version

Summary of OsREG603 (All List)

OrganismOryza sativa  
IDOsREG603  
SequenceGCCCAGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1940  

Entry Sequences (1940 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0102700009-009-A07GCAGCCCAGCCCAGNONE 
AK063774GCAGCCCAGCCCAGTranslocon-associated beta family protein. 
AK099081GCAGCCCAGCCCAGNONE 
AK099360GCAGCCCAGCCCAGNONE 
J013096O20GCAGCCCAGCCCAGNONE 
J023002P14GCAGCCCAGCCCAGNONE 
J033046F10GCAGCCCAGCCCAGNONE 
J033084K08GCAGCCCAGCCCAGNONE 
J065011H22GCAGCCCAGCCCAGNONE 
J090017O18GCAGCCCAGCCCAGNONE 
J090047F15GCAGCCCAGCCCAGNONE 
J090049G20GCAGCCCAGCCCAGNONE 
Os01g0138500AK073435GCCCAGCCProtein of unknown function DUF789 family protein. 
J023118K18GCCCAGCCNONE 
J033039C22GCCCAGCCNONE 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0172200AK100326TGTGGGCTGGGCCGGAWW/Rsp5/WWP domain containing protein. 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0226700014-020-B10TGCGGCCCAGCCNONE 
AK063653TGCGGCCCAGCCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0246100AK120732GGCTGGGCCAGProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0276500006-030-E04GGCTGGGCCTGANONE 
AK061002GGCTGGGCCTGASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335GGCTGGGCCTGANONE 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0357400012-030-F01CAAGCCCAGCCNONE 
012-045-H02CAAGCCCAGCCNONE 
AK063489CAAGCCCAGCCSimilar to Alpha-amylase. 
D10417CAAGCCCAGCCNONE 
Os01g0530300AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0571200014-074-A10GGCTGGGCTTGNONE 
AK121299GGCTGGGCTTGSimilar to Ribosomal protein L34. 
J023110L12GGCTGGGCTTGNONE 
Os01g0588200006-052-E10ACCCGCGCCCACGCCCAGCCNONE 
AJ251563ACCCGCGCCCACGCCCAGCCNONE 
AK070745ACCCGCGCCCACGCCCAGCCVoltage-dependent anion channel. 
AK104055ACCCGCGCCCACGCCCAGCCNONE 
AK104419ACCCGCGCCCACGCCCAGCCNONE 
J023057A07ACCCGCGCCCACGCCCAGCCNONE 
J023068C08ACCCGCGCCCACGCCCAGCCNONE 
J023148E24ACCCGCGCCCACGCCCAGCCNONE 
J090045O22ACCCGCGCCCACGCCCAGCCNONE 
J090045P03ACCCGCGCCCACGCCCAGCCNONE 
J090050C18ACCCGCGCCCACGCCCAGCCNONE 
J100023F01ACCCGCGCCCACGCCCAGCCNONE 
J100051I18ACCCGCGCCCACGCCCAGCCNONE 
J100060P17ACCCGCGCCCACGCCCAGCCNONE 
Os01g0633000006-075-A01AAAGCCCAGCCNONE 
009-064-A11AAAGCCCAGCCNONE 
009-153-F07AAAGCCCAGCCNONE 
AK062051AAAGCCCAGCCSimilar to 50S ribosomal protein L31. 
J013073B08AAAGCCCAGCCNONE 
J065006K19AAAGCCCAGCCNONE 
J065053P08AAAGCCCAGCCNONE 
J065057D08AAAGCCCAGCCNONE 
J065086P07AAAGCCCAGCCNONE 
J065095C14AAAGCCCAGCCNONE 
J065116B05AAAGCCCAGCCNONE 
J065164L20AAAGCCCAGCCNONE 
J065185K19AAAGCCCAGCCNONE 
J065191E21AAAGCCCAGCCNONE 
J065199P21AAAGCCCAGCCNONE 
J065216M12AAAGCCCAGCCNONE 
J075002M09AAAGCCCAGCCNONE 
J075016N10AAAGCCCAGCCNONE 
J075041K05AAAGCCCAGCCNONE 
J075094E04AAAGCCCAGCCNONE 
J075154O04AAAGCCCAGCCNONE 
J075176D22AAAGCCCAGCCNONE 
J075186M09AAAGCCCAGCCNONE 
J075191H20AAAGCCCAGCCNONE 
Os01g0633400AK108988GACGTGGCTGGGCCBS domain containing protein. 
Os01g0639900004-009-H08GCCCAGCCGGGCCGCANONE 
006-050-F07GCCCAGCCGGGCCGCANONE 
006-120-D04GCCCAGCCGGGCCGCANONE 
AF182806GCCCAGCCGGGCCGCANONE 
AK060890GCCCAGCCGGGCCGCASimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825GCCCAGCCGGGCCGCANONE 
J075022I06GCCCAGCCGGGCCGCANONE 
U08404GCCCAGCCGGGCCGCANONE 
Os01g0661400AK073113AGCCCAGCCCAAACNucleic acid-binding, OB-fold domain containing protein. 
J023014C20AGCCCAGCCCAAACNONE 
J033022G03AGCCCAGCCCAAACNONE 
J065050H15AGCCCAGCCCAAACNONE 
J065059J19AGCCCAGCCCAAACNONE 
J065085I24AGCCCAGCCCAAACNONE 
J065166G12AGCCCAGCCCAAACNONE 
J065182C18AGCCCAGCCCAAACNONE 
Os01g0683400AB110983CCAGCCCAGCCNONE 
AK102997CCAGCCCAGCCSimilar to Origin recognition complex 4. 
J033116E22CCAGCCCAGCCNONE 
J090087A03CCAGCCCAGCCNONE 
Os01g0698300AK100582CCCACGCGCCCAGCCGCCCACGCZinc finger, BED-type predicted domain containing protein. 
J023105O09CCCACGCGCCCAGCCGCCCACGCNONE 
J023119F15CCCACGCGCCCAGCCGCCCACGCNONE 
J075007N19CCCACGCGCCCAGCCGCCCACGCNONE 
J075010F10CCCACGCGCCCAGCCGCCCACGCNONE 
J075032M22CCCACGCGCCCAGCCGCCCACGCNONE 
J075038E01CCCACGCGCCCAGCCGCCCACGCNONE 
J075064J17CCCACGCGCCCAGCCGCCCACGCNONE 
J075109L20CCCACGCGCCCAGCCGCCCACGCNONE 
J075131O16CCCACGCGCCCAGCCGCCCACGCNONE 
J075176A17CCCACGCGCCCAGCCGCCCACGCNONE 
J075178N11CCCACGCGCCCAGCCGCCCACGCNONE 
J075181N15CCCACGCGCCCAGCCGCCCACGCNONE 
J090060I06CCCACGCGCCCAGCCGCCCACGCNONE 
J090097O21CCCACGCGCCCAGCCGCCCACGCNONE 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
Os01g0736400AK069723GGCTGGGCTTGGNONE 
AK100689GGCTGGGCTTGGAminotransferase, class I and II domain containing protein. 
Os01g0745700009-020-H03GGGCTGGGCTNONE 
AK062377GGGCTGGGCTNONE 
AK121896GGGCTGGGCTSimilar to GATA transcription factor 3 (AtGATA-3). 
J033105E11GGGCTGGGCTNONE 
J075022B21GGGCTGGGCTNONE 
J075147O07GGGCTGGGCTNONE 
Os01g0765000AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0810000AK102143GTTTGGGCTGGGCTGCNONE 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0834700AK101559GAGGCCCAGCCZinc finger, CCCH-type domain containing protein. 
AK106074GAGGCCCAGCCNONE 
Os01g0848200AK069425GGCTGGGCCTGSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230GGCTGGGCCTGNONE 
Os01g0869000AK067351GGCTGGGCNONE 
AK121602GGCTGGGCProtein of unknown function DUF639 family protein. 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0894700009-177-F04AAGGCCCAGCCNONE 
AK067623AAGGCCCAGCCConserved hypothetical protein. 
AK104876AAGGCCCAGCCNONE 
J013095G01AAGGCCCAGCCNONE 
J013108L20AAGGCCCAGCCNONE 
J013120P13AAGGCCCAGCCNONE 
Os01g0913300AK100698CCAGCCCAGCCTGF-beta receptor, type I/II extracellular region family protein. 
J023030J07CCAGCCCAGCCNONE 
J023102B09CCAGCCCAGCCNONE 
J023102N03CCAGCCCAGCCNONE 
J023114K11CCAGCCCAGCCNONE 
J023140A21CCAGCCCAGCCNONE 
J043017F23CCAGCCCAGCCNONE 
J075058O15CCAGCCCAGCCNONE 
Os01g0913600AK071735GCCCAGCCSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1). 
J023003J11GCCCAGCCNONE 
J023037O11GCCCAGCCNONE 
J023109K10GCCCAGCCNONE 
Os01g0921600AK071344GGTGGGCTGGGCCGGGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GGTGGGCTGGGCCGGGNONE 
J013109E03GGTGGGCTGGGCCGGGNONE 
J023081J12GGTGGGCTGGGCCGGGNONE 
J023091E24GGTGGGCTGGGCCGGGNONE 
J033022A01GGTGGGCTGGGCCGGGNONE 
J033074C13GGTGGGCTGGGCCGGGNONE 
J065199E03GGTGGGCTGGGCCGGGNONE 
J075172O04GGTGGGCTGGGCCGGGNONE 
J090007G18GGTGGGCTGGGCCGGGNONE 
J090052B17GGTGGGCTGGGCCGGGNONE 
J090074H01GGTGGGCTGGGCCGGGNONE 
J100043J09GGTGGGCTGGGCCGGGNONE 
J100059J05GGTGGGCTGGGCCGGGNONE 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0946200AK071060GGCTGGGCTCAGCCCACANo apical meristem (NAM) protein domain containing protein. 
J023080K20GGCTGGGCTCAGCCCACANONE 
Os01g0951800AK069239TCAGGCCCAGCCCProtein prenyltransferase domain containing protein. 
Os01g0958100AK058574GCCCAGCCCNONE 
AK103090GCCCAGCCCSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369GCCCAGCCCNONE 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os02g0150100AK060595GAAGCCCAGCCSimilar to DEAD-box protein abstrakt. 
Os02g0160200AK109618GGCTGGGCTGGCyclin-like F-box domain containing protein. 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCAGCCCATAANONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCAGCCCATAANONE 
Os02g0175800009-083-C02AGCCCAGCCCAACCNONE 
009-083-C02TCGGCCCAGCCNONE 
009-184-H07AGCCCAGCCCAACCNONE 
009-184-H07TCGGCCCAGCCNONE 
009-199-D07AGCCCAGCCCAACCNONE 
009-199-D07TCGGCCCAGCCNONE 
AK058292AGCCCAGCCCAACCNONE 
AK058292TCGGCCCAGCCNONE 
AK120215AGCCCAGCCCAACCConserved hypothetical protein. 
AK120215TCGGCCCAGCCConserved hypothetical protein. 
J013040G12AGCCCAGCCCAACCNONE 
J013040G12TCGGCCCAGCCNONE 
J065050N21AGCCCAGCCCAACCNONE 
J065050N21TCGGCCCAGCCNONE 
J065077O07AGCCCAGCCCAACCNONE 
J065077O07TCGGCCCAGCCNONE 
J065102G05AGCCCAGCCCAACCNONE 
J065102G05TCGGCCCAGCCNONE 
J065197A04AGCCCAGCCCAACCNONE 
J065197A04TCGGCCCAGCCNONE 
J075024L24AGCCCAGCCCAACCNONE 
J075024L24TCGGCCCAGCCNONE 
J075038K01AGCCCAGCCCAACCNONE 
J075038K01TCGGCCCAGCCNONE 
J075044L04AGCCCAGCCCAACCNONE 
J075044L04TCGGCCCAGCCNONE 
J075063D23AGCCCAGCCCAACCNONE 
J075063D23TCGGCCCAGCCNONE 
J075079P13AGCCCAGCCCAACCNONE 
J075079P13TCGGCCCAGCCNONE 
J075084G03AGCCCAGCCCAACCNONE 
J075084G03TCGGCCCAGCCNONE 
J075135G07AGCCCAGCCCAACCNONE 
J075135G07TCGGCCCAGCCNONE 
J075148D17AGCCCAGCCCAACCNONE 
J075148D17TCGGCCCAGCCNONE 
J075150F13AGCCCAGCCCAACCNONE 
J075150F13TCGGCCCAGCCNONE 
J075157F06AGCCCAGCCCAACCNONE 
J075157F06TCGGCCCAGCCNONE 
J090054A05AGCCCAGCCCAACCNONE 
J090054A05TCGGCCCAGCCNONE 
J090085O04AGCCCAGCCCAACCNONE 
J090085O04TCGGCCCAGCCNONE 
J100023C04AGCCCAGCCCAACCNONE 
J100023C04TCGGCCCAGCCNONE 
J100023H23AGCCCAGCCCAACCNONE 
J100023H23TCGGCCCAGCCNONE 
J100026A16AGCCCAGCCCAACCNONE 
J100026A16TCGGCCCAGCCNONE 
J100035K13AGCCCAGCCCAACCNONE 
J100035K13TCGGCCCAGCCNONE 
Os02g0191800009-192-E11AGCCCAGCCNONE 
AK063218AGCCCAGCCConserved hypothetical protein. 
Os02g0215950J090051K07GACAGGTGGGCTGGGCTConserved hypothetical protein. 
Os02g0251900AK109286AAAGCCCAGCCCSimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0288100AK107019AGCCCAGCCCACGCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0321800AK067188GGGCTGGGCCGTANONE 
AK070852GGGCTGGGCCGTAB-cell receptor-associated 31-like family protein. 
J013094K24GGGCTGGGCCGTANONE 
Os02g0326000006-099-D01GCCGGCCCAGCCNONE 
AK059937GCCGGCCCAGCCNONE 
AK102973GCCGGCCCAGCCConserved hypothetical protein. 
J033115K18GCCGGCCCAGCCNONE 
J075069J04GCCGGCCCAGCCNONE 
Os02g0478700AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0519900006-057-B12GGCTGGGCTTTNONE 
006-113-G04GGCTGGGCTTTNONE 
006-119-D01GGCTGGGCTTTNONE 
AK060953GGCTGGGCTTTNONE 
AK068869GGCTGGGCTTTNONE 
AK121453GGCTGGGCTTTNONE 
D21277GGCTGGGCTTTNONE 
D21278GGCTGGGCTTTNONE 
J023002E06GGCTGGGCTTTNONE 
J023106L15GGCTGGGCTTTNONE 
J023142O06GGCTGGGCTTTNONE 
J053089A15GGCTGGGCTTTNONE 
J053091H05GGCTGGGCTTTNONE 
J080303F06GGCTGGGCTTTNONE 
J090003E12GGCTGGGCTTTNONE 
Os02g0591800AK060611AGCCCAGCCBrix domain containing protein. 
AK102534AGCCCAGCCNONE 
J075057H08AGCCCAGCCNONE 
J075179P18AGCCCAGCCNONE 
J080011H01AGCCCAGCCNONE 
J080018E14AGCCCAGCCNONE 
J080026N17AGCCCAGCCNONE 
J080047A13AGCCCAGCCNONE 
J080049C17AGCCCAGCCNONE 
J080050G07AGCCCAGCCNONE 
J080064D10AGCCCAGCCNONE 
J080080A03AGCCCAGCCNONE 
J080080G20AGCCCAGCCNONE 
J080080I03AGCCCAGCCNONE 
J080081H12AGCCCAGCCNONE 
J080090K07AGCCCAGCCNONE 
J080092O06AGCCCAGCCNONE 
J080096B07AGCCCAGCCNONE 
J080097M08AGCCCAGCCNONE 
Os02g0618700AK070657GCCCAGCCCAAATLung seven transmembrane receptor family protein. 
J023056H15GCCCAGCCCAAATNONE 
Os02g0632500AK101701GCCGGCCCAGCCArf GTPase activating protein family protein. 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0637900AK110708CAGGCCCAGCCConserved hypothetical protein. 
J065038O03CAGGCCCAGCCNONE 
J065052A19CAGGCCCAGCCNONE 
J065052A20CAGGCCCAGCCNONE 
J065063D06CAGGCCCAGCCNONE 
J065069D12CAGGCCCAGCCNONE 
J065074H07CAGGCCCAGCCNONE 
J065174K17CAGGCCCAGCCNONE 
J065215M12CAGGCCCAGCCNONE 
J075007E12CAGGCCCAGCCNONE 
J075057K20CAGGCCCAGCCNONE 
J075119I10CAGGCCCAGCCNONE 
Os02g0641800AK066504CCCGGCCCAGCCSimilar to RNA helicase (Fragment). 
AK072124CCCGGCCCAGCCNONE 
Os02g0644000AB081464TGTGGGCTGGGCTGGNONE 
AK101360TGTGGGCTGGGCTGGNONE 
AY062178TGTGGGCTGGGCTGGNONE 
J023043E22TGTGGGCTGGGCTGGNONE 
J033024F05TGTGGGCTGGGCTGGNONE 
J033035H01TGTGGGCTGGGCTGGNONE 
J033042J19TGTGGGCTGGGCTGGNONE 
J033057G18TGTGGGCTGGGCTGGNONE 
J033111F09TGTGGGCTGGGCTGGNONE 
J033115L11TGTGGGCTGGGCTGGNONE 
J033143I16TGTGGGCTGGGCTGGNONE 
J033143M21TGTGGGCTGGGCTGGNONE 
J075072B10TGTGGGCTGGGCTGGNONE 
J075072L04TGTGGGCTGGGCTGGNONE 
J075088F01TGTGGGCTGGGCTGGNONE 
J075196H23TGTGGGCTGGGCTGGNONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0703900AK102115TCAGCCCAGCCCAGCCCAGCCGAGATSimilar to Nodulin-like protein. 
AK121966TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J023109K03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033051G23TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033084H22TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090056B12TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090059L13TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090080M03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
Os02g0705100012-046-E01GCCGGCCCAGCCNONE 
AK063491GCCGGCCCAGCCEpoxide hydrolase family protein. 
J065184H07GCCGGCCCAGCCNONE 
Os02g0713700J043034B19GGCTGGGCNONE 
J065041I10GGCTGGGCNONE 
J065121M03GGCTGGGCNONE 
J065134C21GGCTGGGCProtein of unknown function DUF296 domain containing protein. 
J065186F18GGCTGGGCNONE 
J100033H10GGCTGGGCNONE 
J100043C12GGCTGGGCNONE 
J100048E07GGCTGGGCNONE 
J100087G13GGCTGGGCNONE 
J100090J08GGCTGGGCNONE 
Os02g0753200AK067176GCAGCCCAGCCConserved hypothetical protein. 
J013097D23GCAGCCCAGCCNONE 
J065085J01GCAGCCCAGCCNONE 
J065152L23GCAGCCCAGCCNONE 
J065162F18GCAGCCCAGCCNONE 
J075002K17GCAGCCCAGCCNONE 
J075047D24GCAGCCCAGCCNONE 
J075064A01GCAGCCCAGCCNONE 
J075075C09GCAGCCCAGCCNONE 
J075088M01GCAGCCCAGCCNONE 
J075130K03GCAGCCCAGCCNONE 
J075146K03GCAGCCCAGCCNONE 
J090049F07GCAGCCCAGCCNONE 
Os02g0758200AK111266CCAGCCCAGCCConserved hypothetical protein. 
Os02g0759800012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0765600011-044-C02CAAGCCCAGCCNONE 
011-059-H12CAAGCCCAGCCNONE 
012-010-G07CAAGCCCAGCCNONE 
012-040-D02CAAGCCCAGCCNONE 
012-048-F02CAAGCCCAGCCNONE 
012-055-C12CAAGCCCAGCCNONE 
012-065-C04CAAGCCCAGCCNONE 
012-086-D01CAAGCCCAGCCNONE 
012-099-G02CAAGCCCAGCCNONE 
015-002-D01CAAGCCCAGCCNONE 
015-067-D08CAAGCCCAGCCNONE 
016-060-E08CAAGCCCAGCCNONE 
AK101744CAAGCCCAGCCAlpha-amylase precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase) (Isozyme 1B). 
J033023N15CAAGCCCAGCCNONE 
J033061O03CAAGCCCAGCCNONE 
J033107J03CAAGCCCAGCCNONE 
J033119C02CAAGCCCAGCCNONE 
J043001H07CAAGCCCAGCCNONE 
J043003H07CAAGCCCAGCCNONE 
J043003I05CAAGCCCAGCCNONE 
J043009K22CAAGCCCAGCCNONE 
J043009L08CAAGCCCAGCCNONE 
J043012J02CAAGCCCAGCCNONE 
J043015P13CAAGCCCAGCCNONE 
J043016H11CAAGCCCAGCCNONE 
J043020F17CAAGCCCAGCCNONE 
J053027C06CAAGCCCAGCCNONE 
J053099F07CAAGCCCAGCCNONE 
J065025M06CAAGCCCAGCCNONE 
J065029M17CAAGCCCAGCCNONE 
J065044H20CAAGCCCAGCCNONE 
J065089P12CAAGCCCAGCCNONE 
J065098N21CAAGCCCAGCCNONE 
J065143N20CAAGCCCAGCCNONE 
J065161C24CAAGCCCAGCCNONE 
J065170A09CAAGCCCAGCCNONE 
J065197N16CAAGCCCAGCCNONE 
J065214E11CAAGCCCAGCCNONE 
J065216J23CAAGCCCAGCCNONE 
J100026D11CAAGCCCAGCCNONE 
J100062F01CAAGCCCAGCCNONE 
J100080O15CAAGCCCAGCCNONE 
J100082F09CAAGCCCAGCCNONE 
M24286CAAGCCCAGCCNONE 
Os02g0767900009-154-G01TGCGGCCCAGCCCNONE 
009-172-H09TGCGGCCCAGCCCNONE 
AK099885TGCGGCCCAGCCCGlutaredoxin 2 family protein. 
Os02g0774300AK065228GACGTGGCGCCCCACCGCCCAGCCSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0778200AK065948AGCCCAGCCAminoacyl-tRNA synthetase, class I family protein. 
Os02g0782300AK109297GGCTGGGCGAGACGTGNONE 
Os02g0824700009-023-E06CCCAGCCCAGCCCACCTSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18CCCAGCCCAGCCCACCTNONE 
J065017H21CCCAGCCCAGCCCACCTNONE 
J065052N02CCCAGCCCAGCCCACCTNONE 
J065053M01CCCAGCCCAGCCCACCTNONE 
J065064B14CCCAGCCCAGCCCACCTNONE 
J065146K22CCCAGCCCAGCCCACCTNONE 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os02g0832200AK108268AGCCCAGCCCConserved hypothetical protein. 
J065053F07AGCCCAGCCCNONE 
J065095B09AGCCCAGCCCNONE 
J065137I11AGCCCAGCCCNONE 
J065187O12AGCCCAGCCCNONE 
J075193O05AGCCCAGCCCNONE 
Os03g0108700003-131-E01GCAGCCCAGCCCAGCCNONE 
AK105115GCAGCCCAGCCCAGCCConserved hypothetical protein. 
AY224538GCAGCCCAGCCCAGCCNONE 
J065029A19GCAGCCCAGCCCAGCCNONE 
J065109N11GCAGCCCAGCCCAGCCNONE 
Os03g0122300AK068438GCCCAGCCCSimilar to Flavanone 3-hydroxylase-like protein. 
AK071416GCCCAGCCCNONE 
AK104414GCCCAGCCCNONE 
J023078E24GCCCAGCCCNONE 
J023141J19GCCCAGCCCNONE 
J033050K09GCCCAGCCCNONE 
Os03g0130700AK110670GGCTGGGCCCAACANONE 
Os03g0157400AK066035GCCCAGCCABC transporter related domain containing protein. 
Os03g0172200AK069130TCCGGCCCAGCCACACGArmadillo-like helical domain containing protein. 
Os03g0190100AK061907GCGGCCCAGCCNONE 
AK066332GCGGCCCAGCCUbiA prenyltransferase family protein. 
J013051N11GCGGCCCAGCCNONE 
J013060C07GCGGCCCAGCCNONE 
J065117L08GCGGCCCAGCCNONE 
J100067H10GCGGCCCAGCCNONE 
Os03g0197400AK071413GCAGCCCAGCCCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905GCAGCCCAGCCCNONE 
J053023D18GCAGCCCAGCCCNONE 
Os03g0240500003-116-E06CAGGCCCAGCCCNONE 
AK058676CAGGCCCAGCCCSimilar to Toc34-2 protein. 
AK099032CAGGCCCAGCCCNONE 
J013128A13CAGGCCCAGCCCNONE 
J075064H17CAGGCCCAGCCCNONE 
J075075N03CAGGCCCAGCCCNONE 
J075079H24CAGGCCCAGCCCNONE 
J075127D23CAGGCCCAGCCCNONE 
J075132C09CAGGCCCAGCCCNONE 
J075159D02CAGGCCCAGCCCNONE 
J090053O11CAGGCCCAGCCCNONE 
J090062N04CAGGCCCAGCCCNONE 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0266300006-027-H06GCCCAGCCCNONE 
013-051-G08GCCCAGCCCNONE 
014-002-C05GCCCAGCCCNONE 
014-002-H02GCCCAGCCCNONE 
014-005-A09GCCCAGCCCNONE 
014-008-D02GCCCAGCCCNONE 
014-008-G06GCCCAGCCCNONE 
014-009-C12GCCCAGCCCNONE 
014-010-A07GCCCAGCCCNONE 
014-012-H03GCCCAGCCCNONE 
014-013-E03GCCCAGCCCNONE 
014-014-D03GCCCAGCCCNONE 
014-028-C09GCCCAGCCCNONE 
014-037-G05GCCCAGCCCNONE 
014-038-E04GCCCAGCCCNONE 
014-041-F08GCCCAGCCCNONE 
014-049-E11GCCCAGCCCNONE 
014-050-A05GCCCAGCCCNONE 
014-053-F10GCCCAGCCCNONE 
014-054-C04GCCCAGCCCNONE 
014-056-A01GCCCAGCCCNONE 
014-060-A08GCCCAGCCCNONE 
014-072-C09GCCCAGCCCNONE 
014-072-D02GCCCAGCCCNONE 
014-077-G08GCCCAGCCCNONE 
014-080-C10GCCCAGCCCNONE 
014-098-E01GCCCAGCCCNONE 
014-100-C02GCCCAGCCCNONE 
014-100-E03GCCCAGCCCNONE 
014-100-E10GCCCAGCCCNONE 
015-061-D06GCCCAGCCCNONE 
016-033-H10GCCCAGCCCNONE 
AB110191GCCCAGCCCNONE 
AF467729GCCCAGCCCNONE 
AK073671GCCCAGCCCNONE 
AK104129GCCCAGCCCClass I low-molecular-weight heat shock protein 17.9. 
AK119239GCCCAGCCCNONE 
AK119616GCCCAGCCCNONE 
AK119664GCCCAGCCCNONE 
AK119675GCCCAGCCCNONE 
D21285GCCCAGCCCNONE 
J033051H23GCCCAGCCCNONE 
J065036L24GCCCAGCCCNONE 
J065045J20GCCCAGCCCNONE 
J065104C03GCCCAGCCCNONE 
J065109J20GCCCAGCCCNONE 
J065116F24GCCCAGCCCNONE 
J065146F06GCCCAGCCCNONE 
J065146P18GCCCAGCCCNONE 
J065167A09GCCCAGCCCNONE 
J065183K12GCCCAGCCCNONE 
J075019J15GCCCAGCCCNONE 
J075112F10GCCCAGCCCNONE 
J075150H04GCCCAGCCCNONE 
J075159N20GCCCAGCCCNONE 
J075164P19GCCCAGCCCNONE 
J075185O05GCCCAGCCCNONE 
J100030A19GCCCAGCCCNONE 
J100044E07GCCCAGCCCNONE 
Os03g0279600006-070-A07GAAGCCCAGCCNONE 
AK061080GAAGCCCAGCCConserved hypothetical protein. 
AK071043GAAGCCCAGCCNONE 
AK103191GAAGCCCAGCCNONE 
J065077E22GAAGCCCAGCCNONE 
J065208F22GAAGCCCAGCCNONE 
J075156K12GAAGCCCAGCCNONE 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0308000016-023-H09AAGGCCCAGCCNONE 
AK100355AAGGCCCAGCCUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05AAGGCCCAGCCNONE 
J023043K04AAGGCCCAGCCNONE 
J023083I20AAGGCCCAGCCNONE 
J033068F22AAGGCCCAGCCNONE 
J033125P21AAGGCCCAGCCNONE 
J065207A22AAGGCCCAGCCNONE 
J100018D20AAGGCCCAGCCNONE 
J100026L17AAGGCCCAGCCNONE 
J100055D14AAGGCCCAGCCNONE 
J100060P03AAGGCCCAGCCNONE 
J100078A20AAGGCCCAGCCNONE 
Os03g0308500AK103891CCACGGCCCAGCCCDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os03g0313600AK067474ATTGGGCTGGGCTGASimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0315400AK120551CCAGCCCAGCCSimilar to Typical P-type R2R3 Myb protein (Fragment). 
J013130B13CCAGCCCAGCCNONE 
J065053B05CCAGCCCAGCCNONE 
J065169H20CCAGCCCAGCCNONE 
J065169M22CCAGCCCAGCCNONE 
J100061H19CCAGCCCAGCCNONE 
Os03g0333000AK109811TATGGGCTGGGCCAAConserved hypothetical protein. 
J065152D04TATGGGCTGGGCCAANONE 
J090011B05TATGGGCTGGGCCAANONE 
Os03g0333100AK101050TTGGCCCAGCCCATAProtein of unknown function DUF663 domain containing protein. 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0386000AK072984GGCTGGGCCTGGSimilar to WD domain protein-like. 
J065009K18GGCTGGGCCTGGNONE 
J065165P09GGCTGGGCCTGGNONE 
Os03g0411500AK058696CCCAGCCCAGCCCAACCNONE 
AK071057CCCAGCCCAGCCCAACCPeptidase S14, ClpP family protein. 
Os03g0438400AK070383AAGGCCCAGCCConserved hypothetical protein. 
J023054E02AAGGCCCAGCCNONE 
Os03g0583800AK064786CTGGCCCAGCCMpv17/PMP22 family protein. 
AK099233CTGGCCCAGCCNONE 
J013000B17CTGGCCCAGCCNONE 
J013071N13CTGGCCCAGCCNONE 
J013095M11CTGGCCCAGCCNONE 
J080068F05CTGGCCCAGCCNONE 
J080069C02CTGGCCCAGCCNONE 
J080072E22CTGGCCCAGCCNONE 
J100052H10CTGGCCCAGCCNONE 
J100053H09CTGGCCCAGCCNONE 
J100056G03CTGGCCCAGCCNONE 
Os03g0628900009-062-G01TTTTGGGCTGGGCTNONE 
AK103619TTTTGGGCTGGGCTPrefoldin domain containing protein. 
J033133L23TTTTGGGCTGGGCTNONE 
J100039C17TTTTGGGCTGGGCTNONE 
J100048I07TTTTGGGCTGGGCTNONE 
J100062E19TTTTGGGCTGGGCTNONE 
J100063B11TTTTGGGCTGGGCTNONE 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0712600015-008-G03CAGGCCCAGCCNONE 
AK103705CAGGCCCAGCCHypothetical protein. 
J033136N14CAGGCCCAGCCNONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0760200AK066760GCCCAGCCCytochrome P450 family protein. 
AK104825GCCCAGCCNONE 
J065022I19GCCCAGCCNONE 
J065101B15GCCCAGCCNONE 
J065192B02GCCCAGCCNONE 
Os03g0763000AK120812GGCTGGGCCATSimilar to Casein kinase II alpha subunit. 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0811100AK072463GCCCAGCCSimilar to Magnesium-chelatase subunit chlD, chloroplast precursor (EC 6.6.1.1) (Mg-protoporphyrin IX chelatase) (Mg-chelatase subunit D). 
Os03g0822900AK099787GGCTGGGCCGGTZinc finger, BED-type predicted domain containing protein. 
J013042C24GGCTGGGCCGGTNONE 
J013096O21GGCTGGGCCGGTNONE 
J023109I23GGCTGGGCCGGTNONE 
J033106N09GGCTGGGCCGGTNONE 
J033107H03GGCTGGGCCGGTNONE 
J033118G03GGCTGGGCCGGTNONE 
J033145I24GGCTGGGCCGGTNONE 
J065138D15GGCTGGGCCGGTNONE 
J065140L13GGCTGGGCCGGTNONE 
J065179M13GGCTGGGCCGGTNONE 
J065200F05GGCTGGGCCGGTNONE 
J075104F20GGCTGGGCCGGTNONE 
J075143A15GGCTGGGCCGGTNONE 
J075197J11GGCTGGGCCGGTNONE 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
Os03g0843500AK067985CGGGCCCAGCCCACGCNONE 
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAGCCCACGCNONE 
J080302L23CGGGCCCAGCCCACGCNONE 
Os03g0846400AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
Os03g0854000009-186-C03GGCTGGGCCCACGCGNONE 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
J065138B11GGCTGGGCCCACGCGNONE 
Os03g0858700006-024-D11GGTGGGGCTGGGCCGTCNONE 
AK061723GGTGGGGCTGGGCCGTCProtein of unknown function DUF1499 family protein. 
AK064976GGTGGGGCTGGGCCGTCNONE 
J013001B23GGTGGGGCTGGGCCGTCNONE 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0117100009-025-D02AGCCCAGCCCANONE 
009-056-D03AGCCCAGCCCANONE 
009-145-F01AGCCCAGCCCANONE 
009-146-C06AGCCCAGCCCANONE 
009-186-C05AGCCCAGCCCANONE 
AK060395AGCCCAGCCCANONE 
AK121763AGCCCAGCCCAConserved hypothetical protein. 
J033090J17AGCCCAGCCCANONE 
J065058O06AGCCCAGCCCANONE 
J065058P05AGCCCAGCCCANONE 
J065141C14AGCCCAGCCCANONE 
J065162F07AGCCCAGCCCANONE 
J065199N16AGCCCAGCCCANONE 
J065214I05AGCCCAGCCCANONE 
J075003L04AGCCCAGCCCANONE 
J075014C14AGCCCAGCCCANONE 
J075063K14AGCCCAGCCCANONE 
J075111N19AGCCCAGCCCANONE 
J075138E13AGCCCAGCCCANONE 
J075189E23AGCCCAGCCCANONE 
J080304J23AGCCCAGCCCANONE 
J080310L07AGCCCAGCCCANONE 
J080318A16AGCCCAGCCCANONE 
J100054P14AGCCCAGCCCANONE 
Os04g0117800Os04g0117800GCAGCCCAGGCCCAGCCAmidase family protein. 
Os04g0118100006-100-G08CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
AK058463CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
J065078C03CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0343900AK107841GCCCAGCCCAConserved hypothetical protein. 
Os04g0376600J033065H17GGCTGGGCTGGGNONE 
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0441800AK064785TAGGCCCAGCCTGF-beta receptor, type I/II extracellular region family protein. 
J013000B16TAGGCCCAGCCNONE 
J100043P07TAGGCCCAGCCNONE 
Os04g0479300AK106088TACGGCCCAGCCConserved hypothetical protein. 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
J065116G03GGCTGGGCNONE 
Os04g0513100AK067841GGGCTGGGCTGCGGTGGGCTGTSimilar to Beta-glucosidase. 
J075105F14GGGCTGGGCTGCGGTGGGCTGTNONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0528100009-090-G06TTTCGGCCCAGCCNONE 
009-168-C11TTTCGGCCCAGCCNONE 
AK065957TTTCGGCCCAGCCConserved hypothetical protein. 
J013039G20TTTCGGCCCAGCCNONE 
J013044D08TTTCGGCCCAGCCNONE 
J065013L14TTTCGGCCCAGCCNONE 
J065143H08TTTCGGCCCAGCCNONE 
J065146C14TTTCGGCCCAGCCNONE 
J065149K22TTTCGGCCCAGCCNONE 
J065156B18TTTCGGCCCAGCCNONE 
J065201A04TTTCGGCCCAGCCNONE 
J065209A04TTTCGGCCCAGCCNONE 
Os04g0551800016-049-G12TAATGGGCTGGGCTNONE 
AK121568TAATGGGCTGGGCTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06TAATGGGCTGGGCTNONE 
J013111B11TAATGGGCTGGGCTNONE 
J013121H23TAATGGGCTGGGCTNONE 
J023012A17TAATGGGCTGGGCTNONE 
J023092M05TAATGGGCTGGGCTNONE 
J033026P14TAATGGGCTGGGCTNONE 
J033033C10TAATGGGCTGGGCTNONE 
J033033M10TAATGGGCTGGGCTNONE 
J033035C24TAATGGGCTGGGCTNONE 
J033052E19TAATGGGCTGGGCTNONE 
J033140K19TAATGGGCTGGGCTNONE 
J065036F18TAATGGGCTGGGCTNONE 
J065067L12TAATGGGCTGGGCTNONE 
J065095G09TAATGGGCTGGGCTNONE 
J065115B08TAATGGGCTGGGCTNONE 
J065218E24TAATGGGCTGGGCTNONE 
J090002N13TAATGGGCTGGGCTNONE 
J090008B12TAATGGGCTGGGCTNONE 
J090016F24TAATGGGCTGGGCTNONE 
J090019H14TAATGGGCTGGGCTNONE 
J090020G20TAATGGGCTGGGCTNONE 
J090029L18TAATGGGCTGGGCTNONE 
J090057C23TAATGGGCTGGGCTNONE 
J090073H23TAATGGGCTGGGCTNONE 
J090081C16TAATGGGCTGGGCTNONE 
J090081E21TAATGGGCTGGGCTNONE 
J090084L14TAATGGGCTGGGCTNONE 
J090086M01TAATGGGCTGGGCTNONE 
J090089E16TAATGGGCTGGGCTNONE 
J100031P12TAATGGGCTGGGCTNONE 
J100090N23TAATGGGCTGGGCTNONE 
Os04g0555300012-003-H04GGCTGGGCTNONE 
012-055-C10GGCTGGGCTNONE 
012-067-E04GGCTGGGCTNONE 
015-035-G03GGCTGGGCTNONE 
016-038-E01GGCTGGGCTNONE 
AK105088GGCTGGGCTNONE 
J013048K21GGCTGGGCTNONE 
J013149O17GGCTGGGCTNONE 
J023008F10GGCTGGGCTNONE 
J023086K19GGCTGGGCTNONE 
J033123B14GGCTGGGCTNONE 
J053043L13GGCTGGGCTNONE 
J053045D23GGCTGGGCTNONE 
J053061O14GGCTGGGCTNONE 
J053062F14GGCTGGGCTNONE 
J053095C01GGCTGGGCTNONE 
J053095I16GGCTGGGCTNONE 
J053099E11GGCTGGGCTNONE 
J090008C01GGCTGGGCTNONE 
J090010K10GGCTGGGCTNONE 
J090026I23GGCTGGGCTNONE 
J090045I22GGCTGGGCTNONE 
J090051K01GGCTGGGCTNONE 
J090057J15GGCTGGGCTNONE 
J090061K23GGCTGGGCTNONE 
J100045I16GGCTGGGCTNONE 
J100084L22GGCTGGGCTNONE 
Os04g0559400AK106376AAAAGCCCAGCCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0585600006-117-A02GGCTGGGCNONE 
AK106073GGCTGGGCConserved hypothetical protein. 
J053089I23GGCTGGGCNONE 
J065112K06GGCTGGGCNONE 
J065128D09GGCTGGGCNONE 
J100038D09GGCTGGGCNONE 
Os04g0587300AK119483GCCCAGCCCSimilar to Purine permease-like protein. 
Os04g0589200AK068571AGCCCAGCCCAGCCConserved hypothetical protein. 
AK102463AGCCCAGCCCAGCCNONE 
J075083K10AGCCCAGCCCAGCCNONE 
Os04g0636000015-046-E08AGCCCAGCCCNONE 
AK065639AGCCCAGCCCSPla/RYanodine receptor SPRY domain containing protein. 
AK099615AGCCCAGCCCNONE 
Os04g0636400006-064-G07TAAGCCCAGCCNONE 
006-097-D05TAAGCCCAGCCNONE 
AK061848TAAGCCCAGCCSimilar to Senescence-associated protein 6. 
AK099573TAAGCCCAGCCNONE 
J013035J20TAAGCCCAGCCNONE 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0650700006-037-H03GCCCAGCCNONE 
AK061502GCCCAGCCNONE 
AK068693GCCCAGCCNONE 
AK121820GCCCAGCCSimilar to L-asparaginase (L-asparagine amidohydrolase). 
J043030P10GCCCAGCCNONE 
J065084D09GCCCAGCCNONE 
Os04g0659400AK070174GGCTGGGCCGGCENT domain containing protein. 
Os04g0682800AK121846CCAGCCCAGCCCAGCSodium/hydrogen exchanger family protein. 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os04g0691900AK068257GCAGCCCAGCCACCAACChaperonin Cpn60/TCP-1 family protein. 
Os05g0255600AK073067CTTGGGCTGGGCCCTThioredoxin domain 2 containing protein. 
J033022A04CTTGGGCTGGGCCCTNONE 
J033022B03CTTGGGCTGGGCCCTNONE 
J033116F22CTTGGGCTGGGCCCTNONE 
J065017H13CTTGGGCTGGGCCCTNONE 
J065038G20CTTGGGCTGGGCCCTNONE 
J065076J16CTTGGGCTGGGCCCTNONE 
J065135D06CTTGGGCTGGGCCCTNONE 
J065168P22CTTGGGCTGGGCCCTNONE 
J065188G21CTTGGGCTGGGCCCTNONE 
J065207C14CTTGGGCTGGGCCCTNONE 
J080014C23CTTGGGCTGGGCCCTNONE 
J080018G12CTTGGGCTGGGCCCTNONE 
J080021F03CTTGGGCTGGGCCCTNONE 
J100068C14CTTGGGCTGGGCCCTNONE 
Os05g0325200J090038J19GGGCTGGGCGGCCCATTTGGGCCyclin-like domain containing protein. 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK111268AAGGCCCATTTAGCCCAGCCCNONE 
J013129N08AAGGCCCATTTAGCCCAGCCCNONE 
J065191E01AAGGCCCATTTAGCCCAGCCCNONE 
J065216P03AAGGCCCATTTAGCCCAGCCCNONE 
J075089K21AAGGCCCATTTAGCCCAGCCCNONE 
Os05g0490800J065037L19AAAAGCCCAGCCNONE 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0495100AK108028GGGCTGGGCTTTTConserved hypothetical protein. 
Os05g0512400011-014-B07GGCTGGGCNONE 
AK120770GGCTGGGCConserved hypothetical protein. 
Os05g0540100AB021666CCCAGCCCAGCCNONE 
AK060623CCCAGCCCAGCCNONE 
AK103819CCCAGCCCAGCCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0543700AK071113GGTGGGGCCCAGCCSimilar to Chaperone protein dnaJ. 
AK103912GGTGGGGCCCAGCCNONE 
Os05g0551700AK071216CCCAGCCCAGCCtRNA isopentenyltransferase family protein. 
Os05g0554100AK073023GCCCAGCCCATCARibosomal protein L7/L12 family protein. 
AK101756GCCCAGCCCATCANONE 
Os05g0566300AK099641GGCTGGGCCGA16S rRNA processing protein RimM family protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0592400AB037144GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
AK065508GTTTGGGCTGGGCTGGGCTGGGCTGGUV-damaged DNA binding protein. 
J013069J24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013075H15GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013095H04GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013105L19GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013152P13GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J023072O05GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033024J22GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033030D07GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033041D09GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033051M16GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033126M01GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033145H24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
Os05g0594800AK058332GAAGCCCAGCCCACCAAdhesion regulating molecule family protein. 
AK068013GAAGCCCAGCCCACCANONE 
J013129L24GAAGCCCAGCCCACCANONE 
Os05g0595000AK071326AGCCCAGCCAllergen V5/Tpx-1 related family protein. 
J023088B21AGCCCAGCCNONE 
Os06g0116400006-082-G06GAAGCCCAGCCNONE 
AK058327GAAGCCCAGCCNONE 
AK105979GAAGCCCAGCCHigh-affinity nickel-transporter family protein. 
J065083I24GAAGCCCAGCCNONE 
J100072O18GAAGCCCAGCCNONE 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0134000AK102796GCCCAGCCCACCTNONE 
Os06g0136900AK107405ACAGCCCAGCCCAGGGCCCGCProtein of unknown function DUF296 domain containing protein. 
Os06g0140400AK059116GGCTGGGCCTCNONE 
AK102692GGCTGGGCCTCSimilar to HAHB-6 (Fragment). 
AY554033GGCTGGGCCTCNONE 
J033103D12GGCTGGGCCTCNONE 
Os06g0156700AK107226GCCGGCCCAGCCCLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCGGCCCAGCCCNONE 
J075023M12GCCGGCCCAGCCCNONE 
J075041C14GCCGGCCCAGCCCNONE 
J075041C19GCCGGCCCAGCCCNONE 
J075064F08GCCGGCCCAGCCCNONE 
J075116I03GCCGGCCCAGCCCNONE 
J075123I02GCCGGCCCAGCCCNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0219800011-090-C04GGCTGGGCTNONE 
AK072030GGCTGGGCTSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405GGCTGGGCTNONE 
J065063P03GGCTGGGCTNONE 
J100032E17GGCTGGGCTNONE 
J100081I18GGCTGGGCTNONE 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCAACGCCCAGCCCNONE 
J023028N24GGCCCGGCCCAACGCCCAGCCCNONE 
J033098H21GGCCCGGCCCAACGCCCAGCCCNONE 
J033118G04GGCCCGGCCCAACGCCCAGCCCNONE 
J090056P15GGCCCGGCCCAACGCCCAGCCCNONE 
J090062B02GGCCCGGCCCAACGCCCAGCCCNONE 
J100024B09GGCCCGGCCCAACGCCCAGCCCNONE 
J100060I04GGCCCGGCCCAACGCCCAGCCCNONE 
J100078H11GGCCCGGCCCAACGCCCAGCCCNONE 
J100080A14GGCCCGGCCCAACGCCCAGCCCNONE 
J100086F18GGCCCGGCCCAACGCCCAGCCCNONE 
Os06g0472200AK059428CAGGCCCAGCCNONE 
AK103043CAGGCCCAGCCSimilar to Isoflavone reductase homolog Bet v 6.0101 (Fragment). 
J033117F05CAGGCCCAGCCNONE 
Os06g0496800AK069969GGCTGGGCTNONE 
AK105608GGCTGGGCTSimilar to S-locus receptor kinase precursor. 
J023038O14GGCTGGGCTNONE 
J023067C09GGCTGGGCTNONE 
J065040A13GGCTGGGCTNONE 
J075041I24GGCTGGGCTNONE 
J075088P04GGCTGGGCTNONE 
J075114B05GGCTGGGCTNONE 
J075155L05GGCTGGGCTNONE 
J075169G21GGCTGGGCTNONE 
J090049L19GGCTGGGCTNONE 
J090075E08GGCTGGGCTNONE 
J090092J03GGCTGGGCTNONE 
J100054E02GGCTGGGCTNONE 
J100079D08GGCTGGGCTNONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0701400013-010-G06GGCTGGGCCAANONE 
AK121229GGCTGGGCCAASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16GGCTGGGCCAANONE 
J033023L12GGCTGGGCCAANONE 
J065043I07GGCTGGGCCAANONE 
J065049E09GGCTGGGCCAANONE 
J065054I05GGCTGGGCCAANONE 
J065072H13GGCTGGGCCAANONE 
J065073L10GGCTGGGCCAANONE 
J065079P09GGCTGGGCCAANONE 
J065112I06GGCTGGGCCAANONE 
J065167C03GGCTGGGCCAANONE 
J065167I03GGCTGGGCCAANONE 
J065176P13GGCTGGGCCAANONE 
J065205M07GGCTGGGCCAANONE 
J075018E13GGCTGGGCCAANONE 
J075021E04GGCTGGGCCAANONE 
J075038F13GGCTGGGCCAANONE 
J075051E05GGCTGGGCCAANONE 
J075067C10GGCTGGGCCAANONE 
J075079A12GGCTGGGCCAANONE 
J075084A13GGCTGGGCCAANONE 
J075103E20GGCTGGGCCAANONE 
J075116E09GGCTGGGCCAANONE 
J075118F15GGCTGGGCCAANONE 
J075121I15GGCTGGGCCAANONE 
J075129B01GGCTGGGCCAANONE 
J075138A22GGCTGGGCCAANONE 
J075159B22GGCTGGGCCAANONE 
J075165I11GGCTGGGCCAANONE 
J075186E09GGCTGGGCCAANONE 
J075190J09GGCTGGGCCAANONE 
J075191I07GGCTGGGCCAANONE 
J080301C05GGCTGGGCCAANONE 
J080302L02GGCTGGGCCAANONE 
J100035C19GGCTGGGCCAANONE 
J100059P06GGCTGGGCCAANONE 
Os06g0714100AK121079AAAGCCCAGCCCAComplex 1 LYR protein family protein. 
J023062M13AAAGCCCAGCCCANONE 
J043020D18AAAGCCCAGCCCANONE 
J065073A17AAAGCCCAGCCCANONE 
J065158D09AAAGCCCAGCCCANONE 
J065195H04AAAGCCCAGCCCANONE 
J065214P13AAAGCCCAGCCCANONE 
J080079I22AAAGCCCAGCCCANONE 
J100031M06AAAGCCCAGCCCANONE 
J100036I12AAAGCCCAGCCCANONE 
Os06g0715000AK107114GGGCTGGGCCGGCConserved hypothetical protein. 
Os07g0112600AK109561GTGGCCCAGCCConserved hypothetical protein. 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0133700J065005A21TCAGCCCAGCCCAGCCCAAGHypothetical protein. 
J065096D02TCAGCCCAGCCCAGCCCAAGNONE 
J065097G13TCAGCCCAGCCCAGCCCAAGNONE 
Os07g0155200006-036-E03AAAGCCCATTTAGGCCCAGCCNONE 
006-036-E04AAAGCCCATTTAGGCCCAGCCNONE 
AK061006AAAGCCCATTTAGGCCCAGCCProtein of unknown function DUF150 family protein. 
AK104606AAAGCCCATTTAGGCCCAGCCNONE 
Os07g0164500J013094M18GGCTGGGCCGTGNONE 
J013153L05GGCTGGGCCGTGNONE 
J023011J18GGCTGGGCCGTGNONE 
J023106H21GGCTGGGCCGTGNONE 
J033105F10GGCTGGGCCGTGNONE 
J065210M20GGCTGGGCCGTGSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05GGCTGGGCCGTGNONE 
J090061C13GGCTGGGCCGTGNONE 
J090074K15GGCTGGGCCGTGNONE 
Os07g0180900006-055-B11CAAGGCCCAGCCCANONE 
006-103-F09CAAGGCCCAGCCCANONE 
011-009-E03CAAGGCCCAGCCCANONE 
011-035-H08CAAGGCCCAGCCCANONE 
014-043-F08CAAGGCCCAGCCCANONE 
AK060711CAAGGCCCAGCCCARibosomal protein L4/L1e family protein. 
AK060963CAAGGCCCAGCCCANONE 
AK104447CAAGGCCCAGCCCANONE 
AK104504CAAGGCCCAGCCCANONE 
AK104629CAAGGCCCAGCCCANONE 
J023003P15CAAGGCCCAGCCCANONE 
J023075H14CAAGGCCCAGCCCANONE 
J033101N17CAAGGCCCAGCCCANONE 
J033132M11CAAGGCCCAGCCCANONE 
J065081C24CAAGGCCCAGCCCANONE 
J080004L10CAAGGCCCAGCCCANONE 
J080009H21CAAGGCCCAGCCCANONE 
J080013F01CAAGGCCCAGCCCANONE 
J080022K24CAAGGCCCAGCCCANONE 
J080023C22CAAGGCCCAGCCCANONE 
J080024M16CAAGGCCCAGCCCANONE 
J080026K06CAAGGCCCAGCCCANONE 
J080030J23CAAGGCCCAGCCCANONE 
J080030L05CAAGGCCCAGCCCANONE 
J080031G03CAAGGCCCAGCCCANONE 
J080033C03CAAGGCCCAGCCCANONE 
J080033D02CAAGGCCCAGCCCANONE 
J080035A11CAAGGCCCAGCCCANONE 
J080035A14CAAGGCCCAGCCCANONE 
J080039E08CAAGGCCCAGCCCANONE 
J080040L15CAAGGCCCAGCCCANONE 
J080040M03CAAGGCCCAGCCCANONE 
J080041L21CAAGGCCCAGCCCANONE 
J080043E09CAAGGCCCAGCCCANONE 
J080048B14CAAGGCCCAGCCCANONE 
J080048O09CAAGGCCCAGCCCANONE 
J080051H01CAAGGCCCAGCCCANONE 
J080052H06CAAGGCCCAGCCCANONE 
J080065K05CAAGGCCCAGCCCANONE 
J080066D10CAAGGCCCAGCCCANONE 
J080066E23CAAGGCCCAGCCCANONE 
J080069F10CAAGGCCCAGCCCANONE 
J080074M06CAAGGCCCAGCCCANONE 
J080075D13CAAGGCCCAGCCCANONE 
J080076G02CAAGGCCCAGCCCANONE 
J080082G15CAAGGCCCAGCCCANONE 
J080082K06CAAGGCCCAGCCCANONE 
J080082P12CAAGGCCCAGCCCANONE 
J080085F01CAAGGCCCAGCCCANONE 
J080090H22CAAGGCCCAGCCCANONE 
J080092D07CAAGGCCCAGCCCANONE 
J080094M03CAAGGCCCAGCCCANONE 
J080094O10CAAGGCCCAGCCCANONE 
J090008I06CAAGGCCCAGCCCANONE 
J100058N20CAAGGCCCAGCCCANONE 
J100060M07CAAGGCCCAGCCCANONE 
J100062M08CAAGGCCCAGCCCANONE 
J100064L07CAAGGCCCAGCCCANONE 
J100073H16CAAGGCCCAGCCCANONE 
J100074C10CAAGGCCCAGCCCANONE 
J100075N06CAAGGCCCAGCCCANONE 
J100087P11CAAGGCCCAGCCCANONE 
J100088B13CAAGGCCCAGCCCANONE 
J100088J16CAAGGCCCAGCCCANONE 
J100088L17CAAGGCCCAGCCCANONE 
J100088O12CAAGGCCCAGCCCANONE 
Os07g0191700AK066389GCGGCCCAGCCCAAGSimilar to AT.I.24-9 protein (Fragment). 
AK103768GCGGCCCAGCCCAAGNONE 
Os07g0198300006-052-H02GCAGCCCAGCCNONE 
009-097-B09GCAGCCCAGCCNONE 
009-116-E02GCAGCCCAGCCNONE 
009-186-A12GCAGCCCAGCCNONE 
AK060951GCAGCCCAGCCPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK071830GCAGCCCAGCCNONE 
J023117F24GCAGCCCAGCCNONE 
J065073D24GCAGCCCAGCCNONE 
J065116O11GCAGCCCAGCCNONE 
J065122C11GCAGCCCAGCCNONE 
Os07g0242600AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0256200AK072904GCTGGGCTGGGCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCTGGGCTGGGCTNONE 
Os07g0296000AK073416GCCCAGCCCConserved hypothetical protein. 
AK121178GCCCAGCCCNONE 
J033040D17GCCCAGCCCNONE 
Os07g0438300AK106732GGGCTGGGCConserved hypothetical protein. 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0509800Os07g0509800GGCTGGGCSimilar to APS reductase (Fragment). 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0589000AK069813GCCCAGCCCLateral organ boundaries, LOB domain containing protein. 
J023030F23GCCCAGCCCNONE 
J065165H21GCCCAGCCCNONE 
J065193G01GCCCAGCCCNONE 
J075093F03GCCCAGCCCNONE 
Os07g0589400AK072501GGCTGGGCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617GGCTGGGCTNONE 
AK104756GGCTGGGCTNONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0668200AK059051AAAGCCCAGCCCAATNONE 
AK101682AAAGCCCAGCCCAATConserved hypothetical protein. 
AK102839AAAGCCCAGCCCAATNONE 
Os07g0673700AK071934TCGGCCCAGCCCACCCCyclin-like F-box domain containing protein. 
AK107556TCGGCCCAGCCCACCCNONE 
Os07g0686100AK110915GGTTGGGCCCAGCCAGCCCAGSimilar to Abscisic acid responsive elements-binding factor. 
Os08g0134900012-044-H02AGCCCAGCCCATCANONE 
015-040-D07AGCCCAGCCCATCANONE 
AK066009AGCCCAGCCCATCAConserved hypothetical protein. 
J013047E17AGCCCAGCCCATCANONE 
J065064A15AGCCCAGCCCATCANONE 
J065116E14AGCCCAGCCCATCANONE 
J090067O03AGCCCAGCCCATCANONE 
Os08g0236900AK109597GAAGCCCAGCCCConserved hypothetical protein. 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0390700009-094-H10GGGCTGGGCCTCNONE 
AK062714GGGCTGGGCCTCSimilar to 2-oxoglutarate-dependent oxygenase. 
Os08g0414300AK072217ATGGCCCAGCCConserved hypothetical protein. 
J065039C07ATGGCCCAGCCNONE 
J065098N11ATGGCCCAGCCNONE 
J065120J15ATGGCCCAGCCNONE 
J075076H12ATGGCCCAGCCNONE 
J075101N16ATGGCCCAGCCNONE 
J080010A07ATGGCCCAGCCNONE 
J080023C16ATGGCCCAGCCNONE 
J080027G22ATGGCCCAGCCNONE 
J080053D02ATGGCCCAGCCNONE 
J080065E17ATGGCCCAGCCNONE 
J080068C15ATGGCCCAGCCNONE 
J090061J10ATGGCCCAGCCNONE 
Os08g0416400AK064144AGCCCAGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0427900AK103217GGGCTGGGCCGTASimilar to Hin19 (Fragment). 
AK109208GGGCTGGGCCGTANONE 
J080005C08GGGCTGGGCCGTANONE 
J080010B10GGGCTGGGCCGTANONE 
J080013C21GGGCTGGGCCGTANONE 
J080022L12GGGCTGGGCCGTANONE 
J080029C08GGGCTGGGCCGTANONE 
J080029G09GGGCTGGGCCGTANONE 
J080035L14GGGCTGGGCCGTANONE 
J080040M20GGGCTGGGCCGTANONE 
J080043M18GGGCTGGGCCGTANONE 
J080045K15GGGCTGGGCCGTANONE 
J080048I17GGGCTGGGCCGTANONE 
J080051P16GGGCTGGGCCGTANONE 
J080053L16GGGCTGGGCCGTANONE 
J080059P14GGGCTGGGCCGTANONE 
J080063E13GGGCTGGGCCGTANONE 
J080075N18GGGCTGGGCCGTANONE 
J080077E05GGGCTGGGCCGTANONE 
J080080H23GGGCTGGGCCGTANONE 
J080081L16GGGCTGGGCCGTANONE 
J080083F17GGGCTGGGCCGTANONE 
J080085C23GGGCTGGGCCGTANONE 
J080086A12GGGCTGGGCCGTANONE 
J080088N06GGGCTGGGCCGTANONE 
J080092G10GGGCTGGGCCGTANONE 
J080093F04GGGCTGGGCCGTANONE 
J080094C03GGGCTGGGCCGTANONE 
J090032L12GGGCTGGGCCGTANONE 
Os08g0435800AK121712CCAGCCCAGCCCAGATSimilar to Lipoate protein ligase-like protein. 
J065121P15CCAGCCCAGCCCAGATNONE 
Os08g0442300006-067-F05GCTGGGCTGGGCTTTNONE 
AK059843GCTGGGCTGGGCTTTNONE 
AK071719GCTGGGCTGGGCTTTSimilar to Calcineurin-like protein. 
AK102411GCTGGGCTGGGCTTTNONE 
J023108H11GCTGGGCTGGGCTTTNONE 
J033092P05GCTGGGCTGGGCTTTNONE 
J075109C09GCTGGGCTGGGCTTTNONE 
J090070B02GCTGGGCTGGGCTTTNONE 
J090076M14GCTGGGCTGGGCTTTNONE 
J100064B16GCTGGGCTGGGCTTTNONE 
Os08g0465800AY428025CACGGCCCAGCCNONE 
J013029M24CACGGCCCAGCCNONE 
J013030K15CACGGCCCAGCCNONE 
J013048G12CACGGCCCAGCCNONE 
J023041H10CACGGCCCAGCCNONE 
J023065G12CACGGCCCAGCCNONE 
J023074A02CACGGCCCAGCCNONE 
J023092B20CACGGCCCAGCCNONE 
J023147A01CACGGCCCAGCCNONE 
J023150L07CACGGCCCAGCCNONE 
J043007P21CACGGCCCAGCCNONE 
J090004P19CACGGCCCAGCCNONE 
J100030K13CACGGCCCAGCCNONE 
J100060N03CACGGCCCAGCCNONE 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0480000006-053-A10GCCGGCCCAGCCNONE 
AK067748GCCGGCCCAGCCMulti antimicrobial extrusion protein MatE family protein. 
J013118K06GCCGGCCCAGCCNONE 
Os08g0522600014-041-A10GCCCAGCCNONE 
AK105364GCCCAGCCSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
Os08g0526400J065038L03GGCTGGGCCTTNONE 
J065048D07GGCTGGGCCTTNONE 
J065057B11GGCTGGGCCTTNONE 
J065149F16GGCTGGGCCTTNONE 
J065152P03GGCTGGGCCTTNONE 
J065192J12GGCTGGGCCTTNONE 
Os08g0527100AK119411TCAGCCCAGCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TCAGCCCAGCCNONE 
J090029K18TCAGCCCAGCCNONE 
Os08g0532800AK061214GGCTGGGCTCTGGGCTGTPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK061387GGCTGGGCTCTGGGCTGTNONE 
AK067802GGCTGGGCTCTGGGCTGTNONE 
AK104251GGCTGGGCTCTGGGCTGTNONE 
Os08g0536000011-094-E07GGCTGGGCTNONE 
AK071782GGCTGGGCTSimilar to Pyruvate dehydrogenase E1 beta subunit isoform 1 (EC 1.2.4.1). 
AK104686GGCTGGGCTNONE 
J013041J12GGCTGGGCTNONE 
Os08g0539700AB013451GGGCTGGGCTGANONE 
AK065693GGGCTGGGCTGADisease resistance protein family protein. 
AK099855GGGCTGGGCTGANONE 
J013022K17GGGCTGGGCTGANONE 
J013035D04GGGCTGGGCTGANONE 
J013037A20GGGCTGGGCTGANONE 
J013043I01GGGCTGGGCTGANONE 
J013051J07GGGCTGGGCTGANONE 
J013056G09GGGCTGGGCTGANONE 
J013067C09GGGCTGGGCTGANONE 
J013067M22GGGCTGGGCTGANONE 
J013089C05GGGCTGGGCTGANONE 
J013106J08GGGCTGGGCTGANONE 
J013110K12GGGCTGGGCTGANONE 
J013114K06GGGCTGGGCTGANONE 
J013135N19GGGCTGGGCTGANONE 
J013149H06GGGCTGGGCTGANONE 
J075111G14GGGCTGGGCTGANONE 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0115500006-023-A12GCAGCCCAGCCNONE 
006-042-G01GCAGCCCAGCCNONE 
AK061717GCAGCCCAGCCCBS domain containing protein. 
AK065986GCAGCCCAGCCNONE 
J013043C13GCAGCCCAGCCNONE 
J013111D13GCAGCCCAGCCNONE 
J023114K12GCAGCCCAGCCNONE 
J065102N18GCAGCCCAGCCNONE 
Os09g0120033AK069069TTGGCCCAGCCConserved hypothetical protein. 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0296400J090084M08GCCCGGCCCAGCCConserved hypothetical protein. 
Os09g0325100J080009O19GCGGCCCAGCCNONE 
J080011H14GCGGCCCAGCCConserved hypothetical protein. 
J080014F14GCGGCCCAGCCNONE 
J080014M09GCGGCCCAGCCNONE 
J080014N20GCGGCCCAGCCNONE 
J080018K13GCGGCCCAGCCNONE 
J080023C08GCGGCCCAGCCNONE 
J080023C09GCGGCCCAGCCNONE 
J080023K14GCGGCCCAGCCNONE 
J080025I09GCGGCCCAGCCNONE 
J080030J04GCGGCCCAGCCNONE 
J080039D08GCGGCCCAGCCNONE 
J080039L17GCGGCCCAGCCNONE 
J080041B13GCGGCCCAGCCNONE 
J080041P21GCGGCCCAGCCNONE 
J080042J21GCGGCCCAGCCNONE 
J080042L19GCGGCCCAGCCNONE 
J080045F07GCGGCCCAGCCNONE 
J080047B10GCGGCCCAGCCNONE 
J080051F23GCGGCCCAGCCNONE 
J080053D15GCGGCCCAGCCNONE 
J080053K02GCGGCCCAGCCNONE 
J080058K18GCGGCCCAGCCNONE 
J080061M13GCGGCCCAGCCNONE 
J080064M24GCGGCCCAGCCNONE 
J080067H07GCGGCCCAGCCNONE 
J080080B21GCGGCCCAGCCNONE 
J080080D18GCGGCCCAGCCNONE 
J080082G07GCGGCCCAGCCNONE 
J080088B01GCGGCCCAGCCNONE 
J080088E09GCGGCCCAGCCNONE 
J080093L01GCGGCCCAGCCNONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0397900AK101306GGCTGGGCTTTTTGGTGGGCCAASimilar to FEG protein. 
Os09g0447500AK110565GGCTGGGCCytochrome P450 family protein. 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0461500006-107-E02GTGCGGTGCGCCCAGCCNONE 
011-089-D02GTGCGGTGCGCCCAGCCNONE 
AK063400GTGCGGTGCGCCCAGCCNONE 
AK102328GTGCGGTGCGCCCAGCCEsterase/lipase/thioesterase domain containing protein. 
J033090L22GTGCGGTGCGCCCAGCCNONE 
J065031O14GTGCGGTGCGCCCAGCCNONE 
J065083D22GTGCGGTGCGCCCAGCCNONE 
J065182N14GTGCGGTGCGCCCAGCCNONE 
J065190H22GTGCGGTGCGCCCAGCCNONE 
J065219H11GTGCGGTGCGCCCAGCCNONE 
J075007O22GTGCGGTGCGCCCAGCCNONE 
J075025E09GTGCGGTGCGCCCAGCCNONE 
J075041K24GTGCGGTGCGCCCAGCCNONE 
J075046F11GTGCGGTGCGCCCAGCCNONE 
J090032E12GTGCGGTGCGCCCAGCCNONE 
Os09g0465800009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0509200AK069525GGCTGGGCCTTTGGGCCAASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0516800009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0535300AK071211AAGGCCCAGCCCAAGXAP5 protein family protein. 
Os09g0568000AK068829TACTGGGCTGGGCTTGNONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
L29471AAATGGGCTGGGCTTGNONE 
Os11g0100100009-122-C12ACATGGGCTGGGCTSimilar to Gamma-aminobutyric acid receptor-associated protein-like 2 (GABA(A) receptor-associated protein-like 2) (Ganglioside expression factor 2) (GEF-2) (General protein transport factor p16) (MAP1 light chain 3 related protein). 
Os11g0162200009-059-H04GCGGCCCAGCCNONE 
AK060396GCGGCCCAGCCSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11GCGGCCCAGCCNONE 
J065105K09GCGGCCCAGCCNONE 
J075024G12GCGGCCCAGCCNONE 
J075040K04GCGGCCCAGCCNONE 
J075066D13GCGGCCCAGCCNONE 
J075108A11GCGGCCCAGCCNONE 
J100031D04GCGGCCCAGCCNONE 
J100060O05GCGGCCCAGCCNONE 
J100075M22GCGGCCCAGCCNONE 
Os11g0168200005-010-H01CCCAGCCCAGCCCAGNONE 
009-156-F07CCCAGCCCAGCCCAGNONE 
012-025-F01CCCAGCCCAGCCCAGNONE 
012-089-A02CCCAGCCCAGCCCAGNONE 
016-016-E08CCCAGCCCAGCCCAGNONE 
AK073392CCCAGCCCAGCCCAG60S ribosomal protein L3. 
AK099225CCCAGCCCAGCCCAGNONE 
AK101469CCCAGCCCAGCCCAGNONE 
AY236158CCCAGCCCAGCCCAGNONE 
J013152M22CCCAGCCCAGCCCAGNONE 
J023013N11CCCAGCCCAGCCCAGNONE 
J023038J11CCCAGCCCAGCCCAGNONE 
J023054N21CCCAGCCCAGCCCAGNONE 
J033041E13CCCAGCCCAGCCCAGNONE 
J033050O09CCCAGCCCAGCCCAGNONE 
J033093G05CCCAGCCCAGCCCAGNONE 
J033094J17CCCAGCCCAGCCCAGNONE 
J033112J24CCCAGCCCAGCCCAGNONE 
J033113D05CCCAGCCCAGCCCAGNONE 
J033120K10CCCAGCCCAGCCCAGNONE 
J033121H19CCCAGCCCAGCCCAGNONE 
J033129C08CCCAGCCCAGCCCAGNONE 
J033140H24CCCAGCCCAGCCCAGNONE 
J065020I18CCCAGCCCAGCCCAGNONE 
J065058L01CCCAGCCCAGCCCAGNONE 
J065059G22CCCAGCCCAGCCCAGNONE 
J065212L09CCCAGCCCAGCCCAGNONE 
J075047P09CCCAGCCCAGCCCAGNONE 
J075063C18CCCAGCCCAGCCCAGNONE 
J075076E07CCCAGCCCAGCCCAGNONE 
J075077F14CCCAGCCCAGCCCAGNONE 
J075086C22CCCAGCCCAGCCCAGNONE 
J075161L09CCCAGCCCAGCCCAGNONE 
J075177K20CCCAGCCCAGCCCAGNONE 
J090007L06CCCAGCCCAGCCCAGNONE 
J090010M02CCCAGCCCAGCCCAGNONE 
J090013M20CCCAGCCCAGCCCAGNONE 
J090044I15CCCAGCCCAGCCCAGNONE 
J090045O06CCCAGCCCAGCCCAGNONE 
J090060L04CCCAGCCCAGCCCAGNONE 
J090061C17CCCAGCCCAGCCCAGNONE 
J090062F10CCCAGCCCAGCCCAGNONE 
J090066L03CCCAGCCCAGCCCAGNONE 
J090089E13CCCAGCCCAGCCCAGNONE 
J090096D21CCCAGCCCAGCCCAGNONE 
J100039F12CCCAGCCCAGCCCAGNONE 
J100053N06CCCAGCCCAGCCCAGNONE 
Os11g0184900011-088-C07GCGGCCCAGCCCAGCNONE 
015-036-B03GCGGCCCAGCCCAGCNONE 
016-087-F07GCGGCCCAGCCCAGCNONE 
AB028184GCGGCCCAGCCCAGCNONE 
AK063399GCGGCCCAGCCCAGCSimilar to NAC-domain protein 5-7. 
AK064292GCGGCCCAGCCCAGCNONE 
AK102475GCGGCCCAGCCCAGCNONE 
J033094I01GCGGCCCAGCCCAGCNONE 
J090087J16GCGGCCCAGCCCAGCNONE 
Os11g0216400Os11g0216400TCCGGCCCAGCCProteinase inhibitor, propeptide domain containing protein. 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os11g0449800AK108433GGCTGGGCHypothetical protein. 
Os11g0482000006-056-D12GGCTGGGCCTTGNONE 
006-102-C10GGCTGGGCCTTGNONE 
009-005-E07GGCTGGGCCTTGNONE 
014-088-D03GGCTGGGCCTTGNONE 
AK059558GGCTGGGCCTTGSimilar to 40S ribosomal protein S5-1. 
AK103918GGCTGGGCCTTGNONE 
Os11g0488600AK111309CACGGCCCAGCCCACGAConserved hypothetical protein. 
J075011H20CACGGCCCAGCCCACGANONE 
J075068E17CACGGCCCAGCCCACGANONE 
J075102G16CACGGCCCAGCCCACGANONE 
Os11g0513900AK101049GGCTGGGCTGGGCCTTGConserved hypothetical protein. 
Os11g0545800AK073687CCAGCCCAGCCCRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCAGCCCAGCCCNONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0642100AK107010TAATGGGCCCAGCCCCyclin-like F-box domain containing protein. 
Os11g0648000AK066444GTGGTGGGCCCAGCCSimilar to Na+/H+ antiporter. 
AK072026GTGGTGGGCCCAGCCNONE 
Os12g0100050Os12g0100050ACATGGGCTGGGCTGGGCTGGGCTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AGCCCAGCCCAGCCCAGCCCATGTNONE 
AK061492AGCCCAGCCCAGCCCAGCCCATGTSimilar to ALY protein. 
AK068452AGCCCAGCCCAGCCCAGCCCATGTNONE 
J013153E18AGCCCAGCCCAGCCCAGCCCATGTNONE 
J033140D06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065046A19AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065061F08AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065101I03AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065158B05AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065162H06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065195I23AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065218E07AGCCCAGCCCAGCCCAGCCCATGTNONE 
Os12g0133600AK103096TCCGGCCCAGCCConserved hypothetical protein. 
J033118M03TCCGGCCCAGCCNONE 
Os12g0164300AK120100GCCCAGCCCAAGCyclin-like F-box domain containing protein. 
J013022J17GCCCAGCCCAAGNONE 
J013040L22GCCCAGCCCAAGNONE 
J013041G05GCCCAGCCCAAGNONE 
J013096I02GCCCAGCCCAAGNONE 
J013156F05GCCCAGCCCAAGNONE 
J023122E20GCCCAGCCCAAGNONE 
J065008K06GCCCAGCCCAAGNONE 
J065073G14GCCCAGCCCAAGNONE 
J065105H07GCCCAGCCCAAGNONE 
J065117A15GCCCAGCCCAAGNONE 
J075025K21GCCCAGCCCAAGNONE 
J075051A13GCCCAGCCCAAGNONE 
J075119C17GCCCAGCCCAAGNONE 
J075143A02GCCCAGCCCAAGNONE 
J075149K04GCCCAGCCCAAGNONE 
J080304A20GCCCAGCCCAAGNONE 
J080305H17GCCCAGCCCAAGNONE 
J080306D14GCCCAGCCCAAGNONE 
J080306N01GCCCAGCCCAAGNONE 
J080308P13GCCCAGCCCAAGNONE 
J080310C04GCCCAGCCCAAGNONE 
J090048B12GCCCAGCCCAAGNONE 
J090092A18GCCCAGCCCAAGNONE 
J090099G20GCCCAGCCCAAGNONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0193800AK111754CCATGGGCTGGGCConserved hypothetical protein. 
Os12g0244000AK106408GCCCAGCCHypothetical protein. 
Os12g0274200009-166-H09ACCGGCCCAGCCNONE 
AK063071ACCGGCCCAGCCLipolytic enzyme, G-D-S-L family protein. 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
Os12g0538500006-077-B08AGTGGGCCCAGCCCNONE 
AK059316AGTGGGCCCAGCCCSimilar to PGPD14 protein. 
AK069502AGTGGGCCCAGCCCNONE 
AK104170AGTGGGCCCAGCCCNONE 
AK104287AGTGGGCCCAGCCCNONE 
J023020D18AGTGGGCCCAGCCCNONE 
J090079P08AGTGGGCCCAGCCCNONE 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0584100006-083-C12TAGGCCCAGCCCACCCNONE 
006-104-C06TAGGCCCAGCCCACCCNONE 
AK066829TAGGCCCAGCCCACCCNONE 
AK071424TAGGCCCAGCCCACCCConserved hypothetical protein. 
J013075O22TAGGCCCAGCCCACCCNONE 
J023091J20TAGGCCCAGCCCACCCNONE 
J065167K15TAGGCCCAGCCCACCCNONE 
J065213C02TAGGCCCAGCCCACCCNONE 
J075001B17TAGGCCCAGCCCACCCNONE 
J075165D13TAGGCCCAGCCCACCCNONE 
J075195C24TAGGCCCAGCCCACCCNONE 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0599800AK111139GGCTGGGCGAGGConserved hypothetical protein. 
Os12g0628100AK121150GTGGCCCAGCCSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J023078I07GTGGCCCAGCCNONE 
J075153L01GTGGCCCAGCCNONE 
J100050C05GTGGCCCAGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.