version

Summary of OsREG604 (All List)

OrganismOryza sativa  
IDOsREG604  
SequenceGCCCAGTA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count685  

Entry Sequences (685 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602TACTGGGCCAGSas10/Utp3 family protein. 
J013109E04TACTGGGCCAGNONE 
J033057M05TACTGGGCCAGNONE 
J043021M24TACTGGGCCAGNONE 
J090014N05TACTGGGCCAGNONE 
J090077H23TACTGGGCCAGNONE 
J090084H08TACTGGGCCAGNONE 
Os01g0138900AK058378TGTGGGGCCCAGTAMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0145200J100017K24CAAGTGGGCCCAGTANONE 
Os01g0191800AK061360TCTCGGCCCAGTANONE 
Os01g0559200AK102611GCAGCCCAGTAConserved hypothetical protein. 
J033099D01GCAGCCCAGTANONE 
J043003D13GCAGCCCAGTANONE 
J090030B01GCAGCCCAGTANONE 
J090044A12GCAGCCCAGTANONE 
Os01g0633400AK108988TTGGCCCATCGTGGCCCAGTACBS domain containing protein. 
Os01g0643900AK108288TAAGCCCAGTAOleosin family protein. 
Os01g0654400Os01g0654400TACTGGGCConserved hypothetical protein. 
Os01g0662600009-056-E10GAGGCCCAGTANONE 
AK062234GAGGCCCAGTANONE 
AK098887GAGGCCCAGTANONE 
AK099656GAGGCCCAGTANONE 
AK119723GAGGCCCAGTASimilar to NifU-like protein. 
J013001K01GAGGCCCAGTANONE 
J013090F20GAGGCCCAGTANONE 
J013119A14GAGGCCCAGTANONE 
J013121P12GAGGCCCAGTANONE 
J033132I15GAGGCCCAGTANONE 
J075023F22GAGGCCCAGTANONE 
J075023M13GAGGCCCAGTANONE 
J100024D10GAGGCCCAGTANONE 
J100024N01GAGGCCCAGTANONE 
J100026H09GAGGCCCAGTANONE 
J100027H07GAGGCCCAGTANONE 
J100045K07GAGGCCCAGTANONE 
J100057K18GAGGCCCAGTANONE 
J100085C22GAGGCCCAGTANONE 
Os01g0715900016-082-B10TACTGGGCNONE 
AK106507TACTGGGCProtein prenyltransferase domain containing protein. 
Os01g0856500AK103981TGGATGGGCTACTGGGCCCGNONE 
Os01g0874800016-042-F01TACTGGGCCAANONE 
AK065916TACTGGGCCAANONE 
AK065991TACTGGGCCAANONE 
AK103577TACTGGGCCAANONE 
AK105063TACTGGGCCAA5'-3' exonuclease domain containing protein. 
AK119315TACTGGGCCAANONE 
J023106C06TACTGGGCCAANONE 
J053023A11TACTGGGCCAANONE 
J053068H13TACTGGGCCAANONE 
J053071O13TACTGGGCCAANONE 
J053074M10TACTGGGCCAANONE 
Os01g0908100AK072293GCTGGGCCGAAATTTCGGCCCAGTARabGAP/TBC domain containing protein. 
J065010B13GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065010M12GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065047C19GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065069B18GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065071K24GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065142P04GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065170E11GCTGGGCCGAAATTTCGGCCCAGTANONE 
Os01g0916300011-018-B12TACTGGGCCTTNONE 
AK063922TACTGGGCCTTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TACTGGGCCTTNONE 
AK121061TACTGGGCCTTNONE 
AK121997TACTGGGCCTTNONE 
J033118P14TACTGGGCCTTNONE 
J065002N16TACTGGGCCTTNONE 
J065079B04TACTGGGCCTTNONE 
J065102J07TACTGGGCCTTNONE 
J065128F16TACTGGGCCTTNONE 
J065184D11TACTGGGCCTTNONE 
J065186A07TACTGGGCCTTNONE 
J075115C07TACTGGGCCTTNONE 
J075147C04TACTGGGCCTTNONE 
Os01g0920200AK120182TCAGGCCCAGTASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14TCAGGCCCAGTANONE 
J013063O14TCAGGCCCAGTANONE 
J023023D20TCAGGCCCAGTANONE 
J075121J02TCAGGCCCAGTANONE 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK111399GAAGCCCAGTASimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
AK120263GAAGCCCAGTANONE 
Os01g0949500006-054-G03TACTGGGCTTANONE 
006-095-H01TACTGGGCTTANONE 
006-101-D08TACTGGGCTTANONE 
006-110-A10TACTGGGCTTANONE 
AK068769TACTGGGCTTANONE 
AK070662TACTGGGCTTASimilar to Calmodulin (CaM). 
AK104094TACTGGGCTTANONE 
AK104159TACTGGGCTTANONE 
J065045M16TACTGGGCTTANONE 
J075112E20TACTGGGCTTANONE 
J100074O04TACTGGGCTTANONE 
J100078F05TACTGGGCTTANONE 
Os01g0960800AK073977TAGGCCCAGTAProtein Transporter, Pam16 family protein. 
AY313247TAGGCCCAGTANONE 
J033075P16TAGGCCCAGTANONE 
J065051H06TAGGCCCAGTANONE 
J065167L02TAGGCCCAGTANONE 
J090083C22TAGGCCCAGTANONE 
Os01g0966200009-079-H11GAGGCCCAGTANONE 
009-124-G10GAGGCCCAGTANONE 
AK058564GAGGCCCAGTAProtein of unknown function YGGT family protein. 
AK098935GAGGCCCAGTANONE 
Os02g0115900AF006825GCCCAGTANONE 
AK065743GCCCAGTAEndosperm lumenal binding protein. 
AK119653GCCCAGTANONE 
Os02g0120000AK067383TACTGGGCProtein prenyltransferase domain containing protein. 
AK101590TACTGGGCNONE 
J013100B15TACTGGGCNONE 
Os02g0450000AK106956TACTGGGCNONE 
Os02g0520800AK102815TACTGGGCCTGGGCCAGSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09TACTGGGCCTGGGCCAGNONE 
J100038E09TACTGGGCCTGGGCCAGNONE 
J100076G11TACTGGGCCTGGGCCAGNONE 
Os02g0622400005-010-C04TACTGGGCCTCNONE 
AK061679TACTGGGCCTCConserved hypothetical protein. 
J013058H01TACTGGGCCTCNONE 
J013095D07TACTGGGCCTCNONE 
J023054G05TACTGGGCCTCNONE 
J023093A17TACTGGGCCTCNONE 
J023146P16TACTGGGCCTCNONE 
J033089D16TACTGGGCCTCNONE 
J033099G12TACTGGGCCTCNONE 
J033131N10TACTGGGCCTCNONE 
J053073J04TACTGGGCCTCNONE 
J053074P03TACTGGGCCTCNONE 
J053075M06TACTGGGCCTCNONE 
J053088K13TACTGGGCCTCNONE 
J090039F18TACTGGGCCTCNONE 
J090045M03TACTGGGCCTCNONE 
Os02g0633200012-053-F09TAGGCCCAGTANONE 
015-051-C09TAGGCCCAGTANONE 
AK063500TAGGCCCAGTAProtein prenyltransferase domain containing protein. 
J065019K23TAGGCCCAGTANONE 
J065205C16TAGGCCCAGTANONE 
Os02g0655800AK060657TACTGGGCProtein kinase domain containing protein. 
AK101947TACTGGGCNONE 
J033044H23TACTGGGCNONE 
J033075D02TACTGGGCNONE 
J100030G03TACTGGGCNONE 
J100047B05TACTGGGCNONE 
J100083B03TACTGGGCNONE 
Os02g0673600009-071-C12AAGGCCCAGTANONE 
J023037G24AAGGCCCAGTANONE 
J023038E07AAGGCCCAGTAORMDL family protein. 
J023142L24AAGGCCCAGTANONE 
J033115B14AAGGCCCAGTANONE 
J075004B15AAGGCCCAGTANONE 
J075067J21AAGGCCCAGTANONE 
J075072K07AAGGCCCAGTANONE 
J075147H21AAGGCCCAGTANONE 
J075154F03AAGGCCCAGTANONE 
Os02g0699000AK109931GCCCAGTATGF-beta receptor, type I/II extracellular region family protein. 
Os02g0717800009-009-B02TAGGCCCAGTANONE 
J065185P06TAGGCCCAGTANONE 
J100061J04TAGGCCCAGTANONE 
J100064M21TAGGCCCAGTANONE 
Os02g0761100AK070404TAAGCCCAGTASimilar to Cyclophilin-40 (Expressed protein). 
Os02g0791800AK066282TACTGGGCNONE 
AK066282TACTGGGCCGTCCNONE 
AK099697TACTGGGCWD-40 repeat containing protein. 
AK099697TACTGGGCCGTCCWD-40 repeat containing protein. 
AY445625TACTGGGCNONE 
AY445625TACTGGGCCGTCCNONE 
J053065H07TACTGGGCNONE 
J053065H07TACTGGGCCGTCCNONE 
J065108P05TACTGGGCNONE 
J065108P05TACTGGGCCGTCCNONE 
J065154P22TACTGGGCNONE 
J065154P22TACTGGGCCGTCCNONE 
J100037P04TACTGGGCNONE 
J100037P04TACTGGGCCGTCCNONE 
J100068K05TACTGGGCNONE 
J100068K05TACTGGGCCGTCCNONE 
Os02g0804300006-046-D12GCCCAGTANONE 
AK060165GCCCAGTANONE 
Os02g0808800011-057-A10GCCCAGTANONE 
015-074-B06GCCCAGTANONE 
AK064401GCCCAGTASimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
AK099203TCGGCCCAAGGCCCAGTANONE 
Os03g0109600005-005-D08TACTGGGCTTGNONE 
AK061661TACTGGGCTTGNONE 
Os03g0131400015-012-D11CCAGCCCAGTANONE 
AK103714CCAGCCCAGTAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TACTGGGCTGGVitamin K epoxide reductase domain containing protein. 
Os03g0169700AK066912TACTGGGCTTGConserved hypothetical protein. 
Os03g0196600Os03g0196600GCCCAGTASimilar to Chloroplast serine acetyltransferase. 
Os03g0262400014-013-D09CAAGCCCAGTANONE 
AK059989CAAGCCCAGTASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18CAAGCCCAGTANONE 
J033025J23CAAGCCCAGTANONE 
J065047G10CAAGCCCAGTANONE 
J065153H03CAAGCCCAGTANONE 
J065155J08CAAGCCCAGTANONE 
J075025C05CAAGCCCAGTANONE 
Os03g0340700011-070-H05TACTGGGCNONE 
AK100470TACTGGGCTetratricopeptide-like helical domain containing protein. 
J013158I08TACTGGGCNONE 
J023009H24TACTGGGCNONE 
J023031L20TACTGGGCNONE 
J023093E24TACTGGGCNONE 
J023105J11TACTGGGCNONE 
J100059O05TACTGGGCNONE 
J100075G03TACTGGGCNONE 
J100086J06TACTGGGCNONE 
Os03g0405500AK104893ATGGCCCAGTANONE 
Os03g0604600J090093K23GAAGCCCAGTAConserved hypothetical protein. 
Os03g0712600015-008-G03TACTGGGCCTCNONE 
AK103705TACTGGGCCTCHypothetical protein. 
J033136N14TACTGGGCCTCNONE 
Os03g0737600014-094-E01TACTGGGCCGAGCCGNONE 
014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGAGCCGNONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGAGCCGCyclin H-1. 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGAGCCGNONE 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGAGCCGNONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGAGCCGNONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGAGCCGNONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0746600AK069559TACTGGGCCTAWD40-like domain containing protein. 
J023141K22TACTGGGCCTANONE 
Os03g0758700AK106620TACTGGGCCAAWD40-like domain containing protein. 
Os03g0829100AK072669TAGGCCCAGTASimilar to Soluble epoxide hydrolase. 
J013073C22TAGGCCCAGTANONE 
J033067O15TAGGCCCAGTANONE 
J065021D04TAGGCCCAGTANONE 
J065102E20TAGGCCCAGTANONE 
Os03g0850100AK101126TACTGGGCCTGNLI interacting factor domain containing protein. 
Os04g0105500AK068066TACGGCCCAGTANONE 
AK071444TACGGCCCAGTASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J013130G18TACGGCCCAGTANONE 
J023093I17TACGGCCCAGTANONE 
J033079J01TACGGCCCAGTANONE 
J043027J02TACGGCCCAGTANONE 
J065135G05TACGGCCCAGTANONE 
Os04g0320200012-089-H09GCGGCCCAGTANONE 
AK069513GCGGCCCAGTAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028GCGGCCCAGTANONE 
AK119256GCGGCCCAGTANONE 
J023020H09GCGGCCCAGTANONE 
J065112F21GCGGCCCAGTANONE 
J100036M07GCGGCCCAGTANONE 
Os04g0443000011-022-G04TACTGGGCCGGNONE 
AK100533TACTGGGCCGGFAR1 domain containing protein. 
J023101L24TACTGGGCCGGNONE 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0577500006-039-C03TACTGGGCCGATAAGCCCAGNONE 
006-043-H01TACTGGGCCGATAAGCCCAGNONE 
AK061538TACTGGGCCGATAAGCCCAGNONE 
AK065648TACTGGGCCGATAAGCCCAGTatD-related deoxyribonuclease family protein. 
AK104763TACTGGGCCGATAAGCCCAGNONE 
J013035E21TACTGGGCCGATAAGCCCAGNONE 
J013066M11TACTGGGCCGATAAGCCCAGNONE 
J100026B02TACTGGGCCGATAAGCCCAGNONE 
Os04g0589600011-100-F04ATATGGGCTACTGGGCCGTANONE 
011-100-F04TACTGGGCTGTNONE 
AK061833ATATGGGCTACTGGGCCGTAGlycosyl transferase, group 1 domain containing protein. 
AK061833TACTGGGCTGTGlycosyl transferase, group 1 domain containing protein. 
AK098964ATATGGGCTACTGGGCCGTANONE 
AK098964TACTGGGCTGTNONE 
AK100053ATATGGGCTACTGGGCCGTANONE 
AK100053TACTGGGCTGTNONE 
Os04g0678800AK072212CAAGGCCCAGTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065CAAGGCCCAGTANONE 
Os05g0110300AK067116TGCGGCCCAGTANONE 
AK071038TGCGGCCCAGTANAD-dependent epimerase/dehydratase family protein. 
J065060E20TGCGGCCCAGTANONE 
J065093K05TGCGGCCCAGTANONE 
Os05g0168400006-039-A06TACTGGGCTGANONE 
006-039-A06TAGGCCCAGTANONE 
AK069800TACTGGGCTGANONE 
AK069800TAGGCCCAGTANONE 
AK106195TACTGGGCTGAConserved hypothetical protein. 
AK106195TAGGCCCAGTAConserved hypothetical protein. 
J065086N09TACTGGGCTGANONE 
J065086N09TAGGCCCAGTANONE 
J065137B10TACTGGGCTGANONE 
J065137B10TAGGCCCAGTANONE 
J075062B04TACTGGGCTGANONE 
J075062B04TAGGCCCAGTANONE 
J075193I07TACTGGGCTGANONE 
J075193I07TAGGCCCAGTANONE 
J075193K24TACTGGGCTGANONE 
J075193K24TAGGCCCAGTANONE 
J075194D10TACTGGGCTGANONE 
J075194D10TAGGCCCAGTANONE 
J100037F01TACTGGGCTGANONE 
J100037F01TAGGCCCAGTANONE 
J100071E09TACTGGGCTGANONE 
J100071E09TAGGCCCAGTANONE 
Os05g0437200014-036-D04TACTGGGCCAGANONE 
AK059283TACTGGGCCAGANONE 
AK121867TACTGGGCCAGAProtein of unknown function DUF502 family protein. 
Os05g0455600AK060152CACGGCCCAGTAPrenylated rab acceptor PRA1 family protein. 
AK103269CACGGCCCAGTANONE 
AK105995CACGGCCCAGTANONE 
J023109E13CACGGCCCAGTANONE 
J023120K13CACGGCCCAGTANONE 
J033124H03CACGGCCCAGTANONE 
Os05g0500500AK110627GCAGCCCAGTAHSP20-like chaperone domain containing protein. 
Os05g0519400012-055-D01GCCCAGTANONE 
AK058216GCCCAGTANONE 
D25240GCCCAGTANONE 
J023002K19GCCCAGTANONE 
J023008C01GCCCAGTANONE 
J023036D11GCCCAGTANONE 
J023066G11GCCCAGTANONE 
J023113H02GCCCAGTANONE 
J023121K21GCCCAGTANONE 
J023146P19GCCCAGTANONE 
J033033K24GCCCAGTANONE 
J033044H06GCCCAGTANONE 
J033046E02GCCCAGTANONE 
J033051N10GCCCAGTANONE 
J033067A11GCCCAGTANONE 
J033067E08GCCCAGTANONE 
J033076J04GCCCAGTANONE 
J033085C24GCCCAGTANONE 
J033093M08GCCCAGTANONE 
J033115G23GCCCAGTANONE 
J033118P20GCCCAGTANONE 
J033119C09GCCCAGTANONE 
J033124B06GCCCAGTANONE 
J033148B19GCCCAGTANONE 
J053033K10GCCCAGTANONE 
J053065H14GCCCAGTANONE 
J053069F23GCCCAGTANONE 
J053078B11GCCCAGTANONE 
J090042D06GCCCAGTANONE 
J090077O08GCCCAGTANONE 
J090094M14GCCCAGTANONE 
Os05g0524500AK073571TACTGGGCProtein kinase-like domain containing protein. 
Os05g0548100AK060333TACTGGGCCTTConserved hypothetical protein. 
AK100682TACTGGGCCTTNONE 
J013151E01TACTGGGCCTTNONE 
J023113L22TACTGGGCCTTNONE 
J043027A19TACTGGGCCTTNONE 
J075093E06TACTGGGCCTTNONE 
J090060D15TACTGGGCCTTNONE 
J090082J03TACTGGGCCTTNONE 
J100050E01TACTGGGCCTTNONE 
Os05g0552900AK102095GCCCGGCCCAGTAMAP65/ASE1 family protein. 
Os05g0560100AK072239TACTGGGCSimilar to Pollen-specific kinase partner protein. 
J023003G05TACTGGGCNONE 
Os05g0566300AK099641TACTGGGC16S rRNA processing protein RimM family protein. 
Os06g0114600015-077-E06TCCGGCCCAGTANONE 
AK067972TCCGGCCCAGTAConserved hypothetical protein. 
Os06g0134300AK071534TTGTGGGCTACTGGGCCATConserved hypothetical protein. 
J023106E03TTGTGGGCTACTGGGCCATNONE 
J075172D02TTGTGGGCTACTGGGCCATNONE 
J100047B13TTGTGGGCTACTGGGCCATNONE 
Os06g0135340J065061D17GAAGCCCAGTANONE 
J065159A10GAAGCCCAGTAConserved hypothetical protein. 
Os06g0143700AK067270GCAGCCCAGTASimilar to Sulfate transporter 2. 
J013098O05GCAGCCCAGTANONE 
J065017H17GCAGCCCAGTANONE 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075023M12GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C14GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C19GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075064F08GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075116I03GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075123I02GCCCAGTAAGGCCCATGGGCCTTGNONE 
Os06g0160800009-164-H06GCCCAGTANONE 
AK063063GCCCAGTAConserved hypothetical protein. 
AK069662GCCCAGTANONE 
J090005A21GCCCAGTANONE 
J090055M15GCCCAGTANONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0625500006-034-A05TACTGGGCCTCNONE 
AK058459TACTGGGCCTCSimilar to Thioredoxin peroxidase. 
AK068955TACTGGGCCTCNONE 
AK104130TACTGGGCCTCNONE 
J023003C09TACTGGGCCTCNONE 
J033043I02TACTGGGCCTCNONE 
J065063E05TACTGGGCCTCNONE 
J065190D24TACTGGGCCTCNONE 
J065198I01TACTGGGCCTCNONE 
J075107A02TACTGGGCCTCNONE 
Os06g0716200J100070M15GAAGCCCAGTAThaumatin, pathogenesis-related family protein. 
J100082O07GAAGCCCAGTANONE 
Os06g0716700AB037681GCCCAGTASimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385GCCCAGTANONE 
AK102478GCCCAGTANONE 
J013030D18GCCCAGTANONE 
J090091L06GCCCAGTANONE 
Os07g0100200006-022-D06GCCCAGTANONE 
011-025-B06GCCCAGTANONE 
012-069-A07GCCCAGTANONE 
AK060986GCCCAGTANONE 
AK073305GCCCAGTASimilar to PDX1-like protein 4. 
J023055C05GCCCAGTANONE 
J033024J11GCCCAGTANONE 
J065045F14GCCCAGTANONE 
J075097C22GCCCAGTANONE 
Os07g0152800AK065458TACTGGGCCCACGTGTConserved hypothetical protein. 
J013022G05TACTGGGCCCACGTGTNONE 
J013023D18TACTGGGCCCACGTGTNONE 
J013048J16TACTGGGCCCACGTGTNONE 
J013055I03TACTGGGCCCACGTGTNONE 
J013057F12TACTGGGCCCACGTGTNONE 
J023109A22TACTGGGCCCACGTGTNONE 
J023148E09TACTGGGCCCACGTGTNONE 
J033069G17TACTGGGCCCACGTGTNONE 
J033092I18TACTGGGCCCACGTGTNONE 
J033093C02TACTGGGCCCACGTGTNONE 
J033141M17TACTGGGCCCACGTGTNONE 
J043016M18TACTGGGCCCACGTGTNONE 
J090016D12TACTGGGCCCACGTGTNONE 
J090071B10TACTGGGCCCACGTGTNONE 
J090098K07TACTGGGCCCACGTGTNONE 
J100035K14TACTGGGCCCACGTGTNONE 
Os07g0191700AK066389TAGGCCCAAAGCCCAGTASimilar to AT.I.24-9 protein (Fragment). 
AK103768TAGGCCCAAAGCCCAGTANONE 
Os07g0546700009-110-H10TACTGGGCCGTCNONE 
AK058262TACTGGGCCGTCNONE 
J065154I05TACTGGGCCGTCNONE 
J065175P09TACTGGGCCGTCNONE 
J065187F11TACTGGGCCGTCNONE 
J075114K16TACTGGGCCGTCNONE 
J090031L21TACTGGGCCGTCNONE 
U86017TACTGGGCCGTCSimilar to 60S ribosomal protein L38. 
Os07g0638500AK108983TACTGGGCTTASimilar to Dirigent-like protein (Fragment). 
J100035F20TACTGGGCTTANONE 
Os07g0688100AK101635GCCCAGTAProtein prenyltransferase domain containing protein. 
J033055B02GCCCAGTANONE 
J090013O08GCCCAGTANONE 
J090074A17GCCCAGTANONE 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0195400006-057-E04ACAGCCCAGTANONE 
006-060-B10ACAGCCCAGTANONE 
AK070464ACAGCCCAGTAConserved hypothetical protein. 
AK104389ACAGCCCAGTANONE 
AK106140ACAGCCCAGTANONE 
J023013G08ACAGCCCAGTANONE 
J023054K19ACAGCCCAGTANONE 
J023089D18ACAGCCCAGTANONE 
J023092K05ACAGCCCAGTANONE 
J033025A08ACAGCCCAGTANONE 
J033067P12ACAGCCCAGTANONE 
J033098A10ACAGCCCAGTANONE 
J065219L04ACAGCCCAGTANONE 
J090021P06ACAGCCCAGTANONE 
J090062M05ACAGCCCAGTANONE 
J090079F15ACAGCCCAGTANONE 
J100041H19ACAGCCCAGTANONE 
Os08g0233300AK067421TACTGGGCCGAANONE 
AK120342TACTGGGCCGAAConserved hypothetical protein. 
J013061K19TACTGGGCCGAANONE 
J013106J20TACTGGGCCGAANONE 
J023022P16TACTGGGCCGAANONE 
J090015I03TACTGGGCCGAANONE 
Os08g0302000AK106760GCCCAGTASimilar to Peroxidase 40 precursor (EC 1.11.1.7) (Atperox P40). 
Os08g0416400AK064144GCCCAGTAAGGCCCATCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0441400011-033-F01TTCGGCCCAGTANONE 
015-084-B04TTCGGCCCAGTANONE 
AK063317TTCGGCCCAGTANONE 
AK064141TTCGGCCCAGTAConserved hypothetical protein. 
J065060F06TTCGGCCCAGTANONE 
J075110A22TTCGGCCCAGTANONE 
J080307P11TTCGGCCCAGTANONE 
J090041E06TTCGGCCCAGTANONE 
Os08g0504600AK064868TACTGGGCTTTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013051G08TACTGGGCTTTTNONE 
Os08g0527100AK119411TACTGGGCCGGGCCTTGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TACTGGGCCGGGCCTTGNONE 
J090029K18TACTGGGCCGGGCCTTGNONE 
Os08g0532300009-122-A05TCCGGCCCAGTANONE 
009-129-H05TCCGGCCCAGTANONE 
AB011262TCCGGCCCAGTANONE 
AK065141TCCGGCCCAGTANONE 
AK119730TCCGGCCCAGTASimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14TCCGGCCCAGTANONE 
J013042K23TCCGGCCCAGTANONE 
J023057J08TCCGGCCCAGTANONE 
J023057N10TCCGGCCCAGTANONE 
J023113C21TCCGGCCCAGTANONE 
J053054E03TCCGGCCCAGTANONE 
J053062B07TCCGGCCCAGTANONE 
J053075O17TCCGGCCCAGTANONE 
J053075P09TCCGGCCCAGTANONE 
J065024H05TCCGGCCCAGTANONE 
J065049F22TCCGGCCCAGTANONE 
J065063L03TCCGGCCCAGTANONE 
J065102O07TCCGGCCCAGTANONE 
J065104M12TCCGGCCCAGTANONE 
J065119E04TCCGGCCCAGTANONE 
J065153E10TCCGGCCCAGTANONE 
J065168M24TCCGGCCCAGTANONE 
J065173I10TCCGGCCCAGTANONE 
J065181L04TCCGGCCCAGTANONE 
J065184I18TCCGGCCCAGTANONE 
J065203M15TCCGGCCCAGTANONE 
J075004C21TCCGGCCCAGTANONE 
J075047B11TCCGGCCCAGTANONE 
J075055F18TCCGGCCCAGTANONE 
J075065G09TCCGGCCCAGTANONE 
J075094O14TCCGGCCCAGTANONE 
J075143C22TCCGGCCCAGTANONE 
J075153K18TCCGGCCCAGTANONE 
J075164N10TCCGGCCCAGTANONE 
J075197C11TCCGGCCCAGTANONE 
J080001A01TCCGGCCCAGTANONE 
J080003B11TCCGGCCCAGTANONE 
J080006G17TCCGGCCCAGTANONE 
J080007J06TCCGGCCCAGTANONE 
J080010H12TCCGGCCCAGTANONE 
J080014I01TCCGGCCCAGTANONE 
J080015C16TCCGGCCCAGTANONE 
J080016P19TCCGGCCCAGTANONE 
J080020G24TCCGGCCCAGTANONE 
J080021E12TCCGGCCCAGTANONE 
J080023I11TCCGGCCCAGTANONE 
J080024H24TCCGGCCCAGTANONE 
J080025G18TCCGGCCCAGTANONE 
J080028H08TCCGGCCCAGTANONE 
J080030G08TCCGGCCCAGTANONE 
J080031H20TCCGGCCCAGTANONE 
J080034C20TCCGGCCCAGTANONE 
J080040H13TCCGGCCCAGTANONE 
J080044M04TCCGGCCCAGTANONE 
J080047D02TCCGGCCCAGTANONE 
J080049D17TCCGGCCCAGTANONE 
J080049J17TCCGGCCCAGTANONE 
J080050A05TCCGGCCCAGTANONE 
J080051C11TCCGGCCCAGTANONE 
J080051K06TCCGGCCCAGTANONE 
J080053A07TCCGGCCCAGTANONE 
J080053I08TCCGGCCCAGTANONE 
J080056L12TCCGGCCCAGTANONE 
J080061I19TCCGGCCCAGTANONE 
J080075G09TCCGGCCCAGTANONE 
J080078C23TCCGGCCCAGTANONE 
J080080I21TCCGGCCCAGTANONE 
J080084F04TCCGGCCCAGTANONE 
J080085K16TCCGGCCCAGTANONE 
J080097A12TCCGGCCCAGTANONE 
J080097N01TCCGGCCCAGTANONE 
J090027L10TCCGGCCCAGTANONE 
J100034N17TCCGGCCCAGTANONE 
Os08g0532400AK101608TACTGGGCCGGASimilar to AT.I.24-7 protein. 
Os08g0542100AK058490GCCCGGCCCAGTARibosomal protein L7, eukaryotic form family protein. 
AK101416GCCCGGCCCAGTANONE 
J033037N08GCCCGGCCCAGTANONE 
J033086B16GCCCGGCCCAGTANONE 
J043036J02GCCCGGCCCAGTANONE 
J065137E02GCCCGGCCCAGTANONE 
J090015L07GCCCGGCCCAGTANONE 
J100036D02GCCCGGCCCAGTANONE 
Os08g0557100AK070743AATTGGGCCCAGTANONE 
AK101214AATTGGGCCCAGTASimilar to Nucleic acid-binding protein precursor. 
AK105901AATTGGGCCCAGTANONE 
J033031B04AATTGGGCCCAGTANONE 
J080004F08AATTGGGCCCAGTANONE 
J080004H12AATTGGGCCCAGTANONE 
J080005H08AATTGGGCCCAGTANONE 
J080005I02AATTGGGCCCAGTANONE 
J080008N16AATTGGGCCCAGTANONE 
J080009H23AATTGGGCCCAGTANONE 
J080012H17AATTGGGCCCAGTANONE 
J080012J21AATTGGGCCCAGTANONE 
J080013I20AATTGGGCCCAGTANONE 
J080016E07AATTGGGCCCAGTANONE 
J080018O04AATTGGGCCCAGTANONE 
J080020B18AATTGGGCCCAGTANONE 
J080021I16AATTGGGCCCAGTANONE 
J080022N01AATTGGGCCCAGTANONE 
J080023G08AATTGGGCCCAGTANONE 
J080023N09AATTGGGCCCAGTANONE 
J080024J24AATTGGGCCCAGTANONE 
J080025M12AATTGGGCCCAGTANONE 
J080028A22AATTGGGCCCAGTANONE 
J080028I01AATTGGGCCCAGTANONE 
J080029D22AATTGGGCCCAGTANONE 
J080030M02AATTGGGCCCAGTANONE 
J080031B06AATTGGGCCCAGTANONE 
J080035G08AATTGGGCCCAGTANONE 
J080036F19AATTGGGCCCAGTANONE 
J080038P14AATTGGGCCCAGTANONE 
J080039C17AATTGGGCCCAGTANONE 
J080043A10AATTGGGCCCAGTANONE 
J080044H02AATTGGGCCCAGTANONE 
J080044P12AATTGGGCCCAGTANONE 
J080047L06AATTGGGCCCAGTANONE 
J080050L06AATTGGGCCCAGTANONE 
J080052J11AATTGGGCCCAGTANONE 
J080052M10AATTGGGCCCAGTANONE 
J080053E20AATTGGGCCCAGTANONE 
J080054J01AATTGGGCCCAGTANONE 
J080059N09AATTGGGCCCAGTANONE 
J080064F19AATTGGGCCCAGTANONE 
J080064N22AATTGGGCCCAGTANONE 
J080065K14AATTGGGCCCAGTANONE 
J080065M12AATTGGGCCCAGTANONE 
J080068O07AATTGGGCCCAGTANONE 
J080076P20AATTGGGCCCAGTANONE 
J080087D08AATTGGGCCCAGTANONE 
J080087H16AATTGGGCCCAGTANONE 
J080090N23AATTGGGCCCAGTANONE 
J080091H04AATTGGGCCCAGTANONE 
J080091P13AATTGGGCCCAGTANONE 
J080094O15AATTGGGCCCAGTANONE 
J080094P14AATTGGGCCCAGTANONE 
J080095I07AATTGGGCCCAGTANONE 
J080097E22AATTGGGCCCAGTANONE 
Os08g0558000J080005K14TCCGGCCCAAAAGGCCCAGTANONE 
Os09g0287500006-102-A02CCAGCCCAGTAACAGCCCAATNONE 
AK059944CCAGCCCAGTAACAGCCCAATProtein of unknown function DUF565 family protein. 
Os09g0293900Os09g0293900TCGGCCCAGTAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0434200AK062015GGACGGCCCAGTANONE 
AK103447GGACGGCCCAGTAZinc finger, RING-type domain containing protein. 
Os09g0479100012-013-H04TACTGGGCCTTNONE 
AK063439TACTGGGCCTTCyclin-like F-box domain containing protein. 
J065042M05TACTGGGCCTTNONE 
J065048D23TACTGGGCCTTNONE 
J065048E20TACTGGGCCTTNONE 
J065097H24TACTGGGCCTTNONE 
J065156P09TACTGGGCCTTNONE 
J065160M11TACTGGGCCTTNONE 
J065209A11TACTGGGCCTTNONE 
J075010M19TACTGGGCCTTNONE 
J075021B22TACTGGGCCTTNONE 
J075033A10TACTGGGCCTTNONE 
J075046B05TACTGGGCCTTNONE 
J075064A21TACTGGGCCTTNONE 
J075083B22TACTGGGCCTTNONE 
J075097F21TACTGGGCCTTNONE 
J075107K10TACTGGGCCTTNONE 
J075108C05TACTGGGCCTTNONE 
J075148C06TACTGGGCCTTNONE 
J075154D09TACTGGGCCTTNONE 
J075196M02TACTGGGCCTTNONE 
J090016F05TACTGGGCCTTNONE 
Os09g0567000012-071-E09TACTGGGCCTCNONE 
013-099-E05TACTGGGCCTCNONE 
AK065613TACTGGGCCTCConserved hypothetical protein. 
J013026M04TACTGGGCCTCNONE 
J023103F04TACTGGGCCTCNONE 
J033119N04TACTGGGCCTCNONE 
J065011I19TACTGGGCCTCNONE 
J065042A10TACTGGGCCTCNONE 
J100023F16TACTGGGCCTCNONE 
Os09g0568000AK068829TACTGGGCTGGGCTTGNONE 
Os11g0132700AK103286TCGGCCCAGTACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0140300009-175-B06GCCCAGTANONE 
AK063105GCCCAGTAConserved hypothetical protein. 
Os11g0183700006-030-G09TACTGGGCNONE 
AK061734TACTGGGCNONE 
Os11g0501500AK109874TACTGGGCConserved hypothetical protein. 
Os11g0593100AK070035TAAGCCCAGTAProtein of unknown function DUF295 family protein. 
J023038E14TAAGCCCAGTANONE 
J100062C21TAAGCCCAGTANONE 
Os12g0131300J090086B06TCGGCCCAGTAHypothetical protein. 
Os12g0556100J065083C21TACTGGGCCTCDrought induced 19 family protein. 
J065124M18TACTGGGCCTCNONE 
J100032P22TACTGGGCCTCNONE 
J100048N01TACTGGGCCTCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.