version

Summary of OsREG602 (All List)

OrganismOryza sativa  
IDOsREG602  
SequenceGCCCACGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2149  

Entry Sequences (2149 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03CGCGTGGGCCCGGANONE 
006-030-A03GGGTGGGCCCACGCGTNONE 
006-049-C10CGCGTGGGCCCGGANONE 
006-049-C10GGGTGGGCCCACGCGTNONE 
006-054-E02CGCGTGGGCCCGGANONE 
006-054-E02GGGTGGGCCCACGCGTNONE 
011-035-H02CGCGTGGGCCCGGANONE 
011-035-H02GGGTGGGCCCACGCGTNONE 
011-036-E04CGCGTGGGCCCGGANONE 
011-036-E04GGGTGGGCCCACGCGTNONE 
012-047-C08CGCGTGGGCCCGGANONE 
012-047-C08GGGTGGGCCCACGCGTNONE 
012-079-F08CGCGTGGGCCCGGANONE 
012-079-F08GGGTGGGCCCACGCGTNONE 
012-097-C02CGCGTGGGCCCGGANONE 
012-097-C02GGGTGGGCCCACGCGTNONE 
012-100-A07CGCGTGGGCCCGGANONE 
012-100-A07GGGTGGGCCCACGCGTNONE 
013-015-H05CGCGTGGGCCCGGANONE 
013-015-H05GGGTGGGCCCACGCGTNONE 
013-047-A03CGCGTGGGCCCGGANONE 
013-047-A03GGGTGGGCCCACGCGTNONE 
013-051-B05CGCGTGGGCCCGGANONE 
013-051-B05GGGTGGGCCCACGCGTNONE 
013-061-G02CGCGTGGGCCCGGANONE 
013-061-G02GGGTGGGCCCACGCGTNONE 
013-077-H02CGCGTGGGCCCGGANONE 
013-077-H02GGGTGGGCCCACGCGTNONE 
015-005-D04CGCGTGGGCCCGGANONE 
015-005-D04GGGTGGGCCCACGCGTNONE 
015-064-B06CGCGTGGGCCCGGANONE 
015-064-B06GGGTGGGCCCACGCGTNONE 
015-072-D02CGCGTGGGCCCGGANONE 
015-072-D02GGGTGGGCCCACGCGTNONE 
016-073-E09CGCGTGGGCCCGGANONE 
016-073-E09GGGTGGGCCCACGCGTNONE 
016-088-H03CGCGTGGGCCCGGANONE 
016-088-H03GGGTGGGCCCACGCGTNONE 
AK062063CGCGTGGGCCCGGANONE 
AK062063GGGTGGGCCCACGCGTNONE 
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277CGCGTGGGCCCGGANONE 
AK102277GGGTGGGCCCACGCGTNONE 
AK119645CGCGTGGGCCCGGANONE 
AK119645GGGTGGGCCCACGCGTNONE 
AY341828CGCGTGGGCCCGGANONE 
AY341828GGGTGGGCCCACGCGTNONE 
J013036O08CGCGTGGGCCCGGANONE 
J013036O08GGGTGGGCCCACGCGTNONE 
J013037M17CGCGTGGGCCCGGANONE 
J013037M17GGGTGGGCCCACGCGTNONE 
J013039B11CGCGTGGGCCCGGANONE 
J013039B11GGGTGGGCCCACGCGTNONE 
J013039L20CGCGTGGGCCCGGANONE 
J013039L20GGGTGGGCCCACGCGTNONE 
J013047B20CGCGTGGGCCCGGANONE 
J013047B20GGGTGGGCCCACGCGTNONE 
J013048E23CGCGTGGGCCCGGANONE 
J013048E23GGGTGGGCCCACGCGTNONE 
J013051E12CGCGTGGGCCCGGANONE 
J013051E12GGGTGGGCCCACGCGTNONE 
J013051F12CGCGTGGGCCCGGANONE 
J013051F12GGGTGGGCCCACGCGTNONE 
J013056B05CGCGTGGGCCCGGANONE 
J013056B05GGGTGGGCCCACGCGTNONE 
J013057N24CGCGTGGGCCCGGANONE 
J013057N24GGGTGGGCCCACGCGTNONE 
J013064D21CGCGTGGGCCCGGANONE 
J013064D21GGGTGGGCCCACGCGTNONE 
J013065G24CGCGTGGGCCCGGANONE 
J013065G24GGGTGGGCCCACGCGTNONE 
J013075L13CGCGTGGGCCCGGANONE 
J013075L13GGGTGGGCCCACGCGTNONE 
J013075L24CGCGTGGGCCCGGANONE 
J013075L24GGGTGGGCCCACGCGTNONE 
J013092F04CGCGTGGGCCCGGANONE 
J013092F04GGGTGGGCCCACGCGTNONE 
J013092F10CGCGTGGGCCCGGANONE 
J013092F10GGGTGGGCCCACGCGTNONE 
J013092M16CGCGTGGGCCCGGANONE 
J013092M16GGGTGGGCCCACGCGTNONE 
J013096K06CGCGTGGGCCCGGANONE 
J013096K06GGGTGGGCCCACGCGTNONE 
J013111F10CGCGTGGGCCCGGANONE 
J013111F10GGGTGGGCCCACGCGTNONE 
J013120B17CGCGTGGGCCCGGANONE 
J013120B17GGGTGGGCCCACGCGTNONE 
J013120P07CGCGTGGGCCCGGANONE 
J013120P07GGGTGGGCCCACGCGTNONE 
J013122F18CGCGTGGGCCCGGANONE 
J013122F18GGGTGGGCCCACGCGTNONE 
J013122H23CGCGTGGGCCCGGANONE 
J013122H23GGGTGGGCCCACGCGTNONE 
J013126I15CGCGTGGGCCCGGANONE 
J013126I15GGGTGGGCCCACGCGTNONE 
J013126L17CGCGTGGGCCCGGANONE 
J013126L17GGGTGGGCCCACGCGTNONE 
J013129C15CGCGTGGGCCCGGANONE 
J013129C15GGGTGGGCCCACGCGTNONE 
J013146A04CGCGTGGGCCCGGANONE 
J013146A04GGGTGGGCCCACGCGTNONE 
J013146A06CGCGTGGGCCCGGANONE 
J013146A06GGGTGGGCCCACGCGTNONE 
J013153F01CGCGTGGGCCCGGANONE 
J013153F01GGGTGGGCCCACGCGTNONE 
J013156O06CGCGTGGGCCCGGANONE 
J013156O06GGGTGGGCCCACGCGTNONE 
J013162D05CGCGTGGGCCCGGANONE 
J013162D05GGGTGGGCCCACGCGTNONE 
J023008N04CGCGTGGGCCCGGANONE 
J023008N04GGGTGGGCCCACGCGTNONE 
J023010D06CGCGTGGGCCCGGANONE 
J023010D06GGGTGGGCCCACGCGTNONE 
J023011I23CGCGTGGGCCCGGANONE 
J023011I23GGGTGGGCCCACGCGTNONE 
J023023I15CGCGTGGGCCCGGANONE 
J023023I15GGGTGGGCCCACGCGTNONE 
J023025C08CGCGTGGGCCCGGANONE 
J023025C08GGGTGGGCCCACGCGTNONE 
J023029H02CGCGTGGGCCCGGANONE 
J023029H02GGGTGGGCCCACGCGTNONE 
J023033C18CGCGTGGGCCCGGANONE 
J023033C18GGGTGGGCCCACGCGTNONE 
J023037D21CGCGTGGGCCCGGANONE 
J023037D21GGGTGGGCCCACGCGTNONE 
J023049F17CGCGTGGGCCCGGANONE 
J023049F17GGGTGGGCCCACGCGTNONE 
J023052B15CGCGTGGGCCCGGANONE 
J023052B15GGGTGGGCCCACGCGTNONE 
J023061D03CGCGTGGGCCCGGANONE 
J023061D03GGGTGGGCCCACGCGTNONE 
J023062M01CGCGTGGGCCCGGANONE 
J023062M01GGGTGGGCCCACGCGTNONE 
J023089D24CGCGTGGGCCCGGANONE 
J023089D24GGGTGGGCCCACGCGTNONE 
J023109J20CGCGTGGGCCCGGANONE 
J023109J20GGGTGGGCCCACGCGTNONE 
J023109M21CGCGTGGGCCCGGANONE 
J023109M21GGGTGGGCCCACGCGTNONE 
J023120N04CGCGTGGGCCCGGANONE 
J023120N04GGGTGGGCCCACGCGTNONE 
J023122A04CGCGTGGGCCCGGANONE 
J023122A04GGGTGGGCCCACGCGTNONE 
J023134F23CGCGTGGGCCCGGANONE 
J023134F23GGGTGGGCCCACGCGTNONE 
J023149E20CGCGTGGGCCCGGANONE 
J023149E20GGGTGGGCCCACGCGTNONE 
J033022A12CGCGTGGGCCCGGANONE 
J033022A12GGGTGGGCCCACGCGTNONE 
J033022C04CGCGTGGGCCCGGANONE 
J033022C04GGGTGGGCCCACGCGTNONE 
J033024K06CGCGTGGGCCCGGANONE 
J033024K06GGGTGGGCCCACGCGTNONE 
J033026F23CGCGTGGGCCCGGANONE 
J033026F23GGGTGGGCCCACGCGTNONE 
J033029J19CGCGTGGGCCCGGANONE 
J033029J19GGGTGGGCCCACGCGTNONE 
J033040H20CGCGTGGGCCCGGANONE 
J033040H20GGGTGGGCCCACGCGTNONE 
J033042P21CGCGTGGGCCCGGANONE 
J033042P21GGGTGGGCCCACGCGTNONE 
J033043F14CGCGTGGGCCCGGANONE 
J033043F14GGGTGGGCCCACGCGTNONE 
J033044G11CGCGTGGGCCCGGANONE 
J033044G11GGGTGGGCCCACGCGTNONE 
J033052L10CGCGTGGGCCCGGANONE 
J033052L10GGGTGGGCCCACGCGTNONE 
J033052O03CGCGTGGGCCCGGANONE 
J033052O03GGGTGGGCCCACGCGTNONE 
J033052P03CGCGTGGGCCCGGANONE 
J033052P03GGGTGGGCCCACGCGTNONE 
J033079B20CGCGTGGGCCCGGANONE 
J033079B20GGGTGGGCCCACGCGTNONE 
J033089D21CGCGTGGGCCCGGANONE 
J033089D21GGGTGGGCCCACGCGTNONE 
J033094P04CGCGTGGGCCCGGANONE 
J033094P04GGGTGGGCCCACGCGTNONE 
J033103N02CGCGTGGGCCCGGANONE 
J033103N02GGGTGGGCCCACGCGTNONE 
J033110J19CGCGTGGGCCCGGANONE 
J033110J19GGGTGGGCCCACGCGTNONE 
J033114E17CGCGTGGGCCCGGANONE 
J033114E17GGGTGGGCCCACGCGTNONE 
J033115K04CGCGTGGGCCCGGANONE 
J033115K04GGGTGGGCCCACGCGTNONE 
J033119I06CGCGTGGGCCCGGANONE 
J033119I06GGGTGGGCCCACGCGTNONE 
J033121L10CGCGTGGGCCCGGANONE 
J033121L10GGGTGGGCCCACGCGTNONE 
J033123H14CGCGTGGGCCCGGANONE 
J033123H14GGGTGGGCCCACGCGTNONE 
J033136H10CGCGTGGGCCCGGANONE 
J033136H10GGGTGGGCCCACGCGTNONE 
J033139L07CGCGTGGGCCCGGANONE 
J033139L07GGGTGGGCCCACGCGTNONE 
J033143G23CGCGTGGGCCCGGANONE 
J033143G23GGGTGGGCCCACGCGTNONE 
J043021F16CGCGTGGGCCCGGANONE 
J043021F16GGGTGGGCCCACGCGTNONE 
J080304G01CGCGTGGGCCCGGANONE 
J080304G01GGGTGGGCCCACGCGTNONE 
J080305H24CGCGTGGGCCCGGANONE 
J080305H24GGGTGGGCCCACGCGTNONE 
J080309B11CGCGTGGGCCCGGANONE 
J080309B11GGGTGGGCCCACGCGTNONE 
J080315N09CGCGTGGGCCCGGANONE 
J080315N09GGGTGGGCCCACGCGTNONE 
J080319J20CGCGTGGGCCCGGANONE 
J080319J20GGGTGGGCCCACGCGTNONE 
J090014D01CGCGTGGGCCCGGANONE 
J090014D01GGGTGGGCCCACGCGTNONE 
J090067F08CGCGTGGGCCCGGANONE 
J090067F08GGGTGGGCCCACGCGTNONE 
J090079P18CGCGTGGGCCCGGANONE 
J090079P18GGGTGGGCCCACGCGTNONE 
J090082K13CGCGTGGGCCCGGANONE 
J090082K13GGGTGGGCCCACGCGTNONE 
J090093K17CGCGTGGGCCCGGANONE 
J090093K17GGGTGGGCCCACGCGTNONE 
J090099G18CGCGTGGGCCCGGANONE 
J090099G18GGGTGGGCCCACGCGTNONE 
J100022K14CGCGTGGGCCCGGANONE 
J100022K14GGGTGGGCCCACGCGTNONE 
J100052G17CGCGTGGGCCCGGANONE 
J100052G17GGGTGGGCCCACGCGTNONE 
Os01g0174600AK107662GCCCACGCGZinc finger, CCCH-type domain containing protein. 
Os01g0186900013-032-B12CGCGTGGGCCCCNONE 
013-069-C11CGCGTGGGCCCCNONE 
AK105323CGCGTGGGCCCCNONE 
AK105331CGCGTGGGCCCCConserved hypothetical protein. 
AK106168CGCGTGGGCCCCNONE 
J065023I10CGCGTGGGCCCCNONE 
J065182I03CGCGTGGGCCCCNONE 
J075116O22CGCGTGGGCCCCNONE 
J090082G13CGCGTGGGCCCCNONE 
J100060H12CGCGTGGGCCCCNONE 
Os01g0196600AK101742CCAAGCCCACGCNONE 
U25430CCAAGCCCACGCSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0239100Os01g0239100CACGGCCCACGCHeat shock protein DnaJ family protein. 
Os01g0256400AK107950GCCCACGCCCACGGSimilar to Dynein light chain 1 protein DLC-1 (Fragment). 
J100044J04GCCCACGCCCACGGNONE 
Os01g0276000009-162-D08GCGTGGGCNONE 
AK058917GCGTGGGCSimilar to 60S ribosomal protein L30. 
AK119715GCGTGGGCNONE 
AK122128GCGTGGGCNONE 
J033132L17GCGTGGGCNONE 
J065019G15GCGTGGGCNONE 
J065033O12GCGTGGGCNONE 
J065058J19GCGTGGGCNONE 
J065069L03GCGTGGGCNONE 
J065072E03GCGTGGGCNONE 
J065112J06GCGTGGGCNONE 
J065163C18GCGTGGGCNONE 
J065170L20GCGTGGGCNONE 
J065184O11GCGTGGGCNONE 
J065199M19GCGTGGGCNONE 
J065207P22GCGTGGGCNONE 
J065211C12GCGTGGGCNONE 
J075072K20GCGTGGGCNONE 
J075100B16GCGTGGGCNONE 
J075173F02GCGTGGGCNONE 
J090083E15GCGTGGGCNONE 
J100022F06GCGTGGGCNONE 
J100064C04GCGTGGGCNONE 
J100068F11GCGTGGGCNONE 
Os01g0303300J053035N19ACCGGCCCACGCNONE 
J075042F02ACCGGCCCACGCNONE 
J075068E10ACCGGCCCACGCNONE 
J075116E19ACCGGCCCACGCNONE 
J075131C10ACCGGCCCACGCNONE 
J075145J11ACCGGCCCACGCNONE 
J075157P20ACCGGCCCACGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12ACCGGCCCACGCNONE 
Os01g0346700AK071793CACGGCCCACGCConserved hypothetical protein. 
J023114F06CACGGCCCACGCNONE 
Os01g0352100AK072222GCGTGGGCCAC2OG-Fe(II) oxygenase domain containing protein. 
Os01g0371200006-104-H09GCCCACGCNONE 
AJ002380GCCCACGCNONE 
AK058900GCCCACGCSimilar to Glutathione-S-transferase 19E50. 
Os01g0508000AK069177TCCGGCCCACGCSimilar to Beta-glucosidase. 
Os01g0588200006-052-E10ACCCGCGCCCACGCCCAGCCNONE 
AJ251563ACCCGCGCCCACGCCCAGCCNONE 
AK070745ACCCGCGCCCACGCCCAGCCVoltage-dependent anion channel. 
AK104055ACCCGCGCCCACGCCCAGCCNONE 
AK104419ACCCGCGCCCACGCCCAGCCNONE 
J023057A07ACCCGCGCCCACGCCCAGCCNONE 
J023068C08ACCCGCGCCCACGCCCAGCCNONE 
J023148E24ACCCGCGCCCACGCCCAGCCNONE 
J090045O22ACCCGCGCCCACGCCCAGCCNONE 
J090045P03ACCCGCGCCCACGCCCAGCCNONE 
J090050C18ACCCGCGCCCACGCCCAGCCNONE 
J100023F01ACCCGCGCCCACGCCCAGCCNONE 
J100051I18ACCCGCGCCCACGCCCAGCCNONE 
J100060P17ACCCGCGCCCACGCCCAGCCNONE 
Os01g0594900AK070921GCCCACGCConserved hypothetical protein. 
J023074J04GCCCACGCNONE 
J023078B04GCCCACGCNONE 
J023078N11GCCCACGCNONE 
J075143E19GCCCACGCNONE 
J075187L10GCCCACGCNONE 
J080010N23GCCCACGCNONE 
J080013C01GCCCACGCNONE 
J080013G03GCCCACGCNONE 
J080016I23GCCCACGCNONE 
J080017E01GCCCACGCNONE 
J080029E18GCCCACGCNONE 
J080034L24GCCCACGCNONE 
J080039N12GCCCACGCNONE 
J080067L11GCCCACGCNONE 
J080068N08GCCCACGCNONE 
J080069E19GCCCACGCNONE 
J080071E16GCCCACGCNONE 
J080077J09GCCCACGCNONE 
J080085E03GCCCACGCNONE 
J080301J09GCCCACGCNONE 
J080303L19GCCCACGCNONE 
J080308B12GCCCACGCNONE 
Os01g0631800AK069421CGCGTGGGCConserved hypothetical protein. 
J065017G23CGCGTGGGCNONE 
J065198M01CGCGTGGGCNONE 
Os01g0633000006-075-A01ACGCGTGGGCCAGANONE 
009-064-A11ACGCGTGGGCCAGANONE 
009-153-F07ACGCGTGGGCCAGANONE 
AK062051ACGCGTGGGCCAGASimilar to 50S ribosomal protein L31. 
J013073B08ACGCGTGGGCCAGANONE 
J065006K19ACGCGTGGGCCAGANONE 
J065053P08ACGCGTGGGCCAGANONE 
J065057D08ACGCGTGGGCCAGANONE 
J065086P07ACGCGTGGGCCAGANONE 
J065095C14ACGCGTGGGCCAGANONE 
J065116B05ACGCGTGGGCCAGANONE 
J065164L20ACGCGTGGGCCAGANONE 
J065185K19ACGCGTGGGCCAGANONE 
J065191E21ACGCGTGGGCCAGANONE 
J065199P21ACGCGTGGGCCAGANONE 
J065216M12ACGCGTGGGCCAGANONE 
J075002M09ACGCGTGGGCCAGANONE 
J075016N10ACGCGTGGGCCAGANONE 
J075041K05ACGCGTGGGCCAGANONE 
J075094E04ACGCGTGGGCCAGANONE 
J075154O04ACGCGTGGGCCAGANONE 
J075176D22ACGCGTGGGCCAGANONE 
J075186M09ACGCGTGGGCCAGANONE 
J075191H20ACGCGTGGGCCAGANONE 
Os01g0680400AK067914AAGGCCCACGCGTAFII28-like protein family protein. 
J065039K13AAGGCCCACGCGNONE 
J065042K22AAGGCCCACGCGNONE 
J080016E23AAGGCCCACGCGNONE 
J080064E22AAGGCCCACGCGNONE 
Os01g0686300014-073-D12GCCCACGCNONE 
016-075-E10GCCCACGCNONE 
AK109457GCCCACGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os01g0698300AK100582CCCACGCGCCCAGCCGCCCACGCZinc finger, BED-type predicted domain containing protein. 
J023105O09CCCACGCGCCCAGCCGCCCACGCNONE 
J023119F15CCCACGCGCCCAGCCGCCCACGCNONE 
J075007N19CCCACGCGCCCAGCCGCCCACGCNONE 
J075010F10CCCACGCGCCCAGCCGCCCACGCNONE 
J075032M22CCCACGCGCCCAGCCGCCCACGCNONE 
J075038E01CCCACGCGCCCAGCCGCCCACGCNONE 
J075064J17CCCACGCGCCCAGCCGCCCACGCNONE 
J075109L20CCCACGCGCCCAGCCGCCCACGCNONE 
J075131O16CCCACGCGCCCAGCCGCCCACGCNONE 
J075176A17CCCACGCGCCCAGCCGCCCACGCNONE 
J075178N11CCCACGCGCCCAGCCGCCCACGCNONE 
J075181N15CCCACGCGCCCAGCCGCCCACGCNONE 
J090060I06CCCACGCGCCCAGCCGCCCACGCNONE 
J090097O21CCCACGCGCCCAGCCGCCCACGCNONE 
Os01g0720700J033124M22GCCCACGCGTCCNONE 
J033124M22TCCGGGCCCACGCNONE 
J065006G21GCCCACGCGTCCNONE 
J065006G21TCCGGGCCCACGCNONE 
J065025M24GCCCACGCGTCCNONE 
J065025M24TCCGGGCCCACGCNONE 
J065041J02GCCCACGCGTCCNONE 
J065041J02TCCGGGCCCACGCNONE 
J065044B14GCCCACGCGTCCNONE 
J065044B14TCCGGGCCCACGCNONE 
J065061J06GCCCACGCGTCCNONE 
J065061J06TCCGGGCCCACGCNONE 
J065116L21GCCCACGCGTCCNONE 
J065116L21TCCGGGCCCACGCNONE 
J075030F18GCCCACGCGTCCNONE 
J075030F18TCCGGGCCCACGCNONE 
J075034K17GCCCACGCGTCCNONE 
J075034K17TCCGGGCCCACGCNONE 
J075063I02GCCCACGCGTCCNONE 
J075063I02TCCGGGCCCACGCNONE 
J075110D21GCCCACGCGTCCSimilar to Serine acetyltransferase. 
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase. 
J075188L15GCCCACGCGTCCNONE 
J075188L15TCCGGGCCCACGCNONE 
J075197B17GCCCACGCGTCCNONE 
J075197B17TCCGGGCCCACGCNONE 
Os01g0727100AK068181CCCACACGCCCACGCGGlycosyl transferase, family 8 protein. 
AK105758CCCACACGCCCACGCGNONE 
J013126C21CCCACACGCCCACGCGNONE 
J023049F24CCCACACGCCCACGCGNONE 
J033140G15CCCACACGCCCACGCGNONE 
Os01g0770400006-112-B08GCCCACGCCCACCACNONE 
AK061253GCCCACGCCCACCACNONE 
AK061585GCCCACGCCCACCACCyclin-like F-box domain containing protein. 
Os01g0802200009-092-E04GCGTGGGCNONE 
AK062699GCGTGGGCConserved hypothetical protein. 
J065186C19GCGTGGGCNONE 
Os01g0805000009-045-H11GCGTGGGCNONE 
009-196-H08GCGTGGGCNONE 
J013094D22GCGTGGGCRibosomal protein L34 family protein. 
J013119F23GCGTGGGCNONE 
J065128B11GCGTGGGCNONE 
Os01g0805800006-057-H04GGGGCCCACGCGTCATCCACCNONE 
006-106-H01GGGGCCCACGCGTCATCCACCNONE 
AK059963GGGGCCCACGCGTCATCCACCNONE 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0823500016-059-D03GTGGGGGCCCACGCNONE 
AK064237GTGGGGGCCCACGCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0850400AJ575220GGGCCGAGAGGCCCACGCGNONE 
AK108582GGGCCGAGAGGCCCACGCGSimilar to MYBY1 protein (Fragment). 
Os01g0869000AK067351CGGGTGGGGCCCACCGCCCACGCCCAAACNONE 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein. 
J033030B16ACCGGCCCACGCCTCNONE 
J033098D06ACCGGCCCACGCCTCNONE 
J033112A12ACCGGCCCACGCCTCNONE 
J043003L24ACCGGCCCACGCCTCNONE 
Os01g0911700012-079-H01GCGTGGGCNONE 
012-088-G05GCGTGGGCNONE 
012-099-A01GCGTGGGCNONE 
015-009-H07GCGTGGGCNONE 
015-035-H12GCGTGGGCNONE 
016-054-G03GCGTGGGCNONE 
AK073805GCGTGGGCSimilar to Regulatory protein viviparous-1. 
AK105441GCGTGGGCNONE 
J033069I02GCGTGGGCNONE 
J033086K01GCGTGGGCNONE 
Os01g0913400AK099881AGCCCACGCProtein prenyltransferase domain containing protein. 
Os01g0915200AK121863GCCCACGCSimilar to Cystatin. 
Os01g0915800AK103859TAGGCCCACGCGSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TAGGCCCACGCGNONE 
J090056H03TAGGCCCACGCGNONE 
J090058L14TAGGCCCACGCGNONE 
J090058P16TAGGCCCACGCGNONE 
J090076C19TAGGCCCACGCGNONE 
J100086P14TAGGCCCACGCGNONE 
Os01g0927500AK068802GCCCACGCProtein kinase domain containing protein. 
AK101312GCCCACGCNONE 
J013159J12GCCCACGCNONE 
J033033P12GCCCACGCNONE 
J043034L07GCCCACGCNONE 
Os01g0942200011-007-H02GCCCACGCNONE 
AK063265GCCCACGCProtein of unknown function DUF295 family protein. 
Os01g0963300AK067544GCGTGGGCSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0121100012-035-F06CGGGCCCACGCGTNONE 
013-031-H05CGGGCCCACGCGTNONE 
013-058-E11CGGGCCCACGCGTNONE 
014-010-D01CGGGCCCACGCGTNONE 
AK070711CGGGCCCACGCGTConserved hypothetical protein. 
AK119758CGGGCCCACGCGTNONE 
J013033G12CGGGCCCACGCGTNONE 
J023007M16CGGGCCCACGCGTNONE 
J023020K20CGGGCCCACGCGTNONE 
J023061H10CGGGCCCACGCGTNONE 
J033027H20CGGGCCCACGCGTNONE 
J033051E18CGGGCCCACGCGTNONE 
J090005F12CGGGCCCACGCGTNONE 
J090017A20CGGGCCCACGCGTNONE 
J090018G11CGGGCCCACGCGTNONE 
J090062C18CGGGCCCACGCGTNONE 
J100027N10CGGGCCCACGCGTNONE 
J100032L14CGGGCCCACGCGTNONE 
J100045C14CGGGCCCACGCGTNONE 
J100061M09CGGGCCCACGCGTNONE 
J100062K11CGGGCCCACGCGTNONE 
J100064H11CGGGCCCACGCGTNONE 
J100074H16CGGGCCCACGCGTNONE 
J100082N01CGGGCCCACGCGTNONE 
Os02g0123200016-017-F04GCCCACGCNONE 
J033057C03GCCCACGCNONE 
J033087C11GCCCACGCNONE 
J033108J20GCCCACGCNONE 
J043015P08GCCCACGCNONE 
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE 
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE 
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE 
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE 
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE 
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE 
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE 
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE 
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE 
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE 
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE 
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE 
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE 
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE 
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE 
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE 
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE 
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE 
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE 
Os02g0186700AK064492ATGGCCCACGCConserved hypothetical protein. 
J065210K09ATGGCCCACGCNONE 
J075006A17ATGGCCCACGCNONE 
J075108C18ATGGCCCACGCNONE 
J075153E08ATGGCCCACGCNONE 
Os02g0193500009-092-G09TGCGGCCCACGCGNONE 
AK101237TGCGGCCCACGCGHypothetical protein. 
J033031K13TGCGGCCCACGCGNONE 
J033034P12TGCGGCCCACGCGNONE 
J080304L19TGCGGCCCACGCGNONE 
J100059N21TGCGGCCCACGCGNONE 
Os02g0219000AK064689GCCCACGCCCAATAInterferon-related developmental regulator domain containing protein. 
Os02g0234300003-129-C12CGCGTGGGCNONE 
AK062592CGCGTGGGCU box domain containing protein. 
Os02g0266200AK099647TAGGCCCACGCGNONE 
AK103371TAGGCCCACGCGProtein prenyltransferase domain containing protein. 
Os02g0288100AK107019AGCCCAGCCCACGCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0445600009-183-B02AGCCCACGCNONE 
AK063150AGCCCACGCSimilar to Auxin-induced SAUR-like protein (Fragment). 
Os02g0543200AK100963AAAAGCCCACGCGCyclin-like F-box domain containing protein. 
Os02g0595800Os02g0595800GCCCACGCSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0643200AK106784TGCGGCCCACGCYABBY protein family protein. 
J075048L13TGCGGCCCACGCNONE 
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE 
AK101360GTGGCGTGGGCCGTCGGATCNONE 
AY062178GTGGCGTGGGCCGTCGGATCNONE 
J023043E22GTGGCGTGGGCCGTCGGATCNONE 
J033024F05GTGGCGTGGGCCGTCGGATCNONE 
J033035H01GTGGCGTGGGCCGTCGGATCNONE 
J033042J19GTGGCGTGGGCCGTCGGATCNONE 
J033057G18GTGGCGTGGGCCGTCGGATCNONE 
J033111F09GTGGCGTGGGCCGTCGGATCNONE 
J033115L11GTGGCGTGGGCCGTCGGATCNONE 
J033143I16GTGGCGTGGGCCGTCGGATCNONE 
J033143M21GTGGCGTGGGCCGTCGGATCNONE 
J075072B10GTGGCGTGGGCCGTCGGATCNONE 
J075072L04GTGGCGTGGGCCGTCGGATCNONE 
J075088F01GTGGCGTGGGCCGTCGGATCNONE 
J075196H23GTGGCGTGGGCCGTCGGATCNONE 
Os02g0649300014-043-A05GGTGGGGCCCACGCGTNONE 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0666200006-021-D11CTGGCCCACCAGGGCCCACGCNONE 
006-022-F02CTGGCCCACCAGGGCCCACGCNONE 
006-022-H11CTGGCCCACCAGGGCCCACGCNONE 
006-024-C03CTGGCCCACCAGGGCCCACGCNONE 
006-026-G05CTGGCCCACCAGGGCCCACGCNONE 
006-027-F11CTGGCCCACCAGGGCCCACGCNONE 
006-028-G06CTGGCCCACCAGGGCCCACGCNONE 
006-028-H05CTGGCCCACCAGGGCCCACGCNONE 
006-030-H06CTGGCCCACCAGGGCCCACGCNONE 
006-030-H12CTGGCCCACCAGGGCCCACGCNONE 
006-031-C07CTGGCCCACCAGGGCCCACGCNONE 
006-031-G01CTGGCCCACCAGGGCCCACGCNONE 
006-033-F09CTGGCCCACCAGGGCCCACGCNONE 
006-035-A01CTGGCCCACCAGGGCCCACGCNONE 
006-035-A12CTGGCCCACCAGGGCCCACGCNONE 
006-035-F04CTGGCCCACCAGGGCCCACGCNONE 
006-036-G09CTGGCCCACCAGGGCCCACGCNONE 
006-038-A01CTGGCCCACCAGGGCCCACGCNONE 
006-038-A03CTGGCCCACCAGGGCCCACGCNONE 
006-039-D08CTGGCCCACCAGGGCCCACGCNONE 
006-042-C11CTGGCCCACCAGGGCCCACGCNONE 
006-042-H06CTGGCCCACCAGGGCCCACGCNONE 
006-044-E01CTGGCCCACCAGGGCCCACGCNONE 
006-045-E05CTGGCCCACCAGGGCCCACGCNONE 
006-046-G05CTGGCCCACCAGGGCCCACGCNONE 
006-047-A03CTGGCCCACCAGGGCCCACGCNONE 
006-048-H08CTGGCCCACCAGGGCCCACGCNONE 
006-052-A07CTGGCCCACCAGGGCCCACGCNONE 
006-053-A05CTGGCCCACCAGGGCCCACGCNONE 
006-054-G06CTGGCCCACCAGGGCCCACGCNONE 
006-056-D10CTGGCCCACCAGGGCCCACGCNONE 
006-057-B07CTGGCCCACCAGGGCCCACGCNONE 
006-058-F12CTGGCCCACCAGGGCCCACGCNONE 
006-060-D01CTGGCCCACCAGGGCCCACGCNONE 
006-061-A12CTGGCCCACCAGGGCCCACGCNONE 
006-062-E02CTGGCCCACCAGGGCCCACGCNONE 
006-063-F11CTGGCCCACCAGGGCCCACGCNONE 
006-063-H02CTGGCCCACCAGGGCCCACGCNONE 
006-066-F12CTGGCCCACCAGGGCCCACGCNONE 
006-067-H12CTGGCCCACCAGGGCCCACGCNONE 
006-068-B09CTGGCCCACCAGGGCCCACGCNONE 
006-068-D08CTGGCCCACCAGGGCCCACGCNONE 
006-071-A12CTGGCCCACCAGGGCCCACGCNONE 
006-072-H06CTGGCCCACCAGGGCCCACGCNONE 
006-074-A02CTGGCCCACCAGGGCCCACGCNONE 
006-074-F10CTGGCCCACCAGGGCCCACGCNONE 
006-077-H10CTGGCCCACCAGGGCCCACGCNONE 
006-078-G02CTGGCCCACCAGGGCCCACGCNONE 
006-081-B03CTGGCCCACCAGGGCCCACGCNONE 
006-084-H01CTGGCCCACCAGGGCCCACGCNONE 
006-084-H02CTGGCCCACCAGGGCCCACGCNONE 
006-084-H04CTGGCCCACCAGGGCCCACGCNONE 
006-087-H08CTGGCCCACCAGGGCCCACGCNONE 
006-090-B08CTGGCCCACCAGGGCCCACGCNONE 
006-091-E10CTGGCCCACCAGGGCCCACGCNONE 
006-093-G02CTGGCCCACCAGGGCCCACGCNONE 
006-094-B12CTGGCCCACCAGGGCCCACGCNONE 
006-094-E03CTGGCCCACCAGGGCCCACGCNONE 
006-095-G07CTGGCCCACCAGGGCCCACGCNONE 
006-095-H07CTGGCCCACCAGGGCCCACGCNONE 
006-097-G08CTGGCCCACCAGGGCCCACGCNONE 
006-098-E12CTGGCCCACCAGGGCCCACGCNONE 
006-099-A04CTGGCCCACCAGGGCCCACGCNONE 
006-099-E08CTGGCCCACCAGGGCCCACGCNONE 
006-103-F12CTGGCCCACCAGGGCCCACGCNONE 
006-104-G02CTGGCCCACCAGGGCCCACGCNONE 
006-105-F02CTGGCCCACCAGGGCCCACGCNONE 
006-107-D12CTGGCCCACCAGGGCCCACGCNONE 
006-108-F10CTGGCCCACCAGGGCCCACGCNONE 
006-108-H05CTGGCCCACCAGGGCCCACGCNONE 
006-110-G11CTGGCCCACCAGGGCCCACGCNONE 
006-111-D10CTGGCCCACCAGGGCCCACGCNONE 
006-111-E03CTGGCCCACCAGGGCCCACGCNONE 
006-111-H01CTGGCCCACCAGGGCCCACGCNONE 
006-113-C12CTGGCCCACCAGGGCCCACGCNONE 
006-114-C10CTGGCCCACCAGGGCCCACGCNONE 
006-115-B02CTGGCCCACCAGGGCCCACGCNONE 
006-117-D11CTGGCCCACCAGGGCCCACGCNONE 
006-117-E01CTGGCCCACCAGGGCCCACGCNONE 
009-131-C02CTGGCCCACCAGGGCCCACGCNONE 
009-133-G05CTGGCCCACCAGGGCCCACGCNONE 
009-152-E01CTGGCCCACCAGGGCCCACGCNONE 
009-154-E08CTGGCCCACCAGGGCCCACGCNONE 
009-196-C11CTGGCCCACCAGGGCCCACGCNONE 
012-010-E10CTGGCCCACCAGGGCCCACGCNONE 
013-018-C05CTGGCCCACCAGGGCCCACGCNONE 
013-074-A06CTGGCCCACCAGGGCCCACGCNONE 
013-078-E06CTGGCCCACCAGGGCCCACGCNONE 
AB009665CTGGCCCACCAGGGCCCACGCNONE 
AF022737CTGGCCCACCAGGGCCCACGCNONE 
AJ224327CTGGCCCACCAGGGCCCACGCNONE 
AK061769CTGGCCCACCAGGGCCCACGCNONE 
AK103807CTGGCCCACCAGGGCCCACGCAquaporin. 
AK104658CTGGCCCACCAGGGCCCACGCNONE 
J013065I12CTGGCCCACCAGGGCCCACGCNONE 
J013067L09CTGGCCCACCAGGGCCCACGCNONE 
J013089I10CTGGCCCACCAGGGCCCACGCNONE 
J013095N22CTGGCCCACCAGGGCCCACGCNONE 
J013130E17CTGGCCCACCAGGGCCCACGCNONE 
J013131A06CTGGCCCACCAGGGCCCACGCNONE 
J013154E06CTGGCCCACCAGGGCCCACGCNONE 
J023004D16CTGGCCCACCAGGGCCCACGCNONE 
J023010A15CTGGCCCACCAGGGCCCACGCNONE 
J023010H04CTGGCCCACCAGGGCCCACGCNONE 
J023049K10CTGGCCCACCAGGGCCCACGCNONE 
J023056H24CTGGCCCACCAGGGCCCACGCNONE 
J023064J12CTGGCCCACCAGGGCCCACGCNONE 
J023078I06CTGGCCCACCAGGGCCCACGCNONE 
J023081D05CTGGCCCACCAGGGCCCACGCNONE 
J023099I19CTGGCCCACCAGGGCCCACGCNONE 
J023100F05CTGGCCCACCAGGGCCCACGCNONE 
J023131F16CTGGCCCACCAGGGCCCACGCNONE 
J033025F16CTGGCCCACCAGGGCCCACGCNONE 
J033028F10CTGGCCCACCAGGGCCCACGCNONE 
J033058H13CTGGCCCACCAGGGCCCACGCNONE 
J033064P18CTGGCCCACCAGGGCCCACGCNONE 
J033070H04CTGGCCCACCAGGGCCCACGCNONE 
J033107P20CTGGCCCACCAGGGCCCACGCNONE 
J033114E09CTGGCCCACCAGGGCCCACGCNONE 
J033125G23CTGGCCCACCAGGGCCCACGCNONE 
J033136G05CTGGCCCACCAGGGCCCACGCNONE 
J033147A07CTGGCCCACCAGGGCCCACGCNONE 
J053048M24CTGGCCCACCAGGGCCCACGCNONE 
J053056K02CTGGCCCACCAGGGCCCACGCNONE 
J053057N24CTGGCCCACCAGGGCCCACGCNONE 
J053060C13CTGGCCCACCAGGGCCCACGCNONE 
J065053C22CTGGCCCACCAGGGCCCACGCNONE 
J065067J11CTGGCCCACCAGGGCCCACGCNONE 
J065085A01CTGGCCCACCAGGGCCCACGCNONE 
J065189K01CTGGCCCACCAGGGCCCACGCNONE 
J075024G24CTGGCCCACCAGGGCCCACGCNONE 
J075060O04CTGGCCCACCAGGGCCCACGCNONE 
J075075M07CTGGCCCACCAGGGCCCACGCNONE 
J075090A10CTGGCCCACCAGGGCCCACGCNONE 
J075110P11CTGGCCCACCAGGGCCCACGCNONE 
J075114H02CTGGCCCACCAGGGCCCACGCNONE 
J075127L13CTGGCCCACCAGGGCCCACGCNONE 
J075151B19CTGGCCCACCAGGGCCCACGCNONE 
J075187M17CTGGCCCACCAGGGCCCACGCNONE 
J075198E22CTGGCCCACCAGGGCCCACGCNONE 
J080006J20CTGGCCCACCAGGGCCCACGCNONE 
J080081J10CTGGCCCACCAGGGCCCACGCNONE 
J080087C03CTGGCCCACCAGGGCCCACGCNONE 
J090029E22CTGGCCCACCAGGGCCCACGCNONE 
J090037C19CTGGCCCACCAGGGCCCACGCNONE 
J090037P10CTGGCCCACCAGGGCCCACGCNONE 
J090047M10CTGGCCCACCAGGGCCCACGCNONE 
J090055K05CTGGCCCACCAGGGCCCACGCNONE 
J090057N19CTGGCCCACCAGGGCCCACGCNONE 
J090062M13CTGGCCCACCAGGGCCCACGCNONE 
J090066F22CTGGCCCACCAGGGCCCACGCNONE 
J090066N12CTGGCCCACCAGGGCCCACGCNONE 
J090071K08CTGGCCCACCAGGGCCCACGCNONE 
J090080F16CTGGCCCACCAGGGCCCACGCNONE 
J090081J21CTGGCCCACCAGGGCCCACGCNONE 
J090083F22CTGGCCCACCAGGGCCCACGCNONE 
J090083I12CTGGCCCACCAGGGCCCACGCNONE 
J090088B16CTGGCCCACCAGGGCCCACGCNONE 
J090088E01CTGGCCCACCAGGGCCCACGCNONE 
J090091C11CTGGCCCACCAGGGCCCACGCNONE 
J090091F17CTGGCCCACCAGGGCCCACGCNONE 
J090097A05CTGGCCCACCAGGGCCCACGCNONE 
J090098B15CTGGCCCACCAGGGCCCACGCNONE 
J100018B04CTGGCCCACCAGGGCCCACGCNONE 
J100021J08CTGGCCCACCAGGGCCCACGCNONE 
J100026M12CTGGCCCACCAGGGCCCACGCNONE 
J100032F02CTGGCCCACCAGGGCCCACGCNONE 
J100034B03CTGGCCCACCAGGGCCCACGCNONE 
J100037D13CTGGCCCACCAGGGCCCACGCNONE 
J100041C16CTGGCCCACCAGGGCCCACGCNONE 
J100044D14CTGGCCCACCAGGGCCCACGCNONE 
J100044E21CTGGCCCACCAGGGCCCACGCNONE 
J100047M16CTGGCCCACCAGGGCCCACGCNONE 
J100051D22CTGGCCCACCAGGGCCCACGCNONE 
J100056M13CTGGCCCACCAGGGCCCACGCNONE 
J100061J12CTGGCCCACCAGGGCCCACGCNONE 
J100065A22CTGGCCCACCAGGGCCCACGCNONE 
J100067L12CTGGCCCACCAGGGCCCACGCNONE 
J100068F06CTGGCCCACCAGGGCCCACGCNONE 
J100070C24CTGGCCCACCAGGGCCCACGCNONE 
J100072N09CTGGCCCACCAGGGCCCACGCNONE 
J100073A10CTGGCCCACCAGGGCCCACGCNONE 
J100073B15CTGGCCCACCAGGGCCCACGCNONE 
J100077F05CTGGCCCACCAGGGCCCACGCNONE 
J100078B03CTGGCCCACCAGGGCCCACGCNONE 
J100078F01CTGGCCCACCAGGGCCCACGCNONE 
J100079B08CTGGCCCACCAGGGCCCACGCNONE 
J100083J06CTGGCCCACCAGGGCCCACGCNONE 
Os02g0668500006-056-A05CCAGCCCACGCNONE 
006-056-A05GCCCACGCGTCCNONE 
AK060958CCAGCCCACGCNONE 
AK060958GCCCACGCGTCCNONE 
AK071867CCAGCCCACGCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
AK071867GCCCACGCGTCCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAGCCCACGCNONE 
J023117I15GCCCACGCGTCCNONE 
J065013J03CCAGCCCACGCNONE 
J065013J03GCCCACGCGTCCNONE 
J065021P16CCAGCCCACGCNONE 
J065021P16GCCCACGCGTCCNONE 
J065044B07CCAGCCCACGCNONE 
J065044B07GCCCACGCGTCCNONE 
J065059E23CCAGCCCACGCNONE 
J065059E23GCCCACGCGTCCNONE 
J065087N20CCAGCCCACGCNONE 
J065087N20GCCCACGCGTCCNONE 
J065185I04CCAGCCCACGCNONE 
J065185I04GCCCACGCGTCCNONE 
J065190G19CCAGCCCACGCNONE 
J065190G19GCCCACGCGTCCNONE 
J065199C15CCAGCCCACGCNONE 
J065199C15GCCCACGCGTCCNONE 
J065213L12CCAGCCCACGCNONE 
J065213L12GCCCACGCGTCCNONE 
J080305C01CCAGCCCACGCNONE 
J080305C01GCCCACGCGTCCNONE 
J080308C07CCAGCCCACGCNONE 
J080308C07GCCCACGCGTCCNONE 
J080310F02CCAGCCCACGCNONE 
J080310F02GCCCACGCGTCCNONE 
Os02g0669100012-068-E10GCCCACGCNONE 
016-075-F09GCCCACGCNONE 
AB011367GCCCACGCNONE 
AK070197GCCCACGCNONE 
AY587109GCCCACGCDehydrin family protein. 
AY786415GCCCACGCNONE 
J023042N13GCCCACGCNONE 
J023128F01GCCCACGCNONE 
J065002K05GCCCACGCNONE 
J090057I09GCCCACGCNONE 
J090067J23GCCCACGCNONE 
J090071B04GCCCACGCNONE 
J100018L23GCCCACGCNONE 
J100036A11GCCCACGCNONE 
J100063L18GCCCACGCNONE 
J100071G02GCCCACGCNONE 
J100084P19GCCCACGCNONE 
Os02g0673700AB028130AACGGCCCACGCZinc finger, Dof-type family protein. 
Os02g0694100J090034G11GCCCACGCCCACGGCyclin-like F-box domain containing protein. 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074GTCGCGCGCGTGGGCCCCNONE 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0761100AK070404GCCCACGCSimilar to Cyclophilin-40 (Expressed protein). 
Os02g0787100Os02g0787100GCGGCCCACGCProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0788800AK066747CCCCCGCGCCCACGCCCACCTAmino acid/polyamine transporter II family protein. 
AK066747GCCCACGCGCCCCCACAmino acid/polyamine transporter II family protein. 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0792800AK105616GCGTGGGCCACSimilar to Rieske iron-sulfur protein Tic55 precursor. 
AK120704GCGTGGGCCACNONE 
J075134O14GCGTGGGCCACNONE 
Os02g0812500AK106918GTGGCGTGGGCCACCyclin-like F-box domain containing protein. 
Os02g0829900009-044-G07AGGTGGGCGTGGGCCTGNONE 
009-044-G07GCGTGGGCTNONE 
AK120917AGGTGGGCGTGGGCCTGSimilar to BRICK1. 
AK120917GCGTGGGCTSimilar to BRICK1. 
AY224582AGGTGGGCGTGGGCCTGNONE 
AY224582GCGTGGGCTNONE 
J023034L01AGGTGGGCGTGGGCCTGNONE 
J023034L01GCGTGGGCTNONE 
J023034M01AGGTGGGCGTGGGCCTGNONE 
J023034M01GCGTGGGCTNONE 
J090010G06AGGTGGGCGTGGGCCTGNONE 
J090010G06GCGTGGGCTNONE 
J090020D07AGGTGGGCGTGGGCCTGNONE 
J090020D07GCGTGGGCTNONE 
J100041L04AGGTGGGCGTGGGCCTGNONE 
J100041L04GCGTGGGCTNONE 
J100061D05AGGTGGGCGTGGGCCTGNONE 
J100061D05GCGTGGGCTNONE 
J100070L18AGGTGGGCGTGGGCCTGNONE 
J100070L18GCGTGGGCTNONE 
Os02g0830000011-075-D11AGCCCACGCNONE 
AK101841AGCCCACGCProtein prenyltransferase domain containing protein. 
J033069G13AGCCCACGCNONE 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0101600006-047-B09GTGGCGTGGGCNONE 
006-082-H11GTGGCGTGGGCNONE 
AK061143GTGGCGTGGGCNONE 
AK069374GTGGCGTGGGCSimilar to Quinone oxidoreductase. 
J023012O14GTGGCGTGGGCNONE 
Os03g0123300003-131-G09GCCCACGCNONE 
AK058595GCCCACGCNONE 
J075056B01GCCCACGCNONE 
Os03g0124300AK069148AAAAGCCCACGCConserved hypothetical protein. 
AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
AK106076AAAAGCCCACGCNONE 
AK106076ACGCGTGGGCCCCACCNONE 
J023003G19AAAAGCCCACGCNONE 
J023003G19ACGCGTGGGCCCCACCNONE 
Os03g0125900AK060370GCCCACGCCCACTCCConserved hypothetical protein. 
AK071921GCCCACGCCCACTCCNONE 
Os03g0126900AK109217GTGGCGTGGGCCAAConserved hypothetical protein. 
J065085G16GTGGCGTGGGCCAANONE 
J100086C03GTGGCGTGGGCCAANONE 
Os03g0136200004-011-E10GCCCACGCNONE 
006-067-A08GCCCACGCNONE 
011-007-E02GCCCACGCNONE 
011-099-H10GCCCACGCNONE 
012-044-D08GCCCACGCNONE 
013-045-G12GCCCACGCNONE 
013-062-C09GCCCACGCNONE 
013-072-F09GCCCACGCNONE 
013-085-B12GCCCACGCNONE 
013-097-E09GCCCACGCNONE 
013-097-F09GCCCACGCNONE 
014-013-C09GCCCACGCNONE 
014-082-D08GCCCACGCNONE 
015-071-A09GCCCACGCNONE 
AF042333GCCCACGCNONE 
AK060887GCCCACGCNONE 
AK121681GCCCACGC24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14GCCCACGCNONE 
J013123F01GCCCACGCNONE 
J023050A02GCCCACGCNONE 
J033046H22GCCCACGCNONE 
J033070A11GCCCACGCNONE 
J065059G11GCCCACGCNONE 
J065068F10GCCCACGCNONE 
J065164A10GCCCACGCNONE 
J075031F07GCCCACGCNONE 
J075054J01GCCCACGCNONE 
J075086M04GCCCACGCNONE 
J075118K23GCCCACGCNONE 
J075122A09GCCCACGCNONE 
J075123D06GCCCACGCNONE 
J075129A22GCCCACGCNONE 
J075161E07GCCCACGCNONE 
J075179H04GCCCACGCNONE 
J075181C06GCCCACGCNONE 
J075186A12GCCCACGCNONE 
J090014H16GCCCACGCNONE 
J090045G17GCCCACGCNONE 
J090048B09GCCCACGCNONE 
J090052J23GCCCACGCNONE 
J090052K22GCCCACGCNONE 
J090059F10GCCCACGCNONE 
J090080F19GCCCACGCNONE 
J100039J08GCCCACGCNONE 
J100044K02GCCCACGCNONE 
J100051E16GCCCACGCNONE 
J100053F08GCCCACGCNONE 
J100056F07GCCCACGCNONE 
J100058A10GCCCACGCNONE 
Os03g0141200AK068968AGCCCACGCGTCGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092AGCCCACGCGTCGCGNONE 
J023003L18AGCCCACGCGTCGCGNONE 
J023022K18AGCCCACGCGTCGCGNONE 
J023107H13AGCCCACGCGTCGCGNONE 
J023107K02AGCCCACGCGTCGCGNONE 
Os03g0144800AK103041GCCCACGCCACSimilar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein). 
J013043M12GCCCACGCCACNONE 
J013043N11GCCCACGCCACNONE 
J013093E21GCCCACGCCACNONE 
J033030E13GCCCACGCCACNONE 
J033044H20GCCCACGCCACNONE 
J033084H08GCCCACGCCACNONE 
J033117F03GCCCACGCCACNONE 
J043005E24GCCCACGCCACNONE 
J065218M08GCCCACGCCACNONE 
Os03g0146300011-078-E08CCAGCCCACGCCACNONE 
014-009-B07CCAGCCCACGCCACNONE 
AK121395CCAGCCCACGCCACSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319CCAGCCCACGCCACNONE 
J013104I06CCAGCCCACGCCACNONE 
J023130M16CCAGCCCACGCCACNONE 
J053037E13CCAGCCCACGCCACNONE 
J075104M08CCAGCCCACGCCACNONE 
J075144I22CCAGCCCACGCCACNONE 
J100057B09CCAGCCCACGCCACNONE 
Os03g0151800AK064955CGCGTGGGCCACNONE 
AK098874CGCGTGGGCCACNONE 
AK098980CGCGTGGGCCACNONE 
AK099712CGCGTGGGCCACNONE 
AK099889CGCGTGGGCCACNONE 
AK121641CGCGTGGGCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGCGTGGGCCACNONE 
J013001D04CGCGTGGGCCACNONE 
J013121O12CGCGTGGGCCACNONE 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0184100AK067400GCCCACGCHypothetical protein. 
J013030J24GCCCACGCNONE 
J013037M23GCCCACGCNONE 
J013106B15GCCCACGCNONE 
J013130H10GCCCACGCNONE 
J013152B03GCCCACGCNONE 
J013157J24GCCCACGCNONE 
J013157K04GCCCACGCNONE 
J033093A19GCCCACGCNONE 
J033106E24GCCCACGCNONE 
J090043G12GCCCACGCNONE 
Os03g0206600AK058618GCTGGGCCCACGCProtein of unknown function DUF588 family protein. 
Os03g0248000AK070612GCCCACGCGNONE 
AK071419GCCCACGCGNONE 
AK100304GCCCACGCGAutophagy protein Apg9 family protein. 
Os03g0275700AK111329GTGGCCCACGCConserved hypothetical protein. 
Os03g0299900AK069075CGCGTGGGCTGCSimilar to Plastid aminotransferase (Fragment). 
AY338235CGCGTGGGCTGCNONE 
J053077F07CGCGTGGGCTGCNONE 
Os03g0300600003-125-G06AAAGCCCACGCNONE 
006-048-C04AAAGCCCACGCNONE 
009-044-A09AAAGCCCACGCNONE 
AK059801AAAGCCCACGCNONE 
AK066250AAAGCCCACGCSimilar to Chaperone protein dnaJ. 
AK069897AAAGCCCACGCNONE 
AK104186AAAGCCCACGCNONE 
J065197D15AAAGCCCACGCNONE 
J090031C11AAAGCCCACGCNONE 
J100024C23AAAGCCCACGCNONE 
J100030B16AAAGCCCACGCNONE 
J100033K12AAAGCCCACGCNONE 
J100043M19AAAGCCCACGCNONE 
J100056N09AAAGCCCACGCNONE 
J100058E12AAAGCCCACGCNONE 
J100084J08AAAGCCCACGCNONE 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0312300AK111364GCCCACGCProtein of unknown function DUF26 domain containing protein. 
Os03g0316200009-196-H10GCCCACGCNONE 
013-011-H03GCCCACGCNONE 
014-031-F04GCCCACGCNONE 
014-083-C08GCCCACGCNONE 
AK071812GCCCACGCSimilar to Galactinol synthase (Fragment). 
AK103958GCCCACGCNONE 
J023054E12GCCCACGCNONE 
J023075G21GCCCACGCNONE 
J023113D08GCCCACGCNONE 
J065067M09GCCCACGCNONE 
J065102E07GCCCACGCNONE 
J065103M07GCCCACGCNONE 
Os03g0322200009-102-F01GCCCACGCNONE 
009-144-G06GCCCACGCNONE 
016-048-D06GCCCACGCNONE 
AK062978GCCCACGCConserved hypothetical protein. 
Os03g0419100AK073482GCCCACGCNONE 
AK119969GCCCACGCProtein of unknown function DUF1675 family protein. 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0588700Os03g0588700GCAGCCCACGCGConserved hypothetical protein. 
Os03g0607200013-002-F05GCGTGGGCCACNONE 
013-021-H08GCGTGGGCCACNONE 
013-038-E10GCGTGGGCCACNONE 
014-009-E05GCGTGGGCCACNONE 
014-034-H01GCGTGGGCCACNONE 
014-038-A08GCGTGGGCCACNONE 
014-072-G08GCGTGGGCCACNONE 
014-083-B06GCGTGGGCCACNONE 
014-088-G10GCGTGGGCCACNONE 
AK070268GCGTGGGCCACGibberellin regulated protein family protein. 
J023044E14GCGTGGGCCACNONE 
J065199F02GCGTGGGCCACNONE 
J075001C09GCGTGGGCCACNONE 
J075019F02GCGTGGGCCACNONE 
J075061J21GCGTGGGCCACNONE 
J075068G03GCGTGGGCCACNONE 
J075126F10GCGTGGGCCACNONE 
J075153F19GCGTGGGCCACNONE 
J080305I04GCGTGGGCCACNONE 
J080307F24GCGTGGGCCACNONE 
J080312E23GCGTGGGCCACNONE 
J080315M20GCGTGGGCCACNONE 
J080317E18GCGTGGGCCACNONE 
J090043I11GCGTGGGCCACNONE 
Os03g0643100AK106587GCCCACGCGTGCGHomeodomain-like containing protein. 
Os03g0643300AK099445GCCCACGCCCACGCCCACGCCCACGGCCCACGGSimilar to AER123Wp. 
AK108010GCCCACGCCCACGCCCACGCCCACGGCCCACGGNONE 
Os03g0656100AK062338GCCCACGCConserved hypothetical protein. 
Os03g0670200011-069-G05CGCGTGGGCGAGGNONE 
011-069-G05GCGTGGGCNONE 
AK069553CGCGTGGGCGAGGSimilar to YJR013Wp (Fragment). 
AK069553GCGTGGGCSimilar to YJR013Wp (Fragment). 
J023020O11CGCGTGGGCGAGGNONE 
J023020O11GCGTGGGCNONE 
J023114J22CGCGTGGGCGAGGNONE 
J023114J22GCGTGGGCNONE 
J100084F17CGCGTGGGCGAGGNONE 
J100084F17GCGTGGGCNONE 
J100087A11CGCGTGGGCGAGGNONE 
J100087A11GCGTGGGCNONE 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
J080302F19GATCGGACGGCCCACGCNONE 
J080303J23GATCGGACGGCCCACGCNONE 
J080303K16GATCGGACGGCCCACGCNONE 
J080306B15GATCGGACGGCCCACGCNONE 
J080309C02GATCGGACGGCCCACGCNONE 
J080312F13GATCGGACGGCCCACGCNONE 
J080312M04GATCGGACGGCCCACGCNONE 
J080315L20GATCGGACGGCCCACGCNONE 
Os03g0712600015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0751100AK102404GCCCACGCGSimilar to Isp4 protein-like. 
Os03g0788800AK071670GTGGGGCCCACGCZinc finger, RING-type domain containing protein. 
J013090J22GTGGGGCCCACGCNONE 
J023050M06GTGGGGCCCACGCNONE 
J023073A12GTGGGGCCCACGCNONE 
J023075P21GTGGGGCCCACGCNONE 
J023106F04GTGGGGCCCACGCNONE 
J075181H19GTGGGGCCCACGCNONE 
J090009C24GTGGGGCCCACGCNONE 
J100027L24GTGGGGCCCACGCNONE 
J100055F06GTGGGGCCCACGCNONE 
J100081C22GTGGGGCCCACGCNONE 
J100084I21GTGGGGCCCACGCNONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0799100AK058959CCTCGCCCACGCNONE 
AK102772CCTCGCCCACGCSimilar to WAVE-DAMPENED2. 
J023093D03CCTCGCCCACGCNONE 
J033099D22CCTCGCCCACGCNONE 
J090054G18CCTCGCCCACGCNONE 
J100031H24CCTCGCCCACGCNONE 
J100065H09CCTCGCCCACGCNONE 
J100082G10CCTCGCCCACGCNONE 
Os03g0824400AK070153TACGGCCCACGCTGCGGCCCNONE 
AK104298TACGGCCCACGCTGCGGCCCSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0833300015-038-A05GCGTGGGCNONE 
AK072164GCGTGGGCNONE 
J013122I04GCGTGGGCNONE 
J013130O11GCGTGGGCNONE 
Os03g0833500AK119356GAGGCGTGGGCCTGSimilar to 98kDa HDM allergen. 
Os03g0843500AK067985CGGGCCCAGCCCACGCNONE 
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAGCCCACGCNONE 
J080302L23CGGGCCCAGCCCACGCNONE 
Os03g0854000009-186-C03GGCTGGGCCCACGCGNONE 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
J065138B11GGCTGGGCCCACGCGNONE 
Os04g0372700009-110-D07GCGTGGGCCCACGCCACACGACGCGTCCNONE 
AK062814GCGTGGGCCCACGCCACACGACGCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065021E21GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065099E23GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065120F10GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065165P14GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065208L18GCGTGGGCCCACGCCACACGACGCGTCCNONE 
Os04g0387600009-148-E01CCCGTGGGGCCCACGCNONE 
009-155-A11CCCGTGGGGCCCACGCNONE 
009-175-F04CCCGTGGGGCCCACGCNONE 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
J065035F12CCCGTGGGGCCCACGCNONE 
J065162C13CCCGTGGGGCCCACGCNONE 
J065169L19CCCGTGGGGCCCACGCNONE 
Os04g0406600AK103609CCCAGCCCACGCPrephenate dehydratase domain containing protein. 
J033133I10CCCAGCCCACGCNONE 
J075092D11CCCAGCCCACGCNONE 
J100031M09CCCAGCCCACGCNONE 
Os04g0412900AK073418GCGTGGGCSec23/Sec24 trunk region domain containing protein. 
J033027C24GCGTGGGCNONE 
J033044C16GCGTGGGCNONE 
J090023G03GCGTGGGCNONE 
J090082C21GCGTGGGCNONE 
Os04g0428500AK109932CGCGTGGGCTGTCGGACGGConserved hypothetical protein. 
Os04g0434400014-079-B10GCCCACGCGTNONE 
AK063725GCCCACGCGTConserved hypothetical protein. 
Os04g0447600006-023-A01GCCCACGCNONE 
006-080-D11GCCCACGCNONE 
006-095-D01GCCCACGCNONE 
006-114-F03GCCCACGCNONE 
AK061282GCCCACGCSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0556300009-065-A04CGCGTGGGCCACACGNONE 
009-124-C05CGCGTGGGCCACACGNONE 
AK062772CGCGTGGGCCACACGGlutathione peroxidase. 
AY100689CGCGTGGGCCACACGNONE 
J065008N06CGCGTGGGCCACACGNONE 
J065012C13CGCGTGGGCCACACGNONE 
J065017J06CGCGTGGGCCACACGNONE 
J065033M15CGCGTGGGCCACACGNONE 
J065086O21CGCGTGGGCCACACGNONE 
J065102K04CGCGTGGGCCACACGNONE 
J065141D21CGCGTGGGCCACACGNONE 
J065159K20CGCGTGGGCCACACGNONE 
J065164C12CGCGTGGGCCACACGNONE 
J065170F10CGCGTGGGCCACACGNONE 
J065181F20CGCGTGGGCCACACGNONE 
J065205N07CGCGTGGGCCACACGNONE 
J065209N21CGCGTGGGCCACACGNONE 
J075001M12CGCGTGGGCCACACGNONE 
J075007D22CGCGTGGGCCACACGNONE 
J075026H04CGCGTGGGCCACACGNONE 
J075042O08CGCGTGGGCCACACGNONE 
J075044G20CGCGTGGGCCACACGNONE 
J075057D10CGCGTGGGCCACACGNONE 
J075096L23CGCGTGGGCCACACGNONE 
J075104K12CGCGTGGGCCACACGNONE 
J075119H14CGCGTGGGCCACACGNONE 
J075136C14CGCGTGGGCCACACGNONE 
J075172D01CGCGTGGGCCACACGNONE 
J075184M01CGCGTGGGCCACACGNONE 
J075186E06CGCGTGGGCCACACGNONE 
J075192M08CGCGTGGGCCACACGNONE 
J080006D18CGCGTGGGCCACACGNONE 
J080044G16CGCGTGGGCCACACGNONE 
J080087G15CGCGTGGGCCACACGNONE 
J100021I05CGCGTGGGCCACACGNONE 
J100039D10CGCGTGGGCCACACGNONE 
J100073B05CGCGTGGGCCACACGNONE 
J100074M12CGCGTGGGCCACACGNONE 
Os04g0559400AK106376CCTGGGCCCACGCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0563300AK100487CCCGGCCCACGCCyclin-like F-box domain containing protein. 
J023097O18CCCGGCCCACGCNONE 
J065100E16CCCGGCCCACGCNONE 
J075022C23CCCGGCCCACGCNONE 
J075023L18CCCGGCCCACGCNONE 
J075040N10CCCGGCCCACGCNONE 
J075061L14CCCGGCCCACGCNONE 
J075069B15CCCGGCCCACGCNONE 
J075106C16CCCGGCCCACGCNONE 
J075138P13CCCGGCCCACGCNONE 
J075139H18CCCGGCCCACGCNONE 
J075139L06CCCGGCCCACGCNONE 
J075149B07CCCGGCCCACGCNONE 
J075177N21CCCGGCCCACGCNONE 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0615700AK120766GCCCACGCArgonaute and Dicer protein, PAZ domain containing protein. 
Os04g0635000009-031-A05GCCCACGCCACGCCACGCCACNONE 
009-074-F05GCCCACGCCACGCCACGCCACNONE 
009-163-H03GCCCACGCCACGCCACGCCACNONE 
AK062619GCCCACGCCACGCCACGCCACConserved hypothetical protein. 
Os04g0639100009-158-D03CGCGTGGGCCTCNONE 
AK063036CGCGTGGGCCTCConserved hypothetical protein. 
J075045D14CGCGTGGGCCTCNONE 
J075047L16CGCGTGGGCCTCNONE 
J075048D20CGCGTGGGCCTCNONE 
J075056E20CGCGTGGGCCTCNONE 
J075074E14CGCGTGGGCCTCNONE 
J075108F16CGCGTGGGCCTCNONE 
J075143L19CGCGTGGGCCTCNONE 
J075146L07CGCGTGGGCCTCNONE 
J075158I04CGCGTGGGCCTCNONE 
J075172B20CGCGTGGGCCTCNONE 
J090061M08CGCGTGGGCCTCNONE 
Os04g0673400Os04g0673400GCGTGGGCSimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0674000006-093-C01GCGGGCCCACGCNONE 
009-040-F06GCGGGCCCACGCNONE 
AK071276GCGGGCCCACGCNONE 
AK109377GCGGGCCCACGCConserved hypothetical protein. 
AK119671GCGGGCCCACGCNONE 
J023084J11GCGGGCCCACGCNONE 
J023088F18GCGGGCCCACGCNONE 
J065099M12GCGGGCCCACGCNONE 
J065136J08GCGGGCCCACGCNONE 
J065167H22GCGGGCCCACGCNONE 
J075046L21GCGGGCCCACGCNONE 
J080029F17GCGGGCCCACGCNONE 
J080053C16GCGGGCCCACGCNONE 
J080053E24GCGGGCCCACGCNONE 
J080074D14GCGGGCCCACGCNONE 
J100029C12GCGGGCCCACGCNONE 
J100030D01GCGGGCCCACGCNONE 
J100044E16GCGGGCCCACGCNONE 
J100065N18GCGGGCCCACGCNONE 
J100077D18GCGGGCCCACGCNONE 
J100090P13GCGGGCCCACGCNONE 
Os04g0678200006-037-E05GGGGCCCACGCGTNONE 
006-059-G04GGGGCCCACGCGTNONE 
006-097-A11GGGGCCCACGCGTNONE 
006-098-D11GGGGCCCACGCGTNONE 
009-154-H11GGGGCCCACGCGTNONE 
AK106193GGGGCCCACGCGTProtein of unknown function DUF1218 family protein. 
J013064K07GGGGCCCACGCGTNONE 
Os04g0685600AK067506GCGGCCCACGCGExo70 exocyst complex subunit family protein. 
J013108D21GCGGCCCACGCGNONE 
J023041E19GCGGCCCACGCGNONE 
J065006M21GCGGCCCACGCGNONE 
J065060B21GCGGCCCACGCGNONE 
J065086K07GCGGCCCACGCGNONE 
J065121N03GCGGCCCACGCGNONE 
J065201M22GCGGCCCACGCGNONE 
J075004H05GCGGCCCACGCGNONE 
J075005G06GCGGCCCACGCGNONE 
J075032N07GCGGCCCACGCGNONE 
J075055M01GCGGCCCACGCGNONE 
J075057A20GCGGCCCACGCGNONE 
J075078L23GCGGCCCACGCGNONE 
J075137G04GCGGCCCACGCGNONE 
J090026N09GCGGCCCACGCGNONE 
J090044L05GCGGCCCACGCGNONE 
Os05g0111200009-033-A06ACGCGTGGGCCACNONE 
AK101693ACGCGTGGGCCACSimilar to Amino acid selective channel protein. 
J065006E13ACGCGTGGGCCACNONE 
J075001D12ACGCGTGGGCCACNONE 
J075005J18ACGCGTGGGCCACNONE 
J075009L08ACGCGTGGGCCACNONE 
J075012M21ACGCGTGGGCCACNONE 
J075019K17ACGCGTGGGCCACNONE 
J075020D07ACGCGTGGGCCACNONE 
J075041D11ACGCGTGGGCCACNONE 
J075051C03ACGCGTGGGCCACNONE 
J075060C05ACGCGTGGGCCACNONE 
J075079N09ACGCGTGGGCCACNONE 
J075094B04ACGCGTGGGCCACNONE 
J075108E08ACGCGTGGGCCACNONE 
J075115G05ACGCGTGGGCCACNONE 
J075147L21ACGCGTGGGCCACNONE 
J075161G12ACGCGTGGGCCACNONE 
J075168J11ACGCGTGGGCCACNONE 
J075168L11ACGCGTGGGCCACNONE 
J075174F22ACGCGTGGGCCACNONE 
Os05g0119000AK069359GCGTGGGCCCCACCConserved hypothetical protein 245 family protein. 
J065020A09GCGTGGGCCCCACCNONE 
J065043F11GCGTGGGCCCCACCNONE 
J065182D16GCGTGGGCCCCACCNONE 
J065211L04GCGTGGGCCCCACCNONE 
Os05g0121800AK101222CCCACGCGTGGGCCCTConserved hypothetical protein. 
J033031D02CCCACGCGTGGGCCCTNONE 
J065078F10CCCACGCGTGGGCCCTNONE 
J065151J16CCCACGCGTGGGCCCTNONE 
J065151K04CCCACGCGTGGGCCCTNONE 
J090057E18CCCACGCGTGGGCCCTNONE 
Os05g0145900006-095-D04CCACGGCCCACGCCCACTCCNONE 
006-104-B04CCACGGCCCACGCCCACTCCNONE 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
J043034M11CCACGGCCCACGCCCACTCCNONE 
J053032K19CCACGGCCCACGCCCACTCCNONE 
J090096F20CCACGGCCCACGCCCACTCCNONE 
Os05g0150600011-043-D06CCACTGACAGCGTGGGCCCACANONE 
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein. 
AY180331CCACTGACAGCGTGGGCCCACANONE 
J090053A16CCACTGACAGCGTGGGCCCACANONE 
Os05g0163700AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0164100AF456329CCCCCGCGTGGGCCCCACCCGNONE 
AK065086CCCCCGCGTGGGCCCCACCCGNONE 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CCCCCGCGTGGGCCCCACCCGNONE 
J013132O12CCCCCGCGTGGGCCCCACCCGNONE 
J023003N09CCCCCGCGTGGGCCCCACCCGNONE 
Os05g0184901Os05g0184901CGCGTGGGCCGTASigma factor, regions 3 and 4 domain containing protein. 
Os05g0193600AK064687GCGTGGGCConserved hypothetical protein. 
J075087C03GCGTGGGCNONE 
Os05g0214900006-070-A10GCGTGGGCTGCNONE 
AK061081GCGTGGGCTGCConserved hypothetical protein. 
Os05g0283600AK100359GCGTGGGCCGGTConserved hypothetical protein. 
AK106958GCGTGGGCCGGTNONE 
AK109539GCGTGGGCCGGTNONE 
J023083K23GCGTGGGCCGGTNONE 
Os05g0322900006-057-H12CGCGTGGGCCGCNONE 
006-057-H12GCCCACGCNONE 
014-051-A08CGCGTGGGCCGCNONE 
014-051-A08GCCCACGCNONE 
AK063697CGCGTGGGCCGCNONE 
AK063697GCCCACGCNONE 
AK066255CGCGTGGGCCGCSimilar to WRKY transcription factor 45. 
AK066255GCCCACGCSimilar to WRKY transcription factor 45. 
AK103959CGCGTGGGCCGCNONE 
AK103959GCCCACGCNONE 
AY870611CGCGTGGGCCGCNONE 
AY870611GCCCACGCNONE 
J100068H13CGCGTGGGCCGCNONE 
J100068H13GCCCACGCNONE 
Os05g0331200AK100884CCACGGCCCACGCSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os05g0399300AK108949TCCGACGGCGTGGGCTNONE 
Os05g0440100015-006-F06TACGGCCCACGCNONE 
015-076-D04TACGGCCCACGCNONE 
AK073094TACGGCCCACGCNONE 
AK102786TACGGCCCACGCHistone deacetylase superfamily protein. 
J033107M16TACGGCCCACGCNONE 
Os05g0454400AK107942GCGTGGGCCCCACAConserved hypothetical protein. 
Os05g0456000AK058420GCGTGGGCGTGTGGCCCAAAAMitochondrial glycoprotein family protein. 
AK102036GCGTGGGCGTGTGGCCCAAAANONE 
J065066F02GCGTGGGCGTGTGGCCCAAAANONE 
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE 
Os05g0503300011-013-H12CGCGTGGGCNONE 
012-072-B03CGCGTGGGCNONE 
AK073969CGCGTGGGCSimilar to Sulfite reductase (Fragment). 
AK100773CGCGTGGGCNONE 
AK103289CGCGTGGGCNONE 
J013045K07CGCGTGGGCNONE 
J033075F01CGCGTGGGCNONE 
J033125N07CGCGTGGGCNONE 
J033130G12CGCGTGGGCNONE 
Os05g0509500AB115419GCGTGGGCGTGTGGCNONE 
AK068958GCGTGGGCGTGTGGCSimilar to Signal recognition particle 54 kDa protein 2 (SRP54). 
Os05g0510700AK070308GCCCACGCBSD domain containing protein. 
Os05g0514300AK061747GCGTGGGCCCGSimilar to Tubby-like protein 3. 
AK098851GCGTGGGCCCGNONE 
Os05g0557200AK062090CGTGTGGGGCCCACGCGNONE 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
J013047E13CGTGTGGGGCCCACGCGNONE 
J013089P04CGTGTGGGGCCCACGCGNONE 
J013130H17CGTGTGGGGCCCACGCGNONE 
J013132C20CGTGTGGGGCCCACGCGNONE 
J023001E06CGTGTGGGGCCCACGCGNONE 
J023108C09CGTGTGGGGCCCACGCGNONE 
J023125C12CGTGTGGGGCCCACGCGNONE 
J033023O10CGTGTGGGGCCCACGCGNONE 
J033033K16CGTGTGGGGCCCACGCGNONE 
J033064C11CGTGTGGGGCCCACGCGNONE 
J033071P07CGTGTGGGGCCCACGCGNONE 
J033072H14CGTGTGGGGCCCACGCGNONE 
J033084F06CGTGTGGGGCCCACGCGNONE 
J033084H11CGTGTGGGGCCCACGCGNONE 
J033097C05CGTGTGGGGCCCACGCGNONE 
J043009E20CGTGTGGGGCCCACGCGNONE 
J053035M10CGTGTGGGGCCCACGCGNONE 
J053043J22CGTGTGGGGCCCACGCGNONE 
J053082K10CGTGTGGGGCCCACGCGNONE 
J053094N13CGTGTGGGGCCCACGCGNONE 
Os05g0560600011-097-B07GCGTGGGCNONE 
AK067862GCGTGGGCNONE 
AK122091GCGTGGGCHomeodomain-like containing protein. 
J013124K11GCGTGGGCNONE 
J033124C04GCGTGGGCNONE 
J065013L06GCGTGGGCNONE 
J065117J23GCGTGGGCNONE 
Os05g0567500AK073046CGGGTGGGCCCACGCGNONE 
AK121133CGGGTGGGCCCACGCGDNA glycosylase family protein. 
J023075P20CGGGTGGGCCCACGCGNONE 
Os05g0568600009-024-B09TCATGGGCCCACGCNONE 
AK063781TCATGGGCCCACGCProtein of unknown function DUF1645 family protein. 
J080049H14TCATGGGCCCACGCNONE 
J080062M08TCATGGGCCCACGCNONE 
J080064I07TCATGGGCCCACGCNONE 
J080068A12TCATGGGCCCACGCNONE 
J080086J10TCATGGGCCCACGCNONE 
Os05g0571800009-157-G07GCCCACGCGNONE 
AK063033GCCCACGCGConserved hypothetical protein. 
Os05g0576300015-055-B11GCCCACGCGNONE 
AK106354GCCCACGCGZinc finger, CCCH-type domain containing protein. 
Os05g0594800AK058332GCGTGGGCAdhesion regulating molecule family protein. 
AK068013GCGTGGGCNONE 
J013129L24GCGTGGGCNONE 
Os05g0595300011-076-H02GCGTGGGCCCATGGNONE 
012-009-E07GCGTGGGCCCATGGNONE 
012-096-B01GCGTGGGCCCATGGNONE 
AK059614GCGTGGGCCCATGGNONE 
AK121601GCGTGGGCCCATGGSimilar to CONSTANS-like protein. 
J033040P21GCGTGGGCCCATGGNONE 
Os06g0152200AB001886GCCCACGCGTCCNONE 
AK072231GCCCACGCGTCCZinc-finger protein R2931. 
AK104083GCCCACGCGTCCNONE 
J065077H19GCCCACGCGTCCNONE 
J065208H22GCCCACGCGTCCNONE 
J100032H08GCCCACGCGTCCNONE 
Os06g0168700011-054-F04GAGGCGTGGGCNONE 
012-001-G03GAGGCGTGGGCNONE 
AK101305GAGGCGTGGGCNONE 
AK103637GAGGCGTGGGCSimilar to Prolin rich protein. 
J075082N06GAGGCGTGGGCNONE 
J100086I19GAGGCGTGGGCNONE 
Os06g0211300009-024-G02GCGTGGGCNONE 
AK060015GCGTGGGCSterol-binding domain containing protein. 
J013070F17GCGTGGGCNONE 
J043021H14GCGTGGGCNONE 
J053055N13GCGTGGGCNONE 
J065027B03GCGTGGGCNONE 
J065089K23GCGTGGGCNONE 
J065211P10GCGTGGGCNONE 
J075018F05GCGTGGGCNONE 
J075050P05GCGTGGGCNONE 
J075054G10GCGTGGGCNONE 
J075090D23GCGTGGGCNONE 
J075122C12GCGTGGGCNONE 
J075122I05GCGTGGGCNONE 
J075149M07GCGTGGGCNONE 
J075155H05GCGTGGGCNONE 
J075169P07GCGTGGGCNONE 
J075188L21GCGTGGGCNONE 
Os06g0248300AK070175GCGTGGGCNONE 
AK070362GCGTGGGCConserved hypothetical protein. 
J023025O21GCGTGGGCNONE 
J023049B05GCGTGGGCNONE 
J023133G04GCGTGGGCNONE 
Os06g0332500009-108-G06GCGTGGGCNONE 
009-119-F06GCGTGGGCNONE 
AK121262GCGTGGGCConserved hypothetical protein. 
J023104L05GCGTGGGCNONE 
J033022F22GCGTGGGCNONE 
Os06g0334600AK064993CCCGGCCCACGCGHypothetical protein. 
J013001D16CCCGGCCCACGCGNONE 
J043009I09CCCGGCCCACGCGNONE 
Os06g0478600015-007-H07GCCCACGCNONE 
AK064086GCCCACGCNONE 
AK105019GCCCACGCLeucine rich repeat, N-terminal domain containing protein. 
Os06g0495500AK109873GCGTGGGCCATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0573700015-015-F02AGCCCACGCNONE 
AK106254AGCCCACGCConserved hypothetical protein. 
J065172G24AGCCCACGCNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05CGCGTGGGCCCCACCACNONE 
J065100L18CGCGTGGGCCCCACCACNONE 
J065129N15CGCGTGGGCCCCACCACNONE 
J065152M08CGCGTGGGCCCCACCACNONE 
J065198M12CGCGTGGGCCCCACCACNONE 
J090077J22CGCGTGGGCCCCACCACNONE 
J100024G23CGCGTGGGCCCCACCACNONE 
J100027L01CGCGTGGGCCCCACCACNONE 
J100047C06CGCGTGGGCCCCACCACNONE 
J100055D01CGCGTGGGCCCCACCACNONE 
J100067M05CGCGTGGGCCCCACCACNONE 
J100077M16CGCGTGGGCCCCACCACNONE 
J100078M22CGCGTGGGCCCCACCACNONE 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
J033042P11GCCCACCCGGCCCACGCNONE 
J033072G12GCCCACCCGGCCCACGCNONE 
J090050C02GCCCACCCGGCCCACGCNONE 
Os06g0683400009-047-C07CCAGCCCACGCCCAACTNONE 
009-060-B06CCAGCCCACGCCCAACTNONE 
013-057-F12CCAGCCCACGCCCAACTNONE 
AK111852CCAGCCCACGCCCAACTNONE 
AK111897CCAGCCCACGCCCAACTNONE 
AK112082CCAGCCCACGCCCAACTSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07CCAGCCCACGCCCAACTNONE 
J065187J11CCAGCCCACGCCCAACTNONE 
J065197L08CCAGCCCACGCCCAACTNONE 
J100045K14CCAGCCCACGCCCAACTNONE 
J100074M08CCAGCCCACGCCCAACTNONE 
J100088H21CCAGCCCACGCCCAACTNONE 
Os06g0704700AK120907GCGTGGGCNmrA-like family protein. 
AY224493GCGTGGGCNONE 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0139400AB096864CGCGTGGGCCCCACTCCNONE 
AK065558CGCGTGGGCCCCACTCCUDP-glucose 4-epimerase family protein. 
AK099140CGCGTGGGCCCCACTCCNONE 
AK099183CGCGTGGGCCCCACTCCNONE 
J013033B01CGCGTGGGCCCCACTCCNONE 
J013157B14CGCGTGGGCCCCACTCCNONE 
J023052E04CGCGTGGGCCCCACTCCNONE 
J023086K05CGCGTGGGCCCCACTCCNONE 
J023099C15CGCGTGGGCCCCACTCCNONE 
J033025C08CGCGTGGGCCCCACTCCNONE 
J033072I24CGCGTGGGCCCCACTCCNONE 
J043020I04CGCGTGGGCCCCACTCCNONE 
J090039I21CGCGTGGGCCCCACTCCNONE 
J090078P20CGCGTGGGCCCCACTCCNONE 
J090084C18CGCGTGGGCCCCACTCCNONE 
J100024F07CGCGTGGGCCCCACTCCNONE 
J100054D22CGCGTGGGCCCCACTCCNONE 
J100062O08CGCGTGGGCCCCACTCCNONE 
Os07g0147600AK099551ACAGCCCACGCNONE 
AK102834ACAGCCCACGCProtein kinase-like domain containing protein. 
J090004P22ACAGCCCACGCNONE 
J090040K07ACAGCCCACGCNONE 
J090044I03ACAGCCCACGCNONE 
J090060I04ACAGCCCACGCNONE 
J090063O16ACAGCCCACGCNONE 
J090072C03ACAGCCCACGCNONE 
J090072E05ACAGCCCACGCNONE 
J090091P08ACAGCCCACGCNONE 
J090099P14ACAGCCCACGCNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment). 
AK103768ACCCGCGCGACGTGGGGCCCACGCNONE 
Os07g0238700AK067680GCGTGGGCNONE 
AK101492GCGTGGGCSimilar to Glutamate dehydrogenase (EC 1.4.1.3) (GDH). 
J013114K24GCGTGGGCNONE 
J033042P14GCGTGGGCNONE 
J065021G13GCGTGGGCNONE 
J065121C20GCGTGGGCNONE 
J065124D06GCGTGGGCNONE 
J065157D02GCGTGGGCNONE 
J065157K12GCGTGGGCNONE 
J065212K07GCGTGGGCNONE 
J080301G13GCGTGGGCNONE 
J080308E14GCGTGGGCNONE 
J080311J11GCGTGGGCNONE 
J080313O06GCGTGGGCNONE 
Os07g0258400AK121534ACCCGCGCGCCCACGCGNONE 
AK121534GCCCACGCCACNONE 
L41217ACCCGCGCGCCCACGCGNONE 
L41217GCCCACGCCACNONE 
S81897ACCCGCGCGCCCACGCGOsNramp1 (Integral membrane protein). 
S81897GCCCACGCCACOsNramp1 (Integral membrane protein). 
Os07g0300900AK061941GCGTGGGCCTCSimilar to Lysine-sensitive aspartate kinase. 
AK102162GCGTGGGCCTCNONE 
Os07g0419800J080309B06GAGGCGTGGGCCACNONE 
Os07g0448800AB029446GCGTGGGCNONE 
Os07g0479200005-017-H08GAGGCCCACGCNONE 
AK058326GAGGCCCACGCSimilar to SL15-like (Fragment). 
J013092A08GAGGCCCACGCNONE 
J033139E04GAGGCCCACGCNONE 
J043016M16GAGGCCCACGCNONE 
J053050O18GAGGCCCACGCNONE 
J053098B03GAGGCCCACGCNONE 
J065068G10GAGGCCCACGCNONE 
J065091I17GAGGCCCACGCNONE 
J065109A03GAGGCCCACGCNONE 
J065168B17GAGGCCCACGCNONE 
J065177A05GAGGCCCACGCNONE 
J065180J01GAGGCCCACGCNONE 
J075006F13GAGGCCCACGCNONE 
J075022J03GAGGCCCACGCNONE 
J075024N09GAGGCCCACGCNONE 
J075114B12GAGGCCCACGCNONE 
J080023M06GAGGCCCACGCNONE 
J080081N24GAGGCCCACGCNONE 
J090060N07GAGGCCCACGCNONE 
Os07g0516200AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
Os07g0556200006-026-F07GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-042-H11GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-048-D01GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-051-E02GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-061-E07GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-075-H06GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-110-E10GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-112-C09GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-116-E10GTGTGGGGGCGTGGGCGTGTGGCNONE 
AF093631GTGTGGGGGCGTGGGCGTGTGGCNONE 
AK071634GTGTGGGGGCGTGGGCGTGTGGCRieske iron-sulfur protein family protein. 
J013022H19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J013057E06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J013151C13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023080E08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023100K03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023105H15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023114I15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065002C09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065037K17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065038K18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065039D16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065040D18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065042O04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046J20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046L02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046L03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065053H02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065063A22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065066C08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065077J23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065081N04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065085O08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065087H09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065093M05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065094C01GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065102I04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065103C05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065104O06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065108H03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065121I10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065123E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065128E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065129G16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065131I07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065135F13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065137K23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065143A11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065143I04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065154N18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065170L23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065179D21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065180C18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065190F03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065205C02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065208A12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065209B05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065211C03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065212L24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065216I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065217O06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065218A02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075007M16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075013H23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075013O14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075015K10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075022G20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075023H23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075037I08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075038C06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075042B14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075063D13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075064O11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075067D07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075071G15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075072F15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075073D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075083M23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075084J12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075088I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075089C10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075093K09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075095P15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075098P08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075103A15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075108G23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075116G03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075118O21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075127H14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075129H07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075138J20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075142F12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075143F18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075143L11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075145N09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075146N05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075147P21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075154C18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075154N24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075155D22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075159C14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075161E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075168K20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075170E13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075170M24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075175E08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075176C15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075176H16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075177M01GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075178F18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075179C03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075179E16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075183D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075188O16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075193J05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080001M22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080013N04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080031E11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080034E09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080034L17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080037F06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080038M04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080040F10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080042P19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080045B11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080048E07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080048I09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080050J17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080051G02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080062E19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080063E12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080079A22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080079C15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080080D08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080096L22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080302E06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080302G12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080303B02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080303M06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080304I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080306N10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080308D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080308J23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080317I16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100038H16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100043C14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100045N09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100073D03GTGTGGGGGCGTGGGCGTGTGGCNONE 
Os07g0583700AK070537CCCAGCCCACGCWRKY transcription factor 78. 
AY341850CCCAGCCCACGCNONE 
J013089A12CCCAGCCCACGCNONE 
J013118N13CCCAGCCCACGCNONE 
J023039L18CCCAGCCCACGCNONE 
J023062H03CCCAGCCCACGCNONE 
J100029J20CCCAGCCCACGCNONE 
Os07g0589400AK072501CACGGCCCACGCGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617CACGGCCCACGCGNONE 
AK104756CACGGCCCACGCGNONE 
Os07g0616800AK100306ATGGCCCACGCCTCSucrose synthase 3 (EC 2.4.1.13) (Sucrose-UDP glucosyltransferase 3). 
J023081P20ATGGCCCACGCCTCNONE 
J023083F19ATGGCCCACGCCTCNONE 
J023131O18ATGGCCCACGCCTCNONE 
J075005A08ATGGCCCACGCCTCNONE 
J075014A17ATGGCCCACGCCTCNONE 
J075034L22ATGGCCCACGCCTCNONE 
J075042E03ATGGCCCACGCCTCNONE 
J075058F21ATGGCCCACGCCTCNONE 
J075068P20ATGGCCCACGCCTCNONE 
J075069D01ATGGCCCACGCCTCNONE 
J075081D21ATGGCCCACGCCTCNONE 
J075094N20ATGGCCCACGCCTCNONE 
J075141C12ATGGCCCACGCCTCNONE 
J075175I11ATGGCCCACGCCTCNONE 
J075177O15ATGGCCCACGCCTCNONE 
J075181B08ATGGCCCACGCCTCNONE 
J075181E16ATGGCCCACGCCTCNONE 
J075182M01ATGGCCCACGCCTCNONE 
J090002E09ATGGCCCACGCCTCNONE 
J090012C07ATGGCCCACGCCTCNONE 
J090016H23ATGGCCCACGCCTCNONE 
J090018C17ATGGCCCACGCCTCNONE 
J090023D12ATGGCCCACGCCTCNONE 
J090025B11ATGGCCCACGCCTCNONE 
J090026B16ATGGCCCACGCCTCNONE 
J090026D01ATGGCCCACGCCTCNONE 
J090026N17ATGGCCCACGCCTCNONE 
J090027G04ATGGCCCACGCCTCNONE 
J090027J17ATGGCCCACGCCTCNONE 
J090030L01ATGGCCCACGCCTCNONE 
J090032F19ATGGCCCACGCCTCNONE 
J090033C02ATGGCCCACGCCTCNONE 
J090041D05ATGGCCCACGCCTCNONE 
J090042O17ATGGCCCACGCCTCNONE 
J090048I02ATGGCCCACGCCTCNONE 
J090048K18ATGGCCCACGCCTCNONE 
J090054J02ATGGCCCACGCCTCNONE 
J090056K21ATGGCCCACGCCTCNONE 
J090057D16ATGGCCCACGCCTCNONE 
J090058F22ATGGCCCACGCCTCNONE 
J090062L16ATGGCCCACGCCTCNONE 
J090062L17ATGGCCCACGCCTCNONE 
J090063H10ATGGCCCACGCCTCNONE 
J090063L17ATGGCCCACGCCTCNONE 
J090069A12ATGGCCCACGCCTCNONE 
J090069I20ATGGCCCACGCCTCNONE 
J090069L03ATGGCCCACGCCTCNONE 
J090072F07ATGGCCCACGCCTCNONE 
J090074K19ATGGCCCACGCCTCNONE 
J090077E02ATGGCCCACGCCTCNONE 
J090078L13ATGGCCCACGCCTCNONE 
J090081C14ATGGCCCACGCCTCNONE 
J090081J18ATGGCCCACGCCTCNONE 
J090083E11ATGGCCCACGCCTCNONE 
J090083I21ATGGCCCACGCCTCNONE 
J090083P21ATGGCCCACGCCTCNONE 
J090088H09ATGGCCCACGCCTCNONE 
J090090I19ATGGCCCACGCCTCNONE 
J090090K03ATGGCCCACGCCTCNONE 
J090092L21ATGGCCCACGCCTCNONE 
J090094M21ATGGCCCACGCCTCNONE 
J090095E24ATGGCCCACGCCTCNONE 
J090095H06ATGGCCCACGCCTCNONE 
J090095P19ATGGCCCACGCCTCNONE 
J090096E13ATGGCCCACGCCTCNONE 
J090096G02ATGGCCCACGCCTCNONE 
J090096N12ATGGCCCACGCCTCNONE 
J090097C07ATGGCCCACGCCTCNONE 
Os07g0661600006-050-D12ACGCGTGGGCCCGGGNONE 
009-124-B10ACGCGTGGGCCCGGGNONE 
AK061123ACGCGTGGGCCCGGGNONE 
AK066432ACGCGTGGGCCCGGGSimilar to RNA-binding protein-like protein. 
AK104664ACGCGTGGGCCCGGGNONE 
J013064M13ACGCGTGGGCCCGGGNONE 
J013122O12ACGCGTGGGCCCGGGNONE 
J033044A16ACGCGTGGGCCCGGGNONE 
J033144D14ACGCGTGGGCCCGGGNONE 
J090078P13ACGCGTGGGCCCGGGNONE 
Os07g0673400009-130-B03GCCCACGCGNONE 
014-016-A11GCCCACGCGNONE 
AF491815GCCCACGCGNONE 
AK064061GCCCACGCGUniversal stress protein (Usp) family protein. 
AK073356GCCCACGCGNONE 
AY224503GCCCACGCGNONE 
J033028K22GCCCACGCGNONE 
J065010E10GCCCACGCGNONE 
Os07g0681700AK103213GCGGCCCACGCGlycosyl transferase, family 8 protein. 
Os08g0101600AB074260TGTTGGGCCGGCGTGGGCTTGSingle-strand DNA endonuclease-1. 
AK102542TGTTGGGCCGGCGTGGGCTTGNONE 
Os08g0143400015-006-A10TGTGGGCCCACGCNONE 
AK066792TGTGGGCCCACGCNONE 
AK120532TGTGGGCCCACGCSWIRM domain containing protein. 
J100083F02TGTGGGCCCACGCNONE 
Os08g0143500006-072-G06GCGTGGGCCCACANONE 
016-053-H02GCGTGGGCCCACANONE 
AK061094GCGTGGGCCCACANONE 
AK071122GCGTGGGCCCACAGlycosyl transferase, family 14 protein. 
J023081E17GCGTGGGCCCACANONE 
J023106O18GCGTGGGCCCACANONE 
J043001N22GCGTGGGCCCACANONE 
J065062D05GCGTGGGCCCACANONE 
J065099M15GCGTGGGCCCACANONE 
J065180K12GCGTGGGCCCACANONE 
J090045L23GCGTGGGCCCACANONE 
J100088K05GCGTGGGCCCACANONE 
Os08g0319900AK108030GCGTGGGCTGGPutative cyclase family protein. 
Os08g0322400AK120116GCGTGGGCCCTNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20GCGTGGGCCCTNONE 
J013096J15GCGTGGGCCCTNONE 
Os08g0416000AF145729TAAGCCCACGCHomeodomain leucine zipper protein. 
AK100634TAAGCCCACGCNONE 
AK101569TAAGCCCACGCNONE 
AK110561TAAGCCCACGCNONE 
J013074A01TAAGCCCACGCNONE 
J013159K22TAAGCCCACGCNONE 
J023028M01TAAGCCCACGCNONE 
J023033C15TAAGCCCACGCNONE 
J023107N23TAAGCCCACGCNONE 
J023110A12TAAGCCCACGCNONE 
J023122D02TAAGCCCACGCNONE 
J033050G15TAAGCCCACGCNONE 
J033107D17TAAGCCCACGCNONE 
J065082J21TAAGCCCACGCNONE 
J065165L21TAAGCCCACGCNONE 
J065171J17TAAGCCCACGCNONE 
J100026K13TAAGCCCACGCNONE 
J100039E16TAAGCCCACGCNONE 
J100056J11TAAGCCCACGCNONE 
J100070I19TAAGCCCACGCNONE 
J100073B16TAAGCCCACGCNONE 
J100081M19TAAGCCCACGCNONE 
J100088E09TAAGCCCACGCNONE 
Os08g0457600AB095096GCCCACGCGNONE 
AK065020GCCCACGCGSimilar to RSH2. 
AK099624GCCCACGCGNONE 
J013001F20GCCCACGCGNONE 
J013075L22GCCCACGCGNONE 
J023001L02GCCCACGCGNONE 
J023075M07GCCCACGCGNONE 
J033125H13GCCCACGCGNONE 
Os08g0533700AK073691GGGGCCCACGCCCCACCConserved hypothetical protein. 
J033060E01GGGGCCCACGCCCCACCNONE 
J033111N06GGGGCCCACGCCCCACCNONE 
J053025N12GGGGCCCACGCCCCACCNONE 
J053080P18GGGGCCCACGCCCCACCNONE 
J053098H09GGGGCCCACGCCCCACCNONE 
J090076L19GGGGCCCACGCCCCACCNONE 
J100056A18GGGGCCCACGCCCCACCNONE 
Os08g0544800009-168-G01GTGTGGGGCCCACGCGNONE 
011-046-D09GTGTGGGGCCCACGCGNONE 
012-003-C08GTGTGGGGCCCACGCGNONE 
012-042-B06GTGTGGGGCCCACGCGNONE 
013-035-H12GTGTGGGGCCCACGCGNONE 
013-072-A10GTGTGGGGCCCACGCGNONE 
014-010-B11GTGTGGGGCCCACGCGNONE 
014-097-E06GTGTGGGGCCCACGCGNONE 
015-003-E12GTGTGGGGCCCACGCGNONE 
015-040-B04GTGTGGGGCCCACGCGNONE 
AK060536GTGTGGGGCCCACGCGNONE 
AK102666GTGTGGGGCCCACGCGNONE 
AK119660GTGTGGGGCCCACGCGPCF2. 
D87261GTGTGGGGCCCACGCGNONE 
J090049N23GTGTGGGGCCCACGCGNONE 
J090084G06GTGTGGGGCCCACGCGNONE 
Os08g0556000AK068463GCGTGGGCSimilar to YTH domain protein 2 (High-glucose-regulated protein 8) (NY-REN-2 antigen) (CLL-associated antigen KW-14). 
Os08g0557600AB026731CGCGTGGGCNONE 
AK102459CGCGTGGGCSimilar to Monodehydroascorbate reductase (EC 1.6.5.4) (MDAR) (Ascorbate free radical reductase) (AFR reductase). 
J023088J22CGCGTGGGCNONE 
J033094C01CGCGTGGGCNONE 
J033125C20CGCGTGGGCNONE 
J065039E01CGCGTGGGCNONE 
J065212L01CGCGTGGGCNONE 
J075076D03CGCGTGGGCNONE 
J090019L14CGCGTGGGCNONE 
J090053K23CGCGTGGGCNONE 
Os09g0280300AK073346GCCCACGCOxidoreductase, N-terminal domain containing protein. 
J033030J06GCCCACGCNONE 
J053046J06GCCCACGCNONE 
J053076K11GCCCACGCNONE 
J065011L04GCCCACGCNONE 
J075038P07GCCCACGCNONE 
J075185H05GCCCACGCNONE 
J090035J11GCCCACGCNONE 
J090044F02GCCCACGCNONE 
J090079G20GCCCACGCNONE 
Os09g0323000AK121426CGCGTGGGCCCCACTCCACCTGTCSimilar to UDP-galactose 4-epimerase-like protein. 
Os09g0342000AK111440GCCCACGCGCyclin-like F-box domain containing protein. 
Os09g0371200J100027I16GCCCACGCGTMajor facilitator superfamily MFS_1 protein. 
Os09g0375700AK068295CGCGTGGGCCGGCCCAGCHypothetical protein. 
Os09g0420300AK120582GCCCACGCGDNA glycosylase family protein. 
Os09g0444700AK120833GCCCACGCMitochondrial substrate carrier family protein. 
J100039B19GCCCACGCNONE 
Os09g0456900AK073236GCGTGGGCNucleic acid-binding, OB-fold domain containing protein. 
Os09g0458200AK108675CGCGTGGGCConserved hypothetical protein. 
Os09g0459200AK110733GCCCACGCConserved hypothetical protein. 
J065131C07GCCCACGCNONE 
Os09g0482860006-045-G12GCGTGGGCCGCCCAACTNONE 
AK071910GCGTGGGCCGCCCAACTNONE 
AK099026GCGTGGGCCGCCCAACTNONE 
AK105917GCGTGGGCCGCCCAACTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013127L05GCGTGGGCCGCCCAACTNONE 
J065102M20GCGTGGGCCGCCCAACTNONE 
J065119M08GCGTGGGCCGCCCAACTNONE 
Os09g0493700015-091-G11TAGGCCCACGCNONE 
AK068501TAGGCCCACGCSimilar to CUC2. 
AK099237TAGGCCCACGCNONE 
J013155B08TAGGCCCACGCNONE 
J023006E01TAGGCCCACGCNONE 
J023060K23TAGGCCCACGCNONE 
J023100B11TAGGCCCACGCNONE 
J033026L19TAGGCCCACGCNONE 
J033129J12TAGGCCCACGCNONE 
J033149K09TAGGCCCACGCNONE 
J065045I06TAGGCCCACGCNONE 
J065061A10TAGGCCCACGCNONE 
J065101H05TAGGCCCACGCNONE 
J065135A03TAGGCCCACGCNONE 
J065169C16TAGGCCCACGCNONE 
J100047C11TAGGCCCACGCNONE 
J100047K07TAGGCCCACGCNONE 
Os09g0511600015-078-A09GCCCACGCNONE 
AK102869GCCCACGCNONE 
AK121679GCCCACGCNONE 
AK121935GCCCACGCGlycoside hydrolase, family 1 protein. 
Os09g0525900006-115-E04GGGGCCCACGCNONE 
AK059988GGGGCCCACGCRhomboid-like protein family protein. 
AK071290GGGGCCCACGCNONE 
J013153K05GGGGCCCACGCNONE 
J023087M04GGGGCCCACGCNONE 
J065165B13GGGGCCCACGCNONE 
J075013G15GGGGCCCACGCNONE 
J075028A09GGGGCCCACGCNONE 
J075031I06GGGGCCCACGCNONE 
J075051C21GGGGCCCACGCNONE 
J075114H22GGGGCCCACGCNONE 
J075129A19GGGGCCCACGCNONE 
J075129M12GGGGCCCACGCNONE 
J075166N24GGGGCCCACGCNONE 
J075167M23GGGGCCCACGCNONE 
J075168D10GGGGCCCACGCNONE 
Os09g0526800014-002-D10CTCTCCGCCCACGCCTCGCCCNONE 
AK060048CTCTCCGCCCACGCCTCGCCCNONE 
AK072174CTCTCCGCCCACGCCTCGCCCNONE 
AK105121CTCTCCGCCCACGCCTCGCCCNC domain containing protein. 
J013135P13CTCTCCGCCCACGCCTCGCCCNONE 
J033135C23CTCTCCGCCCACGCCTCGCCCNONE 
J043036C17CTCTCCGCCCACGCCTCGCCCNONE 
J065066N16CTCTCCGCCCACGCCTCGCCCNONE 
Os09g0533900003-104-E05AAAGCCCACGCGAGCCCATCCNONE 
012-076-C03AAAGCCCACGCGAGCCCATCCNONE 
AK067774AAAGCCCACGCGAGCCCATCCNONE 
AK100449AAAGCCCACGCGAGCCCATCCSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07AAAGCCCACGCGAGCCCATCCNONE 
J023026E11AAAGCCCACGCGAGCCCATCCNONE 
J023028B20AAAGCCCACGCGAGCCCATCCNONE 
J023050P11AAAGCCCACGCGAGCCCATCCNONE 
J023052K08AAAGCCCACGCGAGCCCATCCNONE 
J023075J03AAAGCCCACGCGAGCCCATCCNONE 
J023078E15AAAGCCCACGCGAGCCCATCCNONE 
J023090P12AAAGCCCACGCGAGCCCATCCNONE 
J023120E01AAAGCCCACGCGAGCCCATCCNONE 
J023142K01AAAGCCCACGCGAGCCCATCCNONE 
J033027K23AAAGCCCACGCGAGCCCATCCNONE 
J033058A09AAAGCCCACGCGAGCCCATCCNONE 
J033058C12AAAGCCCACGCGAGCCCATCCNONE 
J033125A04AAAGCCCACGCGAGCCCATCCNONE 
J043040L01AAAGCCCACGCGAGCCCATCCNONE 
J053061D06AAAGCCCACGCGAGCCCATCCNONE 
J053096N13AAAGCCCACGCGAGCCCATCCNONE 
J065193H10AAAGCCCACGCGAGCCCATCCNONE 
J090075L17AAAGCCCACGCGAGCCCATCCNONE 
J100050D10AAAGCCCACGCGAGCCCATCCNONE 
Os09g0535000AK058712CGCGTGGGCSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CGCGTGGGCNONE 
AK069832CGCGTGGGCNONE 
J100065D20CGCGTGGGCNONE 
Os09g0538700Os09g0538700GCGGCCCACGCCCAATAGlutelin family protein. 
Os11g0137500AK070070CGCGTGGGCTGATranscription factor TFIIE, alpha subunit family protein. 
Os11g0184900011-088-C07TGCGGCCCAGGCCCACGCNONE 
015-036-B03TGCGGCCCAGGCCCACGCNONE 
016-087-F07TGCGGCCCAGGCCCACGCNONE 
AB028184TGCGGCCCAGGCCCACGCNONE 
AK063399TGCGGCCCAGGCCCACGCSimilar to NAC-domain protein 5-7. 
AK064292TGCGGCCCAGGCCCACGCNONE 
AK102475TGCGGCCCAGGCCCACGCNONE 
J033094I01TGCGGCCCAGGCCCACGCNONE 
J090087J16TGCGGCCCAGGCCCACGCNONE 
Os11g0209100016-063-F03ATGGCCCACGCTTGTGGGCCTGNONE 
AK064391ATGGCCCACGCTTGTGGGCCTGCyclin-like F-box domain containing protein. 
J075027K02ATGGCCCACGCTTGTGGGCCTGNONE 
J075154K15ATGGCCCACGCTTGTGGGCCTGNONE 
Os11g0216900AK060326CTCGCGCGCGTGGGCCTTGSimilar to IDI2. 
AK060549CTCGCGCGCGTGGGCCTTGNONE 
AK100869CTCGCGCGCGTGGGCCTTGNONE 
Os11g0227600AK101375TAATGGGCTTAGCGTGGGCCGGAConserved hypothetical protein. 
AK102193TAATGGGCTTAGCGTGGGCCGGANONE 
J033087C03TAATGGGCTTAGCGTGGGCCGGANONE 
Os11g0303200J023135L01GCGTGGGCTGGNONE 
J075074O21GCGTGGGCTGGNONE 
Os11g0429000AK067370CCCGGGCCCACGCConserved hypothetical protein. 
Os11g0621300J090008L04GCGTGGGCNONE 
J100051C10GCGTGGGCNONE 
J100074N05GCGTGGGCNONE 
J100088J22GCGTGGGCNONE 
J100088N14GCGTGGGCNONE 
Os12g0116900J023029P11GCCCACGCNONE 
J023150B17GCCCACGCNONE 
J075053O04GCCCACGCNONE 
J075152K05GCCCACGCNONE 
J075168M02GCCCACGCNONE 
Os12g0118400009-027-G04GCGTGGGCCCCACANONE 
009-129-H07GCGTGGGCCCCACANONE 
AK062407GCGTGGGCCCCACANONE 
AK111804GCGTGGGCCCCACASimilar to Inwardly rectifying potassium channel subunit. 
J065081E04GCGTGGGCCCCACANONE 
J090095O18GCGTGGGCCCCACANONE 
Os12g0137100AK059278GCCCACGCGAnnexin, type VII family protein. 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0236400AK059754GCGTGGGCNONE 
AK069870GCGTGGGCNONE 
D10334GCGTGGGCAdenylate kinase A (EC 2.7.4.3) (ATP-AMP transphosphorylase). 
D10429GCGTGGGCNONE 
J023039H09GCGTGGGCNONE 
J033075J04GCGTGGGCNONE 
J033088L16GCGTGGGCNONE 
J053037D11GCGTGGGCNONE 
J090084M20GCGTGGGCNONE 
J100078B20GCGTGGGCNONE 
Os12g0285600AK069104CTGGCCCACGCGOxysterol-binding protein family protein. 
Os12g0502100Os12g0502100GCGTGGGCCCCConserved hypothetical protein. 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
Os12g0592900AK064058CGCGTGGGCCCCNONE 
AK120039CGCGTGGGCCCCHypothetical protein. 
J065081M07CGCGTGGGCCCCNONE 
J065105G17CGCGTGGGCCCCNONE 
J075017E06CGCGTGGGCCCCNONE 
J075040M14CGCGTGGGCCCCNONE 
J075052I18CGCGTGGGCCCCNONE 
J075055J23CGCGTGGGCCCCNONE 
J075057L03CGCGTGGGCCCCNONE 
J075099C10CGCGTGGGCCCCNONE 
J075104C21CGCGTGGGCCCCNONE 
J075172L12CGCGTGGGCCCCNONE 
J075179D22CGCGTGGGCCCCNONE 
J075182G07CGCGTGGGCCCCNONE 
J075194N11CGCGTGGGCCCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.