version

Summary of OsREG601 (All List)

OrganismOryza sativa  
IDOsREG601  
SequenceGCCCACGA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1299  

Entry Sequences (1299 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10AGCCCACGASurfeit locus 5 family protein. 
J065164N24AGCCCACGANONE 
J065167H04AGCCCACGANONE 
J065187N12AGCCCACGANONE 
Os01g0186200AK109372TCGTGGGCTSimilar to Phototropin. 
AK111679TCGTGGGCTNONE 
J065120K01TCGTGGGCTNONE 
J100025D07TCGTGGGCTNONE 
Os01g0191100009-011-A02TCCGGCCCACGANONE 
009-028-D05TCCGGCCCACGANONE 
009-058-B11TCCGGCCCACGANONE 
009-151-D09TCCGGCCCACGANONE 
013-026-G03TCCGGCCCACGANONE 
013-063-F04TCCGGCCCACGANONE 
013-069-B05TCCGGCCCACGANONE 
014-029-E04TCCGGCCCACGANONE 
014-072-H04TCCGGCCCACGANONE 
014-089-E09TCCGGCCCACGANONE 
015-047-G05TCCGGCCCACGANONE 
016-033-G06TCCGGCCCACGANONE 
AK058815TCCGGCCCACGASimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08TCCGGCCCACGANONE 
J023077K21TCCGGCCCACGANONE 
J023081F19TCCGGCCCACGANONE 
J033052N11TCCGGCCCACGANONE 
J033058N11TCCGGCCCACGANONE 
J033114G05TCCGGCCCACGANONE 
J033114O17TCCGGCCCACGANONE 
J033129L14TCCGGCCCACGANONE 
J053029I12TCCGGCCCACGANONE 
J065067N19TCCGGCCCACGANONE 
J065084I19TCCGGCCCACGANONE 
J065099O03TCCGGCCCACGANONE 
J065201I08TCCGGCCCACGANONE 
J075035B08TCCGGCCCACGANONE 
J075037B22TCCGGCCCACGANONE 
J075054L16TCCGGCCCACGANONE 
J075059D15TCCGGCCCACGANONE 
J075164I08TCCGGCCCACGANONE 
J075185J01TCCGGCCCACGANONE 
J090042O06TCCGGCCCACGANONE 
J090044F12TCCGGCCCACGANONE 
J090063L02TCCGGCCCACGANONE 
J090073I10TCCGGCCCACGANONE 
J090078E18TCCGGCCCACGANONE 
J100072K16TCCGGCCCACGANONE 
Os01g0253500J100088F12TCTGGGCCCACGAConserved hypothetical protein. 
Os01g0598400AK109846CTGGCCCACGAACyclin-like F-box domain containing protein. 
Os01g0622300006-041-C10TTGGCCCACGANONE 
AK072290TTGGCCCACGANONE 
AK099135TTGGCCCACGANONE 
AK106203TTGGCCCACGASimilar to Plastid uroporphyrinogen decarboxylase (Fragment). 
J065102E05TTGGCCCACGANONE 
J080044C04TTGGCCCACGANONE 
J080046E10TTGGCCCACGANONE 
J080050J18TTGGCCCACGANONE 
J080067B13TTGGCCCACGANONE 
J080072C04TTGGCCCACGANONE 
J080072J09TTGGCCCACGANONE 
J080075A16TTGGCCCACGANONE 
J080093E02TTGGCCCACGANONE 
Os01g0640800AK065688AGCCCACGAAConserved hypothetical protein 48 family protein. 
J013042L10AGCCCACGAANONE 
J013121H08AGCCCACGAANONE 
Os01g0672700AK121375GCCCACGADNA polymerase, beta-like region domain containing protein. 
J023127C22GCCCACGANONE 
J033092B05GCCCACGANONE 
J033129P21GCCCACGANONE 
J065079H18GCCCACGANONE 
Os01g0743400AK059177TCGTGGGCCTTSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114TCGTGGGCCTTNONE 
J065070E07TCGTGGGCCTTNONE 
J065152G11TCGTGGGCCTTNONE 
Os01g0772000009-139-F01TCGTGGGCTNONE 
AK069455TCGTGGGCTConserved hypothetical protein. 
J023019D24TCGTGGGCTNONE 
J033055P09TCGTGGGCTNONE 
J065059A13TCGTGGGCTNONE 
J090008C16TCGTGGGCTNONE 
J090012D20TCGTGGGCTNONE 
Os01g0825800009-072-E02TCGTGGGCNONE 
AK064301TCGTGGGCNONE 
J033087L14TCGTGGGCNONE 
Os01g0834700AK101559TCAGCCCACGAZinc finger, CCCH-type domain containing protein. 
AK106074TCAGCCCACGANONE 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
Os01g0905800006-028-A06TCGTGGGCTNONE 
006-050-H08TCGTGGGCTNONE 
006-057-G07TCGTGGGCTNONE 
006-062-D02TCGTGGGCTNONE 
006-116-G09TCGTGGGCTNONE 
009-117-H10TCGTGGGCTNONE 
011-025-F02TCGTGGGCTNONE 
011-045-E10TCGTGGGCTNONE 
011-068-E01TCGTGGGCTNONE 
013-040-A01TCGTGGGCTNONE 
013-079-E10TCGTGGGCTNONE 
013-079-G11TCGTGGGCTNONE 
015-095-D06TCGTGGGCTNONE 
AK062270TCGTGGGCTNONE 
AK073770TCGTGGGCTAldolase C-1. 
AK104719TCGTGGGCTNONE 
D21279TCGTGGGCTNONE 
D50301TCGTGGGCTNONE 
J013029D24TCGTGGGCTNONE 
J013039N01TCGTGGGCTNONE 
J023039J01TCGTGGGCTNONE 
J023064E16TCGTGGGCTNONE 
J023085J23TCGTGGGCTNONE 
J023100H14TCGTGGGCTNONE 
J023127J19TCGTGGGCTNONE 
J023135J04TCGTGGGCTNONE 
J023140C02TCGTGGGCTNONE 
J023150B18TCGTGGGCTNONE 
J033027L09TCGTGGGCTNONE 
J033033N07TCGTGGGCTNONE 
J033042E03TCGTGGGCTNONE 
J033046K04TCGTGGGCTNONE 
J033068A16TCGTGGGCTNONE 
J033075I01TCGTGGGCTNONE 
J033076C19TCGTGGGCTNONE 
J033079O08TCGTGGGCTNONE 
J033080E19TCGTGGGCTNONE 
J033082F12TCGTGGGCTNONE 
J033089B13TCGTGGGCTNONE 
J033090E13TCGTGGGCTNONE 
J033091K16TCGTGGGCTNONE 
J033093E06TCGTGGGCTNONE 
J033094K02TCGTGGGCTNONE 
J033097O10TCGTGGGCTNONE 
J033098D04TCGTGGGCTNONE 
J033099J02TCGTGGGCTNONE 
J033109F07TCGTGGGCTNONE 
J033120F06TCGTGGGCTNONE 
J033126F10TCGTGGGCTNONE 
J033128I19TCGTGGGCTNONE 
J033132B13TCGTGGGCTNONE 
J033132C16TCGTGGGCTNONE 
J043022A15TCGTGGGCTNONE 
J065001J20TCGTGGGCTNONE 
J065009J23TCGTGGGCTNONE 
J065021P12TCGTGGGCTNONE 
J065047O05TCGTGGGCTNONE 
J065059G07TCGTGGGCTNONE 
J065072B20TCGTGGGCTNONE 
J065073N03TCGTGGGCTNONE 
J065108H21TCGTGGGCTNONE 
J065111B01TCGTGGGCTNONE 
J065113K02TCGTGGGCTNONE 
J065167F23TCGTGGGCTNONE 
J065168A06TCGTGGGCTNONE 
J065172D04TCGTGGGCTNONE 
J065191F04TCGTGGGCTNONE 
J065191K22TCGTGGGCTNONE 
J065193D04TCGTGGGCTNONE 
J065200O11TCGTGGGCTNONE 
J075063B18TCGTGGGCTNONE 
J075127I16TCGTGGGCTNONE 
J075189P14TCGTGGGCTNONE 
J080001P12TCGTGGGCTNONE 
J080004I20TCGTGGGCTNONE 
J080005I23TCGTGGGCTNONE 
J080007H13TCGTGGGCTNONE 
J080010O21TCGTGGGCTNONE 
J080011A07TCGTGGGCTNONE 
J080012N11TCGTGGGCTNONE 
J080012P03TCGTGGGCTNONE 
J080023O17TCGTGGGCTNONE 
J080033D12TCGTGGGCTNONE 
J080035G15TCGTGGGCTNONE 
J080036M15TCGTGGGCTNONE 
J080040N08TCGTGGGCTNONE 
J080044D18TCGTGGGCTNONE 
J080045E16TCGTGGGCTNONE 
J080045H12TCGTGGGCTNONE 
J080047D17TCGTGGGCTNONE 
J080054B19TCGTGGGCTNONE 
J080056P07TCGTGGGCTNONE 
J080063H06TCGTGGGCTNONE 
J080065A11TCGTGGGCTNONE 
J080066B03TCGTGGGCTNONE 
J080066H02TCGTGGGCTNONE 
J080067K05TCGTGGGCTNONE 
J080086B05TCGTGGGCTNONE 
J080096K02TCGTGGGCTNONE 
J080315F07TCGTGGGCTNONE 
J080315M01TCGTGGGCTNONE 
J090001L02TCGTGGGCTNONE 
J090001L03TCGTGGGCTNONE 
J090004I19TCGTGGGCTNONE 
J090024E02TCGTGGGCTNONE 
J090034N18TCGTGGGCTNONE 
J090036K17TCGTGGGCTNONE 
J090051C05TCGTGGGCTNONE 
J090094B01TCGTGGGCTNONE 
J100030C02TCGTGGGCTNONE 
J100033D19TCGTGGGCTNONE 
J100036K05TCGTGGGCTNONE 
J100042F23TCGTGGGCTNONE 
J100045C03TCGTGGGCTNONE 
J100045L18TCGTGGGCTNONE 
J100047A19TCGTGGGCTNONE 
J100052A07TCGTGGGCTNONE 
J100066N04TCGTGGGCTNONE 
J100066N18TCGTGGGCTNONE 
J100074B08TCGTGGGCTNONE 
J100074G10TCGTGGGCTNONE 
J100074H15TCGTGGGCTNONE 
J100074N03TCGTGGGCTNONE 
J100077H11TCGTGGGCTNONE 
J100078G24TCGTGGGCTNONE 
J100089K09TCGTGGGCTNONE 
Os01g0934500AK073211GAGGCCCACGAAConserved hypothetical protein. 
Os01g0942300AK063126TCGTGGGCSimilar to Beta glucanase precursor (EC 3.2.1.73) (Fragment). 
Os01g0951800AK069239TCGTGGGCTTAProtein prenyltransferase domain containing protein. 
Os01g0958100AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os02g0138600AK071778GCCCACGAAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023113L07GCCCACGAANONE 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
Os02g0178400009-151-B08TTGGCCCACGAGGCCCATAANONE 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
AK121516TTGGCCCACGAGGCCCATAANONE 
J033026A17TTGGCCCACGAGGCCCATAANONE 
J065011K14TTGGCCCACGAGGCCCATAANONE 
J065056D01TTGGCCCACGAGGCCCATAANONE 
J065061L22TTGGCCCACGAGGCCCATAANONE 
J065076M01TTGGCCCACGAGGCCCATAANONE 
J075092E14TTGGCCCACGAGGCCCATAANONE 
Os02g0195500AK066481GCCCACGAANONE 
AK121049GCCCACGAAProtein of unknown function DUF1680 family protein. 
Os02g0226900AK064279CAGGCCCACGAACGGCCCProtein prenyltransferase domain containing protein. 
Os02g0245000AK119770CCAGGCCCACGANONE 
AK119874CCAGGCCCACGASWAP/Surp domain containing protein. 
J065038L11CCAGGCCCACGANONE 
J100059I06CCAGGCCCACGANONE 
J100076C23CCAGGCCCACGANONE 
J100081P08CCAGGCCCACGANONE 
J100084C13CCAGGCCCACGANONE 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0437800AK064288GCCCACGANONE 
AK066001GCCCACGASimilar to Vacuolar protein-sorting protein 45 homolog (AtVPS45). 
AK067724GCCCACGANONE 
Os02g0473000AK065460GCCCACGARiboflavin biosynthesis protein RibD family protein. 
Os02g0475300AK072737CCCCCGCGTCGTGGGCCCCACCTGNONE 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0517333AK105573GCAGCCCACGANONE 
AK111331GCAGCCCACGAConserved hypothetical protein. 
Os02g0601000AK111034GCCCACGAAConserved hypothetical protein. 
Os02g0605600016-017-B02AAGGCCCACGANONE 
AK066104AAGGCCCACGALUC7 related family protein. 
J013052G16AAGGCCCACGANONE 
J043022E03AAGGCCCACGANONE 
J065105P10AAGGCCCACGANONE 
Os02g0610700014-008-A03TTCGTGGGCCGGCNONE 
AK059205TTCGTGGGCCGGCConserved hypothetical protein. 
AK100281TTCGTGGGCCGGCNONE 
J023074H03TTCGTGGGCCGGCNONE 
J065002J16TTCGTGGGCCGGCNONE 
J065032I20TTCGTGGGCCGGCNONE 
J065076A07TTCGTGGGCCGGCNONE 
J065142O21TTCGTGGGCCGGCNONE 
J065203A03TTCGTGGGCCGGCNONE 
J075017F24TTCGTGGGCCGGCNONE 
J075017G24TTCGTGGGCCGGCNONE 
Os02g0614600AK058581TCGTGGGCCTCNONE 
Os02g0641800AK066504TCGTGGGCSimilar to RNA helicase (Fragment). 
AK072124TCGTGGGCNONE 
Os02g0655300006-024-H05GCAGCCCACGANONE 
006-032-G04GCAGCCCACGANONE 
006-045-F03GCAGCCCACGANONE 
006-076-D04GCAGCCCACGANONE 
006-086-C09GCAGCCCACGANONE 
006-104-C07GCAGCCCACGANONE 
AK061544GCAGCCCACGANONE 
AK103778GCAGCCCACGANONE 
AK106107GCAGCCCACGANONE 
AK120006GCAGCCCACGANONE 
AY363174GCAGCCCACGASimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21GCAGCCCACGANONE 
J065021C16GCAGCCCACGANONE 
J065182F01GCAGCCCACGANONE 
J075063I18GCAGCCCACGANONE 
J075151E01GCAGCCCACGANONE 
J075198K18GCAGCCCACGANONE 
J090026M06GCAGCCCACGANONE 
J090081H02GCAGCCCACGANONE 
J100061E20GCAGCCCACGANONE 
Os02g0661900006-030-G12GCCCACGANONE 
AK061447GCCCACGASimilar to Vesicle-associated membrane protein-associated protein B/C (VAMP- associated protein B/C) (VAMP-B/VAMP-C) (VAP-B/VAP-C). Splice isoform 2. 
AK068742GCCCACGANONE 
J075046K13GCCCACGANONE 
J075139O08GCCCACGANONE 
J075149I16GCCCACGANONE 
Os02g0681100AK100584GAAGCCCACGAAProtein of unknown function DUF604 family protein. 
J023106A15GAAGCCCACGAANONE 
Os02g0681200006-024-F11CCAAGCCCACGACCCGCACCGCNONE 
006-051-H06CCAAGCCCACGACCCGCACCGCNONE 
006-062-F08CCAAGCCCACGACCCGCACCGCNONE 
009-172-G01CCAAGCCCACGACCCGCACCGCNONE 
AK071853CCAAGCCCACGACCCGCACCGCZinc finger, RING-type domain containing protein. 
AK099314CCAAGCCCACGACCCGCACCGCNONE 
AK104122CCAAGCCCACGACCCGCACCGCNONE 
Os02g0697500006-055-B12GCCCACGANONE 
AK105891GCCCACGANONE 
Os02g0707900AK064638TTCGTGGGCNONE 
Os02g0708100AK059630TCGTGGGCCCGCNONE 
AK102055TCGTGGGCCCGCSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5). 
Os02g0740300AK067833TTCGTGGGCAAA ATPase domain containing protein. 
Os02g0744700AF395537AGCCCACGANONE 
AJ308110AGCCCACGANONE 
AK066446AGCCCACGASimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0745400AK072229AGGGCCCACGAGlycosyl transferase, family 8 protein. 
AK108072AGGGCCCACGANONE 
Os02g0753300012-010-H04AGCCCACGANONE 
AK065736AGCCCACGALipoxygenase, LH2 domain containing protein. 
AK104930AGCCCACGANONE 
J013038J04AGCCCACGANONE 
J065041B21AGCCCACGANONE 
J065162K13AGCCCACGANONE 
J065187G18AGCCCACGANONE 
J075051J11AGCCCACGANONE 
J100027H02AGCCCACGANONE 
Os02g0754500AK069965TATTGGGCCCACGANONE 
AK105696TATTGGGCCCACGAAmidase family protein. 
Os02g0793000AK070242GAGGCCCACGANONE 
AK099173GAGGCCCACGANONE 
AK105863GAGGCCCACGAZinc finger, CCCH-type domain containing protein. 
Os02g0795900012-075-B04GAGGCCCACGAANONE 
012-075-B04TGCGGCCCACGANONE 
AK105305GAGGCCCACGAASimilar to DEAD box-like RNA helicase (Fragment). 
AK105305TGCGGCCCACGASimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21GAGGCCCACGAANONE 
J090031C21TGCGGCCCACGANONE 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os03g0130400AK070255TCGTGGGCCCCAdenylate kinase, subfamily protein. 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0183200AK106987GCCCACGAAConserved hypothetical protein. 
J065001J11GCCCACGAANONE 
J065013J06GCCCACGAANONE 
J065025E10GCCCACGAANONE 
J065039L04GCCCACGAANONE 
J065041H08GCCCACGAANONE 
J065046C23GCCCACGAANONE 
J065049D09GCCCACGAANONE 
J065057M12GCCCACGAANONE 
J065083P08GCCCACGAANONE 
J065096G10GCCCACGAANONE 
J065132D06GCCCACGAANONE 
J065139F18GCCCACGAANONE 
J065159E02GCCCACGAANONE 
J075161E24GCCCACGAANONE 
J075182J22GCCCACGAANONE 
J100053C12GCCCACGAANONE 
J100085D04GCCCACGAANONE 
Os03g0238700AK073387TCGTGGGCCGCAGGCCCGCASimilar to Acid phosphatase type 5. 
J033043K11TCGTGGGCCGCAGGCCCGCANONE 
Os03g0271100AB095095TCCGGCCCACGANONE 
AK060821TCCGGCCCACGASimilar to Sigma factor SIG2B. 
AK067693TCCGGCCCACGANONE 
AK099036TCCGGCCCACGANONE 
Os03g0295500009-083-F02AAAAGCCCACGAANONE 
J053029J05AAAAGCCCACGAANONE 
J053054B07AAAAGCCCACGAACHCH domain containing protein. 
J065024G23AAAAGCCCACGAANONE 
J065036F08AAAAGCCCACGAANONE 
J065066M11AAAAGCCCACGAANONE 
J065143G19AAAAGCCCACGAANONE 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
J033050J24CACGTGGGGTCGTGGGCCCCAGNONE 
J075180K24CACGTGGGGTCGTGGGCCCCAGNONE 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
J065110H17CTGGGGCCCACGACCCCACGTGNONE 
J065156H13CTGGGGCCCACGACCCCACGTGNONE 
J065175P03CTGGGGCCCACGACCCCACGTGNONE 
J075007D24CTGGGGCCCACGACCCCACGTGNONE 
J100040M24CTGGGGCCCACGACCCCACGTGNONE 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
Os03g0410700J065102A22CCCGGCCCACGANONE 
Os03g0410900J065067F10TCGTGGGCCGGGNONE 
J065073D08TCGTGGGCCGGGNONE 
J065176C06TCGTGGGCCGGGNONE 
J065189O13TCGTGGGCCGGGNONE 
J065214E05TCGTGGGCCGGGNONE 
J080007H09TCGTGGGCCGGGNONE 
J080012B19TCGTGGGCCGGGNONE 
J080020J16TCGTGGGCCGGGNONE 
J080038J22TCGTGGGCCGGGNONE 
J080045I09TCGTGGGCCGGGNONE 
J080059M16TCGTGGGCCGGGNONE 
J080060C19TCGTGGGCCGGGNONE 
J080080P22TCGTGGGCCGGGNONE 
J080083C03TCGTGGGCCGGGNONE 
J080093M17TCGTGGGCCGGGNONE 
J100029F12TCGTGGGCCGGGLike-Sm ribonucleoprotein, core family protein. 
Os03g0438400AK070383GCTCAGCTCGTGGGCTCGGCTCGGCTCGGConserved hypothetical protein. 
J023054E02GCTCAGCTCGTGGGCTCGGCTCGGCTCGGNONE 
Os03g0566500AK070576GCCCACGAALupus La protein family protein. 
Os03g0578200003-117-B07TCGTGGGCCCAAGNONE 
009-175-C06TCGTGGGCCCAAGNONE 
009-179-H05TCGTGGGCCCAAGNONE 
013-078-G11TCGTGGGCCCAAGNONE 
AK062224TCGTGGGCCCAAGNONE 
AK120432TCGTGGGCCCAAGConserved hypothetical protein. 
J013096L16TCGTGGGCCCAAGNONE 
J100042G12TCGTGGGCCCAAGNONE 
J100069F04TCGTGGGCCCAAGNONE 
J100073H14TCGTGGGCCCAAGNONE 
Os03g0586800003-114-H11TTCGTGGGCCTANONE 
AK063765TTCGTGGGCCTASimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TTCGTGGGCCTANONE 
J090004H06TTCGTGGGCCTANONE 
J090022N15TTCGTGGGCCTANONE 
J100035E05TTCGTGGGCCTANONE 
J100041L05TTCGTGGGCCTANONE 
J100041M18TTCGTGGGCCTANONE 
J100057P04TTCGTGGGCCTANONE 
J100089H06TTCGTGGGCCTANONE 
J100090C23TTCGTGGGCCTANONE 
Os03g0596800AK073603TCGTGGGCTGGConserved hypothetical protein. 
J033052N01TCGTGGGCTGGNONE 
Os03g0626800015-067-B09GGGTGGGCTGTTCGTGGGCCTCNONE 
AK111916GGGTGGGCTGTTCGTGGGCCTCNONE 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
J075016C21GGGTGGGCTGTTCGTGGGCCTCNONE 
Os03g0668400AK119454AGCCCACGATGGCCCAGGCCCAGGCCCAGGProtein of unknown function DUF860, plant family protein. 
Os03g0681900006-042-F08GGGCCGGCCCACGANONE 
009-043-F12GGGCCGGCCCACGANONE 
AK061750GGGCCGGCCCACGANONE 
AK062094GGGCCGGCCCACGASimilar to RGP-3 (Fragment). 
J033034F01GGGCCGGCCCACGANONE 
J033131F11GGGCCGGCCCACGANONE 
J033143N03GGGCCGGCCCACGANONE 
Os03g0698900013-074-A08TCGTGGGCCACGTCNONE 
AK073303TCGTGGGCCACGTCAlkaline phytoceramidase family protein. 
AK103953TCGTGGGCCACGTCNONE 
J033024P22TCGTGGGCCACGTCNONE 
J065194N16TCGTGGGCCACGTCNONE 
J065195O11TCGTGGGCCACGTCNONE 
J075020F03TCGTGGGCCACGTCNONE 
J075032P18TCGTGGGCCACGTCNONE 
J075037H13TCGTGGGCCACGTCNONE 
J075147I01TCGTGGGCCACGTCNONE 
J075187B13TCGTGGGCCACGTCNONE 
J100043G08TCGTGGGCCACGTCNONE 
J100060L06TCGTGGGCCACGTCNONE 
J100063O21TCGTGGGCCACGTCNONE 
J100066O13TCGTGGGCCACGTCNONE 
J100072K20TCGTGGGCCACGTCNONE 
J100083G21TCGTGGGCCACGTCNONE 
J100085D07TCGTGGGCCACGTCNONE 
Os03g0708800009-180-H07GCCCACGAANONE 
014-021-A05GCCCACGAANONE 
AK063141GCCCACGAANONE 
AK063654GCCCACGAAHypothetical protein. 
AK121625GCCCACGAANONE 
J065041G22GCCCACGAANONE 
J065063P10GCCCACGAANONE 
J065158O11GCCCACGAANONE 
Os03g0725300011-085-E09TAGGCCCACGAANONE 
AK063969TAGGCCCACGAASimilar to Dbr1-prov protein. 
AK073636TAGGCCCACGAANONE 
J033050L15TAGGCCCACGAANONE 
J053082G03TAGGCCCACGAANONE 
Os03g0739700003-104-A04TTCGTGGGCTTTNONE 
AK062272TTCGTGGGCTTTUncharacterized protein UPF0114 family protein. 
Os03g0752800AB041020TCGGCCCAGAAAAGCCCACGANONE 
AF058697TCGGCCCAGAAAAGCCCACGAMADS14 protein. 
AF139664TCGGCCCAGAAAAGCCCACGANONE 
AK121171TCGGCCCAGAAAAGCCCACGANONE 
AY332478TCGGCCCAGAAAAGCCCACGANONE 
AY551916TCGGCCCAGAAAAGCCCACGANONE 
J023081C04TCGGCCCAGAAAAGCCCACGANONE 
Os03g0772800009-023-E05AAAGCCCACGAANONE 
009-059-F12AAAGCCCACGAANONE 
009-114-B08AAAGCCCACGAANONE 
009-115-G09AAAGCCCACGAANONE 
009-151-D08AAAGCCCACGAANONE 
009-158-A10AAAGCCCACGAANONE 
009-191-H02AAAGCCCACGAANONE 
009-192-E05AAAGCCCACGAANONE 
009-197-F11AAAGCCCACGAANONE 
AK059576AAAGCCCACGAANONE 
AK121608AAAGCCCACGAACytochrome c oxidase, subunit VIa family protein. 
J023087H20AAAGCCCACGAANONE 
J023105P14AAAGCCCACGAANONE 
J033026P15AAAGCCCACGAANONE 
J033042K10AAAGCCCACGAANONE 
J033133C09AAAGCCCACGAANONE 
J065123K13AAAGCCCACGAANONE 
J075190D03AAAGCCCACGAANONE 
J080310M14AAAGCCCACGAANONE 
J080317L14AAAGCCCACGAANONE 
J100067J19AAAGCCCACGAANONE 
J100079H21AAAGCCCACGAANONE 
Os03g0776900AK107941GCGGCCCACGASimilar to DNAJ protein-like. 
J053100E14GCGGCCCACGANONE 
J075111A12GCGGCCCACGANONE 
Os03g0796600003-113-D10TCGTGGGCCCCACCNONE 
011-076-B12TCGTGGGCCCCACCNONE 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
J075105C03TCGTGGGCCCCACCNONE 
J080036O17TCGTGGGCCCCACCNONE 
J080064E16TCGTGGGCCCCACCNONE 
J080069E03TCGTGGGCCCCACCNONE 
J080079E23TCGTGGGCCCCACCNONE 
J090036H20TCGTGGGCCCCACCNONE 
J100029L10TCGTGGGCCCCACCNONE 
J100055G09TCGTGGGCCCCACCNONE 
Os03g0833700011-060-A10GAGGCCCACGAANONE 
AK121918GAGGCCCACGAARNA 3'-terminal phosphate cyclase family protein. 
Os03g0836200009-165-F07TCGTGGGCNONE 
015-092-G01TCGTGGGCNONE 
AK058443TCGTGGGCNONE 
AK067084TCGTGGGCSimilar to RNA-binding protein RZ-1. 
AK101225TCGTGGGCNONE 
J013092A03TCGTGGGCNONE 
J013095N17TCGTGGGCNONE 
J013147J18TCGTGGGCNONE 
J023019O10TCGTGGGCNONE 
J023065N18TCGTGGGCNONE 
J033113E18TCGTGGGCNONE 
J033133E03TCGTGGGCNONE 
J065059J15TCGTGGGCNONE 
J065075O11TCGTGGGCNONE 
J065119I07TCGTGGGCNONE 
J065171J03TCGTGGGCNONE 
J090016D21TCGTGGGCNONE 
J090081O03TCGTGGGCNONE 
J100040G18TCGTGGGCNONE 
J100040L10TCGTGGGCNONE 
J100055H13TCGTGGGCNONE 
J100059I22TCGTGGGCNONE 
J100078A08TCGTGGGCNONE 
Os03g0852600009-174-G04AAGGCCCACGANONE 
AK063101AAGGCCCACGAProtein of unknown function DUF565 family protein. 
J065131H12AAGGCCCACGANONE 
J090046K24AAGGCCCACGANONE 
Os04g0110500AK073722GCCCACGAANONE 
AK103144GCCCACGAAProtein prenyltransferase domain containing protein. 
Os04g0196600AK121999GGCCCACGAProtein of unknown function DUF563 family protein. 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0390500AK066575ACAGCCCACGAANONE 
AK099908ACAGCCCACGAANONE 
AK100148ACAGCCCACGAANONE 
Os04g0430200AK070740GCCCACGAAPhosphatidylinositol-specific phospholipase C, X region domain containing protein. 
Os04g0445100014-052-B04GTGGCCCACGANONE 
AK063700GTGGCCCACGASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0448200AK068842TCGTGGGCConserved hypothetical protein. 
Os04g0457000006-027-A09TCGTGGGCNONE 
006-027-D01TCGTGGGCNONE 
006-030-G04TCGTGGGCNONE 
006-038-H12TCGTGGGCNONE 
006-042-E09TCGTGGGCNONE 
006-049-C02TCGTGGGCNONE 
006-049-C09TCGTGGGCNONE 
006-052-C03TCGTGGGCNONE 
006-053-C01TCGTGGGCNONE 
006-054-B08TCGTGGGCNONE 
006-054-G05TCGTGGGCNONE 
006-058-A06TCGTGGGCNONE 
006-059-G07TCGTGGGCNONE 
006-088-F04TCGTGGGCNONE 
006-091-G07TCGTGGGCNONE 
006-093-C04TCGTGGGCNONE 
006-093-H03TCGTGGGCNONE 
006-094-B05TCGTGGGCNONE 
006-097-B05TCGTGGGCNONE 
006-097-E02TCGTGGGCNONE 
006-098-G09TCGTGGGCNONE 
006-099-A11TCGTGGGCNONE 
006-099-B09TCGTGGGCNONE 
006-099-E10TCGTGGGCNONE 
006-111-A07TCGTGGGCNONE 
006-111-H12TCGTGGGCNONE 
006-114-B12TCGTGGGCNONE 
006-115-H03TCGTGGGCNONE 
009-042-G09TCGTGGGCNONE 
009-117-G09TCGTGGGCNONE 
009-121-E02TCGTGGGCNONE 
009-162-H07TCGTGGGCNONE 
011-063-C05TCGTGGGCNONE 
AK066070TCGTGGGCSimilar to Chlorophyll a/b-binding protein CP24, photosystem II (Fragment). 
AK104811TCGTGGGCNONE 
J013055K10TCGTGGGCNONE 
J013072C14TCGTGGGCNONE 
J013091A08TCGTGGGCNONE 
J013123L18TCGTGGGCNONE 
J013129M15TCGTGGGCNONE 
J013135J21TCGTGGGCNONE 
J013170D09TCGTGGGCNONE 
J023107N10TCGTGGGCNONE 
J065142G08TCGTGGGCNONE 
J075023K20TCGTGGGCNONE 
J075119K14TCGTGGGCNONE 
J075134I20TCGTGGGCNONE 
J075161H06TCGTGGGCNONE 
J080014L13TCGTGGGCNONE 
J080026H08TCGTGGGCNONE 
J080070F02TCGTGGGCNONE 
J080070G22TCGTGGGCNONE 
J080093H23TCGTGGGCNONE 
J080305C11TCGTGGGCNONE 
J080305H15TCGTGGGCNONE 
J080317P21TCGTGGGCNONE 
J090023F10TCGTGGGCNONE 
J100061O10TCGTGGGCNONE 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0477500AK063950GCCCACGANONE 
AK067372GCCCACGAGlycosyl transferase, family 17 protein. 
AK100897GCCCACGANONE 
J013106K01GCCCACGANONE 
J065025M07GCCCACGANONE 
J065025M08GCCCACGANONE 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08TCGTGGGCCCCACCCGNONE 
Os04g0552400AK069623TTCGTGGGCTGGSimilar to ZPT2-13. 
J023023M18TTCGTGGGCTGGNONE 
J023063H11TTCGTGGGCTGGNONE 
Os04g0577500006-039-C03TCTGGGCCCACGANONE 
006-043-H01TCTGGGCCCACGANONE 
AK061538TCTGGGCCCACGANONE 
AK065648TCTGGGCCCACGATatD-related deoxyribonuclease family protein. 
AK104763TCTGGGCCCACGANONE 
J013035E21TCTGGGCCCACGANONE 
J013066M11TCTGGGCCCACGANONE 
J100026B02TCTGGGCCCACGANONE 
Os04g0589200AK068571GAGGCCCAATCGTGGGCConserved hypothetical protein. 
AK102463GAGGCCCAATCGTGGGCNONE 
J075083K10GAGGCCCAATCGTGGGCNONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0670600AK064255TCAGGCCCACGAANONE 
Os04g0672100AK121689GCAGCCCACGAASimilar to Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kinase). 
J033057E18GCAGCCCACGAANONE 
J033071C20GCAGCCCACGAANONE 
J033107C06GCAGCCCACGAANONE 
J090033H05GCAGCCCACGAANONE 
J090036E04GCAGCCCACGAANONE 
J090082J15GCAGCCCACGAANONE 
Os04g0674800AK119913CGCGTGCGCCCACGASimilar to CEL1=CELLULASE 1 (Fragment). 
Os05g0148300009-031-A08CCTCGCCCACGANONE 
AK062421CCTCGCCCACGARibosomal protein S27, mitochondrial family protein. 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
Os05g0346300009-033-C06GCCCACGANONE 
AF529175GCCCACGANONE 
AK061627GCCCACGASimilar to 40S ribosomal protein S7. 
AK103081GCCCACGANONE 
AK104191GCCCACGANONE 
J013049B09GCCCACGANONE 
J023142E24GCCCACGANONE 
J033052M14GCCCACGANONE 
J033089N04GCCCACGANONE 
J033118F01GCCCACGANONE 
J065054E07GCCCACGANONE 
J065066L18GCCCACGANONE 
J065078C21GCCCACGANONE 
J065127G23GCCCACGANONE 
J065128N24GCCCACGANONE 
J065144P17GCCCACGANONE 
J065147P14GCCCACGANONE 
J065170E16GCCCACGANONE 
J065175D17GCCCACGANONE 
J065176M05GCCCACGANONE 
J065218G20GCCCACGANONE 
J090074J12GCCCACGANONE 
J100019H16GCCCACGANONE 
J100031N24GCCCACGANONE 
J100072G08GCCCACGANONE 
J100086I23GCCCACGANONE 
Os05g0346400AK058872TCGTGGGCNONE 
AK102727TCGTGGGCProtein of unknown function DUF538 family protein. 
J033105N07TCGTGGGCNONE 
J100077I17TCGTGGGCNONE 
Os05g0357200014-046-H09TCGTGGGCCCCACGGCCNONE 
AK064069TCGTGGGCCCCACGGCCNONE 
AK072064TCGTGGGCCCCACGGCCMitochondrial substrate carrier family protein. 
J065038M01TCGTGGGCCCCACGGCCNONE 
J065121C16TCGTGGGCCCCACGGCCNONE 
J075173E09TCGTGGGCCCCACGGCCNONE 
J080307A20TCGTGGGCCCCACGGCCNONE 
J090046B19TCGTGGGCCCCACGGCCNONE 
J100033N12TCGTGGGCCCCACGGCCNONE 
J100036G01TCGTGGGCCCCACGGCCNONE 
J100057B19TCGTGGGCCCCACGGCCNONE 
Os05g0364300009-036-C07TTCGTGGGCTGTNONE 
AK062440TTCGTGGGCTGTConserved hypothetical protein. 
Os05g0397300009-051-E02TTCGTGGGGCCCACGANONE 
009-060-E03TTCGTGGGGCCCACGANONE 
009-075-B01TTCGTGGGGCCCACGANONE 
009-082-B11TTCGTGGGGCCCACGANONE 
009-136-D05TTCGTGGGGCCCACGANONE 
AK062621TTCGTGGGGCCCACGANONE 
AK066003TTCGTGGGGCCCACGANONE 
AK070832TTCGTGGGGCCCACGAConserved hypothetical protein. 
J023066C05TTCGTGGGGCCCACGANONE 
Os05g0429700AK069203TCGTGGGCCCCACCACNONE 
AK103559TCGTGGGCCCCACCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0477300009-016-A12ATTGGGCCTCCAGCCCACGANONE 
009-029-B06ATTGGGCCTCCAGCCCACGANONE 
009-166-G04ATTGGGCCTCCAGCCCACGANONE 
013-016-C08ATTGGGCCTCCAGCCCACGANONE 
016-091-E10ATTGGGCCTCCAGCCCACGANONE 
AK061933ATTGGGCCTCCAGCCCACGANONE 
AK098982ATTGGGCCTCCAGCCCACGANONE 
AK119683ATTGGGCCTCCAGCCCACGANONE 
AK119693ATTGGGCCTCCAGCCCACGANONE 
AK119797ATTGGGCCTCCAGCCCACGANONE 
AK121584ATTGGGCCTCCAGCCCACGARibosomal protein S26E family protein. 
J013063C18ATTGGGCCTCCAGCCCACGANONE 
J013129B12ATTGGGCCTCCAGCCCACGANONE 
J013152K23ATTGGGCCTCCAGCCCACGANONE 
J023013K21ATTGGGCCTCCAGCCCACGANONE 
J023077O13ATTGGGCCTCCAGCCCACGANONE 
J023085D23ATTGGGCCTCCAGCCCACGANONE 
J033029G14ATTGGGCCTCCAGCCCACGANONE 
J033037F24ATTGGGCCTCCAGCCCACGANONE 
J033040H08ATTGGGCCTCCAGCCCACGANONE 
J033064J24ATTGGGCCTCCAGCCCACGANONE 
J033085C06ATTGGGCCTCCAGCCCACGANONE 
J033123P10ATTGGGCCTCCAGCCCACGANONE 
J033127K23ATTGGGCCTCCAGCCCACGANONE 
J033147D24ATTGGGCCTCCAGCCCACGANONE 
J075064E05ATTGGGCCTCCAGCCCACGANONE 
J090026B03ATTGGGCCTCCAGCCCACGANONE 
J100050M11ATTGGGCCTCCAGCCCACGANONE 
Os05g0519700014-100-B04TCGTGGGCCCCACANONE 
AF332981TCGTGGGCCCCACANONE 
AK100903TCGTGGGCCCCACANONE 
AK105433TCGTGGGCCCCACAHeat shock protein 101. 
Os05g0566800AK065748TCGTGGGCCGTCCold acclimation protein COR413-TM1. 
AY181210TCGTGGGCCGTCNONE 
Os05g0579500AK121528CCTGGGCCCACGAConserved hypothetical protein. 
J033030I07CCTGGGCCCACGANONE 
Os06g0134900AK103205TCGTGGGCCTTConserved hypothetical protein. 
J033122E01TCGTGGGCCTTNONE 
Os06g0135000J075008J15AAGGCCCACGANONE 
J075166F23AAGGCCCACGANONE 
J075185F03AAGGCCCACGANONE 
Os06g0214300AK108107TCGTGGGCTEsterase/lipase/thioesterase domain containing protein. 
Os06g0248200Os06g0248200TCGTGGGCCAANONE 
Os06g0506600009-119-E12TCGTGGGCTNONE 
J023086A18TCGTGGGCTNONE 
J033036I02TCGTGGGCTNONE 
J033125C16TCGTGGGCTNONE 
J065013I11TCGTGGGCTNONE 
J065026O21TCGTGGGCTNONE 
J065060H10TCGTGGGCTNONE 
J065067A15TCGTGGGCTNONE 
J065068F07TCGTGGGCTNONE 
J065085N06TCGTGGGCTNONE 
J065108N10TCGTGGGCTNONE 
J065161O11TCGTGGGCTNONE 
J065185J15TCGTGGGCTNONE 
J065191H18TCGTGGGCTNONE 
J065199J09TCGTGGGCTNONE 
J075005G03TCGTGGGCTNONE 
J075018C16TCGTGGGCTNONE 
J075061K20TCGTGGGCTNONE 
J075069J06TCGTGGGCTNONE 
J075075H19TCGTGGGCTNONE 
J075076D20TCGTGGGCTNONE 
J075078D16TCGTGGGCTNONE 
J075100J19TCGTGGGCTNONE 
J075110M11TCGTGGGCTNONE 
J075157N05TCGTGGGCTNONE 
J075171F20TCGTGGGCTNONE 
J075177G08TCGTGGGCTNONE 
J075179G08TCGTGGGCTNONE 
Os06g0542200AK058589TCGTGGGCCCTNADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0550800J065058J22AGCCCACGAConserved hypothetical protein. 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0603600012-088-B11AGCCCACGANONE 
AK063544AGCCCACGANONE 
AK072067AGCCCACGASimilar to Ids4-like protein. 
J065011H14AGCCCACGANONE 
J065020D09AGCCCACGANONE 
J065130O10AGCCCACGANONE 
J065132J07AGCCCACGANONE 
J075015L15AGCCCACGANONE 
J090091K07AGCCCACGANONE 
Os06g0703300012-007-G01TCGTGGGCNONE 
AK102730TCGTGGGCNONE 
AK105426TCGTGGGCProtein of unknown function DUF594 family protein. 
AK106736TCGTGGGCNONE 
J033105P14TCGTGGGCNONE 
J100090I18TCGTGGGCNONE 
Os06g0704300AK107008TCGTGGGCCGAAZinc finger, CCCH-type domain containing protein. 
J065038I12TCGTGGGCCGAANONE 
J065079E03TCGTGGGCCGAANONE 
J075035B15TCGTGGGCCGAANONE 
J090072D21TCGTGGGCCGAANONE 
Os07g0101500AK059667GCCGGCCCACGANONE 
AK071749GCCGGCCCACGASimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07GCCGGCCCACGANONE 
J065050F03GCCGGCCCACGANONE 
J090015C05GCCGGCCCACGANONE 
J090045C11GCCGGCCCACGANONE 
Os07g0162600015-024-F04TCGTGGGCCCGGANONE 
AK105789TCGTGGGCCCGGANONE 
AK106274TCGTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
J100026E18TCGTGGGCCCGGANONE 
J100037B07TCGTGGGCCCGGANONE 
J100090H11TCGTGGGCCCGGANONE 
Os07g0166800006-038-C11TCGTGGGCTNONE 
012-080-F02TCGTGGGCTNONE 
AK070524TCGTGGGCTRad6 (Ubiquitin carrier protein). 
AK121382TCGTGGGCTNONE 
J023022D19TCGTGGGCTNONE 
J023055G02TCGTGGGCTNONE 
J023073E02TCGTGGGCTNONE 
J023125B08TCGTGGGCTNONE 
J023127H21TCGTGGGCTNONE 
J033052G01TCGTGGGCTNONE 
J033067F13TCGTGGGCTNONE 
J065046L14TCGTGGGCTNONE 
J065178D11TCGTGGGCTNONE 
J065205N17TCGTGGGCTNONE 
J075006K17TCGTGGGCTNONE 
J075051D20TCGTGGGCTNONE 
J075109L04TCGTGGGCTNONE 
J090024K15TCGTGGGCTNONE 
J090025N04TCGTGGGCTNONE 
J090049N09TCGTGGGCTNONE 
J090070N12TCGTGGGCTNONE 
J090078O21TCGTGGGCTNONE 
J090083L07TCGTGGGCTNONE 
J100063K16TCGTGGGCTNONE 
J100083D14TCGTGGGCTNONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0187300AK103069AAGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAGGCCCACGAANONE 
J033117P16AAGGCCCACGAANONE 
Os07g0202450J065010G16GCCCACGANONE 
J065085G13GCCCACGANONE 
J065117M22GCCCACGANONE 
J065147K06GCCCACGANONE 
J065207G15GCCCACGANONE 
J090089M07GCCCACGANONE 
J100064D20GCCCACGASimilar to Mitosis protein dim1. 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0296900J075050I18CCAAGCCCACGAConserved hypothetical protein. 
Os07g0469100009-036-F03TTGTGGGCTCGTGGGCCACNONE 
009-126-D06TTGTGGGCTCGTGGGCCACNONE 
009-190-A01TTGTGGGCTCGTGGGCCACNONE 
AK061626TTGTGGGCTCGTGGGCCACNONE 
AK120365TTGTGGGCTCGTGGGCCACSimilar to Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor. 
J013068P10TTGTGGGCTCGTGGGCCACNONE 
J053066C23TTGTGGGCTCGTGGGCCACNONE 
J065011K15TTGTGGGCTCGTGGGCCACNONE 
J065053E15TTGTGGGCTCGTGGGCCACNONE 
J065167F21TTGTGGGCTCGTGGGCCACNONE 
J075065G04TTGTGGGCTCGTGGGCCACNONE 
J075146A09TTGTGGGCTCGTGGGCCACNONE 
Os07g0498300009-045-C02TCGTGGGCCCCACACNONE 
009-060-A09TCGTGGGCCCCACACNONE 
009-121-C04TCGTGGGCCCCACACNONE 
009-157-G09TCGTGGGCCCCACACNONE 
009-197-B02TCGTGGGCCCCACACNONE 
AK059124TCGTGGGCCCCACACConserved hypothetical protein. 
AK119800TCGTGGGCCCCACACNONE 
J065184M18TCGTGGGCCCCACACNONE 
J075009G21TCGTGGGCCCCACACNONE 
J075013O03TCGTGGGCCCCACACNONE 
J075061C22TCGTGGGCCCCACACNONE 
J075094E12TCGTGGGCCCCACACNONE 
J075148C01TCGTGGGCCCCACACNONE 
Os07g0545400009-136-E03TCCGGGCCCACGANONE 
013-015-G08TCCGGGCCCACGANONE 
AK059228TCCGGGCCCACGANONE 
J065040D09TCCGGGCCCACGANONE 
J065051C19TCCGGGCCCACGANONE 
J065139B05TCCGGGCCCACGANONE 
J065160E20TCCGGGCCCACGANONE 
J065207I17TCCGGGCCCACGANONE 
J080319M24TCCGGGCCCACGANONE 
Os07g0549200006-072-D03TCGTGGGCTNONE 
AK073657TCGTGGGCTNONE 
AK109365TCGTGGGCTProtein prenyltransferase domain containing protein. 
J033051K19TCGTGGGCTNONE 
J100084G13TCGTGGGCTNONE 
Os07g0568300AK067784TCGTGGGCCCCACCCGCGCNONE 
AK067895TCGTGGGCCCCACCCGCGCSimilar to ZF protein (Fragment). 
J013119M01TCGTGGGCCCCACCCGCGCNONE 
J013120B09TCGTGGGCCCCACCCGCGCNONE 
J013123G12TCGTGGGCCCCACCCGCGCNONE 
J023012C12TCGTGGGCCCCACCCGCGCNONE 
J023020G17TCGTGGGCCCCACCCGCGCNONE 
J023037E23TCGTGGGCCCCACCCGCGCNONE 
J033076I01TCGTGGGCCCCACCCGCGCNONE 
J033108A07TCGTGGGCCCCACCCGCGCNONE 
J033138J02TCGTGGGCCCCACCCGCGCNONE 
J075033L09TCGTGGGCCCCACCCGCGCNONE 
J075049E02TCGTGGGCCCCACCCGCGCNONE 
J075060N23TCGTGGGCCCCACCCGCGCNONE 
J075094H13TCGTGGGCCCCACCCGCGCNONE 
J075179L18TCGTGGGCCCCACCCGCGCNONE 
J080005P09TCGTGGGCCCCACCCGCGCNONE 
J080044J03TCGTGGGCCCCACCCGCGCNONE 
J080062G20TCGTGGGCCCCACCCGCGCNONE 
J080063L23TCGTGGGCCCCACCCGCGCNONE 
J080065B16TCGTGGGCCCCACCCGCGCNONE 
J080071K09TCGTGGGCCCCACCCGCGCNONE 
J080089C23TCGTGGGCCCCACCCGCGCNONE 
J090008P21TCGTGGGCCCCACCCGCGCNONE 
J090046B22TCGTGGGCCCCACCCGCGCNONE 
J090094C19TCGTGGGCCCCACCCGCGCNONE 
J090096B19TCGTGGGCCCCACCCGCGCNONE 
J100060G03TCGTGGGCCCCACCCGCGCNONE 
J100082D16TCGTGGGCCCCACCCGCGCNONE 
Os07g0589000AK069813GCCCACGALateral organ boundaries, LOB domain containing protein. 
J023030F23GCCCACGANONE 
J065165H21GCCCACGANONE 
J065193G01GCCCACGANONE 
J075093F03GCCCACGANONE 
Os07g0633200AK061338TAGGCCCACGASimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451TAGGCCCACGANONE 
J033096E22TAGGCCCACGANONE 
J033125D06TAGGCCCACGANONE 
J075048C23TAGGCCCACGANONE 
J075050G02TAGGCCCACGANONE 
J075104J04TAGGCCCACGANONE 
J075144N04TAGGCCCACGANONE 
Os07g0639800AK074012CAAGTGGGCCCACGAGCCCACCCGSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK074012GAGGCCCACGASimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592CAAGTGGGCCCACGAGCCCACCCGNONE 
AK104592GAGGCCCACGANONE 
AK104739CAAGTGGGCCCACGAGCCCACCCGNONE 
AK104739GAGGCCCACGANONE 
Os07g0639900J080305F09TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
J080311G07TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080315B14TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080317C02TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os08g0107500013-094-H02TCCGGCCCACGAACCAGCCCAATTNONE 
013-095-E07TCCGGCCCACGAACCAGCCCAATTNONE 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418TCCGGCCCACGAACCAGCCCAATTNONE 
J033037P14TCCGGCCCACGAACCAGCCCAATTNONE 
J090025I15TCCGGCCCACGAACCAGCCCAATTNONE 
J100022F23TCCGGCCCACGAACCAGCCCAATTNONE 
Os08g0116500009-007-E05GAGGCCCACGATCCGGCCCAAGNONE 
009-074-C07GAGGCCCACGATCCGGCCCAAGNONE 
009-098-A07GAGGCCCACGATCCGGCCCAAGNONE 
009-100-C03GAGGCCCACGATCCGGCCCAAGNONE 
009-136-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-138-B08GAGGCCCACGATCCGGCCCAAGNONE 
009-144-B06GAGGCCCACGATCCGGCCCAAGNONE 
009-184-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-189-F01GAGGCCCACGATCCGGCCCAAGNONE 
013-006-E05GAGGCCCACGATCCGGCCCAAGNONE 
013-015-C10GAGGCCCACGATCCGGCCCAAGNONE 
013-019-F09GAGGCCCACGATCCGGCCCAAGNONE 
013-020-C01GAGGCCCACGATCCGGCCCAAGNONE 
013-021-F05GAGGCCCACGATCCGGCCCAAGNONE 
013-035-D08GAGGCCCACGATCCGGCCCAAGNONE 
013-038-C09GAGGCCCACGATCCGGCCCAAGNONE 
013-054-B07GAGGCCCACGATCCGGCCCAAGNONE 
013-061-G10GAGGCCCACGATCCGGCCCAAGNONE 
013-074-B01GAGGCCCACGATCCGGCCCAAGNONE 
013-079-B06GAGGCCCACGATCCGGCCCAAGNONE 
013-099-B09GAGGCCCACGATCCGGCCCAAGNONE 
013-099-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-023-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-032-C07GAGGCCCACGATCCGGCCCAAGNONE 
014-045-E02GAGGCCCACGATCCGGCCCAAGNONE 
014-085-C02GAGGCCCACGATCCGGCCCAAGNONE 
014-087-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-089-C04GAGGCCCACGATCCGGCCCAAGNONE 
014-090-E01GAGGCCCACGATCCGGCCCAAGNONE 
014-094-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-097-B07GAGGCCCACGATCCGGCCCAAGNONE 
015-024-A12GAGGCCCACGATCCGGCCCAAGNONE 
015-032-C06GAGGCCCACGATCCGGCCCAAGNONE 
016-053-E09GAGGCCCACGATCCGGCCCAAGNONE 
016-081-F10GAGGCCCACGATCCGGCCCAAGNONE 
AK058240GAGGCCCACGATCCGGCCCAAGSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09GAGGCCCACGATCCGGCCCAAGNONE 
J023107O19GAGGCCCACGATCCGGCCCAAGNONE 
J053029K21GAGGCCCACGATCCGGCCCAAGNONE 
J053073P11GAGGCCCACGATCCGGCCCAAGNONE 
J053074B04GAGGCCCACGATCCGGCCCAAGNONE 
J053078M14GAGGCCCACGATCCGGCCCAAGNONE 
J065001E12GAGGCCCACGATCCGGCCCAAGNONE 
J065006J12GAGGCCCACGATCCGGCCCAAGNONE 
J065015C06GAGGCCCACGATCCGGCCCAAGNONE 
J065025D13GAGGCCCACGATCCGGCCCAAGNONE 
J065029A04GAGGCCCACGATCCGGCCCAAGNONE 
J065031D23GAGGCCCACGATCCGGCCCAAGNONE 
J065032E24GAGGCCCACGATCCGGCCCAAGNONE 
J065034P16GAGGCCCACGATCCGGCCCAAGNONE 
J065043B04GAGGCCCACGATCCGGCCCAAGNONE 
J065044A15GAGGCCCACGATCCGGCCCAAGNONE 
J065062D18GAGGCCCACGATCCGGCCCAAGNONE 
J065079G13GAGGCCCACGATCCGGCCCAAGNONE 
J065080A19GAGGCCCACGATCCGGCCCAAGNONE 
J065080A20GAGGCCCACGATCCGGCCCAAGNONE 
J065089N19GAGGCCCACGATCCGGCCCAAGNONE 
J065111O07GAGGCCCACGATCCGGCCCAAGNONE 
J065115N15GAGGCCCACGATCCGGCCCAAGNONE 
J065131A04GAGGCCCACGATCCGGCCCAAGNONE 
J065138H02GAGGCCCACGATCCGGCCCAAGNONE 
J065139K10GAGGCCCACGATCCGGCCCAAGNONE 
J065144A02GAGGCCCACGATCCGGCCCAAGNONE 
J065155J17GAGGCCCACGATCCGGCCCAAGNONE 
J065159D18GAGGCCCACGATCCGGCCCAAGNONE 
J065159I18GAGGCCCACGATCCGGCCCAAGNONE 
J065167H12GAGGCCCACGATCCGGCCCAAGNONE 
J065174C22GAGGCCCACGATCCGGCCCAAGNONE 
J065184A05GAGGCCCACGATCCGGCCCAAGNONE 
J065188M15GAGGCCCACGATCCGGCCCAAGNONE 
J065191D23GAGGCCCACGATCCGGCCCAAGNONE 
J065203C07GAGGCCCACGATCCGGCCCAAGNONE 
J065207C23GAGGCCCACGATCCGGCCCAAGNONE 
J065207L16GAGGCCCACGATCCGGCCCAAGNONE 
J065212F01GAGGCCCACGATCCGGCCCAAGNONE 
J065212F05GAGGCCCACGATCCGGCCCAAGNONE 
J075037B07GAGGCCCACGATCCGGCCCAAGNONE 
J075042F15GAGGCCCACGATCCGGCCCAAGNONE 
J075059J03GAGGCCCACGATCCGGCCCAAGNONE 
J075068M18GAGGCCCACGATCCGGCCCAAGNONE 
J075079E13GAGGCCCACGATCCGGCCCAAGNONE 
J075081F12GAGGCCCACGATCCGGCCCAAGNONE 
J075083I05GAGGCCCACGATCCGGCCCAAGNONE 
J075123K23GAGGCCCACGATCCGGCCCAAGNONE 
J075142F16GAGGCCCACGATCCGGCCCAAGNONE 
J075156N03GAGGCCCACGATCCGGCCCAAGNONE 
J075162K05GAGGCCCACGATCCGGCCCAAGNONE 
J075171E08GAGGCCCACGATCCGGCCCAAGNONE 
J075177N03GAGGCCCACGATCCGGCCCAAGNONE 
J075182K17GAGGCCCACGATCCGGCCCAAGNONE 
J075186K02GAGGCCCACGATCCGGCCCAAGNONE 
J075191K05GAGGCCCACGATCCGGCCCAAGNONE 
J080011E10GAGGCCCACGATCCGGCCCAAGNONE 
J080016M21GAGGCCCACGATCCGGCCCAAGNONE 
J080017A17GAGGCCCACGATCCGGCCCAAGNONE 
J080031O09GAGGCCCACGATCCGGCCCAAGNONE 
J080039G21GAGGCCCACGATCCGGCCCAAGNONE 
J080041B01GAGGCCCACGATCCGGCCCAAGNONE 
J080050G20GAGGCCCACGATCCGGCCCAAGNONE 
J080054A12GAGGCCCACGATCCGGCCCAAGNONE 
J080058O08GAGGCCCACGATCCGGCCCAAGNONE 
J080061N04GAGGCCCACGATCCGGCCCAAGNONE 
J080064L23GAGGCCCACGATCCGGCCCAAGNONE 
J080064P05GAGGCCCACGATCCGGCCCAAGNONE 
J080069I17GAGGCCCACGATCCGGCCCAAGNONE 
J080070E07GAGGCCCACGATCCGGCCCAAGNONE 
J080071B20GAGGCCCACGATCCGGCCCAAGNONE 
J080074L08GAGGCCCACGATCCGGCCCAAGNONE 
J080076N08GAGGCCCACGATCCGGCCCAAGNONE 
J080081A14GAGGCCCACGATCCGGCCCAAGNONE 
J080081J17GAGGCCCACGATCCGGCCCAAGNONE 
J080085N14GAGGCCCACGATCCGGCCCAAGNONE 
J080090B09GAGGCCCACGATCCGGCCCAAGNONE 
J080097L11GAGGCCCACGATCCGGCCCAAGNONE 
J080306H13GAGGCCCACGATCCGGCCCAAGNONE 
J080307H13GAGGCCCACGATCCGGCCCAAGNONE 
J080311F12GAGGCCCACGATCCGGCCCAAGNONE 
J080316L23GAGGCCCACGATCCGGCCCAAGNONE 
J080318H02GAGGCCCACGATCCGGCCCAAGNONE 
J090016L15GAGGCCCACGATCCGGCCCAAGNONE 
J090019I02GAGGCCCACGATCCGGCCCAAGNONE 
J090031G21GAGGCCCACGATCCGGCCCAAGNONE 
J090066C15GAGGCCCACGATCCGGCCCAAGNONE 
J100032I02GAGGCCCACGATCCGGCCCAAGNONE 
J100032N07GAGGCCCACGATCCGGCCCAAGNONE 
J100032N16GAGGCCCACGATCCGGCCCAAGNONE 
J100041P21GAGGCCCACGATCCGGCCCAAGNONE 
J100048M04GAGGCCCACGATCCGGCCCAAGNONE 
J100048M14GAGGCCCACGATCCGGCCCAAGNONE 
J100063B08GAGGCCCACGATCCGGCCCAAGNONE 
J100088E20GAGGCCCACGATCCGGCCCAAGNONE 
J100090I08GAGGCCCACGATCCGGCCCAAGNONE 
Os08g0158900AK067062AAGGCCCACGAGTP1/OBG domain containing protein. 
J013089F04AAGGCCCACGANONE 
J013092D16AAGGCCCACGANONE 
J033120K14AAGGCCCACGANONE 
J033133F24AAGGCCCACGANONE 
J033145A10AAGGCCCACGANONE 
J033145A11AAGGCCCACGANONE 
J053048H24AAGGCCCACGANONE 
J053075H10AAGGCCCACGANONE 
Os08g0159000AK073617TCGTGGGCCTTNONE 
AK103973TCGTGGGCCTTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14TCGTGGGCCTTNONE 
J033051J11TCGTGGGCCTTNONE 
J065101C10TCGTGGGCCTTNONE 
J065168B04TCGTGGGCCTTNONE 
J065184E22TCGTGGGCCTTNONE 
J080021D11TCGTGGGCCTTNONE 
J080025H10TCGTGGGCCTTNONE 
J080026N19TCGTGGGCCTTNONE 
J080034A12TCGTGGGCCTTNONE 
J080040L02TCGTGGGCCTTNONE 
J080042H19TCGTGGGCCTTNONE 
J080047B05TCGTGGGCCTTNONE 
J080047E09TCGTGGGCCTTNONE 
J080047I01TCGTGGGCCTTNONE 
J080052H19TCGTGGGCCTTNONE 
J080062K13TCGTGGGCCTTNONE 
J080063A22TCGTGGGCCTTNONE 
J080068G18TCGTGGGCCTTNONE 
J080068N19TCGTGGGCCTTNONE 
J080076G08TCGTGGGCCTTNONE 
J080077H13TCGTGGGCCTTNONE 
J080077K06TCGTGGGCCTTNONE 
J080093D15TCGTGGGCCTTNONE 
J080094D21TCGTGGGCCTTNONE 
J080097A20TCGTGGGCCTTNONE 
J080097E21TCGTGGGCCTTNONE 
J080097N17TCGTGGGCCTTNONE 
J100071K18TCGTGGGCCTTNONE 
J100072F09TCGTGGGCCTTNONE 
Os08g0178500AK107865GCCCACGAAConserved hypothetical protein. 
Os08g0359500003-107-F09CAAGGCCCACGANONE 
006-091-E08CAAGGCCCACGANONE 
006-096-E12CAAGGCCCACGANONE 
006-111-F11CAAGGCCCACGANONE 
009-090-H10CAAGGCCCACGANONE 
014-013-B02CAAGGCCCACGANONE 
014-083-E03CAAGGCCCACGANONE 
014-100-F05CAAGGCCCACGANONE 
AK104798CAAGGCCCACGANONE 
AK112034CAAGGCCCACGAHSP20-like chaperone domain containing protein. 
J013060J18CAAGGCCCACGANONE 
J033042C22CAAGGCCCACGANONE 
J065168I06CAAGGCCCACGANONE 
J075077E12CAAGGCCCACGANONE 
J075094M21CAAGGCCCACGANONE 
J090068D17CAAGGCCCACGANONE 
J100027E21CAAGGCCCACGANONE 
J100058D21CAAGGCCCACGANONE 
J100067B02CAAGGCCCACGANONE 
Os08g0387500AK105106TCGTGGGCTSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0414300AK072217GCAGCCCACGAConserved hypothetical protein. 
J065039C07GCAGCCCACGANONE 
J065098N11GCAGCCCACGANONE 
J065120J15GCAGCCCACGANONE 
J075076H12GCAGCCCACGANONE 
J075101N16GCAGCCCACGANONE 
J080010A07GCAGCCCACGANONE 
J080023C16GCAGCCCACGANONE 
J080027G22GCAGCCCACGANONE 
J080053D02GCAGCCCACGANONE 
J080065E17GCAGCCCACGANONE 
J080068C15GCAGCCCACGANONE 
J090061J10GCAGCCCACGANONE 
Os08g0442300006-067-F05TCGTGGGCNONE 
AK059843TCGTGGGCNONE 
AK071719TCGTGGGCSimilar to Calcineurin-like protein. 
AK102411TCGTGGGCNONE 
J023108H11TCGTGGGCNONE 
J033092P05TCGTGGGCNONE 
J075109C09TCGTGGGCNONE 
J090070B02TCGTGGGCNONE 
J090076M14TCGTGGGCNONE 
J100064B16TCGTGGGCNONE 
Os08g0463900AK120178TTCGTGGGCCGTTTConserved hypothetical protein. 
J013033H06TTCGTGGGCCGTTTNONE 
J075006G17TTCGTGGGCCGTTTNONE 
Os08g0490300011-064-F08AGATGGGCCGGCCCACGAANONE 
015-050-C06AGATGGGCCGGCCCACGAANONE 
AK066895AGATGGGCCGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22AGATGGGCCGGCCCACGAANONE 
J090060F02AGATGGGCCGGCCCACGAANONE 
Os08g0499900J033080E06TCGTGGGCCCCAGNONE 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0293900AGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0424600AK073882CTGGGGCCCACGAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0439600AK100577GCCGGGCCCACGAExo70 exocyst complex subunit family protein. 
J090071K03GCCGGGCCCACGANONE 
Os09g0458400AK070055AGTTGGGCAGCCCACGAAConserved hypothetical protein. 
AK120321AGTTGGGCAGCCCACGAANONE 
J065064N11AGTTGGGCAGCCCACGAANONE 
J065083J06AGTTGGGCAGCCCACGAANONE 
J065121D24AGTTGGGCAGCCCACGAANONE 
J065156I22AGTTGGGCAGCCCACGAANONE 
J065163J24AGTTGGGCAGCCCACGAANONE 
J075001I02AGTTGGGCAGCCCACGAANONE 
J090088O06AGTTGGGCAGCCCACGAANONE 
Os09g0464000AK060777ACATGGGCCCACGANONE 
AK069530ACATGGGCCCACGASimilar to Carbonate dehydratase-like protein. 
Os09g0521400AK063755CGTGTGGCGCCCACGANONE 
AK101064CGTGTGGCGCCCACGASimilar to HMG-CoA synthase. 
J013109J08CGTGTGGCGCCCACGANONE 
J023133K23CGTGTGGCGCCCACGANONE 
J033044M22CGTGTGGCGCCCACGANONE 
J033068D15CGTGTGGCGCCCACGANONE 
J043027C06CGTGTGGCGCCCACGANONE 
J065094O16CGTGTGGCGCCCACGANONE 
Os09g0554000J065123C23AGCCCACGAASimilar to Mitochondrial phosphate transporter. 
Os09g0572900AK069270TCGTGGGCCTCTCGGCCCAAGSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399CTTGGGCCGAGAGGCCCACGAProtein prenyltransferase domain containing protein. 
Os11g0114700AK065865AAAAGCCCACGANONE 
AK066583AAAAGCCCACGANONE 
AK070834AAAAGCCCACGAPAP/25A core domain containing protein. 
AK072543AAAAGCCCACGANONE 
Os11g0139500AK121845TCGTGGGCTGTATATGGGCTGANONE 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
J075053H03GCCGGCCCAAACGGCCCACGAANONE 
J075062F23GCCGGCCCAAACGGCCCACGAANONE 
J090029D08GCCGGCCCAAACGGCCCACGAANONE 
Os11g0488600AK111309CACGGCCCAGCCCACGAConserved hypothetical protein. 
J075011H20CACGGCCCAGCCCACGANONE 
J075068E17CACGGCCCAGCCCACGANONE 
J075102G16CACGGCCCAGCCCACGANONE 
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE 
J075044E18CTGGCCCAACGGCCCACGANONE 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
Os12g0124400AK071024GCAGCCCACGAExostosin-like family protein. 
Os12g0131300J090086B06TCGTGGGCCTCHypothetical protein. 
Os12g0211000AK101792TCCAACGGCCCACGAAConserved hypothetical protein. 
J033065K09TCCAACGGCCCACGAANONE 
Os12g0266000J075093G23TTCGTGGGCCCACACNONE 
Os12g0278900AK106816AAGGCCCATGCCCACGATCCGGCCCPeptidase C1A, papain family protein. 
Os12g0481100AK073151GACGGCCCACGAAAGCCCATCASimilar to RNA helicase. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.