version

Summary of OsREG607 (All List)

OrganismOryza sativa  
IDOsREG607  
SequenceGCCCATCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3441  

Entry Sequences (3441 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07GAGGCCCATCANONE 
AK063774GAGGCCCATCATranslocon-associated beta family protein. 
AK099081GAGGCCCATCANONE 
AK099360GAGGCCCATCANONE 
J013096O20GAGGCCCATCANONE 
J023002P14GAGGCCCATCANONE 
J033046F10GAGGCCCATCANONE 
J033084K08GAGGCCCATCANONE 
J065011H22GAGGCCCATCANONE 
J090017O18GAGGCCCATCANONE 
J090047F15GAGGCCCATCANONE 
J090049G20GAGGCCCATCANONE 
Os01g0144600006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
Os01g0147200016-005-F02GGGCCCGGCCCATCANONE 
AK106463GGGCCCGGCCCATCANONE 
AK121921GGGCCCGGCCCATCAIWS1, C-terminal family protein. 
J033098O16GGGCCCGGCCCATCANONE 
J033106E16GGGCCCGGCCCATCANONE 
J043026D12GGGCCCGGCCCATCANONE 
J065070B04GGGCCCGGCCCATCANONE 
J065162L03GGGCCCGGCCCATCANONE 
J065166F01GGGCCCGGCCCATCANONE 
J075030A13GGGCCCGGCCCATCANONE 
J075093O12GGGCCCGGCCCATCANONE 
J075106K15GGGCCCGGCCCATCANONE 
J075107F20GGGCCCGGCCCATCANONE 
J090031F21GGGCCCGGCCCATCANONE 
J090079E17GGGCCCGGCCCATCANONE 
Os01g0508300AK101435TGATGGGCTTANONE 
AK111287TGATGGGCTTAConserved hypothetical protein. 
J065096N08TGATGGGCTTANONE 
J075003F13TGATGGGCTTANONE 
J075014I16TGATGGGCTTANONE 
J075022D23TGATGGGCTTANONE 
J075040N19TGATGGGCTTANONE 
J075121O06TGATGGGCTTANONE 
J075131E17TGATGGGCTTANONE 
J075136N22TGATGGGCTTANONE 
J075147D01TGATGGGCTTANONE 
J075173C07TGATGGGCTTANONE 
J075196L22TGATGGGCTTANONE 
Os01g0514300AK121086TGATGGGCCTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0551100AK067932GCCCATCARibonuclease III domain containing protein. 
J053039G10GCCCATCANONE 
J065019H03GCCCATCANONE 
Os01g0590200011-100-E06TGATGGGCTNONE 
012-005-A05TGATGGGCTNONE 
AK063416TGATGGGCTConserved hypothetical protein. 
AK099235TGATGGGCTNONE 
AK105022TGATGGGCTNONE 
J065030D21TGATGGGCTNONE 
J065031C10TGATGGGCTNONE 
J065105A22TGATGGGCTNONE 
J065173M19TGATGGGCTNONE 
J075188F15TGATGGGCTNONE 
J090050C15TGATGGGCTNONE 
J100058K07TGATGGGCTNONE 
Os01g0596300016-083-D09AGCCCATCANONE 
AK069151AGCCCATCACyclin-like F-box domain containing protein. 
J023007D17AGCCCATCANONE 
J065141M02AGCCCATCANONE 
Os01g0611000003-117-E07AGCCCATCANONE 
006-051-D01AGCCCATCANONE 
006-085-B10AGCCCATCANONE 
012-092-F03AGCCCATCANONE 
AK060682AGCCCATCANONE 
AK072500AGCCCATCASimilar to Unidentified precursor. 
AK105921AGCCCATCANONE 
J023001D07AGCCCATCANONE 
J023075J23AGCCCATCANONE 
J023127H12AGCCCATCANONE 
J033024H20AGCCCATCANONE 
J033025H03AGCCCATCANONE 
J065057F11AGCCCATCANONE 
J065096C07AGCCCATCANONE 
J065103A08AGCCCATCANONE 
J065137L11AGCCCATCANONE 
J065179I16AGCCCATCANONE 
J065197P22AGCCCATCANONE 
J075089M08AGCCCATCANONE 
J090008N14AGCCCATCANONE 
J090011K16AGCCCATCANONE 
J090075K24AGCCCATCANONE 
J090079E08AGCCCATCANONE 
Os01g0618500011-019-D03TGATGGGCCTTNONE 
AK067476TGATGGGCCTTSimilar to RNA helicase (Fragment). 
J013020E19TGATGGGCCTTNONE 
J033046J12TGATGGGCCTTNONE 
J033055D06TGATGGGCCTTNONE 
Os01g0626300016-070-G04TTTTGGGCCCATCANONE 
AK122071TTTTGGGCCCATCASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04TTTTGGGCCCATCANONE 
J033117J08TTTTGGGCCCATCANONE 
J065007O12TTTTGGGCCCATCANONE 
J065020K12TTTTGGGCCCATCANONE 
J065142D24TTTTGGGCCCATCANONE 
J065157K19TTTTGGGCCCATCANONE 
J080307H19TTTTGGGCCCATCANONE 
J080311D16TTTTGGGCCCATCANONE 
J080316C12TTTTGGGCCCATCANONE 
J080316E03TTTTGGGCCCATCANONE 
J100033K16TTTTGGGCCCATCANONE 
J100042J21TTTTGGGCCCATCANONE 
J100051E06TTTTGGGCCCATCANONE 
J100071E22TTTTGGGCCCATCANONE 
Os01g0645000AK108658TGATGGGCSimilar to TIS11 protein (dTIS11). 
Os01g0666500AK102689GAGGCCCATCAConserved hypothetical protein. 
Os01g0667900013-097-A02TCAGCCCATCANONE 
014-011-C01TCAGCCCATCANONE 
AK105335TCAGCCCATCAGlutaredoxin-like, plant II family protein. 
J065156F10TCAGCCCATCANONE 
J065163D22TCAGCCCATCANONE 
J065197J04TCAGCCCATCANONE 
J075122C02TCAGCCCATCANONE 
J100047L16TCAGCCCATCANONE 
Os01g0680100AK109677AGCCCATCAConserved hypothetical protein. 
Os01g0696000AK066735TGGATGGGCCGAAATTTCGGCCCATCANONE 
AK110917TGGATGGGCCGAAATTTCGGCCCATCASimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J013088G11TGGATGGGCCGAAATTTCGGCCCATCANONE 
J013102H08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J033126F08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J065053G13TGGATGGGCCGAAATTTCGGCCCATCANONE 
J075109I06TGGATGGGCCGAAATTTCGGCCCATCANONE 
J100073H07TGGATGGGCCGAAATTTCGGCCCATCANONE 
Os01g0764600AK060621TGATGGGCCGGAFosfomycin resistance kinase FomA family protein. 
J013111L18TGATGGGCCGGANONE 
J013134N08TGATGGGCCGGANONE 
Os01g0765600AK108944TGATGGGCCATEF-Hand type domain containing protein. 
Os01g0767100AK109493TGATGGGCCGGCSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0770500AK071653TCGGCCCATCANONE 
AK099603TCGGCCCATCASimilar to ABC transporter ATP-binding protein. 
Os01g0832200004-009-E08GGTGGGCCCATCANONE 
009-103-F06GGTGGGCCCATCANONE 
AK060017GGTGGGCCCATCANONE 
AK068980GGTGGGCCCATCAConserved hypothetical protein. 
J023085I24GGTGGGCCCATCANONE 
J090016I03GGTGGGCCCATCANONE 
J090078K06GGTGGGCCCATCANONE 
Os01g0848300AK120668AGCCCATCAACGGTCProtein prenyltransferase domain containing protein. 
Os01g0861000AK058707GAAGCCCATCAConserved hypothetical protein. 
Os01g0868300AB004461TGATGGGCTSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7). 
Os01g0881100AK109822GCCCATCAEpsin, N-terminal domain containing protein. 
Os01g0889000AK103621CCAGGCCCATCATetratricopeptide-like helical domain containing protein. 
Os01g0896800AK065268GAGGCCCATCANONE 
AK104693GAGGCCCATCAEukaryotic ribosomal protein L5 family protein. 
J013126P09GAGGCCCATCANONE 
J033046N15GAGGCCCATCANONE 
J090008K02GAGGCCCATCANONE 
J090024F15GAGGCCCATCANONE 
J090074I23GAGGCCCATCANONE 
J090093F03GAGGCCCATCANONE 
J090096N02GAGGCCCATCANONE 
Os01g0924000004-020-C09TGATGGGCCGTANONE 
005-014-A06TGATGGGCCGTANONE 
009-085-G12TGATGGGCCGTANONE 
009-123-A08TGATGGGCCGTANONE 
009-134-A05TGATGGGCCGTANONE 
009-137-F06TGATGGGCCGTANONE 
016-016-B08TGATGGGCCGTANONE 
AF050674TGATGGGCCGTANONE 
AK061690TGATGGGCCGTASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797TGATGGGCCGTANONE 
J013040A15TGATGGGCCGTANONE 
J013104L20TGATGGGCCGTANONE 
J013127E12TGATGGGCCGTANONE 
J013158O05TGATGGGCCGTANONE 
J023012E09TGATGGGCCGTANONE 
J023126L23TGATGGGCCGTANONE 
J023143B03TGATGGGCCGTANONE 
J065005B16TGATGGGCCGTANONE 
J065101J15TGATGGGCCGTANONE 
J065105K16TGATGGGCCGTANONE 
J065155K16TGATGGGCCGTANONE 
J065171M17TGATGGGCCGTANONE 
J065182F07TGATGGGCCGTANONE 
J065187D10TGATGGGCCGTANONE 
J065194I24TGATGGGCCGTANONE 
J065207E24TGATGGGCCGTANONE 
J075001C24TGATGGGCCGTANONE 
J075090O10TGATGGGCCGTANONE 
J075095H17TGATGGGCCGTANONE 
J075109M24TGATGGGCCGTANONE 
J075123C18TGATGGGCCGTANONE 
J075148G22TGATGGGCCGTANONE 
J090009B09TGATGGGCCGTANONE 
J090075K17TGATGGGCCGTANONE 
J090081H23TGATGGGCCGTANONE 
J090097H21TGATGGGCCGTANONE 
J100063P14TGATGGGCCGTANONE 
Os01g0970900011-018-A07TGATGGGCCCATTNONE 
011-022-E12TGATGGGCCCATTNONE 
AK063285TGATGGGCCCATTNONE 
AK101688TGATGGGCCCATTProtein prenyltransferase domain containing protein. 
J100042L01TGATGGGCCCATTNONE 
J100053B11TGATGGGCCCATTNONE 
Os02g0115700AK061923GCCCATCANONE 
Os02g0146700AK105609AGCCCATCASimilar to PSMD2 subunit (Fragment). 
AK119490AGCCCATCANONE 
AK121963AGCCCATCANONE 
Os02g0165500AK060547TGATGGGCCCCConserved hypothetical protein. 
Os02g0179100AK058557CCAGGCCCATCAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CCAGGCCCATCANONE 
Os02g0186700AK064492CTGGCCCATCAConserved hypothetical protein. 
J065210K09CTGGCCCATCANONE 
J075006A17CTGGCCCATCANONE 
J075108C18CTGGCCCATCANONE 
J075153E08CTGGCCCATCANONE 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0193500009-092-G09TCTCGGCCCATCANONE 
AK101237TCTCGGCCCATCAHypothetical protein. 
J033031K13TCTCGGCCCATCANONE 
J033034P12TCTCGGCCCATCANONE 
J080304L19TCTCGGCCCATCANONE 
J100059N21TCTCGGCCCATCANONE 
Os02g0205000AK060003CCAGCCCATCANONE 
AK073514CCAGCCCATCARibosomal protein L19 family protein. 
J065106I07CCAGCCCATCANONE 
Os02g0321900AK058256TAGGCCCATAGCCCATCANONE 
AK062103TAGGCCCATAGCCCATCASimilar to 60S ribosomal protein L10a-1. 
AK102574TAGGCCCATAGCCCATCANONE 
J065176M06TAGGCCCATAGCCCATCANONE 
J075112D24TAGGCCCATAGCCCATCANONE 
Os02g0332200AK067672GAGGCCCATCASimilar to T-complex protein 1 delta subunit. 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0549600009-119-C10ATATGGGCCCATCANONE 
AK066564ATATGGGCCCATCASimilar to 40S ribosomal protein S10-1. 
J013073I17ATATGGGCCCATCANONE 
J013104F19ATATGGGCCCATCANONE 
J013104K21ATATGGGCCCATCANONE 
J013110E05ATATGGGCCCATCANONE 
J023020L11ATATGGGCCCATCANONE 
J023130D08ATATGGGCCCATCANONE 
J033041D03ATATGGGCCCATCANONE 
J033105K14ATATGGGCCCATCANONE 
J065040N14ATATGGGCCCATCANONE 
J065157A09ATATGGGCCCATCANONE 
J075123A20ATATGGGCCCATCANONE 
J075129F06ATATGGGCCCATCANONE 
J075135E04ATATGGGCCCATCANONE 
J075173A10ATATGGGCCCATCANONE 
J080301E09ATATGGGCCCATCANONE 
J080306D10ATATGGGCCCATCANONE 
J080310M21ATATGGGCCCATCANONE 
J080312M09ATATGGGCCCATCANONE 
J080319J08ATATGGGCCCATCANONE 
J090036L14ATATGGGCCCATCANONE 
J090051D01ATATGGGCCCATCANONE 
J090066K07ATATGGGCCCATCANONE 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0564000AJ486976TGATGGGCNONE 
AK073086TGATGGGCSimilar to Glutathione S-transferase. 
J065021E14TGATGGGCNONE 
J065139E02TGATGGGCNONE 
J065165G05TGATGGGCNONE 
J065181H16TGATGGGCNONE 
J065217K07TGATGGGCNONE 
J065218L13TGATGGGCNONE 
J100082K21TGATGGGCNONE 
J100084K19TGATGGGCNONE 
Os02g0564100006-072-A11AGCCCATCANONE 
AK073526AGCCCATCASimilar to EL3 protein. 
AK105951AGCCCATCANONE 
J100045C15AGCCCATCANONE 
Os02g0580300006-029-D02TGATGGGCNONE 
006-107-B02TGATGGGCNONE 
016-064-F09TGATGGGCNONE 
AJ276594TGATGGGCNONE 
AK066506TGATGGGCNONE 
AK068248TGATGGGCSimilar to 14-3-3 protein 6. 
AK104907TGATGGGCNONE 
J013071A03TGATGGGCNONE 
J023060J03TGATGGGCNONE 
J023068F03TGATGGGCNONE 
J033071L14TGATGGGCNONE 
J033079M04TGATGGGCNONE 
J033126P08TGATGGGCNONE 
J033133J01TGATGGGCNONE 
J065075G21TGATGGGCNONE 
J065203B11TGATGGGCNONE 
J075015M24TGATGGGCNONE 
J075063C02TGATGGGCNONE 
J100041M05TGATGGGCNONE 
J100043P11TGATGGGCNONE 
J100073C11TGATGGGCNONE 
J100085L18TGATGGGCNONE 
Os02g0618250009-115-E10CAAGCCCATCANONE 
014-076-A03CAAGCCCATCANONE 
J065096D10CAAGCCCATCASimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CAAGCCCATCANONE 
J075092J11CAAGCCCATCANONE 
J075134F02CAAGCCCATCANONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
Os02g0651300AK061454GCCCATCANONE 
AK099767GCCCATCAConserved hypothetical protein. 
Os02g0673600009-071-C12GCCCATCANONE 
J023037G24GCCCATCANONE 
J023038E07GCCCATCAORMDL family protein. 
J023142L24GCCCATCANONE 
J033115B14GCCCATCANONE 
J075004B15GCCCATCANONE 
J075067J21GCCCATCANONE 
J075072K07GCCCATCANONE 
J075147H21GCCCATCANONE 
J075154F03GCCCATCANONE 
Os02g0697200015-013-B10TGATGGGCCTGATGGGCCTTNONE 
AK059475TGATGGGCCTGATGGGCCTTNONE 
AK102993TGATGGGCCTGATGGGCCTTConserved hypothetical protein. 
J033079I18TGATGGGCCTGATGGGCCTTNONE 
J033082A14TGATGGGCCTGATGGGCCTTNONE 
J065047H08TGATGGGCCTGATGGGCCTTNONE 
J065131M14TGATGGGCCTGATGGGCCTTNONE 
Os02g0744100006-070-H12TGATGGGCCTANONE 
006-115-C05TGATGGGCCTANONE 
AK061274TGATGGGCCTASAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0767900009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
Os02g0776800AB042415GACGGCCCATCANONE 
AK072308GACGGCCCATCAReplication protein A 70kDa. 
AK101212GACGGCCCATCANONE 
J033031B02GACGGCCCATCANONE 
J090004E18GACGGCCCATCANONE 
J090084C24GACGGCCCATCANONE 
Os02g0782200AK070439TCTGGCCCATCANONE 
AK101869TCTGGCCCATCANOT2/NOT3/NOT5 domain containing protein. 
Os02g0782500013-043-A07TGATGGGCTNONE 
013-068-B10TGATGGGCTNONE 
013-093-A08TGATGGGCTNONE 
014-083-C12TGATGGGCTNONE 
AK063602TGATGGGCTNONE 
AK119261TGATGGGCTSimilar to Small heat stress protein class CIII. 
J065013N12TGATGGGCTNONE 
J075136E01TGATGGGCTNONE 
J075149G04TGATGGGCTNONE 
Os02g0787100Os02g0787100TGATGGGCCTTProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0788400AK060351AAAAGCCCATCANONE 
AK103497AAAAGCCCATCASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0819500AK058926TGATGGGCCAANONE 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
J023128P21AACTGGGCCTTTGATGGGCTTTNONE 
J053097O16AACTGGGCCTTTGATGGGCTTTNONE 
J065012I02AACTGGGCCTTTGATGGGCTTTNONE 
J065049C06AACTGGGCCTTTGATGGGCTTTNONE 
J065051H02AACTGGGCCTTTGATGGGCTTTNONE 
J065069A13AACTGGGCCTTTGATGGGCTTTNONE 
J065082E04AACTGGGCCTTTGATGGGCTTTNONE 
J065102N09AACTGGGCCTTTGATGGGCTTTNONE 
J065157O10AACTGGGCCTTTGATGGGCTTTNONE 
J065188N23AACTGGGCCTTTGATGGGCTTTNONE 
J065190J11AACTGGGCCTTTGATGGGCTTTNONE 
J065202M09AACTGGGCCTTTGATGGGCTTTNONE 
Os02g0827900AK099911TGATGGGCCAGCGGCCCATACSimilar to Signal peptidase 18 subunit (Fragment). 
Os02g0830100AK059746TGATGGGCCATNONE 
Os03g0125000006-032-D09TGATGGGCCTANONE 
006-032-D09TGATGGGCCTAAGGCCCAAATNONE 
006-033-B05TGATGGGCCTANONE 
006-033-B05TGATGGGCCTAAGGCCCAAATNONE 
006-048-G06TGATGGGCCTANONE 
006-048-G06TGATGGGCCTAAGGCCCAAATNONE 
006-048-G09TGATGGGCCTANONE 
006-048-G09TGATGGGCCTAAGGCCCAAATNONE 
006-052-D09TGATGGGCCTANONE 
006-052-D09TGATGGGCCTAAGGCCCAAATNONE 
006-072-A04TGATGGGCCTANONE 
006-072-A04TGATGGGCCTAAGGCCCAAATNONE 
006-076-F12TGATGGGCCTANONE 
006-076-F12TGATGGGCCTAAGGCCCAAATNONE 
006-080-B03TGATGGGCCTANONE 
006-080-B03TGATGGGCCTAAGGCCCAAATNONE 
006-092-H03TGATGGGCCTANONE 
006-092-H03TGATGGGCCTAAGGCCCAAATNONE 
006-103-G04TGATGGGCCTANONE 
006-103-G04TGATGGGCCTAAGGCCCAAATNONE 
009-079-E01TGATGGGCCTANONE 
009-079-E01TGATGGGCCTAAGGCCCAAATNONE 
009-150-F03TGATGGGCCTANONE 
009-150-F03TGATGGGCCTAAGGCCCAAATNONE 
AF095708TGATGGGCCTANONE 
AF095708TGATGGGCCTAAGGCCCAAATNONE 
AK059557TGATGGGCCTANONE 
AK059557TGATGGGCCTAAGGCCCAAATNONE 
AK070779TGATGGGCCTASimilar to 50S ribosomal protein L5, chloroplast. 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999TGATGGGCCTANONE 
AK098999TGATGGGCCTAAGGCCCAAATNONE 
AK104137TGATGGGCCTANONE 
AK104137TGATGGGCCTAAGGCCCAAATNONE 
J065002D07TGATGGGCCTANONE 
J065002D07TGATGGGCCTAAGGCCCAAATNONE 
J065167E24TGATGGGCCTANONE 
J065167E24TGATGGGCCTAAGGCCCAAATNONE 
J075199O14TGATGGGCCTANONE 
J075199O14TGATGGGCCTAAGGCCCAAATNONE 
J100083L01TGATGGGCCTANONE 
J100083L01TGATGGGCCTAAGGCCCAAATNONE 
Os03g0143800003-111-C11TGATGGGCNONE 
015-013-D12TGATGGGCCytoplasmic fragile X mental retardation protein interacting protein family protein. 
J075099N09TGATGGGCNONE 
Os03g0168200AK099530TGATGGGCCGTGConserved hypothetical protein. 
Os03g0187350J065013L15TGATGGGCHypothetical protein. 
J065049N06TGATGGGCNONE 
J065090E15TGATGGGCNONE 
J065112I11TGATGGGCNONE 
J065114I10TGATGGGCNONE 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0225600AK058500TGATGGGCCAAConserved oligomeric complex COG6 family protein. 
Os03g0248300009-063-H02AAAGCCCATCANONE 
AK062535AAAGCCCATCASimilar to Cytochrome P450 76C4 (EC 1.14.-.-). 
Os03g0249200009-103-B08GCCCATCANONE 
AK069944GCCCATCAClass I peptide chain release factor domain containing protein. 
J065166E13GCCCATCANONE 
Os03g0260100AK066143GAGGCCCATCAConserved hypothetical protein. 
AK066143TGATGGGCCCACAConserved hypothetical protein. 
Os03g0272400009-134-B08CAAGCCCATCANONE 
AK070454CAAGCCCATCAHypothetical protein. 
J023050K07CAAGCCCATCANONE 
J075075P06CAAGCCCATCANONE 
J090098L07CAAGCCCATCANONE 
Os03g0282900006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0297800AK107121TGATGGGCTProtein kinase-like domain containing protein. 
Os03g0305400009-198-D04GAAGCCCATCANONE 
013-012-C06GAAGCCCATCANONE 
014-034-D01GAAGCCCATCANONE 
AK071397GAAGCCCATCAUniversal stress protein (Usp) family protein. 
J023012O22GAAGCCCATCANONE 
J023097A13GAAGCCCATCANONE 
J023107P16GAAGCCCATCANONE 
J023113C14GAAGCCCATCANONE 
Os03g0312600AK073391TGATGGGCCAGSimilar to XPA-binding protein 1 (HUSSY-23). 
AK073391TGATGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0333000AK109811TGATGGGCCGAGConserved hypothetical protein. 
J065152D04TGATGGGCCGAGNONE 
J090011B05TGATGGGCCGAGNONE 
Os03g0333100AK101050CTCGGCCCATCAProtein of unknown function DUF663 domain containing protein. 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0339100AK111641TGATGGGCCGGGSimilar to PRL1 protein. 
Os03g0347700AK110492AGCCCATCANPH3 domain containing protein. 
Os03g0395000AK073283TTGGCCCATCASimilar to Heme oxygenase 2 (Fragment). 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12TGGTGGGCCCTGGCCCATCANONE 
Os03g0598200AK068322ACAGCCCATCANop14-like protein family protein. 
Os03g0622100AK063506GCCCATCATranscriptional factor B3 family protein. 
Os03g0622300AK107931AGCCCATCAConserved hypothetical protein. 
J065184K14AGCCCATCANONE 
Os03g0626250J075100A11CGGGCCCATCANONE 
J075100A11TTGGCCCATCANONE 
J075134H15CGGGCCCATCANONE 
J075134H15TTGGCCCATCANONE 
J075142J02CGGGCCCATCANONE 
J075142J02TTGGCCCATCANONE 
J075181A14CGGGCCCATCANONE 
J075181A14TTGGCCCATCANONE 
J075192K17CGGGCCCATCANONE 
J075192K17TTGGCCCATCANONE 
J090046B06CGGGCCCATCANONE 
J090046B06TTGGCCCATCANONE 
Os03g0685900009-026-A09CTGGCCCATCANONE 
009-145-C09CTGGCCCATCANONE 
AK062981CTGGCCCATCAConserved hypothetical protein. 
J065001D12CTGGCCCATCANONE 
J065023B10CTGGCCCATCANONE 
J065041E10CTGGCCCATCANONE 
J065046C01CTGGCCCATCANONE 
J065146I22CTGGCCCATCANONE 
J065184F20CTGGCCCATCANONE 
J075011E15CTGGCCCATCANONE 
J075048H17CTGGCCCATCANONE 
J075070H15CTGGCCCATCANONE 
J075133C01CTGGCCCATCANONE 
J075170D02CTGGCCCATCANONE 
J090001G08CTGGCCCATCANONE 
J090026B09CTGGCCCATCANONE 
J100055M03CTGGCCCATCANONE 
Os03g0708400006-108-F11TGATGGGCNONE 
AK066216TGATGGGCProtein of unknown function DUF1295 family protein. 
Os03g0711300AK060694TGATGGGCNONE 
Os03g0721700AK106706CCAGGCCCATCAProtein of unknown function DUF569 family protein. 
Os03g0746400AK063445TGATGGGCTGCProtein prenyltransferase domain containing protein. 
AK070923TGATGGGCTGCNONE 
J065008K24TGATGGGCTGCNONE 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
006-034-B06TAGGCCCATCANONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01TAGGCCCATCANONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08TAGGCCCATCANONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK067446TAGGCCCATCASimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK068388TAGGCCCATCANONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412TAGGCCCATCANONE 
Os03g0807800AK064984TGATGGGCCTGASimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TGATGGGCCTGANONE 
J065015J20TGATGGGCCTGANONE 
J065122L11TGATGGGCCTGANONE 
J065217E10TGATGGGCCTGANONE 
J075023C02TGATGGGCCTGANONE 
J075102O04TGATGGGCCTGANONE 
J080024G24TGATGGGCCTGANONE 
J080033F02TGATGGGCCTGANONE 
J080047M13TGATGGGCCTGANONE 
J080048A22TGATGGGCCTGANONE 
J080056E06TGATGGGCCTGANONE 
J080064O11TGATGGGCCTGANONE 
Os03g0828100009-088-D04CTGGCCCATCANONE 
009-125-F01CTGGCCCATCANONE 
009-169-C06CTGGCCCATCANONE 
AK059132CTGGCCCATCANONE 
AK062799CTGGCCCATCANONE 
AK099043CTGGCCCATCASimilar to 50S ribosomal protein L18. 
J013146D01CTGGCCCATCANONE 
J065057J16CTGGCCCATCANONE 
Os03g0831100AK103115TGATGGGCCTAArmadillo-like helical domain containing protein. 
J033119F15TGATGGGCCTANONE 
J065011M19TGATGGGCCTANONE 
J075019I08TGATGGGCCTANONE 
J075047A01TGATGGGCCTANONE 
J075096P21TGATGGGCCTANONE 
J075121I05TGATGGGCCTANONE 
J075121I07TGATGGGCCTANONE 
J090063F13TGATGGGCCTANONE 
J090068F16TGATGGGCCTANONE 
J090094E14TGATGGGCCTANONE 
Os03g0837300AK111243TTGGCCCATCANONE 
AK121140TTGGCCCATCANicotinate phosphoribosyltransferase and related family protein. 
AY214337TTGGCCCATCANONE 
J023077G12TTGGCCCATCANONE 
J023078M10TTGGCCCATCANONE 
J033031B10TTGGCCCATCANONE 
J033067L18TTGGCCCATCANONE 
J043005P09TTGGCCCATCANONE 
J090013J15TTGGCCCATCANONE 
J090042E10TTGGCCCATCANONE 
J090045A20TTGGCCCATCANONE 
J100022H02TTGGCCCATCANONE 
Os03g0840200AK067797TCAGCCCATCATolB, C-terminal domain containing protein. 
AK100408TCAGCCCATCANONE 
J075027I23TCAGCCCATCANONE 
J075049N10TCAGCCCATCANONE 
J100058E07TCAGCCCATCANONE 
Os03g0841100AK120279TGATGGGCEGF domain containing protein. 
Os03g0847500AK073859TGATGGGCCTTSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0856200009-070-B07GACGGCCCATCANONE 
009-070-B07GCAGCCCATCANONE 
009-135-H05GACGGCCCATCANONE 
009-135-H05GCAGCCCATCANONE 
J100067D22GACGGCCCATCANONE 
J100067D22GCAGCCCATCANONE 
J100067L13GACGGCCCATCANONE 
J100067L13GCAGCCCATCANONE 
J100073I07GACGGCCCATCANONE 
J100073I07GCAGCCCATCANONE 
J100080D01GACGGCCCATCANONE 
J100080D01GCAGCCCATCANONE 
Os04g0378200AK103076TGATGGGCCGAGSterile alpha motif SAM domain containing protein. 
J033118E02TGATGGGCCGAGNONE 
J065065F15TGATGGGCCGAGNONE 
J090080I24TGATGGGCCGAGNONE 
Os04g0388900AK063224CAAGGCCCGGCCCATCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CAAGGCCCGGCCCATCANONE 
J065148P22CAAGGCCCGGCCCATCANONE 
J075040G12CAAGGCCCGGCCCATCANONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0465700016-043-B01AAGGCCCATCANONE 
AK064379AAGGCCCATCARNA dependent RNA polymerase family protein. 
Os04g0481400J065055O14TGATGGGCNONE 
J065070K24TGATGGGCNONE 
J065164A14TGATGGGCNONE 
J065192B03TGATGGGCNONE 
Os04g0486400AJ535489TGATGGGCCTGANONE 
AK103296TGATGGGCCTGARML1 protein. 
J013045L03TGATGGGCCTGANONE 
J013045M03TGATGGGCCTGANONE 
J033034L24TGATGGGCCTGANONE 
J033125B02TGATGGGCCTGANONE 
J075001G08TGATGGGCCTGANONE 
J075011I16TGATGGGCCTGANONE 
J075033M08TGATGGGCCTGANONE 
J075044G01TGATGGGCCTGANONE 
J075047D04TGATGGGCCTGANONE 
J075061J09TGATGGGCCTGANONE 
J075085L07TGATGGGCCTGANONE 
J075087D20TGATGGGCCTGANONE 
J075117A04TGATGGGCCTGANONE 
J075134H06TGATGGGCCTGANONE 
J075184J12TGATGGGCCTGANONE 
Os04g0512300AK071791TGATGGGCArp2/3 complex, 34kDa subunit p34-Arc family protein. 
J023012N15TGATGGGCNONE 
J023114E05TGATGGGCNONE 
J075035B21TGATGGGCNONE 
J075173E11TGATGGGCNONE 
J075199P08TGATGGGCNONE 
Os04g0551300AK103502TGATGGGCCAASimilar to Growth regulator like protein. 
Os04g0551800016-049-G12CAAGGCCCATCANONE 
AK121568CAAGGCCCATCASimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CAAGGCCCATCANONE 
J013111B11CAAGGCCCATCANONE 
J013121H23CAAGGCCCATCANONE 
J023012A17CAAGGCCCATCANONE 
J023092M05CAAGGCCCATCANONE 
J033026P14CAAGGCCCATCANONE 
J033033C10CAAGGCCCATCANONE 
J033033M10CAAGGCCCATCANONE 
J033035C24CAAGGCCCATCANONE 
J033052E19CAAGGCCCATCANONE 
J033140K19CAAGGCCCATCANONE 
J065036F18CAAGGCCCATCANONE 
J065067L12CAAGGCCCATCANONE 
J065095G09CAAGGCCCATCANONE 
J065115B08CAAGGCCCATCANONE 
J065218E24CAAGGCCCATCANONE 
J090002N13CAAGGCCCATCANONE 
J090008B12CAAGGCCCATCANONE 
J090016F24CAAGGCCCATCANONE 
J090019H14CAAGGCCCATCANONE 
J090020G20CAAGGCCCATCANONE 
J090029L18CAAGGCCCATCANONE 
J090057C23CAAGGCCCATCANONE 
J090073H23CAAGGCCCATCANONE 
J090081C16CAAGGCCCATCANONE 
J090081E21CAAGGCCCATCANONE 
J090084L14CAAGGCCCATCANONE 
J090086M01CAAGGCCCATCANONE 
J090089E16CAAGGCCCATCANONE 
J100031P12CAAGGCCCATCANONE 
J100090N23CAAGGCCCATCANONE 
Os04g0581000AK061337TGATGGGCCGGCSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142TGATGGGCCGGCNONE 
Os04g0584600006-042-D11CAAGCCCATCANONE 
006-065-G07CAAGCCCATCANONE 
AB042550CAAGCCCATCANONE 
AK059786CAAGCCCATCANONE 
AK061881CAAGCCCATCANONE 
AK066495CAAGCCCATCASimilar to Calcium dependent protein kinase. 
J090067J05CAAGCCCATCANONE 
J100037I23CAAGCCCATCANONE 
Os04g0586100009-190-F11GCCCATCANONE 
AK063206GCCCATCAProtein of unknown function DUF581 family protein. 
Os04g0611300009-006-G08TAGGCCCATCANONE 
009-011-C01TAGGCCCATCANONE 
009-036-B09TAGGCCCATCANONE 
009-116-G09TAGGCCCATCANONE 
009-126-E09TAGGCCCATCANONE 
009-132-F09TAGGCCCATCANONE 
009-151-G07TAGGCCCATCANONE 
009-155-C07TAGGCCCATCANONE 
009-163-G01TAGGCCCATCANONE 
009-169-G08TAGGCCCATCANONE 
009-191-B02TAGGCCCATCANONE 
009-196-A08TAGGCCCATCANONE 
009-198-E07TAGGCCCATCANONE 
014-015-F04TAGGCCCATCANONE 
015-087-H04TAGGCCCATCANONE 
AK062605TAGGCCCATCANONE 
AK063022TAGGCCCATCAConserved hypothetical protein. 
AK066749TAGGCCCATCANONE 
AK104924TAGGCCCATCANONE 
J065002M20TAGGCCCATCANONE 
J065045L23TAGGCCCATCANONE 
J065101E05TAGGCCCATCANONE 
J065140J23TAGGCCCATCANONE 
J065179G11TAGGCCCATCANONE 
J065191B18TAGGCCCATCANONE 
J065192E03TAGGCCCATCANONE 
J065199H21TAGGCCCATCANONE 
J075067F01TAGGCCCATCANONE 
J075089L01TAGGCCCATCANONE 
J075147K22TAGGCCCATCANONE 
J080069G23TAGGCCCATCANONE 
J100053D10TAGGCCCATCANONE 
J100078C10TAGGCCCATCANONE 
Os04g0614500AK100259TGATGGGCCGTCAminotransferase class-III family protein. 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0638800AK070319AAAGCCCATCAProtein of unknown function DUF617, plant family protein. 
AK070319TGATGGGCTProtein of unknown function DUF617, plant family protein. 
AK071753AAAGCCCATCANONE 
AK071753TGATGGGCTNONE 
Os04g0658600AK064729TACGGCCCATCANONE 
AK119253TACGGCCCATCANucleolar, Nop52 family protein. 
J075132J07TACGGCCCATCANONE 
J075157N21TACGGCCCATCANONE 
Os04g0681600AK105243CAAGCCCATCAProtein of unknown function DUF580 family protein. 
Os05g0103100AK103317AAATGGGCTGATGGGCTranslocon-associated beta family protein. 
J033125H15AAATGGGCTGATGGGCNONE 
J065021L01AAATGGGCTGATGGGCNONE 
J065029M01AAATGGGCTGATGGGCNONE 
J065089F17AAATGGGCTGATGGGCNONE 
J065112N04AAATGGGCTGATGGGCNONE 
J065163L03AAATGGGCTGATGGGCNONE 
J065175B04AAATGGGCTGATGGGCNONE 
J065192E02AAATGGGCTGATGGGCNONE 
J075046C20AAATGGGCTGATGGGCNONE 
J075192A01AAATGGGCTGATGGGCNONE 
J100018H13AAATGGGCTGATGGGCNONE 
J100067K20AAATGGGCTGATGGGCNONE 
J100080N03AAATGGGCTGATGGGCNONE 
Os05g0123400AK069521CACGGCCCATCAConserved hypothetical protein. 
J023022O05CACGGCCCATCANONE 
Os05g0134400006-081-H06AGCCCATCANONE 
006-116-E07AGCCCATCANONE 
009-037-B01AGCCCATCANONE 
009-151-H03AGCCCATCANONE 
016-005-E01AGCCCATCANONE 
AK061809AGCCCATCAHaem peroxidase, plant/fungal/bacterial family protein. 
AK119205AGCCCATCANONE 
AK122031AGCCCATCANONE 
J013088F04AGCCCATCANONE 
J013106F18AGCCCATCANONE 
J033139E06AGCCCATCANONE 
J065152O06AGCCCATCANONE 
J090086A11AGCCCATCANONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0161400AK105485TGATGGGCCAAPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0182800AK121273TGATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0243300AK108395GAGGCCCATCASimilar to 50S ribosomal protein L13. 
J090098J16GAGGCCCATCANONE 
J100042H03GAGGCCCATCANONE 
J100088D02GAGGCCCATCANONE 
Os05g0295800AK070232AAGGCCCATCASimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03AAGGCCCATCANONE 
Os05g0361700AJ575218GCGGCCCATCANONE 
AK100184GCGGCCCATCASimilar to EREBP-2 protein (Fragment). 
AK111676GCGGCCCATCANONE 
J013155B14GCGGCCCATCANONE 
J065073N01GCGGCCCATCANONE 
J065161J12GCGGCCCATCANONE 
J075074A07GCGGCCCATCANONE 
J100029H13GCGGCCCATCANONE 
Os05g0377000Os05g0377000ACCGGCCCATCASimilar to Acyl carrier protein (ACP). 
Os05g0378900AK103841ACAGCCCATCAConserved hypothetical protein. 
AK103841CCAGCCCATCAConserved hypothetical protein. 
J033148I18ACAGCCCATCANONE 
J033148I18CCAGCCCATCANONE 
J065085F12ACAGCCCATCANONE 
J065085F12CCAGCCCATCANONE 
J075041H24ACAGCCCATCANONE 
J075041H24CCAGCCCATCANONE 
J075180P06ACAGCCCATCANONE 
J075180P06CCAGCCCATCANONE 
Os05g0379300AK109293TTTCGGCCCATCAConserved hypothetical protein. 
Os05g0406100AK069515TGATGGGCCGCInosine/uridine-preferring nucleoside hydrolase domain containing protein. 
J023019G14TGATGGGCCGCNONE 
Os05g0481000AK059369TGATGGGCCGAGCN5-related N-acetyltransferase domain containing protein. 
AK068619TGATGGGCCGANONE 
Os05g0513800015-098-E01GCCCATCANONE 
AB029509GCCCATCANONE 
AK101866GCCCATCASmall GTP-binding protein OsRac2. 
J033028B01GCCCATCANONE 
J033070C18GCCCATCANONE 
J033127F06GCCCATCANONE 
Os05g0526800016-054-G05ATATGGGCTGATGGGCCATNONE 
AK066551ATATGGGCTGATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ATATGGGCTGATGGGCCATNONE 
J013095M02ATATGGGCTGATGGGCCATNONE 
J065195O21ATATGGGCTGATGGGCCATNONE 
Os05g0527800006-028-D01GCCCATCANONE 
AK060997GCCCATCANONE 
AK068336GCCCATCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os05g0531500AK120867GCCCATCAProtein of unknown function DUF616 family protein. 
Os05g0541500AK101190TAGGCCCATCACyclin-like F-box domain containing protein. 
AK101531TAGGCCCATCANONE 
J033030F10TAGGCCCATCANONE 
Os05g0542900AK102925TGATGGGCCGAVirulence factor, pectin lyase fold family protein. 
Os05g0554100AK073023GCCCAGCCCATCARibosomal protein L7/L12 family protein. 
AK101756GCCCAGCCCATCANONE 
Os05g0566500AK073468TGATGGGCTNONE 
AK099052TGATGGGCTSimilar to Initiation factor 3d (Fragment). 
AK104093TGATGGGCTNONE 
J090025I18TGATGGGCTNONE 
Os05g0577200AK069756TGATGGGCCGTGGCarboxylesterase, type B family protein. 
Os06g0103400009-138-H04TAGGCCCATCANONE 
AK067021TAGGCCCATCANucleic acid-binding, OB-fold domain containing protein. 
AK071627TAGGCCCATCANONE 
J080307A01TAGGCCCATCANONE 
Os06g0116400006-082-G06ATGGCCCATCANONE 
AK058327ATGGCCCATCANONE 
AK105979ATGGCCCATCAHigh-affinity nickel-transporter family protein. 
J065083I24ATGGCCCATCANONE 
J100072O18ATGGCCCATCANONE 
Os06g0116800AK058985GAGGCCCATCASimilar to GFA2. 
AK120746GAGGCCCATCANONE 
Os06g0168000AK059250TGATGGGCTTCNONE 
AK099356TGATGGGCTTCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19TGATGGGCTTCNONE 
J033097H04TGATGGGCTTCNONE 
J075087M11TGATGGGCTTCNONE 
J075146H06TGATGGGCTTCNONE 
J075188H11TGATGGGCTTCNONE 
J090071D03TGATGGGCTTCNONE 
J090097L20TGATGGGCTTCNONE 
J100051M05TGATGGGCTTCNONE 
J100082H13TGATGGGCTTCNONE 
Os06g0192500AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0200800AK111302TGATGGGCConserved hypothetical protein. 
J100065C17TGATGGGCNONE 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0251000J033111L12GCCGGCCCATCANONE 
J043001C08GCCGGCCCATCAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0328800AK065974GCCCATCANONE 
AK101557GCCCATCAProtein of unknown function DUF23 family protein. 
J013049H12GCCCATCANONE 
J033050C11GCCCATCANONE 
Os06g0542300J100050D16TTGGCCCATCAHeavy metal transport/detoxification protein domain containing protein. 
J100052L04TTGGCCCATCANONE 
Os06g0543400AK065374TGATGGGCCTCSimilar to CBL-interacting serine/threonine-protein kinase 11 (EC 2.7.1.37) (SOS2-like protein kinase PKS5) (SOS-interacting protein 4) (SNF1- related kinase 3.22). 
J065019L09TGATGGGCCTCNONE 
J065041F08TGATGGGCCTCNONE 
J065081P20TGATGGGCCTCNONE 
J065087C11TGATGGGCCTCNONE 
J065136F12TGATGGGCCTCNONE 
J065152F17TGATGGGCCTCNONE 
J065152M10TGATGGGCCTCNONE 
J065168F13TGATGGGCCTCNONE 
J065169K12TGATGGGCCTCNONE 
J065171C10TGATGGGCCTCNONE 
J065180B14TGATGGGCCTCNONE 
J090014B17TGATGGGCCTCNONE 
Os06g0547900AK100950TACGGCCCATCASimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665TACGGCCCATCANONE 
J023139I22TACGGCCCATCANONE 
J090066J10TACGGCCCATCANONE 
Y13437TACGGCCCATCANONE 
Os06g0581300AK070987TGATGGGCCCTProtein of unknown function DUF1475 family protein. 
AK073185TGATGGGCCCTNONE 
J065209C10TGATGGGCCCTNONE 
J075060B03TGATGGGCCCTNONE 
J075117M08TGATGGGCCCTNONE 
J075126E04TGATGGGCCCTNONE 
J075189G04TGATGGGCCCTNONE 
J075189L16TGATGGGCCCTNONE 
J100061E16TGATGGGCCCTNONE 
Os06g0600100AK065619ACAGCCCATCASimilar to TAT-binding protein homolog (Fragment). 
Os06g0622300AK064549TGATGGGCNONE 
AK071559TGATGGGCNONE 
Os06g0639000AK102470TGGGCCTGATGGGCTNONE 
J013106M02TGGGCCTGATGGGCTNONE 
J100051K23TGGGCCTGATGGGCTNONE 
Os06g0670100AK102577CTGGCCCATCAHypothetical protein. 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0688100AK063450CAGGCCCATCANONE 
AK101144CAGGCCCATCARNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0704900AK103054AGCCCATCASimilar to Cell division-like protein. 
J033117I21AGCCCATCANONE 
Os06g0708900AK100402TCGGCCCATCAConserved hypothetical protein. 
Os06g0714100AK121079AGCCCATCAComplex 1 LYR protein family protein. 
J023062M13AGCCCATCANONE 
J043020D18AGCCCATCANONE 
J065073A17AGCCCATCANONE 
J065158D09AGCCCATCANONE 
J065195H04AGCCCATCANONE 
J065214P13AGCCCATCANONE 
J080079I22AGCCCATCANONE 
J100031M06AGCCCATCANONE 
J100036I12AGCCCATCANONE 
Os06g0724300012-097-C06TGATGGGCTNONE 
AK059191TGATGGGCTNONE 
AK121941TGATGGGCTProtein of unknown function DUF616 family protein. 
J023084D02TGATGGGCTNONE 
J033107E19TGATGGGCTNONE 
Os07g0106000015-044-D09TGATGGGCTGCNONE 
AK064319TGATGGGCTGCNONE 
Os07g0110800009-107-B11GGCCCGGCCCATCANONE 
AK062792GGCCCGGCCCATCAConserved hypothetical protein. 
J053026P09GGCCCGGCCCATCANONE 
J053074L17GGCCCGGCCCATCANONE 
J065057E24GGCCCGGCCCATCANONE 
J065149B18GGCCCGGCCCATCANONE 
J075002O20GGCCCGGCCCATCANONE 
J090002C13GGCCCGGCCCATCANONE 
Os07g0110900AK058987TGATGGGCCGGGCCConserved hypothetical protein. 
J065032L02TGATGGGCCGGGCCNONE 
J065074H06TGATGGGCCGGGCCNONE 
J065168M23TGATGGGCCGGGCCNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0113200AK108787GGCCCGGCCCATCAConserved hypothetical protein. 
J065090J04GGCCCGGCCCATCANONE 
J065116K24GGCCCGGCCCATCANONE 
J065161F14GGCCCGGCCCATCANONE 
J065203E23GGCCCGGCCCATCANONE 
Os07g0123300AK108490GCAGCCCATCAConserved hypothetical protein. 
J065197L01GCAGCCCATCANONE 
J065206N07GCAGCCCATCANONE 
J080011N05GCAGCCCATCANONE 
J080021N11GCAGCCCATCANONE 
J080025M24GCAGCCCATCANONE 
J080031E13GCAGCCCATCANONE 
J080047B07GCAGCCCATCANONE 
J080061L03GCAGCCCATCANONE 
J080062C18GCAGCCCATCANONE 
J080063E20GCAGCCCATCANONE 
J080063O12GCAGCCCATCANONE 
J080070D20GCAGCCCATCANONE 
J080074J17GCAGCCCATCANONE 
J080076K17GCAGCCCATCANONE 
J080079K21GCAGCCCATCANONE 
J080080D02GCAGCCCATCANONE 
J080088E12GCAGCCCATCANONE 
J080092I18GCAGCCCATCANONE 
Os07g0150200009-152-C07CTCGGCCCATCANONE 
009-152-C07TGATGGGCCTCNONE 
AK058680CTCGGCCCATCANONE 
AK058680TGATGGGCCTCNONE 
AK121635CTCGGCCCATCASimilar to 40S ribosomal protein S12-1. 
AK121635TGATGGGCCTCSimilar to 40S ribosomal protein S12-1. 
J033051C16CTCGGCCCATCANONE 
J033051C16TGATGGGCCTCNONE 
J033123H15CTCGGCCCATCANONE 
J033123H15TGATGGGCCTCNONE 
J065093I01CTCGGCCCATCANONE 
J065093I01TGATGGGCCTCNONE 
J065197C05CTCGGCCCATCANONE 
J065197C05TGATGGGCCTCNONE 
J075037B11CTCGGCCCATCANONE 
J075037B11TGATGGGCCTCNONE 
J075114B08CTCGGCCCATCANONE 
J075114B08TGATGGGCCTCNONE 
J075123N01CTCGGCCCATCANONE 
J075123N01TGATGGGCCTCNONE 
J075129O04CTCGGCCCATCANONE 
J075129O04TGATGGGCCTCNONE 
J075160H17CTCGGCCCATCANONE 
J075160H17TGATGGGCCTCNONE 
J075166H17CTCGGCCCATCANONE 
J075166H17TGATGGGCCTCNONE 
J080310F11CTCGGCCCATCANONE 
J080310F11TGATGGGCCTCNONE 
J080315P11CTCGGCCCATCANONE 
J080315P11TGATGGGCCTCNONE 
J090025A22CTCGGCCCATCANONE 
J090025A22TGATGGGCCTCNONE 
Os07g0191000AK071379TGATGGGCInositol monophosphatase family protein. 
AK103440TGATGGGCNONE 
Os07g0205000009-018-A12AGATGGGCCGGCCCATCGGCCCATCANONE 
AK103963AGATGGGCCGGCCCATCGGCCCATCANONE 
AK121368AGATGGGCCGGCCCATCGGCCCATCANONE 
J023001M20AGATGGGCCGGCCCATCGGCCCATCANONE 
J023125I03AGATGGGCCGGCCCATCGGCCCATCANONE 
J053034L22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065078A21AGATGGGCCGGCCCATCGGCCCATCANONE 
J065089G24AGATGGGCCGGCCCATCGGCCCATCANONE 
J065096G23AGATGGGCCGGCCCATCGGCCCATCANONE 
J065103N06AGATGGGCCGGCCCATCGGCCCATCANONE 
J065146J22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065159K18AGATGGGCCGGCCCATCGGCCCATCANONE 
J065204L04AGATGGGCCGGCCCATCGGCCCATCANONE 
J065207N07AGATGGGCCGGCCCATCGGCCCATCANONE 
J065208E24AGATGGGCCGGCCCATCGGCCCATCANONE 
J075057F19AGATGGGCCGGCCCATCGGCCCATCANONE 
J075058K01AGATGGGCCGGCCCATCGGCCCATCANONE 
J075072H13AGATGGGCCGGCCCATCGGCCCATCANONE 
J080003D08AGATGGGCCGGCCCATCGGCCCATCANONE 
J080025F02AGATGGGCCGGCCCATCGGCCCATCANONE 
Os07g0206500AB016503TGATGGGCNONE 
J065026L09TGATGGGCNONE 
J065043L20TGATGGGCNONE 
J065046A08TGATGGGCNONE 
J065191B13TGATGGGCNONE 
J065199C04TGATGGGCNONE 
J075001B09TGATGGGCNONE 
J075001F18TGATGGGCNONE 
J075001H12TGATGGGCNONE 
J075002D19TGATGGGCNONE 
J075002F19TGATGGGCNONE 
J075002J08TGATGGGCNONE 
J075002K02TGATGGGCNONE 
J075002M04TGATGGGCNONE 
J075002M10TGATGGGCNONE 
J075003A21TGATGGGCNONE 
J075003D10TGATGGGCNONE 
J075003E15TGATGGGCNONE 
J075003E19TGATGGGCNONE 
J075003F02TGATGGGCNONE 
J075003K11TGATGGGCNONE 
J075003L11TGATGGGCNONE 
J075004C08TGATGGGCNONE 
J075004E04TGATGGGCNONE 
J075004F12TGATGGGCNONE 
J075004H19TGATGGGCNONE 
J075004I03TGATGGGCNONE 
J075005C16TGATGGGCNONE 
J075005F10TGATGGGCNONE 
J075005J19TGATGGGCNONE 
J075006F10TGATGGGCNONE 
J075006I11TGATGGGCNONE 
J075006I20TGATGGGCNONE 
J075006J02TGATGGGCNONE 
J075006L23TGATGGGCNONE 
J075006N23TGATGGGCNONE 
J075007B14TGATGGGCNONE 
J075007C05TGATGGGCNONE 
J075007D19TGATGGGCNONE 
J075007G10TGATGGGCNONE 
J075007H04TGATGGGCNONE 
J075007H11TGATGGGCNONE 
J075007K20TGATGGGCNONE 
J075007M04TGATGGGCNONE 
J075007N01TGATGGGCNONE 
J075007N07TGATGGGCNONE 
J075007N11TGATGGGCNONE 
J075007N17TGATGGGCNONE 
J075007N18TGATGGGCNONE 
J075007O07TGATGGGCNONE 
J075007O15TGATGGGCNONE 
J075008D05TGATGGGCNONE 
J075008G06TGATGGGCNONE 
J075008K17TGATGGGCNONE 
J075008L04TGATGGGCNONE 
J075008N22TGATGGGCNONE 
J075008O20TGATGGGCNONE 
J075009A17TGATGGGCNONE 
J075009H12TGATGGGCNONE 
J075009H17TGATGGGCNONE 
J075009K24TGATGGGCNONE 
J075009L22TGATGGGCNONE 
J075009M05TGATGGGCNONE 
J075009O08TGATGGGCNONE 
J075010C16TGATGGGCNONE 
J075010D02TGATGGGCNONE 
J075010K21TGATGGGCNONE 
J075010K22TGATGGGCNONE 
J075010L08TGATGGGCNONE 
J075010L24TGATGGGCNONE 
J075010N21TGATGGGCNONE 
J075010O09TGATGGGCNONE 
J075010P11TGATGGGCNONE 
J075010P12TGATGGGCNONE 
J075011B05TGATGGGCNONE 
J075011D06TGATGGGCNONE 
J075011J18TGATGGGCNONE 
J075012A03TGATGGGCNONE 
J075012C02TGATGGGCNONE 
J075012I22TGATGGGCNONE 
J075012J19TGATGGGCNONE 
J075012L13TGATGGGCNONE 
J075012M24TGATGGGCNONE 
J075013B21TGATGGGCNONE 
J075013E12TGATGGGCNONE 
J075013H01TGATGGGCNONE 
J075013H10TGATGGGCNONE 
J075013I06TGATGGGCNONE 
J075013L09TGATGGGCNONE 
J075013M16TGATGGGCNONE 
J075013M17TGATGGGCNONE 
J075013P09TGATGGGCNONE 
J075014A08TGATGGGCNONE 
J075014E03TGATGGGCNONE 
J075014H11TGATGGGCNONE 
J075014O22TGATGGGCNONE 
J075015B10TGATGGGCNONE 
J075015D21TGATGGGCNONE 
J075015G11TGATGGGCNONE 
J075015H13TGATGGGCNONE 
J075015H17TGATGGGCNONE 
J075015I11TGATGGGCNONE 
J075015J18TGATGGGCNONE 
J075015L24TGATGGGCNONE 
J075015P11TGATGGGCNONE 
J075016A11TGATGGGCNONE 
J075016A18TGATGGGCNONE 
J075016B01TGATGGGCNONE 
J075016B09TGATGGGCNONE 
J075016F21TGATGGGCNONE 
J075016I06TGATGGGCNONE 
J075016L16TGATGGGCNONE 
J075016M24TGATGGGCNONE 
J075017B01TGATGGGCNONE 
J075017B18TGATGGGCNONE 
J075017C14TGATGGGCNONE 
J075017H03TGATGGGCNONE 
J075017H13TGATGGGCNONE 
J075017I12TGATGGGCNONE 
J075017K10TGATGGGCNONE 
J075017L24TGATGGGCNONE 
J075017M04TGATGGGCNONE 
J075017N03TGATGGGCNONE 
J075019C09TGATGGGCNONE 
J075019J20TGATGGGCNONE 
J075019L19TGATGGGCNONE 
J075019P20TGATGGGCNONE 
J075020A01TGATGGGCNONE 
J075020C16TGATGGGCNONE 
J075020H23TGATGGGCNONE 
J075020L24TGATGGGCNONE 
J075021C11TGATGGGCNONE 
J075021F02TGATGGGCNONE 
J075021F16TGATGGGCNONE 
J075021I01TGATGGGCNONE 
J075021I19TGATGGGCNONE 
J075021J09TGATGGGCNONE 
J075021K11TGATGGGCNONE 
J075021M05TGATGGGCNONE 
J075021M17TGATGGGCNONE 
J075021P06TGATGGGCNONE 
J075022H01TGATGGGCNONE 
J075022K22TGATGGGCNONE 
J075023C09TGATGGGCNONE 
J075023D11TGATGGGCNONE 
J075023G03TGATGGGCNONE 
J075023G14TGATGGGCNONE 
J075023H19TGATGGGCNONE 
J075023I17TGATGGGCNONE 
J075023M02TGATGGGCNONE 
J075023N05TGATGGGCNONE 
J075023N11TGATGGGCNONE 
J075023N16TGATGGGCNONE 
J075023O22TGATGGGCNONE 
J075024C24TGATGGGCNONE 
J075024E01TGATGGGCNONE 
J075024F10TGATGGGCNONE 
J075024I02TGATGGGCNONE 
J075024J08TGATGGGCNONE 
J075024K01TGATGGGCNONE 
J075025D07TGATGGGCNONE 
J075025G10TGATGGGCNONE 
J075025J16TGATGGGCNONE 
J075025L03TGATGGGCNONE 
J075025P13TGATGGGCNONE 
J075026D14TGATGGGCNONE 
J075026D21TGATGGGCNONE 
J075026E21TGATGGGCNONE 
J075026F23TGATGGGCNONE 
J075026K08TGATGGGCNONE 
J075026N18TGATGGGCNONE 
J075026O22TGATGGGCNONE 
J075027C07TGATGGGCNONE 
J075027F19TGATGGGCNONE 
J075027G07TGATGGGCNONE 
J075027H08TGATGGGCNONE 
J075027I11TGATGGGCNONE 
J075027L02TGATGGGCNONE 
J075027P10TGATGGGCNONE 
J075028A18TGATGGGCNONE 
J075028C01TGATGGGCNONE 
J075028F14TGATGGGCNONE 
J075028G04TGATGGGCNONE 
J075028H06TGATGGGCNONE 
J075028I21TGATGGGCNONE 
J075028L20TGATGGGCNONE 
J075028L23TGATGGGCNONE 
J075028N18TGATGGGCNONE 
J075028O10TGATGGGCNONE 
J075028O18TGATGGGCNONE 
J075028P09TGATGGGCNONE 
J075029A14TGATGGGCNONE 
J075029J04TGATGGGCNONE 
J075029M14TGATGGGCNONE 
J075029P13TGATGGGCNONE 
J075030A15TGATGGGCNONE 
J075030B06TGATGGGCNONE 
J075030D05TGATGGGCNONE 
J075030D23TGATGGGCNONE 
J075030G21TGATGGGCNONE 
J075030J18TGATGGGCNONE 
J075030L07TGATGGGCNONE 
J075030M16TGATGGGCNONE 
J075030N18TGATGGGCNONE 
J075030N19TGATGGGCNONE 
J075031D14TGATGGGCNONE 
J075031I04TGATGGGCNONE 
J075031M12TGATGGGCNONE 
J075031O19TGATGGGCNONE 
J075032C16TGATGGGCNONE 
J075032E06TGATGGGCNONE 
J075032G18TGATGGGCNONE 
J075032I20TGATGGGCNONE 
J075032K11TGATGGGCNONE 
J075032K19TGATGGGCNONE 
J075032N08TGATGGGCNONE 
J075033B17TGATGGGCNONE 
J075033B19TGATGGGCNONE 
J075033D24TGATGGGCNONE 
J075033H17TGATGGGCNONE 
J075033L07TGATGGGCNONE 
J075033L11TGATGGGCNONE 
J075033L19TGATGGGCNONE 
J075033P20TGATGGGCNONE 
J075034A07TGATGGGCNONE 
J075034C14TGATGGGCNONE 
J075034E15TGATGGGCNONE 
J075034F10TGATGGGCNONE 
J075034I22TGATGGGCNONE 
J075034J12TGATGGGCNONE 
J075034J19TGATGGGCNONE 
J075034K21TGATGGGCNONE 
J075034O04TGATGGGCNONE 
J075034O12TGATGGGCNONE 
J075035B05TGATGGGCNONE 
J075035B06TGATGGGCNONE 
J075035D14TGATGGGCNONE 
J075035E16TGATGGGCNONE 
J075035L10TGATGGGCNONE 
J075035M05TGATGGGCNONE 
J075035M12TGATGGGCNONE 
J075036F22TGATGGGCNONE 
J075036K04TGATGGGCNONE 
J075036K17TGATGGGCNONE 
J075036P12TGATGGGCNONE 
J075037F03TGATGGGCNONE 
J075037G19TGATGGGCNONE 
J075037H15TGATGGGCNONE 
J075037L23TGATGGGCNONE 
J075037M17TGATGGGCNONE 
J075037O08TGATGGGCNONE 
J075038E13TGATGGGCNONE 
J075038G15TGATGGGCNONE 
J075038N24TGATGGGCNONE 
J075038O09TGATGGGCNONE 
J075039F24TGATGGGCNONE 
J075039O16TGATGGGCNONE 
J075039O17TGATGGGCNONE 
J075040D08TGATGGGCNONE 
J075040D23TGATGGGCNONE 
J075040H18TGATGGGCNONE 
J075040I07TGATGGGCNONE 
J075040L03TGATGGGCNONE 
J075040N15TGATGGGCNONE 
J075040N18TGATGGGCNONE 
J075041A11TGATGGGCNONE 
J075041B17TGATGGGCNONE 
J075041G03TGATGGGCNONE 
J075041M13TGATGGGCNONE 
J075041M24TGATGGGCNONE 
J075041N22TGATGGGCNONE 
J075042A04TGATGGGCNONE 
J075042C05TGATGGGCNONE 
J075042C20TGATGGGCNONE 
J075042D03TGATGGGCNONE 
J075042E01TGATGGGCNONE 
J075042E07TGATGGGCNONE 
J075042G10TGATGGGCNONE 
J075042I24TGATGGGCNONE 
J075042M05TGATGGGCNONE 
J075043D12TGATGGGCNONE 
J075043M20TGATGGGCNONE 
J075044A10TGATGGGCNONE 
J075044B12TGATGGGCNONE 
J075044C20TGATGGGCNONE 
J075044G17TGATGGGCNONE 
J075044H22TGATGGGCNONE 
J075044M22TGATGGGCNONE 
J075044P19TGATGGGCNONE 
J075044P22TGATGGGCNONE 
J075045B16TGATGGGCNONE 
J075045C20TGATGGGCNONE 
J075045D05TGATGGGCNONE 
J075045E12TGATGGGCNONE 
J075045E17TGATGGGCNONE 
J075045N03TGATGGGCNONE 
J075045N09TGATGGGCNONE 
J075046F16TGATGGGCNONE 
J075046G03TGATGGGCNONE 
J075046K14TGATGGGCNONE 
J075046K15TGATGGGCNONE 
J075046K18TGATGGGCNONE 
J075046N21TGATGGGCNONE 
J075047B02TGATGGGCNONE 
J075047D15TGATGGGCNONE 
J075047F13TGATGGGCNONE 
J075047I12TGATGGGCNONE 
J075048B22TGATGGGCNONE 
J075048E10TGATGGGCNONE 
J075048F12TGATGGGCNONE 
J075048K08TGATGGGCNONE 
J075048N10TGATGGGCNONE 
J075048N18TGATGGGCNONE 
J075048O15TGATGGGCNONE 
J075049F16TGATGGGCNONE 
J075049J05TGATGGGCNONE 
J075049O14TGATGGGCNONE 
J075049P17TGATGGGCNONE 
J075050A11TGATGGGCNONE 
J075050A18TGATGGGCNONE 
J075050E21TGATGGGCNONE 
J075050H07TGATGGGCNONE 
J075050I21TGATGGGCNONE 
J075050K05TGATGGGCNONE 
J075050K12TGATGGGCNONE 
J075050K16TGATGGGCNONE 
J075050N22TGATGGGCNONE 
J075050P16TGATGGGCNONE 
J075051C01TGATGGGCNONE 
J075051D08TGATGGGCNONE 
J075051F09TGATGGGCNONE 
J075051G05TGATGGGCNONE 
J075051G22TGATGGGCNONE 
J075051H13TGATGGGCNONE 
J075051L13TGATGGGCNONE 
J075051M11TGATGGGCNONE 
J075051N12TGATGGGCNONE 
J075052F02TGATGGGCNONE 
J075052G22TGATGGGCNONE 
J075052H10TGATGGGCNONE 
J075052H16TGATGGGCNONE 
J075052J18TGATGGGCNONE 
J075052N06TGATGGGCNONE 
J075052P14TGATGGGCNONE 
J075053C15TGATGGGCNONE 
J075053L06TGATGGGCNONE 
J075053N12TGATGGGCNONE 
J075054C04TGATGGGCNONE 
J075054D17TGATGGGCNONE 
J075054F06TGATGGGCNONE 
J075054G08TGATGGGCNONE 
J075054G15TGATGGGCNONE 
J075054H21TGATGGGCNONE 
J075054I07TGATGGGCNONE 
J075054J10TGATGGGCNONE 
J075054L06TGATGGGCNONE 
J075054L17TGATGGGCNONE 
J075054N04TGATGGGCNONE 
J075055D08TGATGGGCNONE 
J075055I19TGATGGGCNONE 
J075055J05TGATGGGCNONE 
J075055N13TGATGGGCNONE 
J075056C20TGATGGGCNONE 
J075056F20TGATGGGCNONE 
J075056I19TGATGGGCNONE 
J075056K18TGATGGGCNONE 
J075056L07TGATGGGCNONE 
J075056O03TGATGGGCNONE 
J075057J08TGATGGGCNONE 
J075057M13TGATGGGCNONE 
J075057N19TGATGGGCNONE 
J075058B21TGATGGGCNONE 
J075058C06TGATGGGCNONE 
J075058I17TGATGGGCNONE 
J075058J02TGATGGGCNONE 
J075058L10TGATGGGCNONE 
J075058N02TGATGGGCNONE 
J075058N10TGATGGGCNONE 
J075058O13TGATGGGCNONE 
J075059B11TGATGGGCNONE 
J075059E18TGATGGGCNONE 
J075059G22TGATGGGCNONE 
J075059H11TGATGGGCNONE 
J075059I02TGATGGGCNONE 
J075059M19TGATGGGCNONE 
J075060B04TGATGGGCNONE 
J075060D07TGATGGGCNONE 
J075060D18TGATGGGCNONE 
J075060E04TGATGGGCNONE 
J075060E10TGATGGGCNONE 
J075060G06TGATGGGCNONE 
J075060J22TGATGGGCNONE 
J075060K08TGATGGGCNONE 
J075060K12TGATGGGCNONE 
J075060K18TGATGGGCNONE 
J075060L24TGATGGGCNONE 
J075060M17TGATGGGCNONE 
J075060P10TGATGGGCNONE 
J075061B09TGATGGGCNONE 
J075061G02TGATGGGCNONE 
J075061H23TGATGGGCNONE 
J075061J20TGATGGGCNONE 
J075061K22TGATGGGCNONE 
J075061M05TGATGGGCNONE 
J075062C22TGATGGGCNONE 
J075062G20TGATGGGCNONE 
J075062H19TGATGGGCNONE 
J075062K04TGATGGGCNONE 
J075062N17TGATGGGCNONE 
J075063A14TGATGGGCNONE 
J075063E03TGATGGGCNONE 
J075063E06TGATGGGCNONE 
J075063G23TGATGGGCNONE 
J075064C21TGATGGGCNONE 
J075064H04TGATGGGCNONE 
J075064L04TGATGGGCNONE 
J075064L09TGATGGGCNONE 
J075065B09TGATGGGCNONE 
J075065F05TGATGGGCNONE 
J075065F19TGATGGGCNONE 
J075065F22TGATGGGCNONE 
J075065G02TGATGGGCNONE 
J075065L14TGATGGGCNONE 
J075065M19TGATGGGCNONE 
J075065N07TGATGGGCNONE 
J075066E20TGATGGGCNONE 
J075066E21TGATGGGCNONE 
J075066J04TGATGGGCNONE 
J075066N10TGATGGGCNONE 
J075066N14TGATGGGCNONE 
J075067A04TGATGGGCNONE 
J075067G23TGATGGGCNONE 
J075067K13TGATGGGCNONE 
J075067L11TGATGGGCNONE 
J075068H01TGATGGGCNONE 
J075068J20TGATGGGCNONE 
J075068K05TGATGGGCNONE 
J075069B13TGATGGGCNONE 
J075069I24TGATGGGCNONE 
J075069J22TGATGGGCNONE 
J075069K08TGATGGGCNONE 
J075069K09TGATGGGCNONE 
J075069L16TGATGGGCNONE 
J075070D12TGATGGGCNONE 
J075070F19TGATGGGCNONE 
J075070I17TGATGGGCNONE 
J075070K14TGATGGGCNONE 
J075070L21TGATGGGCNONE 
J075070N24TGATGGGCNONE 
J075070P03TGATGGGCNONE 
J075071C23TGATGGGCNONE 
J075071K18TGATGGGCNONE 
J075071L02TGATGGGCNONE 
J075072B21TGATGGGCNONE 
J075072C17TGATGGGCNONE 
J075072D08TGATGGGCNONE 
J075072G21TGATGGGCNONE 
J075072I16TGATGGGCNONE 
J075072L08TGATGGGCNONE 
J075072N12TGATGGGCNONE 
J075073C04TGATGGGCNONE 
J075073C21TGATGGGCNONE 
J075073E13TGATGGGCNONE 
J075073E21TGATGGGCNONE 
J075073K12TGATGGGCNONE 
J075073P03TGATGGGCNONE 
J075073P04TGATGGGCNONE 
J075073P05TGATGGGCNONE 
J075074A08TGATGGGCNONE 
J075074B04TGATGGGCNONE 
J075074B09TGATGGGCNONE 
J075074H24TGATGGGCNONE 
J075074I04TGATGGGCNONE 
J075074K11TGATGGGCNONE 
J075074L03TGATGGGCNONE 
J075074L16TGATGGGCNONE 
J075074O14TGATGGGCNONE 
J075075A01TGATGGGCNONE 
J075075A07TGATGGGCNONE 
J075075B06TGATGGGCNONE 
J075075D21TGATGGGCNONE 
J075075H22TGATGGGCNONE 
J075075K07TGATGGGCNONE 
J075075L03TGATGGGCNONE 
J075075M20TGATGGGCNONE 
J075075O15TGATGGGCNONE 
J075075P07TGATGGGCNONE 
J075076A18TGATGGGCNONE 
J075076F10TGATGGGCNONE 
J075076G21TGATGGGCNONE 
J075076H03TGATGGGCNONE 
J075076M04TGATGGGCNONE 
J075076O07TGATGGGCNONE 
J075076P06TGATGGGCNONE 
J075077B03TGATGGGCNONE 
J075077C17TGATGGGCNONE 
J075077D14TGATGGGCNONE 
J075077L18TGATGGGCNONE 
J075078A09TGATGGGCNONE 
J075078B22TGATGGGCNONE 
J075078K22TGATGGGCNONE 
J075078M23TGATGGGCNONE 
J075078N02TGATGGGCNONE 
J075079B09TGATGGGCNONE 
J075079B10TGATGGGCNONE 
J075079B13TGATGGGCNONE 
J075079F18TGATGGGCNONE 
J075079G15TGATGGGCNONE 
J075079L08TGATGGGCNONE 
J075079P08TGATGGGCNONE 
J075080E14TGATGGGCNONE 
J075080J12TGATGGGCNONE 
J075080L08TGATGGGCNONE 
J075081A04TGATGGGCNONE 
J075081C12TGATGGGCNONE 
J075081D08TGATGGGCNONE 
J075081G24TGATGGGCNONE 
J075081I06TGATGGGCNONE 
J075081I19TGATGGGCNONE 
J075081K04TGATGGGCNONE 
J075081K11TGATGGGCNONE 
J075081M14TGATGGGCNONE 
J075081N08TGATGGGCNONE 
J075082A03TGATGGGCNONE 
J075082B02TGATGGGCNONE 
J075082J05TGATGGGCNONE 
J075083B13TGATGGGCNONE 
J075083H05TGATGGGCNONE 
J075083H17TGATGGGCNONE 
J075083I08TGATGGGCNONE 
J075083I22TGATGGGCNONE 
J075083N17TGATGGGCNONE 
J075084D17TGATGGGCNONE 
J075084H21TGATGGGCNONE 
J075084P20TGATGGGCNONE 
J075085A05TGATGGGCNONE 
J075085C22TGATGGGCNONE 
J075085J04TGATGGGCNONE 
J075085K17TGATGGGCNONE 
J075085M07TGATGGGCNONE 
J075086A09TGATGGGCNONE 
J075086A22TGATGGGCNONE 
J075086B16TGATGGGCNONE 
J075086B19TGATGGGCNONE 
J075086C13TGATGGGCNONE 
J075086F15TGATGGGCNONE 
J075086G14TGATGGGCNONE 
J075086I20TGATGGGCNONE 
J075086J02TGATGGGCNONE 
J075086M20TGATGGGCNONE 
J075086N07TGATGGGCNONE 
J075086N09TGATGGGCNONE 
J075087A09TGATGGGCNONE 
J075087D07TGATGGGCNONE 
J075087F12TGATGGGCNONE 
J075087H07TGATGGGCNONE 
J075087J10TGATGGGCNONE 
J075087K16TGATGGGCNONE 
J075087L10TGATGGGCNONE 
J075087P19TGATGGGCNONE 
J075088A11TGATGGGCNONE 
J075088C21TGATGGGCNONE 
J075088D05TGATGGGCNONE 
J075088I05TGATGGGCNONE 
J075088K13TGATGGGCNONE 
J075088M18TGATGGGCNONE 
J075088O11TGATGGGCNONE 
J075088O20TGATGGGCNONE 
J075088P09TGATGGGCNONE 
J075089G21TGATGGGCNONE 
J075089O20TGATGGGCNONE 
J075089P18TGATGGGCNONE 
J075090D07TGATGGGCNONE 
J075090G23TGATGGGCNONE 
J075090H02TGATGGGCNONE 
J075090H07TGATGGGCNONE 
J075090K04TGATGGGCNONE 
J075091E06TGATGGGCNONE 
J075091F04TGATGGGCNONE 
J075091F10TGATGGGCNONE 
J075091H14TGATGGGCNONE 
J075091H22TGATGGGCNONE 
J075091J21TGATGGGCNONE 
J075091L08TGATGGGCNONE 
J075091N21TGATGGGCNONE 
J075091O04TGATGGGCNONE 
J075091P03TGATGGGCNONE 
J075092F15TGATGGGCNONE 
J075092H04TGATGGGCNONE 
J075092I21TGATGGGCNONE 
J075092J16TGATGGGCNONE 
J075092J21TGATGGGCNONE 
J075092L17TGATGGGCNONE 
J075092L24TGATGGGCNONE 
J075092O18TGATGGGCNONE 
J075093C23TGATGGGCNONE 
J075093D02TGATGGGCNONE 
J075093E15TGATGGGCNONE 
J075093F01TGATGGGCNONE 
J075093I24TGATGGGCNONE 
J075093L24TGATGGGCNONE 
J075093M04TGATGGGCNONE 
J075094A04TGATGGGCNONE 
J075094C23TGATGGGCNONE 
J075094I03TGATGGGCNONE 
J075094K07TGATGGGCNONE 
J075094P06TGATGGGCNONE 
J075095H19TGATGGGCNONE 
J075095L11TGATGGGCNONE 
J075095N07TGATGGGCNONE 
J075096B12TGATGGGCNONE 
J075096D21TGATGGGCNONE 
J075096N13TGATGGGCNONE 
J075097A08TGATGGGCNONE 
J075097C09TGATGGGCNONE 
J075097E14TGATGGGCNONE 
J075097G15TGATGGGCNONE 
J075097G19TGATGGGCNONE 
J075097H05TGATGGGCNONE 
J075097K17TGATGGGCNONE 
J075097L13TGATGGGCNONE 
J075097N11TGATGGGCNONE 
J075098D18TGATGGGCNONE 
J075098F08TGATGGGCNONE 
J075098F14TGATGGGCNONE 
J075098M09TGATGGGCNONE 
J075098O17TGATGGGCNONE 
J075099B16TGATGGGCNONE 
J075099E14TGATGGGCNONE 
J075099K08TGATGGGCNONE 
J075099N03TGATGGGCNONE 
J075099O06TGATGGGCNONE 
J075100C01TGATGGGCNONE 
J075100F15TGATGGGCNONE 
J075100F17TGATGGGCNONE 
J075100N15TGATGGGCNONE 
J075101B19TGATGGGCNONE 
J075101C10TGATGGGCNONE 
J075101D02TGATGGGCNONE 
J075101D21TGATGGGCNONE 
J075101F09TGATGGGCNONE 
J075101G11TGATGGGCNONE 
J075101N14TGATGGGCNONE 
J075102E20TGATGGGCNONE 
J075102E22TGATGGGCNONE 
J075102G11TGATGGGCNONE 
J075102M11TGATGGGCNONE 
J075102P08TGATGGGCNONE 
J075102P16TGATGGGCNONE 
J075103B20TGATGGGCNONE 
J075103C19TGATGGGCNONE 
J075103E12TGATGGGCNONE 
J075103K03TGATGGGCNONE 
J075104D07TGATGGGCNONE 
J075104D23TGATGGGCNONE 
J075104F03TGATGGGCNONE 
J075104F08TGATGGGCNONE 
J075104K06TGATGGGCNONE 
J075104K11TGATGGGCNONE 
J075104K18TGATGGGCNONE 
J075104N01TGATGGGCNONE 
J075104N13TGATGGGCNONE 
J075104O19TGATGGGCNONE 
J075105B16TGATGGGCNONE 
J075105C24TGATGGGCNONE 
J075105D03TGATGGGCNONE 
J075105H18TGATGGGCNONE 
J075105I17TGATGGGCNONE 
J075105J24TGATGGGCNONE 
J075105K17TGATGGGCNONE 
J075105M18TGATGGGCNONE 
J075105O11TGATGGGCNONE 
J075105P18TGATGGGCNONE 
J075106B21TGATGGGCNONE 
J075106D14TGATGGGCNONE 
J075106F22TGATGGGCNONE 
J075106M02TGATGGGCNONE 
J075107F05TGATGGGCNONE 
J075107H17TGATGGGCNONE 
J075108B14TGATGGGCNONE 
J075108C06TGATGGGCNONE 
J075108K13TGATGGGCNONE 
J075108L22TGATGGGCNONE 
J075108O16TGATGGGCNONE 
J075109B03TGATGGGCNONE 
J075109C19TGATGGGCNONE 
J075110C03TGATGGGCNONE 
J075110C05TGATGGGCNONE 
J075110D24TGATGGGCNONE 
J075110G17TGATGGGCNONE 
J075110J23TGATGGGCNONE 
J075110K18TGATGGGCNONE 
J075110P03TGATGGGCNONE 
J075111B22TGATGGGCNONE 
J075111C16TGATGGGCNONE 
J075111E09TGATGGGCNONE 
J075111F21TGATGGGCNONE 
J075111G13TGATGGGCNONE 
J075111I07TGATGGGCNONE 
J075111O14TGATGGGCNONE 
J075112A21TGATGGGCNONE 
J075112N01TGATGGGCNONE 
J075112N12TGATGGGCNONE 
J075114B01TGATGGGCNONE 
J075114C03TGATGGGCNONE 
J075114F10TGATGGGCNONE 
J075114K23TGATGGGCNONE 
J075114N15TGATGGGCNONE 
J075114N16TGATGGGCNONE 
J075115G17TGATGGGCNONE 
J075115K22TGATGGGCNONE 
J075116C09TGATGGGCNONE 
J075116C24TGATGGGCNONE 
J075116F03TGATGGGCNONE 
J075116H08TGATGGGCNONE 
J075116J03TGATGGGCNONE 
J075116K19TGATGGGCNONE 
J075116L05TGATGGGCNONE 
J075116L17TGATGGGCNONE 
J075116O17TGATGGGCNONE 
J075117F22TGATGGGCNONE 
J075117K05TGATGGGCNONE 
J075117L05TGATGGGCNONE 
J075117N08TGATGGGCNONE 
J075117N11TGATGGGCNONE 
J075117P18TGATGGGCNONE 
J075118B02TGATGGGCNONE 
J075118C17TGATGGGCNONE 
J075118D10TGATGGGCNONE 
J075118D24TGATGGGCNONE 
J075118E16TGATGGGCNONE 
J075118H14TGATGGGCNONE 
J075118I20TGATGGGCNONE 
J075118L14TGATGGGCNONE 
J075118L23TGATGGGCNONE 
J075118M04TGATGGGCNONE 
J075118O17TGATGGGCNONE 
J075119A01TGATGGGCNONE 
J075119A03TGATGGGCNONE 
J075119A05TGATGGGCNONE 
J075119A17TGATGGGCNONE 
J075119B05TGATGGGCNONE 
J075119C19TGATGGGCNONE 
J075119D04TGATGGGCNONE 
J075119D09TGATGGGCNONE 
J075119G01TGATGGGCNONE 
J075119H22TGATGGGCNONE 
J075119J21TGATGGGCNONE 
J075119L06TGATGGGCNONE 
J075119O09TGATGGGCNONE 
J075119P04TGATGGGCNONE 
J075119P16TGATGGGCNONE 
J075119P20TGATGGGCNONE 
J075120B03TGATGGGCNONE 
J075120F08TGATGGGCNONE 
J075120F14TGATGGGCNONE 
J075120M03TGATGGGCNONE 
J075120N02TGATGGGCNONE 
J075120N23TGATGGGCNONE 
J075120O19TGATGGGCNONE 
J075121I24TGATGGGCNONE 
J075121J23TGATGGGCNONE 
J075121L20TGATGGGCNONE 
J075121N02TGATGGGCNONE 
J075121P09TGATGGGCNONE 
J075122D20TGATGGGCNONE 
J075122G16TGATGGGCNONE 
J075122G18TGATGGGCNONE 
J075122J22TGATGGGCNONE 
J075122L22TGATGGGCNONE 
J075122M19TGATGGGCNONE 
J075122O11TGATGGGCNONE 
J075123D10TGATGGGCNONE 
J075123J15TGATGGGCNONE 
J075123J20TGATGGGCNONE 
J075123L15TGATGGGCNONE 
J075123M22TGATGGGCNONE 
J075123P22TGATGGGCNONE 
J075124C01TGATGGGCNONE 
J075124D02TGATGGGCNONE 
J075124D21TGATGGGCNONE 
J075124E24TGATGGGCNONE 
J075124H13TGATGGGCNONE 
J075124I04TGATGGGCNONE 
J075124I16TGATGGGCNONE 
J075124J20TGATGGGCNONE 
J075124K13TGATGGGCNONE 
J075124M02TGATGGGCNONE 
J075124M07TGATGGGCNONE 
J075124N23TGATGGGCNONE 
J075125A13TGATGGGCNONE 
J075125B13TGATGGGCNONE 
J075125C06TGATGGGCNONE 
J075125C17TGATGGGCNONE 
J075125D14TGATGGGCNONE 
J075125E06TGATGGGCNONE 
J075125H12TGATGGGCNONE 
J075125I07TGATGGGCNONE 
J075125J01TGATGGGCNONE 
J075125M24TGATGGGCNONE 
J075125P05TGATGGGCNONE 
J075126B03TGATGGGCNONE 
J075126F12TGATGGGCNONE 
J075126F14TGATGGGCNONE 
J075126H06TGATGGGCNONE 
J075126K16TGATGGGCNONE 
J075126M15TGATGGGCNONE 
J075126N03TGATGGGCNONE 
J075126N07TGATGGGCNONE 
J075126O13TGATGGGCNONE 
J075127E01TGATGGGCNONE 
J075127E17TGATGGGCNONE 
J075127H07TGATGGGCNONE 
J075127L02TGATGGGCNONE 
J075127L09TGATGGGCNONE 
J075128G12TGATGGGCNONE 
J075128H19TGATGGGCNONE 
J075128J16TGATGGGCNONE 
J075128M07TGATGGGCNONE 
J075128M19TGATGGGCNONE 
J075129C05TGATGGGCNONE 
J075129J03TGATGGGCNONE 
J075129J21TGATGGGCNONE 
J075129L18TGATGGGCNONE 
J075129M10TGATGGGCNONE 
J075130A08TGATGGGCNONE 
J075130B14TGATGGGCNONE 
J075130D05TGATGGGCNONE 
J075130E19TGATGGGCNONE 
J075130P14TGATGGGCNONE 
J075131D10TGATGGGCNONE 
J075131F19TGATGGGCNONE 
J075131L04TGATGGGCNONE 
J075131P17TGATGGGCNONE 
J075132H07TGATGGGCNONE 
J075132H21TGATGGGCNONE 
J075132K03TGATGGGCNONE 
J075132K18TGATGGGCNONE 
J075132O05TGATGGGCNONE 
J075133A19TGATGGGCNONE 
J075133D03TGATGGGCNONE 
J075133E03TGATGGGCNONE 
J075133E23TGATGGGCNONE 
J075133M18TGATGGGCNONE 
J075133O20TGATGGGCNONE 
J075134C02TGATGGGCNONE 
J075134C18TGATGGGCNONE 
J075134F06TGATGGGCNONE 
J075134F16TGATGGGCNONE 
J075134K01TGATGGGCNONE 
J075134K16TGATGGGCNONE 
J075134M05TGATGGGCNONE 
J075134P15TGATGGGCNONE 
J075135B13TGATGGGCNONE 
J075135H10TGATGGGCNONE 
J075136B06TGATGGGCNONE 
J075136F22TGATGGGCNONE 
J075136H21TGATGGGCNONE 
J075136K21TGATGGGCNONE 
J075136L06TGATGGGCNONE 
J075137A10TGATGGGCNONE 
J075137I12TGATGGGCNONE 
J075137P03TGATGGGCNONE 
J075137P12TGATGGGCNONE 
J075137P13TGATGGGCNONE 
J075138A10TGATGGGCNONE 
J075138C05TGATGGGCNONE 
J075138C21TGATGGGCNONE 
J075138J12TGATGGGCNONE 
J075138K09TGATGGGCNONE 
J075138K23TGATGGGCNONE 
J075138L02TGATGGGCNONE 
J075138P22TGATGGGCNONE 
J075139B21TGATGGGCNONE 
J075139I24TGATGGGCNONE 
J075139O21TGATGGGCNONE 
J075140C19TGATGGGCNONE 
J075140E05TGATGGGCNONE 
J075140F12TGATGGGCNONE 
J075140I18TGATGGGCNONE 
J075140J21TGATGGGCNONE 
J075141B12TGATGGGCNONE 
J075141D10TGATGGGCNONE 
J075141E21TGATGGGCNONE 
J075141F03TGATGGGCNONE 
J075141H05TGATGGGCNONE 
J075141H23TGATGGGCNONE 
J075141P19TGATGGGCNONE 
J075142B04TGATGGGCNONE 
J075142B17TGATGGGCNONE 
J075142F03TGATGGGCNONE 
J075142G15TGATGGGCNONE 
J075142H13TGATGGGCNONE 
J075142J03TGATGGGCNONE 
J075142L11TGATGGGCNONE 
J075142L13TGATGGGCNONE 
J075142L15TGATGGGCNONE 
J075142M06TGATGGGCNONE 
J075142O04TGATGGGCNONE 
J075142O15TGATGGGCNONE 
J075143A21TGATGGGCNONE 
J075143B10TGATGGGCNONE 
J075143C07TGATGGGCNONE 
J075143C15TGATGGGCNONE 
J075143D03TGATGGGCNONE 
J075143D20TGATGGGCNONE 
J075143D23TGATGGGCNONE 
J075143F09TGATGGGCNONE 
J075143G02TGATGGGCNONE 
J075143I24TGATGGGCNONE 
J075143L05TGATGGGCNONE 
J075143M05TGATGGGCNONE 
J075143N01TGATGGGCNONE 
J075144B08TGATGGGCNONE 
J075144C04TGATGGGCNONE 
J075144F16TGATGGGCNONE 
J075144I04TGATGGGCNONE 
J075144J22TGATGGGCNONE 
J075145A05TGATGGGCNONE 
J075145B05TGATGGGCNONE 
J075145D07TGATGGGCNONE 
J075145D13TGATGGGCNONE 
J075145G18TGATGGGCNONE 
J075145H09TGATGGGCNONE 
J075145I12TGATGGGCNONE 
J075145L03TGATGGGCNONE 
J075145L08TGATGGGCNONE 
J075145L22TGATGGGCNONE 
J075145M11TGATGGGCNONE 
J075146D05TGATGGGCNONE 
J075146D16TGATGGGCNONE 
J075146F10TGATGGGCNONE 
J075146G13TGATGGGCNONE 
J075146H01TGATGGGCNONE 
J075147A16TGATGGGCNONE 
J075147B22TGATGGGCNONE 
J075147E05TGATGGGCNONE 
J075147J02TGATGGGCNONE 
J075148E12TGATGGGCNONE 
J075148F11TGATGGGCNONE 
J075148J04TGATGGGCNONE 
J075148M11TGATGGGCNONE 
J075148M16TGATGGGCNONE 
J075148P17TGATGGGCNONE 
J075150B08TGATGGGCNONE 
J075150C12TGATGGGCNONE 
J075150J08TGATGGGCNONE 
J075150M18TGATGGGCNONE 
J075150N08TGATGGGCNONE 
J075150N12TGATGGGCNONE 
J075150N14TGATGGGCNONE 
J075151H08TGATGGGCNONE 
J075151I04TGATGGGCNONE 
J075151M12TGATGGGCNONE 
J075151N18TGATGGGCNONE 
J075151O19TGATGGGCNONE 
J075152A02TGATGGGCNONE 
J075152C03TGATGGGCNONE 
J075152D02TGATGGGCNONE 
J075152E05TGATGGGCNONE 
J075152E06TGATGGGCNONE 
J075152F09TGATGGGCNONE 
J075152G16TGATGGGCNONE 
J075152I02TGATGGGCNONE 
J075152I10TGATGGGCNONE 
J075152N06TGATGGGCNONE 
J075153B13TGATGGGCNONE 
J075153C10TGATGGGCNONE 
J075153E04TGATGGGCNONE 
J075153L19TGATGGGCNONE 
J075153L24TGATGGGCNONE 
J075153N02TGATGGGCNONE 
J075154A06TGATGGGCNONE 
J075154D07TGATGGGCNONE 
J075154F24TGATGGGCNONE 
J075154H17TGATGGGCNONE 
J075155A08TGATGGGCNONE 
J075155A14TGATGGGCNONE 
J075155F16TGATGGGCNONE 
J075155F18TGATGGGCNONE 
J075155K18TGATGGGCNONE 
J075155L23TGATGGGCNONE 
J075155M21TGATGGGCNONE 
J075155P05TGATGGGCNONE 
J075156D18TGATGGGCNONE 
J075156M05TGATGGGCNONE 
J075156N18TGATGGGCNONE 
J075157A06TGATGGGCNONE 
J075157C14TGATGGGCNONE 
J075157L11TGATGGGCNONE 
J075157O08TGATGGGCNONE 
J075158B01TGATGGGCNONE 
J075158B19TGATGGGCNONE 
J075158B20TGATGGGCNONE 
J075158D11TGATGGGCNONE 
J075158J17TGATGGGCNONE 
J075158L03TGATGGGCNONE 
J075158N07TGATGGGCNONE 
J075159A08TGATGGGCNONE 
J075159D22TGATGGGCNONE 
J075159G14TGATGGGCNONE 
J075159H16TGATGGGCNONE 
J075159K10TGATGGGCNONE 
J075160E14TGATGGGCNONE 
J075160E18TGATGGGCNONE 
J075160F14TGATGGGCNONE 
J075160J21TGATGGGCNONE 
J075160M19TGATGGGCNONE 
J075161B04TGATGGGCNONE 
J075161F23TGATGGGCNONE 
J075161I22TGATGGGCNONE 
J075161K17TGATGGGCNONE 
J075161M04TGATGGGCNONE 
J075162H19TGATGGGCNONE 
J075162I21TGATGGGCNONE 
J075162J08TGATGGGCNONE 
J075162K18TGATGGGCNONE 
J075162M19TGATGGGCNONE 
J075163B19TGATGGGCNONE 
J075163D03TGATGGGCNONE 
J075163G23TGATGGGCNONE 
J075163N14TGATGGGCNONE 
J075163P19TGATGGGCNONE 
J075164C06TGATGGGCNONE 
J075164C10TGATGGGCNONE 
J075164G24TGATGGGCNONE 
J075164H05TGATGGGCNONE 
J075164I07TGATGGGCNONE 
J075164J09TGATGGGCNONE 
J075164J16TGATGGGCNONE 
J075164O09TGATGGGCNONE 
J075165B18TGATGGGCNONE 
J075165D09TGATGGGCNONE 
J075165E24TGATGGGCNONE 
J075165G21TGATGGGCNONE 
J075165J11TGATGGGCNONE 
J075165K16TGATGGGCNONE 
J075165M03TGATGGGCNONE 
J075165P21TGATGGGCNONE 
J075166B19TGATGGGCNONE 
J075166C05TGATGGGCNONE 
J075166D01TGATGGGCNONE 
J075166E03TGATGGGCNONE 
J075166M06TGATGGGCNONE 
J075166P13TGATGGGCNONE 
J075167B19TGATGGGCNONE 
J075167C16TGATGGGCNONE 
J075167F06TGATGGGCNONE 
J075167F08TGATGGGCNONE 
J075167G23TGATGGGCNONE 
J075167K16TGATGGGCNONE 
J075167L13TGATGGGCNONE 
J075167P05TGATGGGCNONE 
J075168A17TGATGGGCNONE 
J075168N08TGATGGGCNONE 
J075168P09TGATGGGCNONE 
J075168P13TGATGGGCNONE 
J075169D18TGATGGGCNONE 
J075169G07TGATGGGCNONE 
J075170A12TGATGGGCNONE 
J075170I05TGATGGGCNONE 
J075170K19TGATGGGCNONE 
J075170L23TGATGGGCNONE 
J075170N09TGATGGGCNONE 
J075171A02TGATGGGCNONE 
J075171J11TGATGGGCNONE 
J075171J16TGATGGGCNONE 
J075171M16TGATGGGCNONE 
J075171N16TGATGGGCNONE 
J075172A22TGATGGGCNONE 
J075172B04TGATGGGCNONE 
J075172D20TGATGGGCNONE 
J075172H21TGATGGGCNONE 
J075172I19TGATGGGCNONE 
J075172M07TGATGGGCNONE 
J075172N04TGATGGGCNONE 
J075172N13TGATGGGCNONE 
J075172O15TGATGGGCNONE 
J075173A03TGATGGGCNONE 
J075173C12TGATGGGCNONE 
J075173D22TGATGGGCNONE 
J075173G10TGATGGGCNONE 
J075173I19TGATGGGCNONE 
J075174A21TGATGGGCNONE 
J075174B11TGATGGGCNONE 
J075174F03TGATGGGCNONE 
J075174G13TGATGGGCNONE 
J075174H07TGATGGGCNONE 
J075175A22TGATGGGCNONE 
J075175C03TGATGGGCNONE 
J075175H10TGATGGGCNONE 
J075175H17TGATGGGCNONE 
J075175J21TGATGGGCNONE 
J075175N10TGATGGGCNONE 
J075175P20TGATGGGCNONE 
J075176A03TGATGGGCNONE 
J075176B07TGATGGGCNONE 
J075176D16TGATGGGCNONE 
J075176E09TGATGGGCNONE 
J075176F14TGATGGGCNONE 
J075176G18TGATGGGCNONE 
J075176I24TGATGGGCNONE 
J075176K05TGATGGGCNONE 
J075176L14TGATGGGCNONE 
J075176O12TGATGGGCNONE 
J075176O15TGATGGGCNONE 
J075177C06TGATGGGCNONE 
J075177F20TGATGGGCNONE 
J075177I01TGATGGGCNONE 
J075178B02TGATGGGCNONE 
J075178D03TGATGGGCNONE 
J075178F16TGATGGGCNONE 
J075178G01TGATGGGCNONE 
J075178L09TGATGGGCNONE 
J075178N21TGATGGGCNONE 
J075179A19TGATGGGCNONE 
J075179F02TGATGGGCNONE 
J075179G19TGATGGGCNONE 
J075179J17TGATGGGCNONE 
J075180B19TGATGGGCNONE 
J075180C20TGATGGGCNONE 
J075180D21TGATGGGCNONE 
J075180M02TGATGGGCNONE 
J075181B09TGATGGGCNONE 
J075181C03TGATGGGCNONE 
J075181C17TGATGGGCNONE 
J075181D22TGATGGGCNONE 
J075181I01TGATGGGCNONE 
J075181I07TGATGGGCNONE 
J075181K20TGATGGGCNONE 
J075181L15TGATGGGCNONE 
J075181L24TGATGGGCNONE 
J075181M13TGATGGGCNONE 
J075181P14TGATGGGCNONE 
J075182B02TGATGGGCNONE 
J075182P16TGATGGGCNONE 
J075183E19TGATGGGCNONE 
J075183K22TGATGGGCNONE 
J075184B06TGATGGGCNONE 
J075184D11TGATGGGCNONE 
J075184F24TGATGGGCNONE 
J075184H23TGATGGGCNONE 
J075184J01TGATGGGCNONE 
J075184K19TGATGGGCNONE 
J075185C22TGATGGGCNONE 
J075185D19TGATGGGCNONE 
J075185E19TGATGGGCNONE 
J075185G01TGATGGGCNONE 
J075186A16TGATGGGCNONE 
J075186E05TGATGGGCNONE 
J075186F10TGATGGGCNONE 
J075186F14TGATGGGCNONE 
J075186F24TGATGGGCNONE 
J075186K24TGATGGGCNONE 
J075186L10TGATGGGCNONE 
J075186O21TGATGGGCNONE 
J075187C22TGATGGGCNONE 
J075187E12TGATGGGCNONE 
J075187F03TGATGGGCNONE 
J075187K23TGATGGGCNONE 
J075187L01TGATGGGCNONE 
J075187N11TGATGGGCNONE 
J075187N19TGATGGGCNONE 
J075188B08TGATGGGCNONE 
J075188B09TGATGGGCNONE 
J075188B19TGATGGGCNONE 
J075188C13TGATGGGCNONE 
J075188F10TGATGGGCNONE 
J075188I09TGATGGGCNONE 
J075188P03TGATGGGCNONE 
J075188P09TGATGGGCNONE 
J075189F03TGATGGGCNONE 
J075189F23TGATGGGCNONE 
J075189I20TGATGGGCNONE 
J075189K03TGATGGGCNONE 
J075189N17TGATGGGCNONE 
J075190B16TGATGGGCNONE 
J075190J07TGATGGGCNONE 
J075190J16TGATGGGCNONE 
J075190J23TGATGGGCNONE 
J075190M02TGATGGGCNONE 
J075190N23TGATGGGCNONE 
J075191A16TGATGGGCNONE 
J075191C07TGATGGGCNONE 
J075191F03TGATGGGCNONE 
J075191I20TGATGGGCNONE 
J075191I21TGATGGGCNONE 
J075191K07TGATGGGCNONE 
J075191M24TGATGGGCNONE 
J075191N20TGATGGGCNONE 
J075191O13TGATGGGCNONE 
J075191P11TGATGGGCNONE 
J075191P13TGATGGGCNONE 
J075192A10TGATGGGCNONE 
J075192C14TGATGGGCNONE 
J075192D16TGATGGGCNONE 
J075192E03TGATGGGCNONE 
J075192E21TGATGGGCNONE 
J075192H04TGATGGGCNONE 
J075192L03TGATGGGCNONE 
J075192O07TGATGGGCNONE 
J075193A22TGATGGGCNONE 
J075193D19TGATGGGCNONE 
J075193F20TGATGGGCNONE 
J075193P17TGATGGGCNONE 
J075194N22TGATGGGCNONE 
J075195F05TGATGGGCNONE 
J075195F22TGATGGGCNONE 
J075195I04TGATGGGCNONE 
J075195L17TGATGGGCNONE 
J075195O15TGATGGGCNONE 
J075196C15TGATGGGCNONE 
J075196D21TGATGGGCNONE 
J075196E22TGATGGGCNONE 
J075196H08TGATGGGCNONE 
J075196I03TGATGGGCNONE 
J075196I08TGATGGGCNONE 
J075196N03TGATGGGCNONE 
J075196O14TGATGGGCNONE 
J075196O15TGATGGGCNONE 
J075197A09TGATGGGCNONE 
J075197F19TGATGGGCNONE 
J075197P10TGATGGGCNONE 
J075198I21TGATGGGCNONE 
J075198J11TGATGGGCNONE 
J075199H07TGATGGGCNONE 
J075199H18TGATGGGCNONE 
J075199M21TGATGGGCNONE 
J075199P15TGATGGGCNONE 
J090017A04TGATGGGCNONE 
J090066L20TGATGGGCNONE 
X60979TGATGGGCNONE 
Os07g0513200015-004-B02TTGGCCCATCANONE 
AK101410TTGGCCCATCANONE 
AK106227TTGGCCCATCANONE 
AK119451TTGGCCCATCAProtein prenyltransferase domain containing protein. 
Os07g0606500AK068811TGATGGGCCTCNONE 
AK121873TGATGGGCCTCNONE 
J013159C05TGATGGGCCTCNONE 
J075158B14TGATGGGCCTCNONE 
Os07g0633600AK061698TGATGGGCNONE 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0668200AK059051CAACGGCCCATCANONE 
AK101682CAACGGCCCATCAConserved hypothetical protein. 
AK102839CAACGGCCCATCANONE 
Os07g0681500AK100010TGATGGGCCAANONE 
Os08g0113800J033069I12AAAGCCCATCANONE 
J053050I07AAAGCCCATCANONE 
J065006J11AAAGCCCATCANONE 
J065013D02AAAGCCCATCANONE 
J065055L24AAAGCCCATCANONE 
J065071I11AAAGCCCATCAConserved hypothetical protein. 
J065093G12AAAGCCCATCANONE 
J065101N03AAAGCCCATCANONE 
Os08g0117400006-086-A09TGATGGGCCTGNONE 
006-086-A09TGATGGGCCTGANONE 
006-103-C02TGATGGGCCTGNONE 
006-103-C02TGATGGGCCTGANONE 
AK059891TGATGGGCCTGSimilar to Calmodulin 1 (Fragment). 
AK059891TGATGGGCCTGASimilar to Calmodulin 1 (Fragment). 
AK103863TGATGGGCCTGNONE 
AK103863TGATGGGCCTGANONE 
AY224521TGATGGGCCTGNONE 
AY224521TGATGGGCCTGANONE 
J033149E23TGATGGGCCTGNONE 
J033149E23TGATGGGCCTGANONE 
J065062E05TGATGGGCCTGNONE 
J065062E05TGATGGGCCTGANONE 
J065083O05TGATGGGCCTGNONE 
J065083O05TGATGGGCCTGANONE 
J065116D14TGATGGGCCTGNONE 
J065116D14TGATGGGCCTGANONE 
J065158F16TGATGGGCCTGNONE 
J065158F16TGATGGGCCTGANONE 
J065179N16TGATGGGCCTGNONE 
J065179N16TGATGGGCCTGANONE 
J065206N23TGATGGGCCTGNONE 
J065206N23TGATGGGCCTGANONE 
Os08g0124000011-023-G08TGATGGGCCACNONE 
AK063293TGATGGGCCACSimilar to Resistance protein candidate (Fragment). 
AK067378TGATGGGCCACNONE 
J090067O21TGATGGGCCACNONE 
Os08g0129200014-040-E08TGATGGGCCGANONE 
AK070034TGATGGGCCGANONE 
AK101577TGATGGGCCGASimilar to Cold shock protein-1. 
J065137A09TGATGGGCCGANONE 
J100062K14TGATGGGCCGANONE 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0132600AK068578AAGGCCCATCAConserved hypothetical protein. 
AK105651AAGGCCCATCANONE 
Os08g0134900012-044-H02AGCCCAGCCCATCANONE 
015-040-D07AGCCCAGCCCATCANONE 
AK066009AGCCCAGCCCATCAConserved hypothetical protein. 
J013047E17AGCCCAGCCCATCANONE 
J065064A15AGCCCAGCCCATCANONE 
J065116E14AGCCCAGCCCATCANONE 
J090067O03AGCCCAGCCCATCANONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0156900AJ605583ACAGCCCATCANONE 
AK073344ACAGCCCATCASpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397ACAGCCCATCANONE 
Os08g0187700AK099689GATCGGACGGCCGAGAGCCCATCARegulation of nuclear pre-mRNA protein domain containing protein. 
Os08g0206600AK064336AAAGCCCATCAAICARFT/IMPCHase bienzyme family protein. 
AK102764AAAGCCCATCANONE 
Os08g0278100014-004-D02TAAGCCCATCANONE 
AK063626TAAGCCCATCAConserved hypothetical protein. 
Os08g0416400AK064144GCCCAGTAAGGCCCATCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0440500AK058761GCCCATCAMIR domain containing protein. 
Os08g0469500AK109599TAGGCCCATCAConserved hypothetical protein. 
Os08g0471900015-099-E10TCTGGCCCATCANONE 
AK069434TCTGGCCCATCAZinc finger, ZPR1-type domain containing protein. 
Os08g0526500016-063-D04TGATGGGCTTTNONE 
AK073431TGATGGGCTTTSimilar to SOX-1 protein. 
J033042D10TGATGGGCTTTNONE 
J065019E02TGATGGGCTTTNONE 
Os08g0527100AK119411AGCCCATCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12AGCCCATCANONE 
J090029K18AGCCCATCANONE 
Os08g0527400AK119389TTGGCCCATCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0527800011-085-F03TGATGGGCNONE 
AK063392TGATGGGCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0540500AK106511TGATGGGCCTASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0546300AK064717TGATGGGCCGTTTConserved hypothetical protein. 
AK119794TGATGGGCCGTTTNONE 
D10982TGATGGGCCGTTTNONE 
J080044B21TGATGGGCCGTTTNONE 
Os08g0548300AK073266TGATGGGCCGTTTZinc finger, RING-type domain containing protein. 
J013030C19TGATGGGCCGTTTNONE 
J033029A20TGATGGGCCGTTTNONE 
J033050L14TGATGGGCCGTTTNONE 
J033058F03TGATGGGCCGTTTNONE 
J033110K01TGATGGGCCGTTTNONE 
J033123D21TGATGGGCCGTTTNONE 
Os08g0564100AK063258TGATGGGCCGTCSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os08g0565900AK106778TGATGGGCTLipolytic enzyme, G-D-S-L family protein. 
Os09g0115500006-023-A12GCCCATCANONE 
006-042-G01GCCCATCANONE 
AK061717GCCCATCACBS domain containing protein. 
AK065986GCCCATCANONE 
J013043C13GCCCATCANONE 
J013111D13GCCCATCANONE 
J023114K12GCCCATCANONE 
J065102N18GCCCATCANONE 
Os09g0133600006-034-E08CCCAGCCCATCANONE 
AK061477CCCAGCCCATCAPAP fibrillin family protein. 
AK099394CCCAGCCCATCANONE 
AK104742CCCAGCCCATCANONE 
AY224474CCCAGCCCATCANONE 
Os09g0370300AK108199TAGGCCCATCASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0416400J075067A16GGCCCGGCCCATCAConserved hypothetical protein. 
J075104N21GGCCCGGCCCATCANONE 
J075106F04GGCCCGGCCCATCANONE 
J075131F08GGCCCGGCCCATCANONE 
Os09g0468900AK120990TCGGCCCATCAGGCCCACGTConserved hypothetical protein. 
J013123P13TCGGCCCATCAGGCCCACGTNONE 
J023013I09TCGGCCCATCAGGCCCACGTNONE 
J023023G08TCGGCCCATCAGGCCCACGTNONE 
J023043E08TCGGCCCATCAGGCCCACGTNONE 
J033124D24TCGGCCCATCAGGCCCACGTNONE 
J065047I07TCGGCCCATCAGGCCCACGTNONE 
J065093C16TCGGCCCATCAGGCCCACGTNONE 
J090088O03TCGGCCCATCAGGCCCACGTNONE 
J100032M21TCGGCCCATCAGGCCCACGTNONE 
Os09g0498100015-046-G11TCAGGCCCATCANONE 
AK064108TCAGGCCCATCASimilar to 30S ribosomal protein S16. 
J065040H21TCAGGCCCATCANONE 
J065062F05TCAGGCCCATCANONE 
J065147B17TCAGGCCCATCANONE 
J075098J22TCAGGCCCATCANONE 
Os09g0509200AK069525AAAGCCCATCASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0510500AK066188TGATGGGCSimilar to Phytochrome-interacting factor 4 (Basic helix-loop-helix protein 9) (bHLH9) (AtbHLH009) (Short under red-light 2). 
Os09g0545700009-127-C10GCCCATCANONE 
AK062898GCCCATCASimilar to Auxin induced protein. 
Os09g0554000J065123C23TTATGGGCTTATGGCCCATCASimilar to Mitochondrial phosphate transporter. 
Os11g0116400AK059833TGATGGGCCGCSimilar to Elongation factor P (EF-P). 
Os11g0131200J065024D18AAAGCCCATCAMpv17/PMP22 family protein. 
J065206C17AAAGCCCATCANONE 
Os11g0145400009-117-C07ACAGCCCATCASimilar to Ubiquitin-like protein 5. 
009-189-E08ACAGCCCATCANONE 
J023127F18ACAGCCCATCANONE 
J065071G10ACAGCCCATCANONE 
J065118J21ACAGCCCATCANONE 
J065184P05ACAGCCCATCANONE 
J080301B06ACAGCCCATCANONE 
J080303C06ACAGCCCATCANONE 
J080304F18ACAGCCCATCANONE 
J080308D02ACAGCCCATCANONE 
J080309H09ACAGCCCATCANONE 
J080311O09ACAGCCCATCANONE 
J080311O15ACAGCCCATCANONE 
J080312N11ACAGCCCATCANONE 
J080313G04ACAGCCCATCANONE 
J080313I06ACAGCCCATCANONE 
J100077F22ACAGCCCATCANONE 
Os11g0182400016-077-B04TGATGGGCCTANONE 
AK112089TGATGGGCCTACyclin-like F-box domain containing protein. 
Os11g0199600AK101774TCAGCCCATCAZinc finger, CCHC-type domain containing protein. 
AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein. 
AK120040TCAGCCCATCANONE 
AK120040TCATGGGCCCATCACCGGCCCACANONE 
J023047I06TCAGCCCATCANONE 
J023047I06TCATGGGCCCATCACCGGCCCACANONE 
J033064L23TCAGCCCATCANONE 
J033064L23TCATGGGCCCATCACCGGCCCACANONE 
J033117I01TCAGCCCATCANONE 
J033117I01TCATGGGCCCATCACCGGCCCACANONE 
J033123I18TCAGCCCATCANONE 
J033123I18TCATGGGCCCATCACCGGCCCACANONE 
J053026H17TCAGCCCATCANONE 
J053026H17TCATGGGCCCATCACCGGCCCACANONE 
J053078G05TCAGCCCATCANONE 
J053078G05TCATGGGCCCATCACCGGCCCACANONE 
J065102A09TCAGCCCATCANONE 
J065102A09TCATGGGCCCATCACCGGCCCACANONE 
J065113G11TCAGCCCATCANONE 
J065113G11TCATGGGCCCATCACCGGCCCACANONE 
J065207F20TCAGCCCATCANONE 
J065207F20TCATGGGCCCATCACCGGCCCACANONE 
J075027K21TCAGCCCATCANONE 
J075027K21TCATGGGCCCATCACCGGCCCACANONE 
Os11g0219400AK069850AGCCCATCAAnkyrin repeat containing protein. 
AK099123AGCCCATCANONE 
J023143G18AGCCCATCANONE 
Os11g0298400AK068577TTGGCCCATCARibulose bisphosphate carboxylase, small chain family protein. 
Os11g0473000AK060156AAGGCCCAAGGCCCATCANONE 
AK065994AAGGCCCAAGGCCCATCASimilar to ER lumen protein retaining receptor (HDEL receptor) (PGP169-12). 
AK104759AAGGCCCAAGGCCCATCANONE 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0539000AK071015TTTCGGCCCATCAConserved hypothetical protein. 
J023081E02TTTCGGCCCATCANONE 
Os12g0120400AK099904AGCCCATCASimilar to ATPase-like protein. 
AK099904TGATGGGCTTGSimilar to ATPase-like protein. 
J065169A07AGCCCATCANONE 
J065169A07TGATGGGCTTGNONE 
Os12g0136200AK068700GAGGCCCATCANONE 
AK069493GAGGCCCATCAWD40-like domain containing protein. 
Os12g0145700AK071391TGATGGGCCGGAPyruvate kinase family protein. 
J023013N02TGATGGGCCGGANONE 
J033085D15TGATGGGCCGGANONE 
J043021I09TGATGGGCCGGANONE 
J100055L05TGATGGGCCGGANONE 
Os12g0146300J065162K17TAAGCCCATCAHypothetical protein. 
Os12g0170400012-013-C12TGATGGGCNONE 
012-078-F04TGATGGGCNONE 
016-038-B08TGATGGGCNONE 
AK121826TGATGGGCZinc finger, C2H2-type domain containing protein. 
J033086P08TGATGGGCNONE 
J033099G14TGATGGGCNONE 
J065019L01TGATGGGCNONE 
J065093E18TGATGGGCNONE 
J065138J04TGATGGGCNONE 
J065139B14TGATGGGCNONE 
J065193K21TGATGGGCNONE 
J075005D01TGATGGGCNONE 
J075057B19TGATGGGCNONE 
J075061A15TGATGGGCNONE 
J075105N16TGATGGGCNONE 
J075146K15TGATGGGCNONE 
J100026B22TGATGGGCNONE 
Os12g0179700AK068305GCCCATCACAGCCCACCCNONE 
AK120612GCCCATCACAGCCCACCCNONE 
J013146K12GCCCATCACAGCCCACCCNONE 
J023131C17GCCCATCACAGCCCACCCNONE 
J033079I11GCCCATCACAGCCCACCCNONE 
J033125D20GCCCATCACAGCCCACCCNONE 
J090048O13GCCCATCACAGCCCACCCNONE 
J100076M12GCCCATCACAGCCCACCCNONE 
J100079L09GCCCATCACAGCCCACCCNONE 
Os12g0190100AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0211000AK101792GCCCATCAConserved hypothetical protein. 
J033065K09GCCCATCANONE 
Os12g0244100AK069937TGATGGGCCTANONE 
Os12g0269200J075029I20TGATGGGCNONE 
J075036I09TGATGGGCNONE 
J075045C02TGATGGGCNONE 
J075160B15TGATGGGCNONE 
Os12g0269600J075023G16TGATGGGCNONE 
J075153J11TGATGGGCNONE 
J075163C05TGATGGGCSimilar to 13 kDa prolamin precursor. 
Os12g0274700003-008-G09GCCCATCANONE 
006-028-B09GCCCATCANONE 
006-029-D12GCCCATCANONE 
006-034-G05GCCCATCANONE 
006-036-A02GCCCATCANONE 
006-039-A08GCCCATCANONE 
006-057-H10GCCCATCANONE 
006-064-D08GCCCATCANONE 
006-064-G03GCCCATCANONE 
006-071-B05GCCCATCANONE 
006-089-D01GCCCATCANONE 
006-095-G02GCCCATCANONE 
006-098-H02GCCCATCANONE 
006-109-H01GCCCATCANONE 
006-115-H09GCCCATCANONE 
006-120-B02GCCCATCANONE 
009-005-E08GCCCATCANONE 
009-027-E04GCCCATCANONE 
009-028-A10GCCCATCANONE 
009-050-G03GCCCATCANONE 
009-070-E05GCCCATCANONE 
009-095-D10GCCCATCANONE 
009-103-A05GCCCATCANONE 
009-113-G09GCCCATCANONE 
009-116-E08GCCCATCANONE 
009-125-F02GCCCATCANONE 
009-125-F09GCCCATCANONE 
009-129-F03GCCCATCANONE 
009-130-F01GCCCATCANONE 
009-140-F07GCCCATCANONE 
009-151-F07GCCCATCANONE 
009-153-D04GCCCATCANONE 
009-165-D08GCCCATCANONE 
009-170-E11GCCCATCANONE 
009-171-C01GCCCATCANONE 
009-171-G05GCCCATCANONE 
009-189-F07GCCCATCANONE 
009-193-H05GCCCATCANONE 
009-194-D08GCCCATCANONE 
AF017364GCCCATCANONE 
AF052305GCCCATCANONE 
AK061611GCCCATCANONE 
AK119219GCCCATCANONE 
AK121444GCCCATCASimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
D00643GCCCATCANONE 
J013031F15GCCCATCANONE 
J013037P20GCCCATCANONE 
J013050D13GCCCATCANONE 
J013056J24GCCCATCANONE 
J013063C09GCCCATCANONE 
J013071M01GCCCATCANONE 
J013074G12GCCCATCANONE 
J013120E19GCCCATCANONE 
J013124M17GCCCATCANONE 
J013127I18GCCCATCANONE 
J013129G13GCCCATCANONE 
J013132L16GCCCATCANONE 
J013146M05GCCCATCANONE 
J023044F05GCCCATCANONE 
J023056E16GCCCATCANONE 
J023141B14GCCCATCANONE 
J065008E12GCCCATCANONE 
J065010I24GCCCATCANONE 
J065013B01GCCCATCANONE 
J065019L16GCCCATCANONE 
J065021E19GCCCATCANONE 
J065027G11GCCCATCANONE 
J065039B19GCCCATCANONE 
J065039K03GCCCATCANONE 
J065044I07GCCCATCANONE 
J065047B10GCCCATCANONE 
J065050A16GCCCATCANONE 
J065050B15GCCCATCANONE 
J065052H09GCCCATCANONE 
J065053K05GCCCATCANONE 
J065061H12GCCCATCANONE 
J065061M13GCCCATCANONE 
J065078M16GCCCATCANONE 
J065083L13GCCCATCANONE 
J065084L01GCCCATCANONE 
J065091O21GCCCATCANONE 
J065095D06GCCCATCANONE 
J065095J12GCCCATCANONE 
J065097I18GCCCATCANONE 
J065114N19GCCCATCANONE 
J065118P09GCCCATCANONE 
J065123D11GCCCATCANONE 
J065123F08GCCCATCANONE 
J065124B04GCCCATCANONE 
J065128C04GCCCATCANONE 
J065137J07GCCCATCANONE 
J065165K23GCCCATCANONE 
J065183D22GCCCATCANONE 
J065195B17GCCCATCANONE 
J065201N18GCCCATCANONE 
J065204K15GCCCATCANONE 
J065208F08GCCCATCANONE 
J075011P21GCCCATCANONE 
J075020D18GCCCATCANONE 
J075028H08GCCCATCANONE 
J075065H14GCCCATCANONE 
J075069O11GCCCATCANONE 
J075071P10GCCCATCANONE 
J075177C11GCCCATCANONE 
J080002E12GCCCATCANONE 
J080002F23GCCCATCANONE 
J080002J09GCCCATCANONE 
J080003L11GCCCATCANONE 
J080004C05GCCCATCANONE 
J080004E12GCCCATCANONE 
J080004L13GCCCATCANONE 
J080006E06GCCCATCANONE 
J080006H14GCCCATCANONE 
J080008B07GCCCATCANONE 
J080008C21GCCCATCANONE 
J080008G01GCCCATCANONE 
J080008I09GCCCATCANONE 
J080008J10GCCCATCANONE 
J080008O08GCCCATCANONE 
J080009C10GCCCATCANONE 
J080009M22GCCCATCANONE 
J080009O11GCCCATCANONE 
J080009P22GCCCATCANONE 
J080010B11GCCCATCANONE 
J080010K04GCCCATCANONE 
J080011F13GCCCATCANONE 
J080013K07GCCCATCANONE 
J080014H24GCCCATCANONE 
J080015A13GCCCATCANONE 
J080015G11GCCCATCANONE 
J080015N21GCCCATCANONE 
J080016N04GCCCATCANONE 
J080018I15GCCCATCANONE 
J080018O22GCCCATCANONE 
J080020N07GCCCATCANONE 
J080021F19GCCCATCANONE 
J080021K02GCCCATCANONE 
J080023E20GCCCATCANONE 
J080025M08GCCCATCANONE 
J080026E10GCCCATCANONE 
J080027M18GCCCATCANONE 
J080029C04GCCCATCANONE 
J080030A07GCCCATCANONE 
J080030A13GCCCATCANONE 
J080030D14GCCCATCANONE 
J080030D18GCCCATCANONE 
J080031H14GCCCATCANONE 
J080031N07GCCCATCANONE 
J080032B12GCCCATCANONE 
J080036N19GCCCATCANONE 
J080036O03GCCCATCANONE 
J080038J23GCCCATCANONE 
J080040D10GCCCATCANONE 
J080040E08GCCCATCANONE 
J080041K04GCCCATCANONE 
J080042F24GCCCATCANONE 
J080042H22GCCCATCANONE 
J080042H23GCCCATCANONE 
J080044N24GCCCATCANONE 
J080045F16GCCCATCANONE 
J080046C04GCCCATCANONE 
J080046C19GCCCATCANONE 
J080046L07GCCCATCANONE 
J080046M19GCCCATCANONE 
J080048N16GCCCATCANONE 
J080048P05GCCCATCANONE 
J080049N15GCCCATCANONE 
J080050G22GCCCATCANONE 
J080052A09GCCCATCANONE 
J080052J01GCCCATCANONE 
J080053N04GCCCATCANONE 
J080055K09GCCCATCANONE 
J080056N06GCCCATCANONE 
J080057G09GCCCATCANONE 
J080058E22GCCCATCANONE 
J080059E04GCCCATCANONE 
J080061F19GCCCATCANONE 
J080062C19GCCCATCANONE 
J080062E15GCCCATCANONE 
J080063M12GCCCATCANONE 
J080063P12GCCCATCANONE 
J080064F02GCCCATCANONE 
J080064O16GCCCATCANONE 
J080065E22GCCCATCANONE 
J080066C18GCCCATCANONE 
J080068E10GCCCATCANONE 
J080068O13GCCCATCANONE 
J080069A09GCCCATCANONE 
J080069M24GCCCATCANONE 
J080071B21GCCCATCANONE 
J080071C23GCCCATCANONE 
J080072H01GCCCATCANONE 
J080072I16GCCCATCANONE 
J080074D12GCCCATCANONE 
J080075F18GCCCATCANONE 
J080075J08GCCCATCANONE 
J080075N24GCCCATCANONE 
J080076L02GCCCATCANONE 
J080076L21GCCCATCANONE 
J080077E23GCCCATCANONE 
J080079M18GCCCATCANONE 
J080080B19GCCCATCANONE 
J080080H19GCCCATCANONE 
J080080L11GCCCATCANONE 
J080081L18GCCCATCANONE 
J080082N16GCCCATCANONE 
J080083M19GCCCATCANONE 
J080084C20GCCCATCANONE 
J080084M05GCCCATCANONE 
J080085O19GCCCATCANONE 
J080086E02GCCCATCANONE 
J080087B17GCCCATCANONE 
J080088G21GCCCATCANONE 
J080088M20GCCCATCANONE 
J080089H02GCCCATCANONE 
J080090F01GCCCATCANONE 
J080090O03GCCCATCANONE 
J080091F10GCCCATCANONE 
J080091F21GCCCATCANONE 
J080091G07GCCCATCANONE 
J080091H02GCCCATCANONE 
J080092C01GCCCATCANONE 
J080092C08GCCCATCANONE 
J080092H03GCCCATCANONE 
J080092L08GCCCATCANONE 
J080094F04GCCCATCANONE 
J080094H13GCCCATCANONE 
J080095B19GCCCATCANONE 
J080096G21GCCCATCANONE 
J080096M14GCCCATCANONE 
J080097M21GCCCATCANONE 
J080308I23GCCCATCANONE 
J080319A21GCCCATCANONE 
J090009G07GCCCATCANONE 
J090015E19GCCCATCANONE 
L22155GCCCATCANONE 
Os12g0291100013-021-D10TGATGGGCCTGNONE 
013-038-B12TGATGGGCCTGNONE 
AK068555TGATGGGCCTGSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AY445627TGATGGGCCTGNONE 
D00644TGATGGGCCTGNONE 
J013156H12TGATGGGCCTGNONE 
J023122F15TGATGGGCCTGNONE 
J065001F13TGATGGGCCTGNONE 
J065001O16TGATGGGCCTGNONE 
J065006D15TGATGGGCCTGNONE 
J065008I17TGATGGGCCTGNONE 
J065008N22TGATGGGCCTGNONE 
J065010K05TGATGGGCCTGNONE 
J065015G11TGATGGGCCTGNONE 
J065019H21TGATGGGCCTGNONE 
J065020N17TGATGGGCCTGNONE 
J065024O18TGATGGGCCTGNONE 
J065025A04TGATGGGCCTGNONE 
J065026I06TGATGGGCCTGNONE 
J065028C06TGATGGGCCTGNONE 
J065029C01TGATGGGCCTGNONE 
J065029C06TGATGGGCCTGNONE 
J065029D16TGATGGGCCTGNONE 
J065029E02TGATGGGCCTGNONE 
J065030P11TGATGGGCCTGNONE 
J065032M13TGATGGGCCTGNONE 
J065034C06TGATGGGCCTGNONE 
J065037H24TGATGGGCCTGNONE 
J065037O14TGATGGGCCTGNONE 
J065038A12TGATGGGCCTGNONE 
J065043A05TGATGGGCCTGNONE 
J065046C06TGATGGGCCTGNONE 
J065046D22TGATGGGCCTGNONE 
J065048C14TGATGGGCCTGNONE 
J065048D24TGATGGGCCTGNONE 
J065049F19TGATGGGCCTGNONE 
J065050C04TGATGGGCCTGNONE 
J065052J16TGATGGGCCTGNONE 
J065055E07TGATGGGCCTGNONE 
J065055I04TGATGGGCCTGNONE 
J065060L04TGATGGGCCTGNONE 
J065062I15TGATGGGCCTGNONE 
J065062J11TGATGGGCCTGNONE 
J065065I12TGATGGGCCTGNONE 
J065068C24TGATGGGCCTGNONE 
J065069M04TGATGGGCCTGNONE 
J065071J22TGATGGGCCTGNONE 
J065076A12TGATGGGCCTGNONE 
J065076C24TGATGGGCCTGNONE 
J065076F09TGATGGGCCTGNONE 
J065076F16TGATGGGCCTGNONE 
J065077O06TGATGGGCCTGNONE 
J065081E14TGATGGGCCTGNONE 
J065082K22TGATGGGCCTGNONE 
J065082L04TGATGGGCCTGNONE 
J065085B02TGATGGGCCTGNONE 
J065089C21TGATGGGCCTGNONE 
J065092L07TGATGGGCCTGNONE 
J065093G08TGATGGGCCTGNONE 
J065093I19TGATGGGCCTGNONE 
J065093K24TGATGGGCCTGNONE 
J065093N04TGATGGGCCTGNONE 
J065094I09TGATGGGCCTGNONE 
J065094N19TGATGGGCCTGNONE 
J065095J17TGATGGGCCTGNONE 
J065095N24TGATGGGCCTGNONE 
J065096B17TGATGGGCCTGNONE 
J065096C02TGATGGGCCTGNONE 
J065097P18TGATGGGCCTGNONE 
J065099E07TGATGGGCCTGNONE 
J065103D23TGATGGGCCTGNONE 
J065104F04TGATGGGCCTGNONE 
J065104L17TGATGGGCCTGNONE 
J065111L14TGATGGGCCTGNONE 
J065112K11TGATGGGCCTGNONE 
J065115P09TGATGGGCCTGNONE 
J065123A02TGATGGGCCTGNONE 
J065127P14TGATGGGCCTGNONE 
J065137E16TGATGGGCCTGNONE 
J065138H20TGATGGGCCTGNONE 
J065138J11TGATGGGCCTGNONE 
J065141K23TGATGGGCCTGNONE 
J065141L14TGATGGGCCTGNONE 
J065143P04TGATGGGCCTGNONE 
J065146N12TGATGGGCCTGNONE 
J065147F21TGATGGGCCTGNONE 
J065147N15TGATGGGCCTGNONE 
J065154L06TGATGGGCCTGNONE 
J065156C09TGATGGGCCTGNONE 
J065156J18TGATGGGCCTGNONE 
J065157C19TGATGGGCCTGNONE 
J065159H23TGATGGGCCTGNONE 
J065159M08TGATGGGCCTGNONE 
J065163B19TGATGGGCCTGNONE 
J065164K14TGATGGGCCTGNONE 
J065166K07TGATGGGCCTGNONE 
J065166O07TGATGGGCCTGNONE 
J065168A18TGATGGGCCTGNONE 
J065170B18TGATGGGCCTGNONE 
J065170D18TGATGGGCCTGNONE 
J065173E05TGATGGGCCTGNONE 
J065174L23TGATGGGCCTGNONE 
J065177F08TGATGGGCCTGNONE 
J065177I05TGATGGGCCTGNONE 
J065178P20TGATGGGCCTGNONE 
J065181G24TGATGGGCCTGNONE 
J065182A07TGATGGGCCTGNONE 
J065183D24TGATGGGCCTGNONE 
J065184K10TGATGGGCCTGNONE 
J065185F09TGATGGGCCTGNONE 
J065185P10TGATGGGCCTGNONE 
J065186J16TGATGGGCCTGNONE 
J065188K23TGATGGGCCTGNONE 
J065190E22TGATGGGCCTGNONE 
J065191D06TGATGGGCCTGNONE 
J065193C05TGATGGGCCTGNONE 
J065193N13TGATGGGCCTGNONE 
J065194B15TGATGGGCCTGNONE 
J065199C03TGATGGGCCTGNONE 
J065200P19TGATGGGCCTGNONE 
J065202O18TGATGGGCCTGNONE 
J065203F16TGATGGGCCTGNONE 
J065204A15TGATGGGCCTGNONE 
J065206P13TGATGGGCCTGNONE 
J065207P12TGATGGGCCTGNONE 
J065210J24TGATGGGCCTGNONE 
J065211K01TGATGGGCCTGNONE 
J065213O21TGATGGGCCTGNONE 
J065215L18TGATGGGCCTGNONE 
J065216N22TGATGGGCCTGNONE 
J065219A16TGATGGGCCTGNONE 
J065219C24TGATGGGCCTGNONE 
J075012P04TGATGGGCCTGNONE 
J075013K19TGATGGGCCTGNONE 
J075028N24TGATGGGCCTGNONE 
J075028P16TGATGGGCCTGNONE 
J075032H22TGATGGGCCTGNONE 
J075032J18TGATGGGCCTGNONE 
J075042O14TGATGGGCCTGNONE 
J075047A04TGATGGGCCTGNONE 
J075053A16TGATGGGCCTGNONE 
J075064C23TGATGGGCCTGNONE 
J075072H11TGATGGGCCTGNONE 
J075073C03TGATGGGCCTGNONE 
J075081G11TGATGGGCCTGNONE 
J075093H04TGATGGGCCTGNONE 
J075095A11TGATGGGCCTGNONE 
J075095C13TGATGGGCCTGNONE 
J075100D18TGATGGGCCTGNONE 
J075101P08TGATGGGCCTGNONE 
J075114G11TGATGGGCCTGNONE 
J075118D19TGATGGGCCTGNONE 
J075122K13TGATGGGCCTGNONE 
J075125G22TGATGGGCCTGNONE 
J075129E22TGATGGGCCTGNONE 
J075129I07TGATGGGCCTGNONE 
J075132C12TGATGGGCCTGNONE 
J075135E24TGATGGGCCTGNONE 
J075136I06TGATGGGCCTGNONE 
J075136O07TGATGGGCCTGNONE 
J075138I07TGATGGGCCTGNONE 
J075142G08TGATGGGCCTGNONE 
J075147J22TGATGGGCCTGNONE 
J075150H20TGATGGGCCTGNONE 
J075151A15TGATGGGCCTGNONE 
J075151G24TGATGGGCCTGNONE 
J075151J20TGATGGGCCTGNONE 
J075156N21TGATGGGCCTGNONE 
J075158O12TGATGGGCCTGNONE 
J075161E05TGATGGGCCTGNONE 
J075166F17TGATGGGCCTGNONE 
J075169M10TGATGGGCCTGNONE 
J075174K15TGATGGGCCTGNONE 
J075179F17TGATGGGCCTGNONE 
J075185G15TGATGGGCCTGNONE 
J075188P12TGATGGGCCTGNONE 
J075191P15TGATGGGCCTGNONE 
J075192A13TGATGGGCCTGNONE 
J075197E23TGATGGGCCTGNONE 
J075197M02TGATGGGCCTGNONE 
J075198M16TGATGGGCCTGNONE 
J080020B11TGATGGGCCTGNONE 
J080021M20TGATGGGCCTGNONE 
J080066K02TGATGGGCCTGNONE 
J080301F01TGATGGGCCTGNONE 
J080301G19TGATGGGCCTGNONE 
J080305G02TGATGGGCCTGNONE 
J080306N09TGATGGGCCTGNONE 
J080309D21TGATGGGCCTGNONE 
J080309I02TGATGGGCCTGNONE 
J080313J11TGATGGGCCTGNONE 
J080313P09TGATGGGCCTGNONE 
J080315B10TGATGGGCCTGNONE 
J080315O13TGATGGGCCTGNONE 
J080316G02TGATGGGCCTGNONE 
J080317F03TGATGGGCCTGNONE 
J080318D17TGATGGGCCTGNONE 
J080319C10TGATGGGCCTGNONE 
J090017E03TGATGGGCCTGNONE 
J090034N22TGATGGGCCTGNONE 
J090042G07TGATGGGCCTGNONE 
J090062P21TGATGGGCCTGNONE 
J090082D08TGATGGGCCTGNONE 
J090096M13TGATGGGCCTGNONE 
J100086J22TGATGGGCCTGNONE 
Os12g0405700AK061920TGATGGGCCAGASimilar to Wound-induced basic protein. 
AK120436TGATGGGCCAGANONE 
Os12g0481100AK073151GACGGCCCACGAAAGCCCATCASimilar to RNA helicase. 
Os12g0490000J100030D22TGATGGGCTHypothetical protein. 
Os12g0517100012-071-A03GTGGCCCATCANONE 
AK073020GTGGCCCATCACyclin-like F-box domain containing protein. 
J023149K21GTGGCCCATCANONE 
Os12g0556100J065083C21TTTCGGCCCATCADrought induced 19 family protein. 
J065124M18TTTCGGCCCATCANONE 
J100032P22TTTCGGCCCATCANONE 
J100048N01TTTCGGCCCATCANONE 
Os12g0609800AK101303ACAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
AK101303CTGGCCCATGGAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01ACAGCCCATCANONE 
J033032I01CTGGCCCATGGAGCCCATCANONE 
J033033K21ACAGCCCATCANONE 
J033033K21CTGGCCCATGGAGCCCATCANONE 
J033082L13ACAGCCCATCANONE 
J033082L13CTGGCCCATGGAGCCCATCANONE 
J043034M20ACAGCCCATCANONE 
J043034M20CTGGCCCATGGAGCCCATCANONE 
J065137J24ACAGCCCATCANONE 
J065137J24CTGGCCCATGGAGCCCATCANONE 
J065141A11ACAGCCCATCANONE 
J065141A11CTGGCCCATGGAGCCCATCANONE 
J065217H09ACAGCCCATCANONE 
J065217H09CTGGCCCATGGAGCCCATCANONE 
Os12g0630600J100033A04CGATGGGCCCATCAConserved hypothetical protein. 
Os12g0633200009-073-D03TGATGGGCCTGNONE 
AK062615TGATGGGCCTGErg28-like family protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.