version

Summary of OsREG606 (All List)

OrganismOryza sativa  
IDOsREG606  
SequenceGCCCATAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1129  

Entry Sequences (1129 entries)

LocusGene modelSequenceDescription
Os01g0139600AK073130TCAGCCCATACSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0191800AK061360GGGGCCCATACNONE 
Os01g0196600AK101742AGCCCATACNONE 
U25430AGCCCATACSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0224500AK109225GCCCATACConserved hypothetical protein. 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
Os01g0261500AK072194GTATGGGCNONE 
AK101899GTATGGGCConserved hypothetical protein. 
J065041N17GTATGGGCNONE 
Os01g0283000AK073165GTATGGGCCAGConserved hypothetical protein. 
J033023G08GTATGGGCCAGNONE 
Os01g0283100004-018-B01CTGGCCCATACNONE 
AK060908CTGGCCCATACNONE 
AK071713CTGGCCCATACSimilar to Ferripyochelin-binding protein-like. 
AK104205CTGGCCCATACNONE 
AK122051CTGGCCCATACNONE 
J023109L19CTGGCCCATACNONE 
Os01g0379400016-006-B06GCCCATACNONE 
AK064420GCCCATACNONE 
AK102388GCCCATACNONE 
AK110939GCCCATACCyclin-like F-box domain containing protein. 
J033092D18GCCCATACNONE 
J065070N09GCCCATACNONE 
J065078L01GCCCATACNONE 
J065083G15GCCCATACNONE 
Os01g0530300AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0686800006-098-B12TAGGCCCATACNONE 
006-113-H04TAGGCCCATACNONE 
AK060428TAGGCCCATACNONE 
AK098877TAGGCCCATACNONE 
AK098893TAGGCCCATACNONE 
AK121587TAGGCCCATACGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231TAGGCCCATACNONE 
J013001E12TAGGCCCATACNONE 
J013001N15TAGGCCCATACNONE 
J013098G22TAGGCCCATACNONE 
J023004P15TAGGCCCATACNONE 
J023014D09TAGGCCCATACNONE 
J023020G09TAGGCCCATACNONE 
J023034A19TAGGCCCATACNONE 
J023050I11TAGGCCCATACNONE 
J023079D13TAGGCCCATACNONE 
J023091B11TAGGCCCATACNONE 
J023099M03TAGGCCCATACNONE 
J023101H20TAGGCCCATACNONE 
J023106P14TAGGCCCATACNONE 
J023111F19TAGGCCCATACNONE 
J023132C22TAGGCCCATACNONE 
J023139O03TAGGCCCATACNONE 
J023146O10TAGGCCCATACNONE 
J033022G16TAGGCCCATACNONE 
J033030C10TAGGCCCATACNONE 
J033032G18TAGGCCCATACNONE 
J033034N09TAGGCCCATACNONE 
J033037K24TAGGCCCATACNONE 
J033038B22TAGGCCCATACNONE 
J033061E06TAGGCCCATACNONE 
J033065F08TAGGCCCATACNONE 
J033065I24TAGGCCCATACNONE 
J033069L01TAGGCCCATACNONE 
J033086N21TAGGCCCATACNONE 
J033102I06TAGGCCCATACNONE 
J033111N07TAGGCCCATACNONE 
J033118K11TAGGCCCATACNONE 
J033125D08TAGGCCCATACNONE 
J033129P22TAGGCCCATACNONE 
J033131L12TAGGCCCATACNONE 
J033139D08TAGGCCCATACNONE 
J033141J08TAGGCCCATACNONE 
J043024B14TAGGCCCATACNONE 
J053048G19TAGGCCCATACNONE 
J065023B15TAGGCCCATACNONE 
J065082C15TAGGCCCATACNONE 
J065087D24TAGGCCCATACNONE 
J065122D11TAGGCCCATACNONE 
J065128P13TAGGCCCATACNONE 
J065149I19TAGGCCCATACNONE 
J065154E16TAGGCCCATACNONE 
J065156K21TAGGCCCATACNONE 
J065166H09TAGGCCCATACNONE 
J065169F24TAGGCCCATACNONE 
J065194I16TAGGCCCATACNONE 
J065213M20TAGGCCCATACNONE 
J075020F19TAGGCCCATACNONE 
J075051J16TAGGCCCATACNONE 
J075093C18TAGGCCCATACNONE 
J075119H02TAGGCCCATACNONE 
J075120J11TAGGCCCATACNONE 
J075173A15TAGGCCCATACNONE 
J080302B05TAGGCCCATACNONE 
J080304G10TAGGCCCATACNONE 
J080305E13TAGGCCCATACNONE 
J080315L11TAGGCCCATACNONE 
J090005H15TAGGCCCATACNONE 
J090021C24TAGGCCCATACNONE 
J090025H24TAGGCCCATACNONE 
J090025M11TAGGCCCATACNONE 
J090026C22TAGGCCCATACNONE 
J090027H15TAGGCCCATACNONE 
J090034B17TAGGCCCATACNONE 
J090045G11TAGGCCCATACNONE 
J090048H02TAGGCCCATACNONE 
J090051N04TAGGCCCATACNONE 
J090052I06TAGGCCCATACNONE 
J090054L17TAGGCCCATACNONE 
J090060M22TAGGCCCATACNONE 
J090075N17TAGGCCCATACNONE 
J090079K13TAGGCCCATACNONE 
J090086H08TAGGCCCATACNONE 
J090094N20TAGGCCCATACNONE 
J100021F03TAGGCCCATACNONE 
J100031M01TAGGCCCATACNONE 
J100033I18TAGGCCCATACNONE 
J100034P07TAGGCCCATACNONE 
J100043M16TAGGCCCATACNONE 
J100046J12TAGGCCCATACNONE 
J100055F09TAGGCCCATACNONE 
J100057D19TAGGCCCATACNONE 
J100060O10TAGGCCCATACNONE 
J100064G09TAGGCCCATACNONE 
J100077F24TAGGCCCATACNONE 
J100080E12TAGGCCCATACNONE 
J100089J04TAGGCCCATACNONE 
Os01g0767100AK109493AGCCCATACSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0852200AK063954GGGCCGTATGGGCTTTNONE 
Os01g0899200AK108736GCCCATACSimilar to ERD3 protein. 
Os01g0912600009-186-H02AGCCCATACNONE 
AK063179AGCCCATACConserved hypothetical protein. 
Os01g0924000004-020-C09GTATGGGCCGGCCCNONE 
005-014-A06GTATGGGCCGGCCCNONE 
009-085-G12GTATGGGCCGGCCCNONE 
009-123-A08GTATGGGCCGGCCCNONE 
009-134-A05GTATGGGCCGGCCCNONE 
009-137-F06GTATGGGCCGGCCCNONE 
016-016-B08GTATGGGCCGGCCCNONE 
AF050674GTATGGGCCGGCCCNONE 
AK061690GTATGGGCCGGCCCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797GTATGGGCCGGCCCNONE 
J013040A15GTATGGGCCGGCCCNONE 
J013104L20GTATGGGCCGGCCCNONE 
J013127E12GTATGGGCCGGCCCNONE 
J013158O05GTATGGGCCGGCCCNONE 
J023012E09GTATGGGCCGGCCCNONE 
J023126L23GTATGGGCCGGCCCNONE 
J023143B03GTATGGGCCGGCCCNONE 
J065005B16GTATGGGCCGGCCCNONE 
J065101J15GTATGGGCCGGCCCNONE 
J065105K16GTATGGGCCGGCCCNONE 
J065155K16GTATGGGCCGGCCCNONE 
J065171M17GTATGGGCCGGCCCNONE 
J065182F07GTATGGGCCGGCCCNONE 
J065187D10GTATGGGCCGGCCCNONE 
J065194I24GTATGGGCCGGCCCNONE 
J065207E24GTATGGGCCGGCCCNONE 
J075001C24GTATGGGCCGGCCCNONE 
J075090O10GTATGGGCCGGCCCNONE 
J075095H17GTATGGGCCGGCCCNONE 
J075109M24GTATGGGCCGGCCCNONE 
J075123C18GTATGGGCCGGCCCNONE 
J075148G22GTATGGGCCGGCCCNONE 
J090009B09GTATGGGCCGGCCCNONE 
J090075K17GTATGGGCCGGCCCNONE 
J090081H23GTATGGGCCGGCCCNONE 
J090097H21GTATGGGCCGGCCCNONE 
J100063P14GTATGGGCCGGCCCNONE 
Os01g0952600AK067525CTTGGGCCCATACNONE 
AK070047CTTGGGCCCATACSimilar to LacZ (Fragment). 
Os01g0964000AK073599GTATGGGCCCTSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1). 
AK104012GTATGGGCCCTNONE 
AK104190GTATGGGCCCTNONE 
Os01g0977300AK110631GCCCATACSimilar to MYB-related protein. 
J075066C17GCCCATACNONE 
J075081N15GCCCATACNONE 
J075115P18GCCCATACNONE 
J075192N22GCCCATACNONE 
Os02g0179100AK058557CACGCCACCGGCCCATACMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CACGCCACCGGCCCATACNONE 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0226600AK109849GTATGGGCPOX domain containing protein. 
Os02g0226900AK064279AGGGCCCATACProtein prenyltransferase domain containing protein. 
Os02g0241300011-003-E04GCCCATACNONE 
AK100715GCCCATACConserved hypothetical protein. 
J023075L14GCCCATACNONE 
J023115O03GCCCATACNONE 
Os02g0621700011-079-F10CCAGCCCATACNONE 
AK101006CCAGCCCATACSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525CCAGCCCATACNONE 
J013026C02CCAGCCCATACNONE 
J013104M10CCAGCCCATACNONE 
J023003D01CCAGCCCATACNONE 
J023007H13CCAGCCCATACNONE 
J023019G09CCAGCCCATACNONE 
J023020L19CCAGCCCATACNONE 
J023022L12CCAGCCCATACNONE 
J023022O14CCAGCCCATACNONE 
J023036F16CCAGCCCATACNONE 
J023047D16CCAGCCCATACNONE 
J023052P08CCAGCCCATACNONE 
J023077C01CCAGCCCATACNONE 
J023083M06CCAGCCCATACNONE 
J023105A11CCAGCCCATACNONE 
J023117F21CCAGCCCATACNONE 
J023119D20CCAGCCCATACNONE 
J023148E03CCAGCCCATACNONE 
J023149B13CCAGCCCATACNONE 
J033029A10CCAGCCCATACNONE 
J033046L17CCAGCCCATACNONE 
J033052M04CCAGCCCATACNONE 
J033057M14CCAGCCCATACNONE 
J033066K24CCAGCCCATACNONE 
J033069K02CCAGCCCATACNONE 
J033079G14CCAGCCCATACNONE 
J033101E06CCAGCCCATACNONE 
J033116E06CCAGCCCATACNONE 
J033118L18CCAGCCCATACNONE 
J033135B13CCAGCCCATACNONE 
J033136C10CCAGCCCATACNONE 
J033136P08CCAGCCCATACNONE 
J043027B13CCAGCCCATACNONE 
J065039I03CCAGCCCATACNONE 
J065185N21CCAGCCCATACNONE 
J090008D14CCAGCCCATACNONE 
J090029K17CCAGCCCATACNONE 
J090047H20CCAGCCCATACNONE 
J090048N17CCAGCCCATACNONE 
J090085G08CCAGCCCATACNONE 
J090089F07CCAGCCCATACNONE 
Os02g0667300009-057-D01GTATGGGCCCAAGNONE 
AK058228GTATGGGCCCAAGAlcohol dehydrogenase superfamily, zinc-containing protein. 
AK099066GTATGGGCCCAAGNONE 
Os02g0679200AK110789TTCGGCCCATACTetratricopeptide-like helical domain containing protein. 
Os02g0721600AK111973GTATGGGCNONE 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os02g0827900AK099911TGATGGGCCAGCGGCCCATACSimilar to Signal peptidase 18 subunit (Fragment). 
Os03g0138700009-045-H03AGCCCATACNONE 
AK072119AGCCCATACTGF-beta receptor, type I/II extracellular region family protein. 
J013025I16AGCCCATACNONE 
J013123D02AGCCCATACNONE 
J023048B09AGCCCATACNONE 
J023048C09AGCCCATACNONE 
J065027O03AGCCCATACNONE 
J065028C03AGCCCATACNONE 
J065080H22AGCCCATACNONE 
J065102H03AGCCCATACNONE 
J065137P14AGCCCATACNONE 
J065143C23AGCCCATACNONE 
J065168G06AGCCCATACNONE 
J065192N07AGCCCATACNONE 
J065205I11AGCCCATACNONE 
J075040F03AGCCCATACNONE 
J075052H20AGCCCATACNONE 
J075118L18AGCCCATACNONE 
J075126C19AGCCCATACNONE 
J075173L07AGCCCATACNONE 
Os03g0139000006-059-C06GTATGGGCCACNONE 
009-055-F07GTATGGGCCACNONE 
AK060973GTATGGGCCACConserved hypothetical protein. 
AK103850GTATGGGCCACNONE 
Os03g0159700012-100-B09GTGACGTGTGGCCCATACNONE 
AK063559GTGACGTGTGGCCCATACProtein prenyltransferase domain containing protein. 
J065197I24GTGACGTGTGGCCCATACNONE 
J090089G20GTGACGTGTGGCCCATACNONE 
Os03g0196600Os03g0196600GTATGGGCSimilar to Chloroplast serine acetyltransferase. 
Os03g0277500014-019-A09AGCCCATACNONE 
AK063650AGCCCATACGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18AGCCCATACNONE 
J065092A08AGCCCATACNONE 
J065122E17AGCCCATACNONE 
J065182K12AGCCCATACNONE 
J065197H15AGCCCATACNONE 
J075115A05AGCCCATACNONE 
Os03g0346500009-180-F12GTATGGGCCATNONE 
AK063139GTATGGGCCATHypothetical protein. 
Os03g0363350Os03g0363350GTATGGGCCATGAGGCCCAACAProtein of unknown function DUF455 family protein. 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0576900AK071314AGCCCATACAmino acid/polyamine transporter I family protein. 
J023074L08AGCCCATACNONE 
J023084D13AGCCCATACNONE 
J080011C14AGCCCATACNONE 
J080012F24AGCCCATACNONE 
J080018M05AGCCCATACNONE 
J080021G05AGCCCATACNONE 
J080021N18AGCCCATACNONE 
J080023E19AGCCCATACNONE 
J080024H14AGCCCATACNONE 
J080025E15AGCCCATACNONE 
J080038F19AGCCCATACNONE 
J080044N09AGCCCATACNONE 
J080054D05AGCCCATACNONE 
J080057J16AGCCCATACNONE 
J080060A05AGCCCATACNONE 
J080061M12AGCCCATACNONE 
J080063H13AGCCCATACNONE 
J080065O04AGCCCATACNONE 
J080066I17AGCCCATACNONE 
J080066J06AGCCCATACNONE 
J080089J22AGCCCATACNONE 
J080090I03AGCCCATACNONE 
J080091J23AGCCCATACNONE 
J080091K20AGCCCATACNONE 
J080093G24AGCCCATACNONE 
J080094I08AGCCCATACNONE 
J080096A17AGCCCATACNONE 
J090051G12AGCCCATACNONE 
Os03g0610800AK107194CAAGCCCATACSimilar to Protein zx. 
Os03g0634000014-034-A03GTATGGGCCGGGACCCANONE 
AK063673GTATGGGCCGGGACCCASimilar to THA4. 
Os03g0701100014-015-E11GTATGGGCTTTNONE 
AK109455GTATGGGCTTTNONE 
AK110740GTATGGGCTTTNONE 
Os03g0720400AK067604GTATGGGCProtein of unknown function DUF295 family protein. 
J013112B07GTATGGGCNONE 
Os03g0725300011-085-E09GTATGGGCCAANONE 
AK063969GTATGGGCCAASimilar to Dbr1-prov protein. 
AK073636GTATGGGCCAANONE 
J033050L15GTATGGGCCAANONE 
J053082G03GTATGGGCCAANONE 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0755000AK068540ACCGGGCCCATACSimilar to Serine/threonine kinase (Fragment). 
Os03g0805800J080301J20GCCCATACNONE 
J080303E02GCCCATACPheophorbide a oxygenase domain containing protein. 
Os04g0131900AK064088GCCCATACSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os04g0407300AK101793ATGGCCCATACNONE 
AK121980ATGGCCCATACHypothetical protein. 
J033065K23ATGGCCCATACNONE 
J033108L11ATGGCCCATACNONE 
Os04g0506800006-044-G02GTATGGGCNONE 
AK070719GTATGGGCGlycosyl transferase, family 29 protein. 
AK104647GTATGGGCNONE 
AK104762GTATGGGCNONE 
J013096J11GTATGGGCNONE 
J023058L14GTATGGGCNONE 
J065057C09GTATGGGCNONE 
J065101H18GTATGGGCNONE 
J065107F03GTATGGGCNONE 
J065154O19GTATGGGCNONE 
J065179I09GTATGGGCNONE 
J065189E21GTATGGGCNONE 
Os04g0537800AK103654GCCCATACProtein of unknown function DUF26 domain containing protein. 
J023003K20GCCCATACNONE 
J023007K15GCCCATACNONE 
J023041L14GCCCATACNONE 
J033135E09GCCCATACNONE 
Os04g0667600009-131-H09GTATGGGCCCTNONE 
009-200-A04GTATGGGCCCTNONE 
AK068657GTATGGGCCCTHeavy metal transport/detoxification protein domain containing protein. 
J065013M12GTATGGGCCCTNONE 
J065024H17GTATGGGCCCTNONE 
J065025P10GTATGGGCCCTNONE 
J065028I11GTATGGGCCCTNONE 
J065044K11GTATGGGCCCTNONE 
J065045B14GTATGGGCCCTNONE 
J065052B02GTATGGGCCCTNONE 
J065061F20GTATGGGCCCTNONE 
J065061K16GTATGGGCCCTNONE 
J065063E12GTATGGGCCCTNONE 
J065065E16GTATGGGCCCTNONE 
J065082M02GTATGGGCCCTNONE 
J065084O10GTATGGGCCCTNONE 
J065096H18GTATGGGCCCTNONE 
J065122F02GTATGGGCCCTNONE 
J065131F09GTATGGGCCCTNONE 
J065139P06GTATGGGCCCTNONE 
J065148L17GTATGGGCCCTNONE 
J065164D23GTATGGGCCCTNONE 
J065167M17GTATGGGCCCTNONE 
J065174B15GTATGGGCCCTNONE 
J065176G01GTATGGGCCCTNONE 
J065186K17GTATGGGCCCTNONE 
J065186N05GTATGGGCCCTNONE 
J065213N24GTATGGGCCCTNONE 
J075001P17GTATGGGCCCTNONE 
J075004A15GTATGGGCCCTNONE 
J075007B03GTATGGGCCCTNONE 
J075026D23GTATGGGCCCTNONE 
J075032D17GTATGGGCCCTNONE 
J075058C22GTATGGGCCCTNONE 
J075080L14GTATGGGCCCTNONE 
J075094K18GTATGGGCCCTNONE 
J075097K15GTATGGGCCCTNONE 
J075098E02GTATGGGCCCTNONE 
J075104D11GTATGGGCCCTNONE 
J075120L16GTATGGGCCCTNONE 
J075126A18GTATGGGCCCTNONE 
J075129M08GTATGGGCCCTNONE 
J075143N14GTATGGGCCCTNONE 
J075146D07GTATGGGCCCTNONE 
J075149L10GTATGGGCCCTNONE 
J075171F22GTATGGGCCCTNONE 
J090058C05GTATGGGCCCTNONE 
J100018N19GTATGGGCCCTNONE 
J100024K09GTATGGGCCCTNONE 
J100036F15GTATGGGCCCTNONE 
J100042A15GTATGGGCCCTNONE 
J100042P14GTATGGGCCCTNONE 
J100051N18GTATGGGCCCTNONE 
J100055K14GTATGGGCCCTNONE 
J100056F05GTATGGGCCCTNONE 
J100058L10GTATGGGCCCTNONE 
J100083J17GTATGGGCCCTNONE 
J100086N07GTATGGGCCCTNONE 
Os05g0378900AK103841GTATGGGCTGGConserved hypothetical protein. 
J033148I18GTATGGGCTGGNONE 
J065085F12GTATGGGCTGGNONE 
J075041H24GTATGGGCTGGNONE 
J075180P06GTATGGGCTGGNONE 
Os05g0399700AB012855AAAAGCCCATACNONE 
AB018248AAAAGCCCATACNONE 
AB096139AAAAGCCCATACNONE 
AK071196AAAAGCCCATACChitinase (EC 3.2.1.14). 
J023012C04AAAAGCCCATACNONE 
J023086B11AAAAGCCCATACNONE 
J023143A20AAAAGCCCATACNONE 
J080040G15AAAAGCCCATACNONE 
J080306P19AAAAGCCCATACNONE 
J080307K24AAAAGCCCATACNONE 
J090040G17AAAAGCCCATACNONE 
J090047J17AAAAGCCCATACNONE 
J090075E21AAAAGCCCATACNONE 
J090088L05AAAAGCCCATACNONE 
Os05g0408300AK068553GCCCATACConserved hypothetical protein. 
Os05g0447000AK108280TAAGCCCATACSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0458100006-084-A05AAAGCCCATACNONE 
009-091-H05AAAGCCCATACNONE 
AJ557547AAAGCCCATACNONE 
AK059467AAAGCCCATACNONE 
AK061127AAAGCCCATACNONE 
AK101652AAAGCCCATACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AAAGCCCATACNONE 
J033057B20AAAGCCCATACNONE 
J033087A05AAAGCCCATACNONE 
J043009C05AAAGCCCATACNONE 
J090009E10AAAGCCCATACNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0488900AK071883CCCGGCCCATACSimilar to Cytochrome b5 reductase. 
AK073699CCCGGCCCATACNONE 
AK105459CCCGGCCCATACNONE 
J080009C06CCCGGCCCATACNONE 
J080021N09CCCGGCCCATACNONE 
J080041K24CCCGGCCCATACNONE 
J080058H15CCCGGCCCATACNONE 
J080064P06CCCGGCCCATACNONE 
J080077B16CCCGGCCCATACNONE 
Os05g0499400AK059489GTATGGGCHaem peroxidase family protein. 
AK068896GTATGGGCNONE 
J013170E20GTATGGGCNONE 
Os05g0540800AK060731TAGGCCCATACNONE 
AK071090TAGGCCCATACHomeodomain-like containing protein. 
J013095F03TAGGCCCATACNONE 
J023079C11TAGGCCCATACNONE 
J033080E08TAGGCCCATACNONE 
Os06g0192500AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0220800AK059876GTATGGGCCAANONE 
AY739306GTATGGGCCAAThioredoxin domain 2 containing protein. 
J075093C09GTATGGGCCAANONE 
J100026J18GTATGGGCCAANONE 
J100041O16GTATGGGCCAANONE 
J100089K16GTATGGGCCAANONE 
Os06g0298500AK108252GTATGGGCCTAConserved hypothetical protein. 
J065144C04GTATGGGCCTANONE 
J075054P09GTATGGGCCTANONE 
J075165A13GTATGGGCCTANONE 
J075172E10GTATGGGCCTANONE 
Os06g0535300AK059642GTATGGGCTNONE 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0698748004-013-F09GTATGGGCNONE 
006-099-E12GTATGGGCNONE 
009-074-D06GTATGGGCNONE 
009-081-C02GTATGGGCNONE 
013-065-B10GTATGGGCNONE 
AK100361GTATGGGCConserved hypothetical protein. 
AK105781GTATGGGCNONE 
J013088K23GTATGGGCNONE 
J013158L05GTATGGGCNONE 
J023083M02GTATGGGCNONE 
J075034E21GTATGGGCNONE 
J075049F24GTATGGGCNONE 
J075055A21GTATGGGCNONE 
J100044A04GTATGGGCNONE 
J100058I01GTATGGGCNONE 
Os06g0715400012-007-C01GAGGCCCAAGGCCCATACNONE 
012-038-G03GAGGCCCAAGGCCCATACNONE 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
AK073963GAGGCCCAAGGCCCATACNONE 
J023085J06GAGGCCCAAGGCCCATACNONE 
J033073I09GAGGCCCAAGGCCCATACNONE 
J080316N15GAGGCCCAAGGCCCATACNONE 
J090062N15GAGGCCCAAGGCCCATACNONE 
Os07g0202100AK101736AAAAGCCCATACSimilar to ATP-dependent RNA helicase ded1. 
Os07g0418100Os07g0418100GTATGGGCCCATGTProtein of unknown function DUF889, eukaryote family protein. 
Os07g0490500006-086-C07GTATGGGCNONE 
AK059640GTATGGGCNONE 
AK061151GTATGGGCXanthine/uracil/vitamin C permease family protein. 
J075080G01GTATGGGCNONE 
J075197N11GTATGGGCNONE 
Os07g0529600006-066-F05GAGGCCCATACNONE 
009-049-D10GAGGCCCATACNONE 
009-180-A06GAGGCCCATACNONE 
013-001-E04GAGGCCCATACNONE 
013-011-G03GAGGCCCATACNONE 
013-015-D04GAGGCCCATACNONE 
013-016-B02GAGGCCCATACNONE 
013-021-B11GAGGCCCATACNONE 
013-021-F07GAGGCCCATACNONE 
013-022-B02GAGGCCCATACNONE 
013-029-D10GAGGCCCATACNONE 
013-029-E04GAGGCCCATACNONE 
013-032-A07GAGGCCCATACNONE 
013-035-D07GAGGCCCATACNONE 
013-036-B03GAGGCCCATACNONE 
013-036-B10GAGGCCCATACNONE 
013-037-F08GAGGCCCATACNONE 
013-040-B02GAGGCCCATACNONE 
013-040-B10GAGGCCCATACNONE 
013-041-D07GAGGCCCATACNONE 
013-044-H10GAGGCCCATACNONE 
013-046-C06GAGGCCCATACNONE 
013-047-E03GAGGCCCATACNONE 
013-051-E06GAGGCCCATACNONE 
013-055-B07GAGGCCCATACNONE 
013-055-H04GAGGCCCATACNONE 
013-057-G06GAGGCCCATACNONE 
013-060-E04GAGGCCCATACNONE 
013-062-C07GAGGCCCATACNONE 
013-064-B11GAGGCCCATACNONE 
013-065-A09GAGGCCCATACNONE 
013-065-H03GAGGCCCATACNONE 
013-066-C07GAGGCCCATACNONE 
013-069-B03GAGGCCCATACNONE 
013-070-B08GAGGCCCATACNONE 
013-074-A03GAGGCCCATACNONE 
013-082-B08GAGGCCCATACNONE 
013-083-C10GAGGCCCATACNONE 
013-088-H12GAGGCCCATACNONE 
013-089-A10GAGGCCCATACNONE 
013-089-H06GAGGCCCATACNONE 
013-091-B09GAGGCCCATACNONE 
013-095-D09GAGGCCCATACNONE 
013-099-D03GAGGCCCATACNONE 
014-008-H04GAGGCCCATACNONE 
014-015-D12GAGGCCCATACNONE 
014-017-H12GAGGCCCATACNONE 
014-040-C05GAGGCCCATACNONE 
014-045-D07GAGGCCCATACNONE 
014-053-B03GAGGCCCATACNONE 
014-073-B05GAGGCCCATACNONE 
014-098-F10GAGGCCCATACNONE 
AB110170GAGGCCCATACNONE 
AK064916GAGGCCCATACNONE 
AK099918GAGGCCCATACSimilar to Thiazole biosynthetic enzyme 1-1, chloroplast precursor. 
J013000M17GAGGCCCATACNONE 
J013039J16GAGGCCCATACNONE 
J013055B12GAGGCCCATACNONE 
J013059A13GAGGCCCATACNONE 
J013060H05GAGGCCCATACNONE 
J013067A05GAGGCCCATACNONE 
J013071H11GAGGCCCATACNONE 
J013075I24GAGGCCCATACNONE 
J013102B09GAGGCCCATACNONE 
J013123E11GAGGCCCATACNONE 
J013123I22GAGGCCCATACNONE 
J013123L17GAGGCCCATACNONE 
J013156A11GAGGCCCATACNONE 
J013158K17GAGGCCCATACNONE 
J013160E19GAGGCCCATACNONE 
J023022F22GAGGCCCATACNONE 
J023045D15GAGGCCCATACNONE 
J023063E21GAGGCCCATACNONE 
J023078H19GAGGCCCATACNONE 
J023107E18GAGGCCCATACNONE 
J023107O16GAGGCCCATACNONE 
J023108B07GAGGCCCATACNONE 
J023113M14GAGGCCCATACNONE 
J023122K02GAGGCCCATACNONE 
J023134I12GAGGCCCATACNONE 
J033024O07GAGGCCCATACNONE 
J033045E09GAGGCCCATACNONE 
J033050O12GAGGCCCATACNONE 
J033052B16GAGGCCCATACNONE 
J033052F10GAGGCCCATACNONE 
J033052L07GAGGCCCATACNONE 
J033055D16GAGGCCCATACNONE 
J033093C13GAGGCCCATACNONE 
J033107I04GAGGCCCATACNONE 
J033122D23GAGGCCCATACNONE 
J043029H01GAGGCCCATACNONE 
J053043E04GAGGCCCATACNONE 
J053059G17GAGGCCCATACNONE 
J053069L11GAGGCCCATACNONE 
J053095I18GAGGCCCATACNONE 
J065035I11GAGGCCCATACNONE 
J065087P10GAGGCCCATACNONE 
J065124B14GAGGCCCATACNONE 
J065198E12GAGGCCCATACNONE 
J065210N22GAGGCCCATACNONE 
J065210P16GAGGCCCATACNONE 
J080309H11GAGGCCCATACNONE 
J080316C05GAGGCCCATACNONE 
J090039D18GAGGCCCATACNONE 
J090053F06GAGGCCCATACNONE 
J090084D01GAGGCCCATACNONE 
J090085K24GAGGCCCATACNONE 
J090096C10GAGGCCCATACNONE 
J090097N18GAGGCCCATACNONE 
J100045M09GAGGCCCATACNONE 
Os07g0585800006-106-A05GTATGGGCCTTNONE 
AK066419GTATGGGCCTTNONE 
AK105064GTATGGGCCTTSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01GTATGGGCCTTNONE 
J065085B08GTATGGGCCTTNONE 
J065099I23GTATGGGCCTTNONE 
J065169A01GTATGGGCCTTNONE 
J065187N13GTATGGGCCTTNONE 
J065191L18GTATGGGCCTTNONE 
J065194D04GTATGGGCCTTNONE 
J065211M09GTATGGGCCTTNONE 
J065212I02GTATGGGCCTTNONE 
J090003C10GTATGGGCCTTNONE 
J090025O11GTATGGGCCTTNONE 
J090092F10GTATGGGCCTTNONE 
J100055A04GTATGGGCCTTNONE 
J100064A01GTATGGGCCTTNONE 
J100080L02GTATGGGCCTTNONE 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0598900015-040-C12GTATGGGCCATNONE 
AK102627GTATGGGCCATCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521GTATGGGCCATNONE 
J033087C18GTATGGGCCATNONE 
J033099K03GTATGGGCCATNONE 
J065054E02GTATGGGCCATNONE 
J090055O05GTATGGGCCATNONE 
Os07g0611700AK109158GAAGCCCATACTGGCCCAATTPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800GAAGCCCATACTGGCCCAATTNONE 
Os07g0664400006-092-E02AGGGCCCAATGCCCATACNONE 
J065053N04AGGGCCCAATGCCCATACGlucose/ribitol dehydrogenase family protein. 
J065057F09AGGGCCCAATGCCCATACNONE 
J065105C24AGGGCCCAATGCCCATACNONE 
J065192I04AGGGCCCAATGCCCATACNONE 
J065199L10AGGGCCCAATGCCCATACNONE 
J065200C14AGGGCCCAATGCCCATACNONE 
J065214L10AGGGCCCAATGCCCATACNONE 
Os08g0130500006-024-B12CAAGGCCCATACNONE 
006-032-F11CAAGGCCCATACNONE 
006-047-B12CAAGGCCCATACNONE 
006-058-H06CAAGGCCCATACNONE 
006-062-D07CAAGGCCCATACNONE 
006-083-F11CAAGGCCCATACNONE 
006-084-A11CAAGGCCCATACNONE 
006-096-F12CAAGGCCCATACNONE 
006-105-A04CAAGGCCCATACNONE 
006-110-D11CAAGGCCCATACNONE 
011-022-D11CAAGGCCCATACNONE 
AK064857CAAGGCCCATAC60S acidic ribosomal protein P0. 
D21130CAAGGCCCATACNONE 
J013000H12CAAGGCCCATACNONE 
J013024M17CAAGGCCCATACNONE 
J013028H09CAAGGCCCATACNONE 
J013045N22CAAGGCCCATACNONE 
J013092K19CAAGGCCCATACNONE 
J013106L12CAAGGCCCATACNONE 
J013107A03CAAGGCCCATACNONE 
J013109E12CAAGGCCCATACNONE 
J013114N08CAAGGCCCATACNONE 
J013120J12CAAGGCCCATACNONE 
J013121E21CAAGGCCCATACNONE 
J013135P20CAAGGCCCATACNONE 
J023006J08CAAGGCCCATACNONE 
J023014L16CAAGGCCCATACNONE 
J023020N03CAAGGCCCATACNONE 
J023027M24CAAGGCCCATACNONE 
J023029D18CAAGGCCCATACNONE 
J023030A14CAAGGCCCATACNONE 
J023041G23CAAGGCCCATACNONE 
J023049H05CAAGGCCCATACNONE 
J023060I23CAAGGCCCATACNONE 
J023099D07CAAGGCCCATACNONE 
J023104A20CAAGGCCCATACNONE 
J023105F18CAAGGCCCATACNONE 
J023112D21CAAGGCCCATACNONE 
J023122M18CAAGGCCCATACNONE 
J023139J20CAAGGCCCATACNONE 
J023149L20CAAGGCCCATACNONE 
J023150G04CAAGGCCCATACNONE 
J033036G02CAAGGCCCATACNONE 
J033045P13CAAGGCCCATACNONE 
J033046A22CAAGGCCCATACNONE 
J033086H16CAAGGCCCATACNONE 
J033087D07CAAGGCCCATACNONE 
J033089M14CAAGGCCCATACNONE 
J033095F14CAAGGCCCATACNONE 
J033108M01CAAGGCCCATACNONE 
J033117A17CAAGGCCCATACNONE 
J033122F03CAAGGCCCATACNONE 
J033126A04CAAGGCCCATACNONE 
J033144D13CAAGGCCCATACNONE 
J033145D13CAAGGCCCATACNONE 
J043022M09CAAGGCCCATACNONE 
J053025I11CAAGGCCCATACNONE 
J053027K06CAAGGCCCATACNONE 
J053029D15CAAGGCCCATACNONE 
J053048I22CAAGGCCCATACNONE 
J053055I01CAAGGCCCATACNONE 
J053079P07CAAGGCCCATACNONE 
J053090J23CAAGGCCCATACNONE 
J053094C24CAAGGCCCATACNONE 
J065023F18CAAGGCCCATACNONE 
J065029I12CAAGGCCCATACNONE 
J065044B18CAAGGCCCATACNONE 
J065045C07CAAGGCCCATACNONE 
J065063K22CAAGGCCCATACNONE 
J065093D11CAAGGCCCATACNONE 
J065096P09CAAGGCCCATACNONE 
J065099N04CAAGGCCCATACNONE 
J065103K24CAAGGCCCATACNONE 
J065110H12CAAGGCCCATACNONE 
J065132F24CAAGGCCCATACNONE 
J065157K16CAAGGCCCATACNONE 
J065185D11CAAGGCCCATACNONE 
J065202E16CAAGGCCCATACNONE 
J065217D07CAAGGCCCATACNONE 
J075053I19CAAGGCCCATACNONE 
J075055L24CAAGGCCCATACNONE 
J075056H24CAAGGCCCATACNONE 
J075070D02CAAGGCCCATACNONE 
J075084O15CAAGGCCCATACNONE 
J075090F24CAAGGCCCATACNONE 
J075135E03CAAGGCCCATACNONE 
J075174A01CAAGGCCCATACNONE 
J075188F05CAAGGCCCATACNONE 
J075192C17CAAGGCCCATACNONE 
J080001B02CAAGGCCCATACNONE 
J080001C08CAAGGCCCATACNONE 
J080002D15CAAGGCCCATACNONE 
J080002I03CAAGGCCCATACNONE 
J080003E24CAAGGCCCATACNONE 
J080004M10CAAGGCCCATACNONE 
J080005C18CAAGGCCCATACNONE 
J080006A12CAAGGCCCATACNONE 
J080006F04CAAGGCCCATACNONE 
J080006M11CAAGGCCCATACNONE 
J080008J11CAAGGCCCATACNONE 
J080008J22CAAGGCCCATACNONE 
J080009F14CAAGGCCCATACNONE 
J080010B12CAAGGCCCATACNONE 
J080010G14CAAGGCCCATACNONE 
J080010N07CAAGGCCCATACNONE 
J080011D04CAAGGCCCATACNONE 
J080011G10CAAGGCCCATACNONE 
J080011O19CAAGGCCCATACNONE 
J080013K23CAAGGCCCATACNONE 
J080013M09CAAGGCCCATACNONE 
J080013N12CAAGGCCCATACNONE 
J080013O15CAAGGCCCATACNONE 
J080014C13CAAGGCCCATACNONE 
J080014D21CAAGGCCCATACNONE 
J080014F08CAAGGCCCATACNONE 
J080014N08CAAGGCCCATACNONE 
J080014P19CAAGGCCCATACNONE 
J080015L09CAAGGCCCATACNONE 
J080015P15CAAGGCCCATACNONE 
J080018P10CAAGGCCCATACNONE 
J080020C06CAAGGCCCATACNONE 
J080022C14CAAGGCCCATACNONE 
J080022E01CAAGGCCCATACNONE 
J080022P04CAAGGCCCATACNONE 
J080022P10CAAGGCCCATACNONE 
J080023B20CAAGGCCCATACNONE 
J080023G19CAAGGCCCATACNONE 
J080024N15CAAGGCCCATACNONE 
J080025E11CAAGGCCCATACNONE 
J080025G24CAAGGCCCATACNONE 
J080026B01CAAGGCCCATACNONE 
J080026B05CAAGGCCCATACNONE 
J080027L17CAAGGCCCATACNONE 
J080028K02CAAGGCCCATACNONE 
J080029L23CAAGGCCCATACNONE 
J080030D08CAAGGCCCATACNONE 
J080031C03CAAGGCCCATACNONE 
J080031K02CAAGGCCCATACNONE 
J080032C16CAAGGCCCATACNONE 
J080033F10CAAGGCCCATACNONE 
J080033G12CAAGGCCCATACNONE 
J080033K03CAAGGCCCATACNONE 
J080034B03CAAGGCCCATACNONE 
J080034N21CAAGGCCCATACNONE 
J080034O03CAAGGCCCATACNONE 
J080035G10CAAGGCCCATACNONE 
J080038E14CAAGGCCCATACNONE 
J080039A19CAAGGCCCATACNONE 
J080039G10CAAGGCCCATACNONE 
J080039J01CAAGGCCCATACNONE 
J080039J09CAAGGCCCATACNONE 
J080040F07CAAGGCCCATACNONE 
J080040H18CAAGGCCCATACNONE 
J080041E08CAAGGCCCATACNONE 
J080041E16CAAGGCCCATACNONE 
J080041L08CAAGGCCCATACNONE 
J080042A07CAAGGCCCATACNONE 
J080044E02CAAGGCCCATACNONE 
J080045K03CAAGGCCCATACNONE 
J080046O03CAAGGCCCATACNONE 
J080047F08CAAGGCCCATACNONE 
J080048H01CAAGGCCCATACNONE 
J080048I05CAAGGCCCATACNONE 
J080048N06CAAGGCCCATACNONE 
J080050A07CAAGGCCCATACNONE 
J080050B04CAAGGCCCATACNONE 
J080050E21CAAGGCCCATACNONE 
J080051J01CAAGGCCCATACNONE 
J080051K02CAAGGCCCATACNONE 
J080051L02CAAGGCCCATACNONE 
J080052C20CAAGGCCCATACNONE 
J080052I22CAAGGCCCATACNONE 
J080052J21CAAGGCCCATACNONE 
J080052K22CAAGGCCCATACNONE 
J080055A05CAAGGCCCATACNONE 
J080055I12CAAGGCCCATACNONE 
J080056A21CAAGGCCCATACNONE 
J080056N11CAAGGCCCATACNONE 
J080057D02CAAGGCCCATACNONE 
J080058H21CAAGGCCCATACNONE 
J080058P16CAAGGCCCATACNONE 
J080059M03CAAGGCCCATACNONE 
J080059N17CAAGGCCCATACNONE 
J080060F13CAAGGCCCATACNONE 
J080060H06CAAGGCCCATACNONE 
J080060J03CAAGGCCCATACNONE 
J080060O09CAAGGCCCATACNONE 
J080060P22CAAGGCCCATACNONE 
J080061F06CAAGGCCCATACNONE 
J080061H21CAAGGCCCATACNONE 
J080061O13CAAGGCCCATACNONE 
J080062J07CAAGGCCCATACNONE 
J080063A08CAAGGCCCATACNONE 
J080063F19CAAGGCCCATACNONE 
J080063O18CAAGGCCCATACNONE 
J080065D15CAAGGCCCATACNONE 
J080066E13CAAGGCCCATACNONE 
J080068L01CAAGGCCCATACNONE 
J080068P07CAAGGCCCATACNONE 
J080069I21CAAGGCCCATACNONE 
J080070M04CAAGGCCCATACNONE 
J080071E01CAAGGCCCATACNONE 
J080071J08CAAGGCCCATACNONE 
J080071M23CAAGGCCCATACNONE 
J080072A03CAAGGCCCATACNONE 
J080072G18CAAGGCCCATACNONE 
J080075A04CAAGGCCCATACNONE 
J080075E19CAAGGCCCATACNONE 
J080075P18CAAGGCCCATACNONE 
J080076N11CAAGGCCCATACNONE 
J080077A11CAAGGCCCATACNONE 
J080077D22CAAGGCCCATACNONE 
J080077H18CAAGGCCCATACNONE 
J080077L03CAAGGCCCATACNONE 
J080078D02CAAGGCCCATACNONE 
J080078L05CAAGGCCCATACNONE 
J080078N20CAAGGCCCATACNONE 
J080079I20CAAGGCCCATACNONE 
J080081D04CAAGGCCCATACNONE 
J080082A07CAAGGCCCATACNONE 
J080082E24CAAGGCCCATACNONE 
J080084A22CAAGGCCCATACNONE 
J080084E15CAAGGCCCATACNONE 
J080084G06CAAGGCCCATACNONE 
J080086A05CAAGGCCCATACNONE 
J080086F09CAAGGCCCATACNONE 
J080087B11CAAGGCCCATACNONE 
J080087H12CAAGGCCCATACNONE 
J080088I05CAAGGCCCATACNONE 
J080088N08CAAGGCCCATACNONE 
J080088P07CAAGGCCCATACNONE 
J080089A09CAAGGCCCATACNONE 
J080089D21CAAGGCCCATACNONE 
J080089F24CAAGGCCCATACNONE 
J080089H22CAAGGCCCATACNONE 
J080089I04CAAGGCCCATACNONE 
J080090D01CAAGGCCCATACNONE 
J080091F09CAAGGCCCATACNONE 
J080091G18CAAGGCCCATACNONE 
J080091L24CAAGGCCCATACNONE 
J080091M12CAAGGCCCATACNONE 
J080091N12CAAGGCCCATACNONE 
J080093A15CAAGGCCCATACNONE 
J080093C08CAAGGCCCATACNONE 
J080093I08CAAGGCCCATACNONE 
J080093P21CAAGGCCCATACNONE 
J080094E18CAAGGCCCATACNONE 
J080094F15CAAGGCCCATACNONE 
J080094J21CAAGGCCCATACNONE 
J080095A09CAAGGCCCATACNONE 
J080096G05CAAGGCCCATACNONE 
J080096K07CAAGGCCCATACNONE 
J080097M17CAAGGCCCATACNONE 
J080097P21CAAGGCCCATACNONE 
J080302B15CAAGGCCCATACNONE 
J080306J15CAAGGCCCATACNONE 
J080306O13CAAGGCCCATACNONE 
J080307C15CAAGGCCCATACNONE 
J080307I04CAAGGCCCATACNONE 
J080307L05CAAGGCCCATACNONE 
J080308F11CAAGGCCCATACNONE 
J080311C04CAAGGCCCATACNONE 
J080311I07CAAGGCCCATACNONE 
J080312C01CAAGGCCCATACNONE 
J080312O08CAAGGCCCATACNONE 
J080315F14CAAGGCCCATACNONE 
J080318K13CAAGGCCCATACNONE 
J080319A17CAAGGCCCATACNONE 
J090001I01CAAGGCCCATACNONE 
J090002O18CAAGGCCCATACNONE 
J090007A08CAAGGCCCATACNONE 
J090007F22CAAGGCCCATACNONE 
J090008D09CAAGGCCCATACNONE 
J090008L07CAAGGCCCATACNONE 
J090008O08CAAGGCCCATACNONE 
J090012N11CAAGGCCCATACNONE 
J090013M05CAAGGCCCATACNONE 
J090020E08CAAGGCCCATACNONE 
J090020O20CAAGGCCCATACNONE 
J090021I10CAAGGCCCATACNONE 
J090023D07CAAGGCCCATACNONE 
J090023K22CAAGGCCCATACNONE 
J090023O08CAAGGCCCATACNONE 
J090028D21CAAGGCCCATACNONE 
J090029H14CAAGGCCCATACNONE 
J090029L12CAAGGCCCATACNONE 
J090030C05CAAGGCCCATACNONE 
J090031D18CAAGGCCCATACNONE 
J090032G10CAAGGCCCATACNONE 
J090034J22CAAGGCCCATACNONE 
J090034K16CAAGGCCCATACNONE 
J090036D10CAAGGCCCATACNONE 
J090037N17CAAGGCCCATACNONE 
J090043P17CAAGGCCCATACNONE 
J090044L20CAAGGCCCATACNONE 
J090045N16CAAGGCCCATACNONE 
J090048K03CAAGGCCCATACNONE 
J090048K10CAAGGCCCATACNONE 
J090049O07CAAGGCCCATACNONE 
J090055H23CAAGGCCCATACNONE 
J090056G12CAAGGCCCATACNONE 
J090056G16CAAGGCCCATACNONE 
J090059B16CAAGGCCCATACNONE 
J090066H21CAAGGCCCATACNONE 
J090067D22CAAGGCCCATACNONE 
J090072M07CAAGGCCCATACNONE 
J090073J21CAAGGCCCATACNONE 
J090075A15CAAGGCCCATACNONE 
J090079J09CAAGGCCCATACNONE 
J090080L07CAAGGCCCATACNONE 
J090084A03CAAGGCCCATACNONE 
J090085B07CAAGGCCCATACNONE 
J090088H11CAAGGCCCATACNONE 
J090090J12CAAGGCCCATACNONE 
J090091I21CAAGGCCCATACNONE 
J090091L02CAAGGCCCATACNONE 
J090093G18CAAGGCCCATACNONE 
J090094D23CAAGGCCCATACNONE 
J090098L19CAAGGCCCATACNONE 
J100017I22CAAGGCCCATACNONE 
J100018F08CAAGGCCCATACNONE 
J100018G19CAAGGCCCATACNONE 
J100019B05CAAGGCCCATACNONE 
J100019J18CAAGGCCCATACNONE 
J100019L04CAAGGCCCATACNONE 
J100023M06CAAGGCCCATACNONE 
J100024J23CAAGGCCCATACNONE 
J100024P09CAAGGCCCATACNONE 
J100027I05CAAGGCCCATACNONE 
J100029G03CAAGGCCCATACNONE 
J100029K08CAAGGCCCATACNONE 
J100031J17CAAGGCCCATACNONE 
J100037L16CAAGGCCCATACNONE 
J100038C05CAAGGCCCATACNONE 
J100039D19CAAGGCCCATACNONE 
J100041L02CAAGGCCCATACNONE 
J100045B08CAAGGCCCATACNONE 
J100045B15CAAGGCCCATACNONE 
J100047G07CAAGGCCCATACNONE 
J100047P19CAAGGCCCATACNONE 
J100048I15CAAGGCCCATACNONE 
J100049M16CAAGGCCCATACNONE 
J100049P18CAAGGCCCATACNONE 
J100050E21CAAGGCCCATACNONE 
J100051N02CAAGGCCCATACNONE 
J100052M02CAAGGCCCATACNONE 
J100055M24CAAGGCCCATACNONE 
J100056K11CAAGGCCCATACNONE 
J100059F20CAAGGCCCATACNONE 
J100059J15CAAGGCCCATACNONE 
J100068C19CAAGGCCCATACNONE 
J100068G06CAAGGCCCATACNONE 
J100069N02CAAGGCCCATACNONE 
J100073N04CAAGGCCCATACNONE 
J100074B05CAAGGCCCATACNONE 
J100080P13CAAGGCCCATACNONE 
J100083P09CAAGGCCCATACNONE 
J100084B11CAAGGCCCATACNONE 
J100085B07CAAGGCCCATACNONE 
J100086O20CAAGGCCCATACNONE 
J100087B02CAAGGCCCATACNONE 
J100089B14CAAGGCCCATACNONE 
Os08g0463100009-160-D03GCCCATACNONE 
AK063043GCCCATACConserved hypothetical protein. 
Os08g0468400011-057-F06GCAGCCCATACNONE 
AK063363GCAGCCCATACHEC/Ndc80p family protein. 
J100048N11GCAGCCCATACNONE 
Os08g0527400AK119389AGCCCATACCAGCCCACCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0556200009-008-D12GACGGCCCAAGGTATGGGCNONE 
AK121222GACGGCCCAAGGTATGGGCSimilar to Dihydroneopterin aldolase. 
J023090H22GACGGCCCAAGGTATGGGCNONE 
J075027J23GACGGCCCAAGGTATGGGCNONE 
J075032L14GACGGCCCAAGGTATGGGCNONE 
J075053H04GACGGCCCAAGGTATGGGCNONE 
J075171P20GACGGCCCAAGGTATGGGCNONE 
J100057F12GACGGCCCAAGGTATGGGCNONE 
Os08g0558000J080005K14GAAGCCCATACNONE 
Os09g0109500AK067482GTATGGGCTGGCCCAATTUNC-50 family protein. 
J013107E18GTATGGGCTGGCCCAATTNONE 
J023138C21GTATGGGCTGGCCCAATTNONE 
J065117D01GTATGGGCTGGCCCAATTNONE 
J065179F23GTATGGGCTGGCCCAATTNONE 
J100029N14GTATGGGCTGGCCCAATTNONE 
Os09g0463700016-008-D06TAGGCCCATACNONE 
AK060708TAGGCCCATACSimilar to AHM1. 
J090013G05TAGGCCCATACNONE 
Os09g0478400AK107794GTATGGGCCTAConserved hypothetical protein. 
J065082F04GTATGGGCCTANONE 
Os09g0498100015-046-G11AAGGCCCATACNONE 
AK064108AAGGCCCATACSimilar to 30S ribosomal protein S16. 
J065040H21AAGGCCCATACNONE 
J065062F05AAGGCCCATACNONE 
J065147B17AAGGCCCATACNONE 
J075098J22AAGGCCCATACNONE 
Os09g0547300AK102669GTATGGGCNONE 
Os09g0553800009-175-D10GTATGGGCNONE 
009-198-D11GTATGGGCNONE 
J065053G12GTATGGGCNONE 
J065078G05GTATGGGCNONE 
J065114C03GTATGGGCNONE 
J065146M16GTATGGGCNONE 
J065181K24GTATGGGCNONE 
Os09g0558100009-028-D03ACGTGTCGGCCCATACNONE 
014-011-A04ACGTGTCGGCCCATACNONE 
AB030211ACGTGTCGGCCCATACSimilar to Low-temperature induced protein lt101.2. 
AK062410ACGTGTCGGCCCATACNONE 
J065006B17ACGTGTCGGCCCATACNONE 
J065067M15ACGTGTCGGCCCATACNONE 
J065075E19ACGTGTCGGCCCATACNONE 
J075011G16ACGTGTCGGCCCATACNONE 
J075015L22ACGTGTCGGCCCATACNONE 
J075035O11ACGTGTCGGCCCATACNONE 
J075072E15ACGTGTCGGCCCATACNONE 
J075100O22ACGTGTCGGCCCATACNONE 
Os09g0561600AK107166GCCCATACEGF domain containing protein. 
Os11g0146700AK065900GTATGGGCCGTGNONE 
AK072412GTATGGGCCGTGRED-like, C-terminal family protein. 
Os11g0202000AK063427GTATGGGCCTAGGCCCATCCACyclin-like F-box domain containing protein. 
AK122020GTATGGGCCTAGGCCCATCCANONE 
J033111N03GTATGGGCCTAGGCCCATCCANONE 
Os11g0226933J090050D06GTATGGGCDisease resistance protein family protein. 
Os11g0568300016-075-B02AGGGCCCATACNONE 
AK064398AGGGCCCATACHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282AGGGCCCATACNONE 
J033124M10AGGGCCCATACNONE 
J065120I21AGGGCCCATACNONE 
J065144H16AGGGCCCATACNONE 
Os11g0585100AK107496GAGGCCCATACConserved hypothetical protein. 
J065184E24GAGGCCCATACNONE 
Os11g0652600J065013C09GCCCATACNONE 
J065014D21GCCCATACConserved hypothetical protein. 
J065027P08GCCCATACNONE 
J065029L24GCCCATACNONE 
J065102M02GCCCATACNONE 
J065104G24GCCCATACNONE 
J065139D12GCCCATACNONE 
J065140N17GCCCATACNONE 
Os12g0114000009-177-C09GTATGGGCCTANONE 
AK063119GTATGGGCCTAHypothetical protein. 
J065113E12GTATGGGCCTANONE 
Os12g0624800AK103828GCCCATACHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.