version

Summary of OsREG605 (All List)

OrganismOryza sativa  
IDOsREG605  
SequenceGCCCATAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1270  

Entry Sequences (1270 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087TAGGCCCACAGAAGCCCATAANONE 
AK103808TAGGCCCACAGAAGCCCATAAC-type lectin domain containing protein. 
Os01g0104100AK072797TTATGGGCTTCTGTGGGCCTAZinc finger, RING-type domain containing protein. 
AK104280TTATGGGCTTCTGTGGGCCTANONE 
Os01g0104400006-026-B08TTATGGGCCGTGGNONE 
006-030-C01TTATGGGCCGTGGNONE 
006-055-E02TTATGGGCCGTGGNONE 
006-061-B12TTATGGGCCGTGGNONE 
006-064-F06TTATGGGCCGTGGNONE 
006-078-G10TTATGGGCCGTGGNONE 
006-079-G09TTATGGGCCGTGGNONE 
006-080-B08TTATGGGCCGTGGNONE 
006-100-E07TTATGGGCCGTGGNONE 
006-110-E01TTATGGGCCGTGGNONE 
006-118-D10TTATGGGCCGTGGNONE 
006-120-C12TTATGGGCCGTGGNONE 
AK060132TTATGGGCCGTGGNONE 
AK071375TTATGGGCCGTGGRicin B-related lectin domain containing protein. 
AK104555TTATGGGCCGTGGNONE 
AK104820TTATGGGCCGTGGNONE 
J023121J21TTATGGGCCGTGGNONE 
Os01g0191800AK061360AGCCCATAAAGGCCCACCTNONE 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0242200AK107468TTATGGGCTZinc finger, C2H2-type domain containing protein. 
Os01g0303100009-049-H10TTATGGGCCATATGGGCCAANONE 
AK062603TTATGGGCCATATGGGCCAASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0306100AK111041TTATGGGCCGAGAPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0316800009-188-E08ACCGGCCCATAANONE 
AK058821ACCGGCCCATAANONE 
AK119788ACCGGCCCATAASimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09ACCGGCCCATAANONE 
J065102J21ACCGGCCCATAANONE 
J065173M10ACCGGCCCATAANONE 
J075066K08ACCGGCCCATAANONE 
J080302B04ACCGGCCCATAANONE 
J080310P14ACCGGCCCATAANONE 
J080311I23ACCGGCCCATAANONE 
J080319N12ACCGGCCCATAANONE 
J100024D14ACCGGCCCATAANONE 
J100055N12ACCGGCCCATAANONE 
Os01g0328400006-092-H09GAAGCCCATAANONE 
009-085-A02GAAGCCCATAANONE 
012-078-B03GAAGCCCATAANONE 
AK061988GAAGCCCATAAUbiquitin. 
J013073B13GAAGCCCATAANONE 
J023135L09GAAGCCCATAANONE 
J023135O07GAAGCCCATAANONE 
J033027B12GAAGCCCATAANONE 
J033084P17GAAGCCCATAANONE 
J065010M05GAAGCCCATAANONE 
J065021N11GAAGCCCATAANONE 
J065021N12GAAGCCCATAANONE 
J065031K11GAAGCCCATAANONE 
J065072P04GAAGCCCATAANONE 
J065098D05GAAGCCCATAANONE 
J065122N23GAAGCCCATAANONE 
J065129L13GAAGCCCATAANONE 
J065135N13GAAGCCCATAANONE 
J065215N10GAAGCCCATAANONE 
J075120N22GAAGCCCATAANONE 
J090011G23GAAGCCCATAANONE 
J090014F06GAAGCCCATAANONE 
J090040G23GAAGCCCATAANONE 
J090075I20GAAGCCCATAANONE 
J090075N01GAAGCCCATAANONE 
J090089B04GAAGCCCATAANONE 
J090090F08GAAGCCCATAANONE 
J090091M17GAAGCCCATAANONE 
J090094L03GAAGCCCATAANONE 
J090099L06GAAGCCCATAANONE 
J100018A18GAAGCCCATAANONE 
J100027H13GAAGCCCATAANONE 
J100069C05GAAGCCCATAANONE 
J100086L10GAAGCCCATAANONE 
Os01g0379400016-006-B06TTATGGGCNONE 
AK064420TTATGGGCNONE 
AK102388TTATGGGCNONE 
AK110939TTATGGGCCyclin-like F-box domain containing protein. 
J033092D18TTATGGGCNONE 
J065070N09TTATGGGCNONE 
J065078L01TTATGGGCNONE 
J065083G15TTATGGGCNONE 
Os01g0764300J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0772900011-075-G09GCCCATAANONE 
012-036-F01GCCCATAANONE 
AK073362GCCCATAASimilar to Homocysteine S-methyltransferase 4 (EC 2.1.1.10) (S- methylmethionine:homocysteine methyltransferase 4) (SMM:Hcy S- methyltransferase 4) (ZmHMT-4). 
AK104962GCCCATAANONE 
J065037B16GCCCATAANONE 
J065037K23GCCCATAANONE 
J065079D01GCCCATAANONE 
J065104G12GCCCATAANONE 
J065156B20GCCCATAANONE 
J065167M15GCCCATAANONE 
J065208K17GCCCATAANONE 
J075076H13GCCCATAANONE 
J075078M13GCCCATAANONE 
J075093L21GCCCATAANONE 
J075124L10GCCCATAANONE 
Os01g0811100006-061-F11TTATGGGCTCGTGGACCNONE 
AB026562TTATGGGCTCGTGGACCNONE 
AK061784TTATGGGCTCGTGGACCNONE 
AK103541TTATGGGCTCGTGGACCProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
J013020B12TTATGGGCTCGTGGACCNONE 
J013022J21TTATGGGCTCGTGGACCNONE 
J013056G19TTATGGGCTCGTGGACCNONE 
J013060O07TTATGGGCTCGTGGACCNONE 
J013110I07TTATGGGCTCGTGGACCNONE 
J013160D19TTATGGGCTCGTGGACCNONE 
J090035A13TTATGGGCTCGTGGACCNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0847700AK103729GCCCATAATGGGCTGTSimilar to Aldose reductase. 
J033031B19GCCCATAATGGGCTGTNONE 
J065110K09GCCCATAATGGGCTGTNONE 
J065135H06GCCCATAATGGGCTGTNONE 
J075015H10GCCCATAATGGGCTGTNONE 
Os01g0874800016-042-F01AAATGGGCTTTTGGCCCATAANONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK119315AAATGGGCTTTTGGCCCATAANONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
Os01g0888700AK073376GAGGCCCATAAProtein of unknown function RIO1 family protein. 
J033030B16GAGGCCCATAANONE 
J033098D06GAGGCCCATAANONE 
J033112A12GAGGCCCATAANONE 
J043003L24GAGGCCCATAANONE 
Os01g0960300AK100099TTATGGGCCTTSimilar to Glucose inhibited division protein A. 
Os02g0136800011-089-E11TTATGGGCCTANONE 
AK070727TTATGGGCCTANONE 
AK103485TTATGGGCCTAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10TTATGGGCCTANONE 
J033140H14TTATGGGCCTANONE 
J033142H14TTATGGGCCTANONE 
J065151O09TTATGGGCCTANONE 
J090076K09TTATGGGCCTANONE 
J090085K04TTATGGGCCTANONE 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCAGCCCATAANONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCAGCCCATAANONE 
Os02g0178400009-151-B08TTGGCCCACGAGGCCCATAANONE 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
AK121516TTGGCCCACGAGGCCCATAANONE 
J033026A17TTGGCCCACGAGGCCCATAANONE 
J065011K14TTGGCCCACGAGGCCCATAANONE 
J065056D01TTGGCCCACGAGGCCCATAANONE 
J065061L22TTGGCCCACGAGGCCCATAANONE 
J065076M01TTGGCCCACGAGGCCCATAANONE 
J075092E14TTGGCCCACGAGGCCCATAANONE 
Os02g0188000011-003-E06AGCCCATAANONE 
AK105236AGCCCATAAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os02g0230200AK105482TTATGGGCCGCConserved hypothetical protein. 
Os02g0467200014-053-H06GAAGCCCATAANONE 
AK063704GAAGCCCATAAConserved hypothetical protein. 
J065197J05GAAGCCCATAANONE 
Os02g0505500AK073398GCCCATAAConserved hypothetical protein. 
J033045F02GCCCATAANONE 
Os02g0591800AK060611TCGGCCCATAABrix domain containing protein. 
AK102534TCGGCCCATAANONE 
J075057H08TCGGCCCATAANONE 
J075179P18TCGGCCCATAANONE 
J080011H01TCGGCCCATAANONE 
J080018E14TCGGCCCATAANONE 
J080026N17TCGGCCCATAANONE 
J080047A13TCGGCCCATAANONE 
J080049C17TCGGCCCATAANONE 
J080050G07TCGGCCCATAANONE 
J080064D10TCGGCCCATAANONE 
J080080A03TCGGCCCATAANONE 
J080080G20TCGGCCCATAANONE 
J080080I03TCGGCCCATAANONE 
J080081H12TCGGCCCATAANONE 
J080090K07TCGGCCCATAANONE 
J080092O06TCGGCCCATAANONE 
J080096B07TCGGCCCATAANONE 
J080097M08TCGGCCCATAANONE 
Os02g0629900AK108563TAAGCCCATAAConserved hypothetical protein. 
J065138O07TAAGCCCATAANONE 
Os02g0643500AK068423AAGGCCCATAAPentapeptide repeat containing protein. 
Os02g0661300016-077-C09AAATGGGCCAGCCCATAANONE 
AK106503AAATGGGCCAGCCCATAAConserved hypothetical protein. 
Os02g0689200011-024-D04ATGGCCCATAANONE 
AK071254ATGGCCCATAANONE 
AK072660ATGGCCCATAAProtein of unknown function DUF250 domain containing protein. 
J023087G23ATGGCCCATAANONE 
J023134O11ATGGCCCATAANONE 
J033095E21ATGGCCCATAANONE 
J033113F12ATGGCCCATAANONE 
J033124F02ATGGCCCATAANONE 
J065070A01ATGGCCCATAANONE 
J065129C05ATGGCCCATAANONE 
J065165M19ATGGCCCATAANONE 
J090015K07ATGGCCCATAANONE 
J090066D21ATGGCCCATAANONE 
J090075M20ATGGCCCATAANONE 
Os02g0700100AK102954AAAGCCCATAAAGCCCAGCSimilar to WD-repeat protein. 
Os02g0717100014-089-G06TTATGGGCCCAGATNONE 
AK063741TTATGGGCCCAGATEsterase/lipase/thioesterase domain containing protein. 
J065052A22TTATGGGCCCAGATNONE 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
J013099D16AAGGCCCATAAAAGCCCAACNONE 
Os02g0762300AK106684CAGGCCCATAAProtein of unknown function UPF0021 family protein. 
J090060M09CAGGCCCATAANONE 
J100083E05CAGGCCCATAANONE 
Os02g0767900009-154-G01TTTTGGGCCCATAANONE 
009-172-H09TTTTGGGCCCATAANONE 
AK099885TTTTGGGCCCATAAGlutaredoxin 2 family protein. 
Os02g0771200011-006-B07GCCGGCCCATAANONE 
AK066823GCCGGCCCATAAConserved hypothetical protein. 
AK071059GCCGGCCCATAANONE 
J013075K03GCCGGCCCATAANONE 
Os02g0772500AK100349TTATGGGCTGAProtein prenyltransferase domain containing protein. 
J023082M21TTATGGGCTGANONE 
J065047H11TTATGGGCTGANONE 
J065055F20TTATGGGCTGANONE 
J065082I22TTATGGGCTGANONE 
J100074B04TTATGGGCTGANONE 
Os02g0777950J090078H24AAACGGCCCATAAConserved hypothetical protein. 
Os02g0810300AK059363CCAGGCCCATAASimilar to NBD-like protein. 
AK099203CCAGGCCCATAANONE 
Os02g0816700009-132-E07TTATGGGCTNONE 
009-132-E07TTATGGGCTNONE 
AK059572TTATGGGCTConserved hypothetical protein. 
AK059572TTATGGGCTConserved hypothetical protein. 
Os02g0816800013-089-A09AGCCCATAANONE 
013-089-A09AGCCCATAANONE 
AK102271AGCCCATAANAD-dependent epimerase/dehydratase family protein. 
AK102271AGCCCATAANAD-dependent epimerase/dehydratase family protein. 
J013105O04AGCCCATAANONE 
J013105O04AGCCCATAANONE 
J013124I08AGCCCATAANONE 
J013124I08AGCCCATAANONE 
J023002E08AGCCCATAANONE 
J023002E08AGCCCATAANONE 
J023025C01AGCCCATAANONE 
J023025C01AGCCCATAANONE 
J023037O12AGCCCATAANONE 
J023037O12AGCCCATAANONE 
J023049N06AGCCCATAANONE 
J023049N06AGCCCATAANONE 
J023069G18AGCCCATAANONE 
J023069G18AGCCCATAANONE 
J033029M02AGCCCATAANONE 
J033029M02AGCCCATAANONE 
J033037L22AGCCCATAANONE 
J033037L22AGCCCATAANONE 
J033089A08AGCCCATAANONE 
J033089A08AGCCCATAANONE 
J033103L07AGCCCATAANONE 
J033103L07AGCCCATAANONE 
J033125L19AGCCCATAANONE 
J033125L19AGCCCATAANONE 
J090008N20AGCCCATAANONE 
J090008N20AGCCCATAANONE 
J090041F23AGCCCATAANONE 
J090041F23AGCCCATAANONE 
J090092H16AGCCCATAANONE 
J090092H16AGCCCATAANONE 
Os03g0104000AK063829TTATGGGCCTGSimilar to Centromere protein. 
Os03g0108600AK065776CAGGCCCATAADEAD/DEAH box helicase, N-terminal domain containing protein. 
J013038N14CAGGCCCATAANONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0128100003-107-E07TTATGGGCTTCNONE 
AK062279TTATGGGCTTCSimilar to Callose synthase 1 catalytic subunit. 
AK105008TTATGGGCTTCNONE 
Os03g0128500AB037900TTATGGGCCTGANONE 
AK067991TTATGGGCCTGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04TTATGGGCCTGANONE 
J090032P09TTATGGGCCTGANONE 
Os03g0135600J065183G03TTATGGGCTTCAnkyrin repeat containing protein. 
Os03g0181600AK067807TCCGGCCCATAASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TCCGGCCCATAANONE 
Os03g0276800015-062-A05TTATGGGCTTGNONE 
AK106371TTATGGGCTTGHeat shock protein Hsp70 family protein. 
Os03g0305400009-198-D04GCCCATAANONE 
013-012-C06GCCCATAANONE 
014-034-D01GCCCATAANONE 
AK071397GCCCATAAUniversal stress protein (Usp) family protein. 
J023012O22GCCCATAANONE 
J023097A13GCCCATAANONE 
J023107P16GCCCATAANONE 
J023113C14GCCCATAANONE 
Os03g0332700AK072820AAACGGCCCATAASimilar to ABC Transporter, ATP binding component. 
AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0337600AF119232AGGGCCCATAANONE 
AK070859AGGGCCCATAASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18AGGGCCCATAANONE 
J013147M17AGGGCCCATAANONE 
J065083M01AGGGCCCATAANONE 
J065199H24AGGGCCCATAANONE 
Os03g0379500AK064760TAGGCCCATAASimilar to 40S ribosomal protein S9. 
J080024D11TAGGCCCATAANONE 
J080044J02TAGGCCCATAANONE 
J080050F01TAGGCCCATAANONE 
J080063D21TAGGCCCATAANONE 
J080063G04TAGGCCCATAANONE 
J080078E02TAGGCCCATAANONE 
Os03g0598900J053098D07TTATGGGCTNONE 
J065063O13TTATGGGCTDSBA oxidoreductase family protein. 
Os03g0670700009-028-B03GCGGCCCATAANONE 
009-036-H12GCGGCCCATAANONE 
009-053-H05GCGGCCCATAANONE 
009-126-B02GCGGCCCATAANONE 
009-135-D07GCGGCCCATAANONE 
009-148-A03GCGGCCCATAANONE 
009-148-A12GCGGCCCATAANONE 
009-152-B02GCGGCCCATAANONE 
009-153-B06GCGGCCCATAANONE 
009-166-G05GCGGCCCATAANONE 
009-181-A09GCGGCCCATAANONE 
011-061-D07GCGGCCCATAANONE 
012-043-C04GCGGCCCATAANONE 
013-001-A02GCGGCCCATAANONE 
013-004-F05GCGGCCCATAANONE 
013-008-C08GCGGCCCATAANONE 
013-015-B09GCGGCCCATAANONE 
013-016-G05GCGGCCCATAANONE 
013-023-A06GCGGCCCATAANONE 
013-023-B06GCGGCCCATAANONE 
013-032-F09GCGGCCCATAANONE 
013-059-C07GCGGCCCATAANONE 
013-071-E09GCGGCCCATAANONE 
013-073-D06GCGGCCCATAANONE 
013-077-C02GCGGCCCATAANONE 
013-078-B12GCGGCCCATAANONE 
013-093-A01GCGGCCCATAANONE 
014-002-B12GCGGCCCATAANONE 
014-003-E08GCGGCCCATAANONE 
014-004-D06GCGGCCCATAANONE 
014-007-C11GCGGCCCATAANONE 
014-007-G10GCGGCCCATAANONE 
014-019-C04GCGGCCCATAANONE 
014-021-F05GCGGCCCATAANONE 
014-024-G06GCGGCCCATAANONE 
014-027-C07GCGGCCCATAANONE 
014-027-D03GCGGCCCATAANONE 
014-029-E07GCGGCCCATAANONE 
014-031-B04GCGGCCCATAANONE 
014-033-B05GCGGCCCATAANONE 
014-033-C03GCGGCCCATAANONE 
014-033-C12GCGGCCCATAANONE 
014-036-F01GCGGCCCATAANONE 
014-037-C04GCGGCCCATAANONE 
014-040-H02GCGGCCCATAANONE 
014-045-H04GCGGCCCATAANONE 
014-045-H06GCGGCCCATAANONE 
014-052-A08GCGGCCCATAANONE 
014-076-G01GCGGCCCATAANONE 
014-083-F04GCGGCCCATAANONE 
014-086-E01GCGGCCCATAANONE 
014-091-D02GCGGCCCATAANONE 
014-091-F05GCGGCCCATAANONE 
014-093-E10GCGGCCCATAANONE 
014-100-C10GCGGCCCATAANONE 
015-011-H02GCGGCCCATAANONE 
015-073-B03GCGGCCCATAANONE 
AF010579GCGGCCCATAANONE 
AK059164GCGGCCCATAASimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCGGCCCATAANONE 
AK119238GCGGCCCATAANONE 
AK119242GCGGCCCATAANONE 
J023037K17GCGGCCCATAANONE 
J033136F11GCGGCCCATAANONE 
J065008C13GCGGCCCATAANONE 
J065032K18GCGGCCCATAANONE 
J065043N10GCGGCCCATAANONE 
J065045E06GCGGCCCATAANONE 
J065046P21GCGGCCCATAANONE 
J065048J17GCGGCCCATAANONE 
J065053I23GCGGCCCATAANONE 
J065053P03GCGGCCCATAANONE 
J065054C13GCGGCCCATAANONE 
J065058I17GCGGCCCATAANONE 
J065061I12GCGGCCCATAANONE 
J065062E09GCGGCCCATAANONE 
J065063P04GCGGCCCATAANONE 
J065068J07GCGGCCCATAANONE 
J065076D02GCGGCCCATAANONE 
J065083O07GCGGCCCATAANONE 
J065090J02GCGGCCCATAANONE 
J065093N08GCGGCCCATAANONE 
J065097F02GCGGCCCATAANONE 
J065112H17GCGGCCCATAANONE 
J065121B01GCGGCCCATAANONE 
J065124F12GCGGCCCATAANONE 
J065130L03GCGGCCCATAANONE 
J065131K05GCGGCCCATAANONE 
J065132C06GCGGCCCATAANONE 
J065135J18GCGGCCCATAANONE 
J065138J22GCGGCCCATAANONE 
J065140G21GCGGCCCATAANONE 
J065161B19GCGGCCCATAANONE 
J065162F22GCGGCCCATAANONE 
J065162M09GCGGCCCATAANONE 
J065163D03GCGGCCCATAANONE 
J065163O21GCGGCCCATAANONE 
J065165H11GCGGCCCATAANONE 
J065165O16GCGGCCCATAANONE 
J065167N06GCGGCCCATAANONE 
J065168I08GCGGCCCATAANONE 
J065170A14GCGGCCCATAANONE 
J065170L03GCGGCCCATAANONE 
J065171C08GCGGCCCATAANONE 
J065173G11GCGGCCCATAANONE 
J065173M09GCGGCCCATAANONE 
J065176P07GCGGCCCATAANONE 
J065178K24GCGGCCCATAANONE 
J065185O12GCGGCCCATAANONE 
J065191E02GCGGCCCATAANONE 
J065204H10GCGGCCCATAANONE 
J075033C23GCGGCCCATAANONE 
J075041M21GCGGCCCATAANONE 
J075043F13GCGGCCCATAANONE 
J075044D02GCGGCCCATAANONE 
J075044J15GCGGCCCATAANONE 
J075048L07GCGGCCCATAANONE 
J075054G12GCGGCCCATAANONE 
J075055J10GCGGCCCATAANONE 
J075059F09GCGGCCCATAANONE 
J075066M23GCGGCCCATAANONE 
J075071O09GCGGCCCATAANONE 
J075085G23GCGGCCCATAANONE 
J075086B21GCGGCCCATAANONE 
J075087L18GCGGCCCATAANONE 
J075087L21GCGGCCCATAANONE 
J075087N14GCGGCCCATAANONE 
J075088O13GCGGCCCATAANONE 
J075089B06GCGGCCCATAANONE 
J075089E20GCGGCCCATAANONE 
J075090J01GCGGCCCATAANONE 
J075090L05GCGGCCCATAANONE 
J075091G05GCGGCCCATAANONE 
J075091N06GCGGCCCATAANONE 
J075093G08GCGGCCCATAANONE 
J075094C13GCGGCCCATAANONE 
J075095K01GCGGCCCATAANONE 
J075096C02GCGGCCCATAANONE 
J075097L16GCGGCCCATAANONE 
J075097O10GCGGCCCATAANONE 
J075098H24GCGGCCCATAANONE 
J075099H02GCGGCCCATAANONE 
J075099J11GCGGCCCATAANONE 
J075099L08GCGGCCCATAANONE 
J075109I11GCGGCCCATAANONE 
J075114F03GCGGCCCATAANONE 
J075121G07GCGGCCCATAANONE 
J075122D23GCGGCCCATAANONE 
J075132O07GCGGCCCATAANONE 
J075141L21GCGGCCCATAANONE 
J075142I08GCGGCCCATAANONE 
J075145A06GCGGCCCATAANONE 
J075147J15GCGGCCCATAANONE 
J075150B09GCGGCCCATAANONE 
J075151E07GCGGCCCATAANONE 
J075161M16GCGGCCCATAANONE 
J075190I16GCGGCCCATAANONE 
J075192L05GCGGCCCATAANONE 
J075192O03GCGGCCCATAANONE 
J075192O08GCGGCCCATAANONE 
J075193L12GCGGCCCATAANONE 
J080001M24GCGGCCCATAANONE 
J080004E20GCGGCCCATAANONE 
J080005K15GCGGCCCATAANONE 
J080005L05GCGGCCCATAANONE 
J080014P20GCGGCCCATAANONE 
J080029D12GCGGCCCATAANONE 
J080030H09GCGGCCCATAANONE 
J080039G05GCGGCCCATAANONE 
J080040E18GCGGCCCATAANONE 
J080041B02GCGGCCCATAANONE 
J080041E06GCGGCCCATAANONE 
J080041G05GCGGCCCATAANONE 
J080041G24GCGGCCCATAANONE 
J080041H07GCGGCCCATAANONE 
J080041K03GCGGCCCATAANONE 
J080047G01GCGGCCCATAANONE 
J080052E07GCGGCCCATAANONE 
J080053B15GCGGCCCATAANONE 
J080053N01GCGGCCCATAANONE 
J080054I01GCGGCCCATAANONE 
J080054N02GCGGCCCATAANONE 
J080063P03GCGGCCCATAANONE 
J080064E13GCGGCCCATAANONE 
J080064G13GCGGCCCATAANONE 
J080065F02GCGGCCCATAANONE 
J080065G03GCGGCCCATAANONE 
J080065K17GCGGCCCATAANONE 
J080067D06GCGGCCCATAANONE 
J080067H23GCGGCCCATAANONE 
J080067M15GCGGCCCATAANONE 
J080068B20GCGGCCCATAANONE 
J080068G24GCGGCCCATAANONE 
J080072K19GCGGCCCATAANONE 
J080076I24GCGGCCCATAANONE 
J080092F05GCGGCCCATAANONE 
J080092K14GCGGCCCATAANONE 
J080092N22GCGGCCCATAANONE 
J080093K02GCGGCCCATAANONE 
J080094C08GCGGCCCATAANONE 
J080094E09GCGGCCCATAANONE 
J080094E20GCGGCCCATAANONE 
J080094G08GCGGCCCATAANONE 
J080094H18GCGGCCCATAANONE 
J080094P22GCGGCCCATAANONE 
J080095J23GCGGCCCATAANONE 
J080096F14GCGGCCCATAANONE 
J080097A21GCGGCCCATAANONE 
J080097I07GCGGCCCATAANONE 
J080097J02GCGGCCCATAANONE 
J080097K01GCGGCCCATAANONE 
J080097K03GCGGCCCATAANONE 
J080305H18GCGGCCCATAANONE 
J080306G01GCGGCCCATAANONE 
J080306O08GCGGCCCATAANONE 
J080311I01GCGGCCCATAANONE 
J080315N24GCGGCCCATAANONE 
J090003K21GCGGCCCATAANONE 
J090008C20GCGGCCCATAANONE 
J090008K19GCGGCCCATAANONE 
J090008P13GCGGCCCATAANONE 
J090015H22GCGGCCCATAANONE 
J090016M01GCGGCCCATAANONE 
J090018E13GCGGCCCATAANONE 
J090018G03GCGGCCCATAANONE 
J090018L17GCGGCCCATAANONE 
J090019H11GCGGCCCATAANONE 
J090021B19GCGGCCCATAANONE 
J090021K02GCGGCCCATAANONE 
J090023H15GCGGCCCATAANONE 
J090034E03GCGGCCCATAANONE 
J090045D16GCGGCCCATAANONE 
J090045I06GCGGCCCATAANONE 
J090047L09GCGGCCCATAANONE 
J090048B05GCGGCCCATAANONE 
J090048D11GCGGCCCATAANONE 
J090048N11GCGGCCCATAANONE 
J090050F20GCGGCCCATAANONE 
J090052M20GCGGCCCATAANONE 
J090083H03GCGGCCCATAANONE 
J090084C12GCGGCCCATAANONE 
J090095B05GCGGCCCATAANONE 
J090095M18GCGGCCCATAANONE 
J100024I22GCGGCCCATAANONE 
J100024J12GCGGCCCATAANONE 
J100024J22GCGGCCCATAANONE 
J100025F07GCGGCCCATAANONE 
J100026B13GCGGCCCATAANONE 
J100027N03GCGGCCCATAANONE 
J100029F14GCGGCCCATAANONE 
J100029L20GCGGCCCATAANONE 
J100032C22GCGGCCCATAANONE 
J100032I08GCGGCCCATAANONE 
J100032O05GCGGCCCATAANONE 
J100033J24GCGGCCCATAANONE 
J100033L12GCGGCCCATAANONE 
J100034K06GCGGCCCATAANONE 
J100037D09GCGGCCCATAANONE 
J100038H02GCGGCCCATAANONE 
J100039A12GCGGCCCATAANONE 
J100039N12GCGGCCCATAANONE 
J100039O21GCGGCCCATAANONE 
J100040K05GCGGCCCATAANONE 
J100042A02GCGGCCCATAANONE 
J100042A17GCGGCCCATAANONE 
J100043C15GCGGCCCATAANONE 
J100044A17GCGGCCCATAANONE 
J100044E18GCGGCCCATAANONE 
J100044I11GCGGCCCATAANONE 
J100044J15GCGGCCCATAANONE 
J100045E23GCGGCCCATAANONE 
J100049B18GCGGCCCATAANONE 
J100050G04GCGGCCCATAANONE 
J100051D06GCGGCCCATAANONE 
J100051H20GCGGCCCATAANONE 
J100052J01GCGGCCCATAANONE 
J100052K07GCGGCCCATAANONE 
J100055I01GCGGCCCATAANONE 
J100057D02GCGGCCCATAANONE 
J100059G14GCGGCCCATAANONE 
J100059G21GCGGCCCATAANONE 
J100059H03GCGGCCCATAANONE 
J100059H15GCGGCCCATAANONE 
J100063E13GCGGCCCATAANONE 
J100063M02GCGGCCCATAANONE 
J100064B17GCGGCCCATAANONE 
J100064F11GCGGCCCATAANONE 
J100066G12GCGGCCCATAANONE 
J100066H09GCGGCCCATAANONE 
J100068B12GCGGCCCATAANONE 
J100068L16GCGGCCCATAANONE 
J100068M23GCGGCCCATAANONE 
J100069A02GCGGCCCATAANONE 
J100069D07GCGGCCCATAANONE 
J100069M13GCGGCCCATAANONE 
J100070C07GCGGCCCATAANONE 
J100070J11GCGGCCCATAANONE 
J100070L20GCGGCCCATAANONE 
J100071H10GCGGCCCATAANONE 
J100072L14GCGGCCCATAANONE 
J100072N12GCGGCCCATAANONE 
J100073A21GCGGCCCATAANONE 
J100074K17GCGGCCCATAANONE 
J100074M04GCGGCCCATAANONE 
J100075F11GCGGCCCATAANONE 
J100076E23GCGGCCCATAANONE 
J100076G03GCGGCCCATAANONE 
J100077K01GCGGCCCATAANONE 
J100077N23GCGGCCCATAANONE 
J100079H17GCGGCCCATAANONE 
J100081N01GCGGCCCATAANONE 
J100082E04GCGGCCCATAANONE 
J100082K11GCGGCCCATAANONE 
J100085H23GCGGCCCATAANONE 
J100086O18GCGGCCCATAANONE 
J100087F21GCGGCCCATAANONE 
J100088E02GCGGCCCATAANONE 
J100088F08GCGGCCCATAANONE 
J100088G24GCGGCCCATAANONE 
J100088K20GCGGCCCATAANONE 
J100089B19GCGGCCCATAANONE 
J100089K22GCGGCCCATAANONE 
J100089N22GCGGCCCATAANONE 
J100089O17GCGGCCCATAANONE 
J100090N05GCGGCCCATAANONE 
Os03g0743200J065049G14GCGGCCCATAANONE 
J065158O18GCGGCCCATAANONE 
Os03g0752700011-093-A02AAAAGCCCATAANONE 
AK122157AAAAGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03AAAAGCCCATAANONE 
J033096O19AAAAGCCCATAANONE 
J033145P19AAAAGCCCATAANONE 
J065008K09AAAAGCCCATAANONE 
J065027J08AAAAGCCCATAANONE 
J065073H12AAAAGCCCATAANONE 
J065078G14AAAAGCCCATAANONE 
J065092L12AAAAGCCCATAANONE 
J065108D11AAAAGCCCATAANONE 
J065140G10AAAAGCCCATAANONE 
J065161D24AAAAGCCCATAANONE 
J065170F04AAAAGCCCATAANONE 
J075004K20AAAAGCCCATAANONE 
J075069F16AAAAGCCCATAANONE 
J075085B12AAAAGCCCATAANONE 
J075087D24AAAAGCCCATAANONE 
J075102G15AAAAGCCCATAANONE 
J075123M06AAAAGCCCATAANONE 
J090058D24AAAAGCCCATAANONE 
J090068I12AAAAGCCCATAANONE 
J090094A19AAAAGCCCATAANONE 
Os03g0766000AK070596TTATGGGCCATNONE 
AK104743TTATGGGCCATNONE 
AK106079TTATGGGCCATNONE 
J013063M09TTATGGGCCATNONE 
J023056A03TTATGGGCCATNONE 
J043038L07TTATGGGCCATNONE 
J053067N16TTATGGGCCATNONE 
J053073G09TTATGGGCCATNONE 
J053075I19TTATGGGCCATNONE 
Os03g0784000AK067337TTATGGGCCAANONE 
AK100003TTATGGGCCAAFAD dependent oxidoreductase family protein. 
J013102O14TTATGGGCCAANONE 
J013135F18TTATGGGCCAANONE 
Os03g0821900AK070847AGCCCATAASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0828100009-088-D04TTATGGGCCCTNONE 
009-125-F01TTATGGGCCCTNONE 
009-169-C06TTATGGGCCCTNONE 
AK059132TTATGGGCCCTNONE 
AK062799TTATGGGCCCTNONE 
AK099043TTATGGGCCCTSimilar to 50S ribosomal protein L18. 
J013146D01TTATGGGCCCTNONE 
J065057J16TTATGGGCCCTNONE 
Os03g0829000AK071107TTATGGGCCGTAFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTATGGGCCGTANONE 
AK121596TTATGGGCCGTANONE 
J065045C17TTATGGGCCGTANONE 
J065068E23TTATGGGCCGTANONE 
J065083N15TTATGGGCCGTANONE 
J065166P10TTATGGGCCGTANONE 
J065189B13TTATGGGCCGTANONE 
J090082J08TTATGGGCCGTANONE 
J100030P13TTATGGGCCGTANONE 
Os03g0856200009-070-B07TTATGGGCTGTNONE 
009-135-H05TTATGGGCTGTNONE 
J100067D22TTATGGGCTGTNONE 
J100067L13TTATGGGCTGTNONE 
J100073I07TTATGGGCTGTNONE 
J100080D01TTATGGGCTGTNONE 
Os04g0381000AK105435CCAGCCCATAADynamin family protein. 
J075003I06CCAGCCCATAANONE 
Os04g0398000AK101501GCCCATAAPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0581300009-171-H01ATGGCCCATAAGGCCCAACANONE 
009-171-H01GCCCATAANONE 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK063093GCCCATAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0584100012-063-E01CACGGCCCATAANONE 
AK105292CACGGCCCATAAConserved hypothetical protein. 
Os04g0604200013-087-H05CCAGCCCATAANONE 
AK063614CCAGCCCATAASimilar to Xyloglucan endotransglycosylase (Fragment). 
Os04g0607200J065082C16TTATGGGCCTTNONE 
J065167I02TTATGGGCCTTNONE 
Os04g0636000015-046-E08AGCCCATAAGGCCCGCANONE 
AK065639AGCCCATAAGGCCCGCASPla/RYanodine receptor SPRY domain containing protein. 
AK099615AGCCCATAAGGCCCGCANONE 
Os04g0667000AK069874CCAGCCCATAATafazzin family protein. 
J100055P09CCAGCCCATAANONE 
J100057O12CCAGCCCATAANONE 
J100067H07CCAGCCCATAANONE 
J100070D06CCAGCCCATAANONE 
J100071J16CCAGCCCATAANONE 
J100072C15CCAGCCCATAANONE 
Os04g0687300AK060617TGCGGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04TGCGGCCCATAANONE 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0144800AK099724ATGGCCCATAASimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0176600009-151-A09TTATGGGCCGAANONE 
AK071760TTATGGGCCGAAConserved hypothetical protein. 
J023110C14TTATGGGCCGAANONE 
J065116G18TTATGGGCCGAANONE 
J065131I04TTATGGGCCGAANONE 
J065163H12TTATGGGCCGAANONE 
J075088L08TTATGGGCCGAANONE 
J075165F17TTATGGGCCGAANONE 
Os05g0177100AK064652CCAGGCCCATAAConserved hypothetical protein. 
Os05g0244600009-176-H11TTATGGGCCCAAATGAAGCCCACNONE 
AK073979TTATGGGCCCAAATGAAGCCCACNucleic acid-binding, OB-fold domain containing protein. 
J065085L13TTATGGGCCCAAATGAAGCCCACNONE 
J065086F22TTATGGGCCCAAATGAAGCCCACNONE 
J065124H03TTATGGGCCCAAATGAAGCCCACNONE 
J065170C22TTATGGGCCCAAATGAAGCCCACNONE 
J065197K01TTATGGGCCCAAATGAAGCCCACNONE 
J075110M09TTATGGGCCCAAATGAAGCCCACNONE 
J090074F17TTATGGGCCCAAATGAAGCCCACNONE 
J100071O17TTATGGGCCCAAATGAAGCCCACNONE 
Os05g0304200009-059-H05CTCGGCCCATAANONE 
AK099372CTCGGCCCATAANONE 
AK112073CTCGGCCCATAAPAP fibrillin family protein. 
Os05g0382600006-030-H07GCCCATAANONE 
006-032-A07GCCCATAANONE 
006-042-C10GCCCATAANONE 
006-066-C01GCCCATAANONE 
006-070-B11GCCCATAANONE 
006-090-E12GCCCATAANONE 
006-096-H07GCCCATAANONE 
006-119-A02GCCCATAANONE 
009-195-G10GCCCATAANONE 
009-198-B12GCCCATAANONE 
AK060054GCCCATAANONE 
AK068231GCCCATAAAnnexin family protein. 
AK098879GCCCATAANONE 
AK104639GCCCATAANONE 
J013001F11GCCCATAANONE 
J013123K05GCCCATAANONE 
J013147O19GCCCATAANONE 
J013151M18GCCCATAANONE 
Os05g0393800AK069074GCCCATAAProtein of unknown function DUF221 domain containing protein. 
Os05g0481000AK059369GAGGCCCATAAGCN5-related N-acetyltransferase domain containing protein. 
AK068619GAGGCCCATAANONE 
Os05g0493800AK110589GCCCATAASimilar to MtN21 nodulin protein-like. 
Os05g0494200006-042-H12TTATGGGCNONE 
009-020-F06TTATGGGCNONE 
009-069-C06TTATGGGCNONE 
009-118-B01TTATGGGCNONE 
AK059563TTATGGGCNONE 
AK061025TTATGGGCNONE 
J043031L14TTATGGGCNONE 
J05595TTATGGGCSimilar to Cysteine proteinase inhibitor-II (Oryzacystatin-II). 
J075068F23TTATGGGCNONE 
Os05g0502800016-060-H05CAAGGCCCATAANONE 
AK064242CAAGGCCCATAANONE 
AK065486CAAGGCCCATAANAF1 domain containing protein. 
Os05g0519400AK072976GAGGCCCATAASimilar to N-ethylmaleimide sensitive factor NSF (Fragment). 
Os05g0537200AK121713GCCCATAASimilar to Myosin XI (Fragment). 
Os05g0567500AK073046TTATGGGCCCAGATCACGGCCCGNONE 
AK121133TTATGGGCCCAGATCACGGCCCGDNA glycosylase family protein. 
J023075P20TTATGGGCCCAGATCACGGCCCGNONE 
Os05g0568600009-024-B09TTATGGGCCGTANONE 
AK063781TTATGGGCCGTAProtein of unknown function DUF1645 family protein. 
J080049H14TTATGGGCCGTANONE 
J080062M08TTATGGGCCGTANONE 
J080064I07TTATGGGCCGTANONE 
J080068A12TTATGGGCCGTANONE 
J080086J10TTATGGGCCGTANONE 
Os05g0571400009-019-B04TTATGGGCCGANONE 
009-043-H02TTATGGGCCGANONE 
AK062369TTATGGGCCGAConserved hypothetical protein. 
Os05g0587400AK102121GACGGCCCATAAPrefoldin domain containing protein. 
J033084N12GACGGCCCATAANONE 
Os05g0588200AK109323TTGGCCCATAARuvA domain 2-like containing protein. 
Os05g0589400006-051-E04GCCCATAANONE 
006-055-D09GCCCATAANONE 
009-193-B08GCCCATAANONE 
AK059813GCCCATAASimilar to I-box binding factor (Fragment). 
AK068595GCCCATAANONE 
J013154K05GCCCATAANONE 
Os06g0113600016-067-E03TTATGGGCCCAACTNONE 
AK062095TTATGGGCCCAACTNONE 
AK101235TTATGGGCCCAACTCyclin-like F-box domain containing protein. 
AK122025TTATGGGCCCAACTNONE 
J013022O19TTATGGGCCCAACTNONE 
J023045P05TTATGGGCCCAACTNONE 
J033031K01TTATGGGCCCAACTNONE 
J033034I09TTATGGGCCCAACTNONE 
J033041O04TTATGGGCCCAACTNONE 
J033071K03TTATGGGCCCAACTNONE 
J033075K16TTATGGGCCCAACTNONE 
J033097M01TTATGGGCCCAACTNONE 
J033099M22TTATGGGCCCAACTNONE 
J033108N15TTATGGGCCCAACTNONE 
J033121D18TTATGGGCCCAACTNONE 
J033125O06TTATGGGCCCAACTNONE 
J033139M16TTATGGGCCCAACTNONE 
J033145P18TTATGGGCCCAACTNONE 
J033149D05TTATGGGCCCAACTNONE 
Os06g0134300AK071534TCTGGGCCCATAAConserved hypothetical protein. 
J023106E03TCTGGGCCCATAANONE 
J075172D02TCTGGGCCCATAANONE 
J100047B13TCTGGGCCCATAANONE 
Os06g0147600AK107817TTATGGGCCGTAConserved hypothetical protein. 
Os06g0167600AK067977CCAGCCCATAASimilar to Proteasome subunit alpha-3 (Fragment). 
J013123K20CCAGCCCATAANONE 
J033125P19CCAGCCCATAANONE 
J065002M08CCAGCCCATAANONE 
J065045C13CCAGCCCATAANONE 
J065045J07CCAGCCCATAANONE 
J065098M04CCAGCCCATAANONE 
J065110M02CCAGCCCATAANONE 
J065113H12CCAGCCCATAANONE 
J065214E15CCAGCCCATAANONE 
Os06g0227200AK066970AAGGCCCATAAConserved hypothetical protein. 
AK073517AAGGCCCATAANONE 
J013088F13AAGGCCCATAANONE 
J013089B21AAGGCCCATAANONE 
J013109D18AAGGCCCATAANONE 
J023138G01AAGGCCCATAANONE 
J033040I03AAGGCCCATAANONE 
J033042L14AAGGCCCATAANONE 
J065207L20AAGGCCCATAANONE 
J090019A12AAGGCCCATAANONE 
J090053M23AAGGCCCATAANONE 
Os06g0251000J033111L12TCAGGCCCATAANONE 
J043001C08TCAGGCCCATAAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0326700AK101908GCCCATAADiacylglycerol acyltransferase family protein. 
Os06g0494400AK067594GCCCATAAMulti antimicrobial extrusion protein MatE family protein. 
Os06g0555500016-056-B08TAGGCCCATAANONE 
AK102375TAGGCCCATAANONE 
AK106546TAGGCCCATAAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08TAGGCCCATAANONE 
J033091P04TAGGCCCATAANONE 
J090082P16TAGGCCCATAANONE 
Os06g0573700015-015-F02TTATGGGCCCATCCANONE 
AK106254TTATGGGCCCATCCAConserved hypothetical protein. 
J065172G24TTATGGGCCCATCCANONE 
Os06g0601000AK071330TTATGGGCTHomeodomain-like containing protein. 
AY224485TTATGGGCTNONE 
Os06g0632700003-014-F06GCCCATAANONE 
AK060787GCCCATAANONE 
Os06g0687400006-054-C09TTATGGGCNONE 
AK060934TTATGGGCNONE 
Os06g0700500AK072266GCCCATAAProtein of unknown function DUF266, plant family protein. 
AK104088GCCCATAANONE 
J065038J08GCCCATAANONE 
J075158B18GCCCATAANONE 
J090056G05GCCCATAANONE 
Os06g0702800009-039-E05ACAGCCCATAANONE 
AK073948ACAGCCCATAAHypothetical protein. 
J023108K23ACAGCCCATAANONE 
J033072H04ACAGCCCATAANONE 
J065008G05ACAGCCCATAANONE 
J065128J12ACAGCCCATAANONE 
J065131A01ACAGCCCATAANONE 
J065173B12ACAGCCCATAANONE 
Os07g0242600AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0435100AB037153TTATGGGCCCACANONE 
AK061383TTATGGGCCCACASimilar to 26S proteasome subunit RPN12. 
AK061408TTATGGGCCCACANONE 
AK101316TTATGGGCCCACANONE 
J023133D07TTATGGGCCCACANONE 
J023136B17TTATGGGCCCACANONE 
J033065M08TTATGGGCCCACANONE 
J033070F05TTATGGGCCCACANONE 
J033070L20TTATGGGCCCACANONE 
J033108J15TTATGGGCCCACANONE 
J053080M19TTATGGGCCCACANONE 
J053091B15TTATGGGCCCACANONE 
J065067J03TTATGGGCCCACANONE 
J065102C02TTATGGGCCCACANONE 
J065135H09TTATGGGCCCACANONE 
J080302K03TTATGGGCCCACANONE 
J090059J11TTATGGGCCCACANONE 
J090074G14TTATGGGCCCACANONE 
J100025F20TTATGGGCCCACANONE 
J100028L08TTATGGGCCCACANONE 
J100049L14TTATGGGCCCACANONE 
J100054O07TTATGGGCCCACANONE 
Os07g0558500AK064914GCCCATAAInositol phosphatase-like protein. 
AY224446GCCCATAANONE 
J013000M13GCCCATAANONE 
Os07g0568900009-083-H02TTATGGGCCCCCACGNONE 
AK062660TTATGGGCCCCCACGConserved hypothetical protein. 
Os07g0569000AK073915CGTGGGGGCCCATAAConserved hypothetical protein. 
Os07g0585800006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0687300AK073043ATTTGGGCCCATAASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os07g0691100AK071728TTATGGGCCGAASimilar to Pectin methylesterase 6 (Fragment). 
J023108P03TTATGGGCCGAANONE 
J023112F11TTATGGGCCGAANONE 
J023143A10TTATGGGCCGAANONE 
Os08g0118900AK109749TTATGGGCCGGTAdenylate kinase family protein. 
Os08g0120000006-042-E02GCGGCCCATAANONE 
006-051-F06GCGGCCCATAANONE 
006-052-G03GCGGCCCATAANONE 
006-095-B11GCGGCCCATAANONE 
AB017427GCGGCCCATAANONE 
AB017428GCGGCCCATAANONE 
AK059789GCGGCCCATAANONE 
AK059815GCGGCCCATAASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077GCGGCCCATAANONE 
AK102607GCGGCCCATAANONE 
AK104303GCGGCCCATAANONE 
AK104304GCGGCCCATAANONE 
AK104421GCGGCCCATAANONE 
D10414GCGGCCCATAANONE 
J013170D08GCGGCCCATAANONE 
J023086D16GCGGCCCATAANONE 
J033099B04GCGGCCCATAANONE 
J065042P05GCGGCCCATAANONE 
J065144E22GCGGCCCATAANONE 
J065162J20GCGGCCCATAANONE 
J065196N13GCGGCCCATAANONE 
J090013B11GCGGCCCATAANONE 
Os08g0139100006-027-E12ACAGCCCATAANONE 
006-089-E06ACAGCCCATAANONE 
006-113-G02ACAGCCCATAANONE 
AK061429ACAGCCCATAANONE 
AK099590ACAGCCCATAASimilar to DAG protein, chloroplast precursor. 
AK104727ACAGCCCATAANONE 
J013043H11ACAGCCCATAANONE 
J013049N13ACAGCCCATAANONE 
J065079F01ACAGCCCATAANONE 
J065122N24ACAGCCCATAANONE 
J065142J24ACAGCCCATAANONE 
J065193N03ACAGCCCATAANONE 
J075041I21ACAGCCCATAANONE 
J075145E04ACAGCCCATAANONE 
Os08g0155000004-001-C12TTATGGGCTCGGCCCATATNONE 
014-030-C11TTATGGGCTCGGCCCATATNONE 
AK060859TTATGGGCTCGGCCCATATNONE 
AK099613TTATGGGCTCGGCCCATATBrix domain containing protein. 
J013154C17TTATGGGCTCGGCCCATATNONE 
J033039F14TTATGGGCTCGGCCCATATNONE 
J033126I18TTATGGGCTCGGCCCATATNONE 
J043005A17TTATGGGCTCGGCCCATATNONE 
J053027C13TTATGGGCTCGGCCCATATNONE 
J053033I07TTATGGGCTCGGCCCATATNONE 
J053054P04TTATGGGCTCGGCCCATATNONE 
J053060F22TTATGGGCTCGGCCCATATNONE 
J053061P10TTATGGGCTCGGCCCATATNONE 
J053065L13TTATGGGCTCGGCCCATATNONE 
J053099H19TTATGGGCTCGGCCCATATNONE 
J053101D09TTATGGGCTCGGCCCATATNONE 
J075062C16TTATGGGCTCGGCCCATATNONE 
J075129P09TTATGGGCTCGGCCCATATNONE 
J075135C02TTATGGGCTCGGCCCATATNONE 
J075147P13TTATGGGCTCGGCCCATATNONE 
J090007K03TTATGGGCTCGGCCCATATNONE 
J090050M06TTATGGGCTCGGCCCATATNONE 
J090057M20TTATGGGCTCGGCCCATATNONE 
J090070B06TTATGGGCTCGGCCCATATNONE 
J090080D11TTATGGGCTCGGCCCATATNONE 
J100021D15TTATGGGCTCGGCCCATATNONE 
Os08g0270200AK101221TTATGGGCCGAAAExosome-associated family protein. 
J090067H03TTATGGGCCGAAANONE 
Os08g0363000015-090-A07GCCCATAANONE 
AK103677GCCCATAANONE 
AK106532GCCCATAAProtein of unknown function DUF295 family protein. 
J033136B21GCCCATAANONE 
J033136E01GCCCATAANONE 
J043029N11GCCCATAANONE 
J065071G13GCCCATAANONE 
J065105J22GCCCATAANONE 
J075084B18GCCCATAANONE 
Os08g0532300009-122-A05TACGGCCCATAANONE 
009-129-H05TACGGCCCATAANONE 
AB011262TACGGCCCATAANONE 
AK065141TACGGCCCATAANONE 
AK119730TACGGCCCATAASimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14TACGGCCCATAANONE 
J013042K23TACGGCCCATAANONE 
J023057J08TACGGCCCATAANONE 
J023057N10TACGGCCCATAANONE 
J023113C21TACGGCCCATAANONE 
J053054E03TACGGCCCATAANONE 
J053062B07TACGGCCCATAANONE 
J053075O17TACGGCCCATAANONE 
J053075P09TACGGCCCATAANONE 
J065024H05TACGGCCCATAANONE 
J065049F22TACGGCCCATAANONE 
J065063L03TACGGCCCATAANONE 
J065102O07TACGGCCCATAANONE 
J065104M12TACGGCCCATAANONE 
J065119E04TACGGCCCATAANONE 
J065153E10TACGGCCCATAANONE 
J065168M24TACGGCCCATAANONE 
J065173I10TACGGCCCATAANONE 
J065181L04TACGGCCCATAANONE 
J065184I18TACGGCCCATAANONE 
J065203M15TACGGCCCATAANONE 
J075004C21TACGGCCCATAANONE 
J075047B11TACGGCCCATAANONE 
J075055F18TACGGCCCATAANONE 
J075065G09TACGGCCCATAANONE 
J075094O14TACGGCCCATAANONE 
J075143C22TACGGCCCATAANONE 
J075153K18TACGGCCCATAANONE 
J075164N10TACGGCCCATAANONE 
J075197C11TACGGCCCATAANONE 
J080001A01TACGGCCCATAANONE 
J080003B11TACGGCCCATAANONE 
J080006G17TACGGCCCATAANONE 
J080007J06TACGGCCCATAANONE 
J080010H12TACGGCCCATAANONE 
J080014I01TACGGCCCATAANONE 
J080015C16TACGGCCCATAANONE 
J080016P19TACGGCCCATAANONE 
J080020G24TACGGCCCATAANONE 
J080021E12TACGGCCCATAANONE 
J080023I11TACGGCCCATAANONE 
J080024H24TACGGCCCATAANONE 
J080025G18TACGGCCCATAANONE 
J080028H08TACGGCCCATAANONE 
J080030G08TACGGCCCATAANONE 
J080031H20TACGGCCCATAANONE 
J080034C20TACGGCCCATAANONE 
J080040H13TACGGCCCATAANONE 
J080044M04TACGGCCCATAANONE 
J080047D02TACGGCCCATAANONE 
J080049D17TACGGCCCATAANONE 
J080049J17TACGGCCCATAANONE 
J080050A05TACGGCCCATAANONE 
J080051C11TACGGCCCATAANONE 
J080051K06TACGGCCCATAANONE 
J080053A07TACGGCCCATAANONE 
J080053I08TACGGCCCATAANONE 
J080056L12TACGGCCCATAANONE 
J080061I19TACGGCCCATAANONE 
J080075G09TACGGCCCATAANONE 
J080078C23TACGGCCCATAANONE 
J080080I21TACGGCCCATAANONE 
J080084F04TACGGCCCATAANONE 
J080085K16TACGGCCCATAANONE 
J080097A12TACGGCCCATAANONE 
J080097N01TACGGCCCATAANONE 
J090027L10TACGGCCCATAANONE 
J100034N17TACGGCCCATAANONE 
Os08g0532400AK101608TTATGGGCCGTASimilar to AT.I.24-7 protein. 
Os08g0557000AK059917TAGGCCCATAANONE 
AK100496TAGGCCCATAASimilar to Protein-L-isoaspartate O-methyltransferase. 
Os08g0563300009-007-B01GGGCCGGCCCATAANONE 
AK062315GGGCCGGCCCATAASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04GGGCCGGCCCATAANONE 
Os08g0564100AK063258GCCGGCCCATAASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0306700J023045A19TTATGGGCCTTGNONE 
Os09g0323000009-165-E01TTATGGGCNONE 
AK063871TTATGGGCNONE 
Os09g0324300AK109691TTATGGGCCGCCGTGGGCTTTCyclin-like F-box domain containing protein. 
Os09g0395400AK109221TAGGCCCATAAGGATGGGCCGTAConserved hypothetical protein. 
J075009I06TAGGCCCATAAGGATGGGCCGTANONE 
Os09g0416400J075067A16TACGGCCCATAAConserved hypothetical protein. 
J075104N21TACGGCCCATAANONE 
J075106F04TACGGCCCATAANONE 
J075131F08TACGGCCCATAANONE 
Os09g0424600AK073882TTATGGGCCGCAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0436500AK107460TTATGGGCNONE 
Os09g0448100AK070293CCTCGCCCATAACyclin-like F-box domain containing protein. 
AK070628CCTCGCCCATAANONE 
J023050H06CCTCGCCCATAANONE 
J053091I22CCTCGCCCATAANONE 
J065051I11CCTCGCCCATAANONE 
J065066L13CCTCGCCCATAANONE 
Os09g0458100AK109625TTATGGGCCGTAXyloglucan fucosyltransferase family protein. 
Os09g0459900009-190-G09CTCTCCGCCCATAANONE 
AK063208CTCTCCGCCCATAACyclin-dependent kinase inhibitor family protein. 
AK111010CTCTCCGCCCATAANONE 
Os09g0471900AK073815AGTGGGCCCATAABacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0487500AK108131TCCGGCCCATAAConserved hypothetical protein. 
J080062L16TCCGGCCCATAANONE 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
Os09g0554000J065123C23TTATGGGCTTATGGCCCATCASimilar to Mitochondrial phosphate transporter. 
Os09g0559800AK071542TTATGGGCCGASimilar to Transporter-like protein. 
J013063N24TTATGGGCCGANONE 
Os09g0563800AK068364TTATGGGCCTCConserved hypothetical protein. 
J075156H12TTATGGGCCTCNONE 
Os11g0115800AK106102CTCGGCCCATAAConserved hypothetical protein. 
J065057N13CTCGGCCCATAANONE 
Os11g0130600AK066342TTATGGGCCTAGATGGGCCTCConserved hypothetical protein. 
J065192M10TTATGGGCCTAGATGGGCCTCNONE 
Os11g0704700AK102518AAGGCCCATAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023012E06AAGGCCCATAANONE 
J023022M10AAGGCCCATAANONE 
J023086E15AAGGCCCATAANONE 
J033022B08AAGGCCCATAANONE 
J033091K11AAGGCCCATAANONE 
J033095N01AAGGCCCATAANONE 
J090020H24AAGGCCCATAANONE 
Os12g0124400AK071024TTATGGGCCTTExostosin-like family protein. 
Os12g0127500AK064595CAGGCCCATAAConserved hypothetical protein. 
AK064595TTATGGGCCTTConserved hypothetical protein. 
J065067F11CAGGCCCATAANONE 
J065067F11TTATGGGCCTTNONE 
J090007D02CAGGCCCATAANONE 
J090007D02TTATGGGCCTTNONE 
J100035G10CAGGCCCATAANONE 
J100035G10TTATGGGCCTTNONE 
J100077J10CAGGCCCATAANONE 
J100077J10TTATGGGCCTTNONE 
Os12g0136600AK064762TTATGGGCCTConserved hypothetical protein. 
J075198J21TTATGGGCCTNONE 
J080024B04TTATGGGCCTNONE 
J080042H13TTATGGGCCTNONE 
J080042J18TTATGGGCCTNONE 
J080068A13TTATGGGCCTNONE 
J080076G10TTATGGGCCTNONE 
J080076H12TTATGGGCCTNONE 
J080097E20TTATGGGCCTNONE 
J080097L07TTATGGGCCTNONE 
J090049I08TTATGGGCCTNONE 
Os12g0142600AK067092TTATGGGCDTW domain containing protein. 
J013096C01TTATGGGCNONE 
Os12g0143150009-090-F09TTATGGGCUbiquitin domain containing protein. 
J013121D01TTATGGGCNONE 
J065129G09TTATGGGCNONE 
J080311D13TTATGGGCNONE 
J090014O10TTATGGGCNONE 
J090045E21TTATGGGCNONE 
J100047D12TTATGGGCNONE 
Os12g0150100009-047-B11GAGGCCCATAANONE 
AK105075GAGGCCCATAASimilar to 60S ribosomal protein L26A. 
J013067G22GAGGCCCATAANONE 
J033103F08GAGGCCCATAANONE 
J065029P11GAGGCCCATAANONE 
J065043B18GAGGCCCATAANONE 
J065123E16GAGGCCCATAANONE 
J065141O20GAGGCCCATAANONE 
J065161O04GAGGCCCATAANONE 
J065201M07GAGGCCCATAANONE 
J075058I23GAGGCCCATAANONE 
J075172J08GAGGCCCATAANONE 
J100040L13GAGGCCCATAANONE 
Os12g0233500Os12g0233500TTATGGGCTNONE 
Os12g0556100J065083C21ACAGCCCATAADrought induced 19 family protein. 
J065124M18ACAGCCCATAANONE 
J100032P22ACAGCCCATAANONE 
J100048N01ACAGCCCATAANONE 
Os12g0572400016-084-F04AAAGCCCATAAGGCCCACCCNONE 
AK065531AAAGCCCATAAGGCCCACCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03AAAGCCCATAAGGCCCACCCNONE 
J013034H02AAAGCCCATAAGGCCCACCCNONE 
J033117N05AAAGCCCATAAGGCCCACCCNONE 
J065027L09AAAGCCCATAAGGCCCACCCNONE 
J065037D09AAAGCCCATAAGGCCCACCCNONE 
J065197I09AAAGCCCATAAGGCCCACCCNONE 
J090045C01AAAGCCCATAAGGCCCACCCNONE 
J100031E11AAAGCCCATAAGGCCCACCCNONE 
Os12g0574800AK073004TTGGCCCATAANONE 
AK102465TTGGCCCATAABromodomain transcription factor containing protein. 
AK121687TTGGCCCATAANONE 
J033070O18TTGGCCCATAANONE 
J075097O17TTGGCCCATAANONE 
J080069F02TTGGCCCATAANONE 
Os12g0605800AK061906GCCCATAANONE 
AK065165GCCCATAANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.