE 
J013160O05GCCGGCCCGGGCCCACCCNONE 
J023030C05GCCGGCCCGGGCCCACCCNONE 
J033025O04GCCGGCCCGGGCCCACCCNONE 
J033121P15GCCGGCCCGGGCCCACCCNONE 
J043034I23GCCGGCCCGGGCCCACCCNONE 
J065022N01GCCGGCCCGGGCCCACCCNONE 
J065022N02GCCGGCCCGGGCCCACCCNONE 
J065023M01GCCGGCCCGGGCCCACCCNONE 
J065101G13GCCGGCCCGGGCCCACCCNONE 
J075058P13GCCGGCCCGGGCCCACCCNONE 
J075186K10GCCGGCCCGGGCCCACCCNONE 
J075199F17GCCGGCCCGGGCCCACCCNONE 
Os07g0479300AK120117GGTCCCACCGCCCACCCPeptidase S10, serine carboxypeptidase family protein. 
D17587GGTCCCACCGCCCACCCNONE 
Os07g0490300AK068288TCGCGCGCGCGGGGGGGTGGGCCCACCSimilar to Preproacrosin. 
J013149P03TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
J065039L14TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
J100024A06TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0496000AK111986CCAGCCCACCCSimilar to Nt-rab6 protein. 
J065098H22CCAGCCCACCCNONE 
J065172F22CCAGCCCACCCNONE 
J075001F01CCAGCCCACCCNONE 
J075017I20CCAGCCCACCCNONE 
J075035G14CCAGCCCACCCNONE 
J075082D07CCAGCCCACCCNONE 
J075134M14CCAGCCCACCCNONE 
J075146P21CCAGCCCACCCNONE 
J075167H19CCAGCCCACCCNONE 
J075176L08CCAGCCCACCCNONE 
J075190E06CCAGCCCACCCNONE 
J100026M06CCAGCCCACCCNONE 
J100061L07CCAGCCCACCCNONE 
J100079J12CCAGCCCACCCNONE 
Os07g0531600015-098-E11GGGGCCCACCCGNONE 
AK067845GGGGCCCACCCGPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01GGGGCCCACCCGNONE 
J065008E15GGGGCCCACCCGNONE 
J065052K14GGGGCCCACCCGNONE 
J065052L13GGGGCCCACCCGNONE 
J065058M02GGGGCCCACCCGNONE 
J065069M10GGGGCCCACCCGNONE 
J065135A14GGGGCCCACCCGNONE 
J065168O18GGGGCCCACCCGNONE 
J075070D14GGGGCCCACCCGNONE 
J075169B16GGGGCCCACCCGNONE 
Os07g0628500AK059560GCCCACCCCACGCGNONE 
AK070963GCCCACCCCACGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AY222337GCCCACCCCACGCGNONE 
J023068N18GCCCACCCCACGCGNONE 
J023088M08GCCCACCCCACGCGNONE 
J033072H21GCCCACCCCACGCGNONE 
Os07g0639800AK074012CAAGTGGGCCCACGAGCCCACCCGSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592CAAGTGGGCCCACGAGCCCACCCGNONE 
AK104739CAAGTGGGCCCACGAGCCCACCCGNONE 
Os07g0673700AK071934TCGGCCCAGCCCACCCCyclin-like F-box domain containing protein. 
AK107556TCGGCCCAGCCCACCCNONE 
Os08g0101100AK069900GGGTGGGCHigh mobility group box domain containing protein. 
Os08g0110400AK100025GGGTGGGCCCTProtein of unknown function DUF266, plant family protein. 
Os08g0299200009-120-G12AGCCCACCCGNONE 
J075096F13AGCCCACCCGAdenylate cyclase domain containing protein. 
Os08g0337300AK067509GCGGGCCCACCCNONE 
AK072420GCGGGCCCACCCZinc finger, FYVE/PHD-type domain containing protein. 
Os08g0476000AK066585GAAGCCCACCCNONE 
Os08g0493900AK101284CCCGGCCCACCCACGGGNONE 
AK111820CCCGGCCCACCCACGGGWD40-like domain containing protein. 
Os08g0504400014-015-C10CGGGTGGGCCGAGNONE 
AK069190CGGGTGGGCCGAGSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CGGGTGGGCCGAGNONE 
J023006O19CGGGTGGGCCGAGNONE 
J033041C11CGGGTGGGCCGAGNONE 
Os08g0527400AK119389AGCCCATACCAGCCCACCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0547200AK101130GCCCACCCRabGAP/TBC domain containing protein. 
AK119577GCCCACCCNONE 
Os08g0557100AK070743AGCCCACCCNONE 
AK101214AGCCCACCCSimilar to Nucleic acid-binding protein precursor. 
AK105901AGCCCACCCNONE 
J033031B04AGCCCACCCNONE 
J080004F08AGCCCACCCNONE 
J080004H12AGCCCACCCNONE 
J080005H08AGCCCACCCNONE 
J080005I02AGCCCACCCNONE 
J080008N16AGCCCACCCNONE 
J080009H23AGCCCACCCNONE 
J080012H17AGCCCACCCNONE 
J080012J21AGCCCACCCNONE 
J080013I20AGCCCACCCNONE 
J080016E07AGCCCACCCNONE 
J080018O04AGCCCACCCNONE 
J080020B18AGCCCACCCNONE 
J080021I16AGCCCACCCNONE 
J080022N01AGCCCACCCNONE 
J080023G08AGCCCACCCNONE 
J080023N09AGCCCACCCNONE 
J080024J24AGCCCACCCNONE 
J080025M12AGCCCACCCNONE 
J080028A22AGCCCACCCNONE 
J080028I01AGCCCACCCNONE 
J080029D22AGCCCACCCNONE 
J080030M02AGCCCACCCNONE 
J080031B06AGCCCACCCNONE 
J080035G08AGCCCACCCNONE 
J080036F19AGCCCACCCNONE 
J080038P14AGCCCACCCNONE 
J080039C17AGCCCACCCNONE 
J080043A10AGCCCACCCNONE 
J080044H02AGCCCACCCNONE 
J080044P12AGCCCACCCNONE 
J080047L06AGCCCACCCNONE 
J080050L06AGCCCACCCNONE 
J080052J11AGCCCACCCNONE 
J080052M10AGCCCACCCNONE 
J080053E20AGCCCACCCNONE 
J080054J01AGCCCACCCNONE 
J080059N09AGCCCACCCNONE 
J080064F19AGCCCACCCNONE 
J080064N22AGCCCACCCNONE 
J080065K14AGCCCACCCNONE 
J080065M12AGCCCACCCNONE 
J080068O07AGCCCACCCNONE 
J080076P20AGCCCACCCNONE 
J080087D08AGCCCACCCNONE 
J080087H16AGCCCACCCNONE 
J080090N23AGCCCACCCNONE 
J080091H04AGCCCACCCNONE 
J080091P13AGCCCACCCNONE 
J080094O15AGCCCACCCNONE 
J080094P14AGCCCACCCNONE 
J080095I07AGCCCACCCNONE 
J080097E22AGCCCACCCNONE 
Os08g0565200AK108143AGGGCCCACCCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0309500J100027L22CACTGACAGGGTGGGCCCGCConserved hypothetical protein. 
J100027L22GGGTGGGCCCACCCGConserved hypothetical protein. 
Os09g0360400009-192-H06AAGGCCCACCCGGCCCGGGNONE 
AK071395AAGGCCCACCCGGCCCGGGConserved hypothetical protein. 
J013045J21AAGGCCCACCCGGCCCGGGNONE 
J023095O09AAGGCCCACCCGGCCCGGGNONE 
J065207K01AAGGCCCACCCGGCCCGGGNONE 
Os09g0386200J013002G14GCCCACCCNONE 
J065121C06GCCCACCCU box domain containing protein. 
J100039D18GCCCACCCNONE 
J100050A19GCCCACCCNONE 
J100075N18GCCCACCCNONE 
J100083E14GCCCACCCNONE 
J100085J24GCCCACCCNONE 
J100088B02GCCCACCCNONE 
J100090J11GCCCACCCNONE 
Os09g0423500AK120024GGGGCCCACCCPeptidase A1, pepsin family protein. 
Os09g0439700AK105702AGCCCACCCNONE 
AK119953AGCCCACCCNONE 
AK120805AGCCCACCCLung seven transmembrane receptor family protein. 
Os09g0453800AK119212GCCCACCCGNONE 
J023081A04GCCCACCCGNONE 
J065180G14GCCCACCCGNONE 
J100024A17GCCCACCCGNONE 
J100030A05GCCCACCCGNONE 
J100042I11GCCCACCCGNONE 
J100054N05GCCCACCCGNONE 
J100075G23GCCCACCCGNONE 
Os09g0453900AK107054CCCGGCCCACCCGNONE 
Os09g0476100AK099938CTCGCGCGTGGGGCCCACCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
Os09g0507200AK072867GCCCACCCMADS box protein. 
J023143P16GCCCACCCNONE 
J090001N09GCCCACCCNONE 
J090031J17GCCCACCCNONE 
U32109GCCCACCCNONE 
U78892GCCCACCCNONE 
Os09g0511700AK101420TAGGCCCACGGCCCACCCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19TAGGCCCACGGCCCACCCNONE 
J013036D23TAGGCCCACGGCCCACCCNONE 
J013037F22TAGGCCCACGGCCCACCCNONE 
J013111M23TAGGCCCACGGCCCACCCNONE 
J023109F14TAGGCCCACGGCCCACCCNONE 
J023119H17TAGGCCCACGGCCCACCCNONE 
J023133H23TAGGCCCACGGCCCACCCNONE 
J033032G17TAGGCCCACGGCCCACCCNONE 
J033038B10TAGGCCCACGGCCCACCCNONE 
J033071M16TAGGCCCACGGCCCACCCNONE 
J033096G04TAGGCCCACGGCCCACCCNONE 
J033109D06TAGGCCCACGGCCCACCCNONE 
J043016E22TAGGCCCACGGCCCACCCNONE 
J043022O09TAGGCCCACGGCCCACCCNONE 
J100023N11TAGGCCCACGGCCCACCCNONE 
J100046I21TAGGCCCACGGCCCACCCNONE 
Os09g0516800009-017-A01TCCGGCCCACCCConserved hypothetical protein. 
Os11g0130300AK059597GGGTGGGCTNse1 non-SMC component of SMC5-6 complex family protein. 
AK101224GGGTGGGCTNONE 
J033031D09GGGTGGGCTNONE 
J033135B02GGGTGGGCTNONE 
J100021A17GGGTGGGCTNONE 
J100066G09GGGTGGGCTNONE 
Os11g0159000AK065738TGTGGGCCCACCCConserved hypothetical protein. 
Os11g0175500015-087-F02AAATGGGCCCACCCNONE 
AK064320AAATGGGCCCACCCZinc finger, RING-type domain containing protein. 
AK101592AAATGGGCCCACCCNONE 
Os11g0216400Os11g0216400AGGGCCCACCCProteinase inhibitor, propeptide domain containing protein. 
Os11g0684700Os11g0684700AGCCCACCCDisease resistance protein family protein. 
Os12g0175700AK069143ATCCGACGGCCGTCCAAGCCCACCCGNonaspanin (TM9SF) family protein. 
Os12g0179700AK068305GCCCATCACAGCCCACCCNONE 
AK120612GCCCATCACAGCCCACCCNONE 
J013146K12GCCCATCACAGCCCACCCNONE 
J023131C17GCCCATCACAGCCCACCCNONE 
J033079I11GCCCATCACAGCCCACCCNONE 
J033125D20GCCCATCACAGCCCACCCNONE 
J090048O13GCCCATCACAGCCCACCCNONE 
J100076M12GCCCATCACAGCCCACCCNONE 
J100079L09GCCCATCACAGCCCACCCNONE 
Os12g0235800AK071066CAACGGCCCACCCSimilar to Argininosuccinate synthase (Fragment). 
Os12g0405700AK061920ACATGGGCCCACCCSimilar to Wound-induced basic protein. 
AK120436ACATGGGCCCACCCNONE 
Os12g0407300AK119778GCCCACCCGIntron maturase, type II family protein. 
Os12g0507600009-155-B05GGGTGGGCCCATCTCGGCCCATGANONE 
AK070613GGGTGGGCCCATCTCGGCCCATGAConserved hypothetical protein. 
J023063G03GGGTGGGCCCATCTCGGCCCATGANONE 
Os12g0572400016-084-F04AAAGCCCATAAGGCCCACCCNONE 
AK065531AAAGCCCATAAGGCCCACCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03AAAGCCCATAAGGCCCACCCNONE 
J013034H02AAAGCCCATAAGGCCCACCCNONE 
J033117N05AAAGCCCATAAGGCCCACCCNONE 
J065027L09AAAGCCCATAAGGCCCACCCNONE 
J065037D09AAAGCCCATAAGGCCCACCCNONE 
J065197I09AAAGCCCATAAGGCCCACCCNONE 
J090045C01AAAGCCCATAAGGCCCACCCNONE 
J100031E11AAAGCCCATAAGGCCCACCCNONE 
Os12g0573200AK111522CCCGGCCCACCCNONE 
AK121943CCCGGCCCACCCGRAS transcription factor domain containing protein. 
J013002M11CCCGGCCCACCCNONE 
J013151M11CCCGGCCCACCCNONE 
J013159J22CCCGGCCCACCCNONE 
J023087F18CCCGGCCCACCCNONE 
J033107F03CCCGGCCCACCCNONE 
J033125L09CCCGGCCCACCCNONE 
J033126E12CCCGGCCCACCCNONE 
J043022I15CCCGGCCCACCCNONE 
J065176F05CCCGGCCCACCCNONE 
J090034D17CCCGGCCCACCCNONE 
J090075J06CCCGGCCCACCCNONE 
J100058D22CCCGGCCCACCCNONE 
J100058P04CCCGGCCCACCCNONE 
Os12g0584100006-083-C12TAGGCCCAGCCCACCCNONE 
006-104-C06TAGGCCCAGCCCACCCNONE 
AK066829TAGGCCCAGCCCACCCNONE 
AK071424TAGGCCCAGCCCACCCConserved hypothetical protein. 
J013075O22TAGGCCCAGCCCACCCNONE 
J023091J20TAGGCCCAGCCCACCCNONE 
J065167K15TAGGCCCAGCCCACCCNONE 
J065213C02TAGGCCCAGCCCACCCNONE 
J075001B17TAGGCCCAGCCCACCCNONE 
J075165D13TAGGCCCAGCCCACCCNONE 
J075195C24TAGGCCCAGCCCACCCNONE 
Os12g0621500AK111785GCGGGCCCACCCGSimilar to IRE. 
Os12g0638500AK072720GCCCACCCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.