version

Summary of OsREG608 (All List)

OrganismOryza sativa  
IDOsREG608  
SequenceGCCCATCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1990  

Entry Sequences (1990 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683GCCCATCCNONE 
AK100613GCCCATCCSimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
J075195M06GCCCATCCNONE 
J090042G02GCCCATCCNONE 
Os01g0172000012-070-G06GGATGGGCCTTNONE 
AK068405GGATGGGCCTTALG3 family protein. 
J013149A07GGATGGGCCTTNONE 
J053047H05GGATGGGCCTTNONE 
J065075N03GGATGGGCCTTNONE 
J065093G22GGATGGGCCTTNONE 
J065130N21GGATGGGCCTTNONE 
J065143P05GGATGGGCCTTNONE 
J065216H07GGATGGGCCTTNONE 
J075013B06GGATGGGCCTTNONE 
J075196M05GGATGGGCCTTNONE 
J100039G24GGATGGGCCTTNONE 
J100041B11GGATGGGCCTTNONE 
J100069A16GGATGGGCCTTNONE 
J100069L12GGATGGGCCTTNONE 
J100074P16GGATGGGCCTTNONE 
Os01g0203300015-045-F03TAGGCCCATCCANONE 
AK106329TAGGCCCATCCAConserved hypothetical protein. 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0246100AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0303300J053035N19AGCCCATCCANONE 
J075042F02AGCCCATCCANONE 
J075068E10AGCCCATCCANONE 
J075116E19AGCCCATCCANONE 
J075131C10AGCCCATCCANONE 
J075145J11AGCCCATCCANONE 
J075157P20AGCCCATCCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12AGCCCATCCANONE 
Os01g0364900AK121145GGATGGGCConserved hypothetical protein. 
J023078A10GGATGGGCNONE 
Os01g0582400AK069484TGGATGGGCCGGASimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12TGGATGGGCCGGANONE 
J023036F15TGGATGGGCCGGANONE 
J023095O16TGGATGGGCCGGANONE 
J033102M15TGGATGGGCCGGANONE 
J043013I06TGGATGGGCCGGANONE 
J065083M21TGGATGGGCCGGANONE 
J065176A17TGGATGGGCCGGANONE 
Os01g0664500J075157K10GCCCATCCNONE 
J100023K08GCCCATCCNONE 
J100052N02GCCCATCCNONE 
Os01g0674500013-062-A08CCCGGCCCATCCNONE 
AK072815CCCGGCCCATCCNONE 
J023142B02CCCGGCCCATCCNONE 
Os01g0686800006-098-B12GGATGGGCTTANONE 
006-113-H04GGATGGGCTTANONE 
AK060428GGATGGGCTTANONE 
AK098877GGATGGGCTTANONE 
AK098893GGATGGGCTTANONE 
AK121587GGATGGGCTTAGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGATGGGCTTANONE 
J013001E12GGATGGGCTTANONE 
J013001N15GGATGGGCTTANONE 
J013098G22GGATGGGCTTANONE 
J023004P15GGATGGGCTTANONE 
J023014D09GGATGGGCTTANONE 
J023020G09GGATGGGCTTANONE 
J023034A19GGATGGGCTTANONE 
J023050I11GGATGGGCTTANONE 
J023079D13GGATGGGCTTANONE 
J023091B11GGATGGGCTTANONE 
J023099M03GGATGGGCTTANONE 
J023101H20GGATGGGCTTANONE 
J023106P14GGATGGGCTTANONE 
J023111F19GGATGGGCTTANONE 
J023132C22GGATGGGCTTANONE 
J023139O03GGATGGGCTTANONE 
J023146O10GGATGGGCTTANONE 
J033022G16GGATGGGCTTANONE 
J033030C10GGATGGGCTTANONE 
J033032G18GGATGGGCTTANONE 
J033034N09GGATGGGCTTANONE 
J033037K24GGATGGGCTTANONE 
J033038B22GGATGGGCTTANONE 
J033061E06GGATGGGCTTANONE 
J033065F08GGATGGGCTTANONE 
J033065I24GGATGGGCTTANONE 
J033069L01GGATGGGCTTANONE 
J033086N21GGATGGGCTTANONE 
J033102I06GGATGGGCTTANONE 
J033111N07GGATGGGCTTANONE 
J033118K11GGATGGGCTTANONE 
J033125D08GGATGGGCTTANONE 
J033129P22GGATGGGCTTANONE 
J033131L12GGATGGGCTTANONE 
J033139D08GGATGGGCTTANONE 
J033141J08GGATGGGCTTANONE 
J043024B14GGATGGGCTTANONE 
J053048G19GGATGGGCTTANONE 
J065023B15GGATGGGCTTANONE 
J065082C15GGATGGGCTTANONE 
J065087D24GGATGGGCTTANONE 
J065122D11GGATGGGCTTANONE 
J065128P13GGATGGGCTTANONE 
J065149I19GGATGGGCTTANONE 
J065154E16GGATGGGCTTANONE 
J065156K21GGATGGGCTTANONE 
J065166H09GGATGGGCTTANONE 
J065169F24GGATGGGCTTANONE 
J065194I16GGATGGGCTTANONE 
J065213M20GGATGGGCTTANONE 
J075020F19GGATGGGCTTANONE 
J075051J16GGATGGGCTTANONE 
J075093C18GGATGGGCTTANONE 
J075119H02GGATGGGCTTANONE 
J075120J11GGATGGGCTTANONE 
J075173A15GGATGGGCTTANONE 
J080302B05GGATGGGCTTANONE 
J080304G10GGATGGGCTTANONE 
J080305E13GGATGGGCTTANONE 
J080315L11GGATGGGCTTANONE 
J090005H15GGATGGGCTTANONE 
J090021C24GGATGGGCTTANONE 
J090025H24GGATGGGCTTANONE 
J090025M11GGATGGGCTTANONE 
J090026C22GGATGGGCTTANONE 
J090027H15GGATGGGCTTANONE 
J090034B17GGATGGGCTTANONE 
J090045G11GGATGGGCTTANONE 
J090048H02GGATGGGCTTANONE 
J090051N04GGATGGGCTTANONE 
J090052I06GGATGGGCTTANONE 
J090054L17GGATGGGCTTANONE 
J090060M22GGATGGGCTTANONE 
J090075N17GGATGGGCTTANONE 
J090079K13GGATGGGCTTANONE 
J090086H08GGATGGGCTTANONE 
J090094N20GGATGGGCTTANONE 
J100021F03GGATGGGCTTANONE 
J100031M01GGATGGGCTTANONE 
J100033I18GGATGGGCTTANONE 
J100034P07GGATGGGCTTANONE 
J100043M16GGATGGGCTTANONE 
J100046J12GGATGGGCTTANONE 
J100055F09GGATGGGCTTANONE 
J100057D19GGATGGGCTTANONE 
J100060O10GGATGGGCTTANONE 
J100064G09GGATGGGCTTANONE 
J100077F24GGATGGGCTTANONE 
J100080E12GGATGGGCTTANONE 
J100089J04GGATGGGCTTANONE 
Os01g0696000AK066735TGGATGGGCCGAAATTTCGGCCCATCANONE 
AK110917TGGATGGGCCGAAATTTCGGCCCATCASimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J013088G11TGGATGGGCCGAAATTTCGGCCCATCANONE 
J013102H08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J033126F08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J065053G13TGGATGGGCCGAAATTTCGGCCCATCANONE 
J075109I06TGGATGGGCCGAAATTTCGGCCCATCANONE 
J100073H07TGGATGGGCCGAAATTTCGGCCCATCANONE 
Os01g0700200AK100961TAGGCCCAAGCCCATCCASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11TAGGCCCAAGCCCATCCANONE 
Os01g0700500AK072715CGGGCCCATCCCytochrome P450 family protein. 
AK119264CGGGCCCATCCNONE 
Os01g0705200011-075-B10AGCCCATCCNONE 
014-056-F05AGCCCATCCNONE 
014-072-F08AGCCCATCCNONE 
014-082-E10AGCCCATCCNONE 
014-085-E10AGCCCATCCNONE 
AK064074AGCCCATCCLate embryogenesis abundant protein repeat containing protein. 
AK073837AGCCCATCCNONE 
D26536AGCCCATCCNONE 
J033070H10AGCCCATCCNONE 
J065138A19AGCCCATCCNONE 
J065140A10AGCCCATCCNONE 
Os01g0708700AK102451GCCCATCCIQ calmodulin-binding region domain containing protein. 
Os01g0709500016-042-H01GGATGGGCTNONE 
AK105743GGATGGGCTNONE 
J023075E10GGATGGGCTNONE 
J023106N12GGATGGGCTNONE 
J043016L01GGATGGGCTNONE 
J043026D20GGATGGGCTNONE 
J065086G18GGATGGGCTNONE 
J065137B07GGATGGGCTNONE 
J065202M22GGATGGGCTNONE 
J065207I15GGATGGGCTNONE 
J075038B04GGATGGGCTNONE 
J075044E14GGATGGGCTNONE 
J075120G21GGATGGGCTNONE 
J075149O14GGATGGGCTNONE 
J090003L12GGATGGGCTNONE 
J090006B04GGATGGGCTNONE 
J090009F02GGATGGGCTNONE 
J090014L16GGATGGGCTNONE 
J090017A05GGATGGGCTNONE 
J090018H23GGATGGGCTNONE 
J090039P04GGATGGGCTNONE 
J090058F13GGATGGGCTNONE 
J090077H07GGATGGGCTNONE 
J090084F06GGATGGGCTNONE 
J090091H18GGATGGGCTNONE 
J090097F01GGATGGGCTNONE 
Os01g0720500003-129-C07TAGGCCCATCCNONE 
004-015-C03TAGGCCCATCCNONE 
004-016-C06TAGGCCCATCCNONE 
006-022-A02TAGGCCCATCCNONE 
006-022-C04TAGGCCCATCCNONE 
006-022-C05TAGGCCCATCCNONE 
006-026-H07TAGGCCCATCCNONE 
006-028-A10TAGGCCCATCCNONE 
006-028-B01TAGGCCCATCCNONE 
006-030-F02TAGGCCCATCCNONE 
006-031-H01TAGGCCCATCCNONE 
006-046-G10TAGGCCCATCCNONE 
006-049-C03TAGGCCCATCCNONE 
006-050-C08TAGGCCCATCCNONE 
006-051-B12TAGGCCCATCCNONE 
006-051-F11TAGGCCCATCCNONE 
006-053-E07TAGGCCCATCCNONE 
006-055-H07TAGGCCCATCCNONE 
006-056-A12TAGGCCCATCCNONE 
006-060-C01TAGGCCCATCCNONE 
006-060-D10TAGGCCCATCCNONE 
006-063-B05TAGGCCCATCCNONE 
006-063-B09TAGGCCCATCCNONE 
006-071-H09TAGGCCCATCCNONE 
006-081-A08TAGGCCCATCCNONE 
006-082-G12TAGGCCCATCCNONE 
006-084-C09TAGGCCCATCCNONE 
006-085-A04TAGGCCCATCCNONE 
006-086-A02TAGGCCCATCCNONE 
006-086-G11TAGGCCCATCCNONE 
006-087-E07TAGGCCCATCCNONE 
006-090-H01TAGGCCCATCCNONE 
006-092-G11TAGGCCCATCCNONE 
006-093-E01TAGGCCCATCCNONE 
006-095-F02TAGGCCCATCCNONE 
006-097-C08TAGGCCCATCCNONE 
006-098-A01TAGGCCCATCCNONE 
006-100-A10TAGGCCCATCCNONE 
006-109-C10TAGGCCCATCCNONE 
006-112-A11TAGGCCCATCCNONE 
006-112-F09TAGGCCCATCCNONE 
006-113-B08TAGGCCCATCCNONE 
006-113-F01TAGGCCCATCCNONE 
006-115-B01TAGGCCCATCCNONE 
006-116-B11TAGGCCCATCCNONE 
006-118-B05TAGGCCCATCCNONE 
006-118-E04TAGGCCCATCCNONE 
006-119-G08TAGGCCCATCCNONE 
006-120-F04TAGGCCCATCCNONE 
009-078-E06TAGGCCCATCCNONE 
009-097-A11TAGGCCCATCCNONE 
009-115-F02TAGGCCCATCCNONE 
009-135-H12TAGGCCCATCCNONE 
009-145-C06TAGGCCCATCCNONE 
009-187-B03TAGGCCCATCCNONE 
009-197-C08TAGGCCCATCCNONE 
AK058289TAGGCCCATCCNONE 
AK062725TAGGCCCATCCSimilar to Type I chlorophyll a/b-binding protein b (Fragment). 
AK103946TAGGCCCATCCNONE 
AK104176TAGGCCCATCCNONE 
J023055C17TAGGCCCATCCNONE 
J033101K18TAGGCCCATCCNONE 
J075041N01TAGGCCCATCCNONE 
U74295TAGGCCCATCCNONE 
Os01g0728100005-004-B01GGATGGGCNONE 
Os01g0749900AK103588TGGATGGGCCGGTProtein of unknown function DUF250 domain containing protein. 
J033090O22TGGATGGGCCGGTNONE 
J033133C05TGGATGGGCCGGTNONE 
J065122N01TGGATGGGCCGGTNONE 
J065188K04TGGATGGGCCGGTNONE 
J090012D18TGGATGGGCCGGTNONE 
J100074N02TGGATGGGCCGGTNONE 
Os01g0762000AK120818GCCCATCCPatatin family protein. 
Os01g0763600AK061563GCCCATCCANONE 
AK066596GCCCATCCAGlycerophosphoryl diester phosphodiesterase family protein. 
J023057P15GCCCATCCANONE 
J065016A16GCCCATCCANONE 
J065039L06GCCCATCCANONE 
J090001E03GCCCATCCANONE 
J090012J18GCCCATCCANONE 
J090085E15GCCCATCCANONE 
Os01g0814200AK070675GCCCATCCNONE 
AK073107GCCCATCCSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase CVP2 (EC 3.1.3.56) (Cotyledon vascular pattern 2 protein). 
J023061B19GCCCATCCNONE 
Os01g0814400006-047-D09TGGATGGGCNONE 
006-077-D12TGGATGGGCNONE 
AK061117TGGATGGGCNONE 
AK104661TGGATGGGCNONE 
Os01g0829100AK060644GCCCATCCAMajor sperm protein domain containing protein. 
J065045E13GCCCATCCANONE 
J100032N13GCCCATCCANONE 
Os01g0830500006-117-F06TCCGGCCCATCCNONE 
AK061475TCCGGCCCATCCNONE 
AK105801TCCGGCCCATCC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17TCCGGCCCATCCNONE 
J065211O10TCCGGCCCATCCNONE 
Os01g0850400AJ575220TGGATGGGCTGANONE 
AK108582TGGATGGGCTGASimilar to MYBY1 protein (Fragment). 
Os01g0852900J033066K09GCCCATCCACCNONE 
Os01g0856500AK103981GGATGGGCTGANONE 
AK103981TGGATGGGCTACTGGGCCCGNONE 
Os01g0869000AK067351TTTCGGCCCATCCNONE 
AK121602TTTCGGCCCATCCProtein of unknown function DUF639 family protein. 
Os01g0877500AK101067AGCCCATCCProtein of unknown function UPF0054 family protein. 
Os01g0929500AK111399TAGGCCCATCCSimilar to Carbonyl reductase-like protein. 
AK120263TAGGCCCATCCNONE 
Os01g0949700AK069037ACAGCCCATCCNONE 
J023004F17ACAGCCCATCCNONE 
J065063D04ACAGCCCATCCNONE 
J065196H02ACAGCCCATCCNONE 
J075198A05ACAGCCCATCCNONE 
Os01g0958200AK107370GCCCATCCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
J075001H07GCCCATCCANONE 
Os01g0966700006-038-E12GGATGGGCTNONE 
AK061744GGATGGGCTNONE 
Os02g0103700009-031-C12ATTGGGCCCATCCANONE 
AK062502ATTGGGCCCATCCANONE 
AK102186ATTGGGCCCATCCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17ATTGGGCCCATCCANONE 
J065161I07ATTGGGCCCATCCANONE 
J065184G15ATTGGGCCCATCCANONE 
J075123E02ATTGGGCCCATCCANONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0121200AK070123TGGATGGGCCGTGNONE 
AK121751TGGATGGGCCGTGProtein of unknown function DUF890 family protein. 
Os02g0127900AK102783AGCCCATCCAHypothetical protein. 
J065042F15AGCCCATCCANONE 
J075005J10AGCCCATCCANONE 
J075038F02AGCCCATCCANONE 
J075048K10AGCCCATCCANONE 
J075064D21AGCCCATCCANONE 
J075074M07AGCCCATCCANONE 
J075078D20AGCCCATCCANONE 
J075109P15AGCCCATCCANONE 
J075115K24AGCCCATCCANONE 
J075135G01AGCCCATCCANONE 
J075156B07AGCCCATCCANONE 
Os02g0130300011-005-D07CAAGGCCCGCCCATCCNONE 
011-041-B06CAAGGCCCGCCCATCCNONE 
015-099-D11CAAGGCCCGCCCATCCNONE 
016-049-D06CAAGGCCCGCCCATCCNONE 
AK102708CAAGGCCCGCCCATCCZinc finger, RING-type domain containing protein. 
Os02g0162500009-181-F03TTGGCCCATCCNONE 
AK058907TTGGCCCATCCNONE 
AK121223TTGGCCCATCCSimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCATCCNONE 
J023136J11TTGGCCCATCCNONE 
J053097J20TTGGCCCATCCNONE 
J053098F01TTGGCCCATCCNONE 
J065065B09TTGGCCCATCCNONE 
J065082M04TTGGCCCATCCNONE 
J065188O05TTGGCCCATCCNONE 
J075057P15TTGGCCCATCCNONE 
J075061J08TTGGCCCATCCNONE 
J075061N15TTGGCCCATCCNONE 
J075131I08TTGGCCCATCCNONE 
J075141H13TTGGCCCATCCNONE 
J080062E14TTGGCCCATCCNONE 
J080062P15TTGGCCCATCCNONE 
J080318G17TTGGCCCATCCNONE 
J080319G19TTGGCCCATCCNONE 
J090001L10TTGGCCCATCCNONE 
J090024I18TTGGCCCATCCNONE 
J090033F24TTGGCCCATCCNONE 
J090036M16TTGGCCCATCCNONE 
J090040I24TTGGCCCATCCNONE 
J090048P06TTGGCCCATCCNONE 
J090049B12TTGGCCCATCCNONE 
J090068C02TTGGCCCATCCNONE 
J090069O04TTGGCCCATCCNONE 
J090084H22TTGGCCCATCCNONE 
J100022L03TTGGCCCATCCNONE 
J100028O14TTGGCCCATCCNONE 
J100028O18TTGGCCCATCCNONE 
J100032A15TTGGCCCATCCNONE 
J100033D21TTGGCCCATCCNONE 
J100034J23TTGGCCCATCCNONE 
J100043K22TTGGCCCATCCNONE 
J100052M22TTGGCCCATCCNONE 
J100053N03TTGGCCCATCCNONE 
J100074N24TTGGCCCATCCNONE 
J100082J10TTGGCCCATCCNONE 
Os02g0232100AK108775GGATGGGCTNONE 
Os02g0235600009-009-H04AATTGGGCCCATCCANONE 
009-165-G06AATTGGGCCCATCCANONE 
AK120417AATTGGGCCCATCCASimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14AATTGGGCCCATCCANONE 
J023106P11AATTGGGCCCATCCANONE 
J033080L09AATTGGGCCCATCCANONE 
J033123O05AATTGGGCCCATCCANONE 
J065197A18AATTGGGCCCATCCANONE 
J065216P16AATTGGGCCCATCCANONE 
J075017F02AATTGGGCCCATCCANONE 
J075025L16AATTGGGCCCATCCANONE 
J075027P04AATTGGGCCCATCCANONE 
J075039N01AATTGGGCCCATCCANONE 
J075101F24AATTGGGCCCATCCANONE 
J075132J15AATTGGGCCCATCCANONE 
J075164K16AATTGGGCCCATCCANONE 
J075174E19AATTGGGCCCATCCANONE 
J100043C23AATTGGGCCCATCCANONE 
J100067B11AATTGGGCCCATCCANONE 
Os02g0468400AK120593GCCCATCCALipid-binding START domain containing protein. 
Os02g0527300AK101934CTGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11CTGGCCCATCCNONE 
J033073P11CTGGCCCATCCNONE 
Os02g0554100AK060250GCCCATCCSimilar to UVB-resistance protein UVR8. 
AK069920GCCCATCCNONE 
J023039G23GCCCATCCNONE 
Os02g0582600006-041-F11TGGATGGGCCTTNONE 
AK059791TGGATGGGCCTTNONE 
AK102380TGGATGGGCCTTHeavy metal transport/detoxification protein domain containing protein. 
J033092A09TGGATGGGCCTTNONE 
Os02g0605600016-017-B02AGCCCATCCAGCCCATCTGGACCNONE 
AK066104AGCCCATCCAGCCCATCTGGACCLUC7 related family protein. 
J013052G16AGCCCATCCAGCCCATCTGGACCNONE 
J043022E03AGCCCATCCAGCCCATCTGGACCNONE 
J065105P10AGCCCATCCAGCCCATCTGGACCNONE 
Os02g0665400AK073914TGGATGGGCCGANONE 
AK109787TGGATGGGCCGANONE 
AK120141TGGATGGGCCGASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19TGGATGGGCCGANONE 
J075165B08TGGATGGGCCGANONE 
J075177B03TGGATGGGCCGANONE 
J075191K02TGGATGGGCCGANONE 
J090051I12TGGATGGGCCGANONE 
J090057E21TGGATGGGCCGANONE 
J090058E01TGGATGGGCCGANONE 
J090087C06TGGATGGGCCGANONE 
J100025K07TGGATGGGCCGANONE 
J100026I21TGGATGGGCCGANONE 
J100041E12TGGATGGGCCGANONE 
J100083B01TGGATGGGCCGANONE 
Os02g0668500006-056-A05GCCCATCCNONE 
AK060958GCCCATCCNONE 
AK071867GCCCATCCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15GCCCATCCNONE 
J065013J03GCCCATCCNONE 
J065021P16GCCCATCCNONE 
J065044B07GCCCATCCNONE 
J065059E23GCCCATCCNONE 
J065087N20GCCCATCCNONE 
J065185I04GCCCATCCNONE 
J065190G19GCCCATCCNONE 
J065199C15GCCCATCCNONE 
J065213L12GCCCATCCNONE 
J080305C01GCCCATCCNONE 
J080308C07GCCCATCCNONE 
J080310F02GCCCATCCNONE 
Os02g0743800AK064134GGATGGGCCTTGCS domain containing protein. 
AK111254GGATGGGCCTTGNONE 
Os02g0759800012-036-G11AGCCCATCCNONE 
AK067153AGCCCATCCSimilar to GAMYB-binding protein (Fragment). 
AK071666AGCCCATCCNONE 
J013098N03AGCCCATCCNONE 
J023100L02AGCCCATCCNONE 
J023106G20AGCCCATCCNONE 
J033057G09AGCCCATCCNONE 
J100043H19AGCCCATCCNONE 
J100061H16AGCCCATCCNONE 
J100079O17AGCCCATCCNONE 
Os02g0776800AB042415CCAGCCCATCCANONE 
AK072308CCAGCCCATCCAReplication protein A 70kDa. 
AK101212CCAGCCCATCCANONE 
J033031B02CCAGCCCATCCANONE 
J090004E18CCAGCCCATCCANONE 
J090084C24CCAGCCCATCCANONE 
Os02g0785800005-017-E01TGGATGGGCTTTNONE 
009-104-F05TGGATGGGCTTTNONE 
009-149-A09TGGATGGGCTTTNONE 
009-192-D08TGGATGGGCTTTNONE 
AK063859TGGATGGGCTTTNONE 
AK121768TGGATGGGCTTTSimilar to Ribosomal protein L35A. 
J013037M21TGGATGGGCTTTNONE 
J023009A11TGGATGGGCTTTNONE 
J023010P14TGGATGGGCTTTNONE 
J033092B03TGGATGGGCTTTNONE 
J065009O06TGGATGGGCTTTNONE 
J065024K14TGGATGGGCTTTNONE 
J065053F16TGGATGGGCTTTNONE 
J065056D18TGGATGGGCTTTNONE 
J065056N12TGGATGGGCTTTNONE 
J065071L21TGGATGGGCTTTNONE 
J065075M21TGGATGGGCTTTNONE 
J065087D19TGGATGGGCTTTNONE 
J065111N01TGGATGGGCTTTNONE 
J065172M05TGGATGGGCTTTNONE 
J065176E03TGGATGGGCTTTNONE 
J065184D08TGGATGGGCTTTNONE 
J065188K21TGGATGGGCTTTNONE 
J065194I05TGGATGGGCTTTNONE 
J065196E09TGGATGGGCTTTNONE 
J065196O21TGGATGGGCTTTNONE 
J065204O06TGGATGGGCTTTNONE 
J065212J02TGGATGGGCTTTNONE 
J075066H03TGGATGGGCTTTNONE 
J075067C04TGGATGGGCTTTNONE 
J075070I09TGGATGGGCTTTNONE 
J075081J03TGGATGGGCTTTNONE 
J075086I05TGGATGGGCTTTNONE 
J075092E09TGGATGGGCTTTNONE 
J075096D13TGGATGGGCTTTNONE 
J075098A12TGGATGGGCTTTNONE 
J075110B18TGGATGGGCTTTNONE 
J075116E14TGGATGGGCTTTNONE 
J075117J23TGGATGGGCTTTNONE 
J075117O16TGGATGGGCTTTNONE 
J075130H10TGGATGGGCTTTNONE 
J075151B07TGGATGGGCTTTNONE 
J075156C02TGGATGGGCTTTNONE 
J075159C07TGGATGGGCTTTNONE 
J075172O12TGGATGGGCTTTNONE 
J075181K16TGGATGGGCTTTNONE 
J075185J05TGGATGGGCTTTNONE 
J075186D14TGGATGGGCTTTNONE 
J075187F23TGGATGGGCTTTNONE 
J075193B15TGGATGGGCTTTNONE 
J075194P20TGGATGGGCTTTNONE 
J090002B21TGGATGGGCTTTNONE 
J090018E03TGGATGGGCTTTNONE 
J090029I04TGGATGGGCTTTNONE 
J090065F12TGGATGGGCTTTNONE 
J090066M05TGGATGGGCTTTNONE 
J090078A20TGGATGGGCTTTNONE 
J090084O15TGGATGGGCTTTNONE 
J090088P20TGGATGGGCTTTNONE 
J090098L20TGGATGGGCTTTNONE 
J100025B19TGGATGGGCTTTNONE 
J100038H15TGGATGGGCTTTNONE 
J100045H17TGGATGGGCTTTNONE 
J100058E17TGGATGGGCTTTNONE 
J100060O16TGGATGGGCTTTNONE 
J100067I10TGGATGGGCTTTNONE 
J100082N24TGGATGGGCTTTNONE 
J100083C17TGGATGGGCTTTNONE 
J100085I24TGGATGGGCTTTNONE 
J100087K20TGGATGGGCTTTNONE 
Os02g0813600AK107210GCCCATCCAVery-long-chain 3-ketoacyl-CoA synthase family protein. 
Os02g0819700AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os03g0145900J013045K15GGATGGGCNONE 
J013051O08GGATGGGCNONE 
J065054C08GGATGGGCNONE 
J075053J16GGATGGGCNONE 
Os03g0182800003-126-E06ACAGCCCATCCNONE 
AJ304840ACAGCCCATCCNONE 
AK073133ACAGCCCATCCNONE 
AY323478ACAGCCCATCCSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13ACAGCCCATCCNONE 
J033028C22ACAGCCCATCCNONE 
J033042J03ACAGCCCATCCNONE 
J065022E13ACAGCCCATCCNONE 
J065208N24ACAGCCCATCCNONE 
J100034B17ACAGCCCATCCNONE 
J100035J21ACAGCCCATCCNONE 
J100039L16ACAGCCCATCCNONE 
J100040A02ACAGCCCATCCNONE 
J100051L11ACAGCCCATCCNONE 
J100064F07ACAGCCCATCCNONE 
J100070J12ACAGCCCATCCNONE 
Os03g0195900J065063O15GGATGGGCCTCNONE 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0211900AK059280GCCCATCCLeucine rich repeat, N-terminal domain containing protein. 
AK121380GCCCATCCNONE 
J033102D09GCCCATCCNONE 
J053089G04GCCCATCCNONE 
J065138D22GCCCATCCNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0279200009-097-C06TTGGCCCATCCNONE 
013-007-B07TTGGCCCATCCNONE 
AK121750TTGGCCCATCCSimilar to Histone H2A. 
J033087I02TTGGCCCATCCNONE 
J065002G20TTGGCCCATCCNONE 
J065102M04TTGGCCCATCCNONE 
J065139A02TTGGCCCATCCNONE 
J075109D21TTGGCCCATCCNONE 
J075191L12TTGGCCCATCCNONE 
J090096C03TTGGCCCATCCNONE 
J100036C23TTGGCCCATCCNONE 
Os03g0292800012-077-B05CAAGGCCCATCCNONE 
AK069970CAAGGCCCATCCSimilar to Ran binding protein 1 homolog. 
J065138F22CAAGGCCCATCCNONE 
Os03g0305500AK070638TCCGGCCCATCCAArgininosuccinate lyase domain containing protein. 
Os03g0308000016-023-H09AGCCCATCCANONE 
AK100355AGCCCATCCAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05AGCCCATCCANONE 
J023043K04AGCCCATCCANONE 
J023083I20AGCCCATCCANONE 
J033068F22AGCCCATCCANONE 
J033125P21AGCCCATCCANONE 
J065207A22AGCCCATCCANONE 
J100018D20AGCCCATCCANONE 
J100026L17AGCCCATCCANONE 
J100055D14AGCCCATCCANONE 
J100060P03AGCCCATCCANONE 
J100078A20AGCCCATCCANONE 
Os03g0309800004-019-H07GGATGGGCCGCANONE 
AK060922GGATGGGCCGCANONE 
AK098942GGATGGGCCGCANONE 
AK106141GGATGGGCCGCANONE 
AK111530GGATGGGCCGCANONE 
AK111624GGATGGGCCGCASimilar to PPR2. 
J013024C10GGATGGGCCGCANONE 
J013043D15GGATGGGCCGCANONE 
J013108I11GGATGGGCCGCANONE 
J100058L07GGATGGGCCGCANONE 
J100071I19GGATGGGCCGCANONE 
Os03g0336200AK059473GCCCATCCNONE 
AK070466GCCCATCCTranscription factor RF2b. 
AY466471GCCCATCCNONE 
Os03g0360500009-103-B05GGATGGGCCTGGNONE 
AK059166GGATGGGCCTGGNONE 
AK101285GGATGGGCCTGGProtein of unknown function DUF1077 family protein. 
J033061G19GGATGGGCCTGGNONE 
J065169P12GGATGGGCCTGGNONE 
J075104C18GGATGGGCCTGGNONE 
J075166G07GGATGGGCCTGGNONE 
J075170J04GGATGGGCCTGGNONE 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
Os03g0415500AK108435GCGGCCCATCCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GCGGCCCATCCANONE 
Os03g0442400Os03g0442400CCCGGCCCATCCNONE 
Os03g0565500AB040051GCCCATCCANONE 
AK102744GCCCATCCANONE 
AK122133GCCCATCCASimilar to Elongation factor G 1, mitochondrial precursor (mEF-G-1) (EFGM). 
D21121GCCCATCCANONE 
Os03g0579000AK061586GCCCATCCNONE 
AK072995GCCCATCCPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0685000009-031-F08GGATGGGCCGCNONE 
AK059896GGATGGGCCGCSimilar to Ferredoxin. 
AK098989GGATGGGCCGCNONE 
AK099303GGATGGGCCGCNONE 
J065041E14GGATGGGCCGCNONE 
J065085G22GGATGGGCCGCNONE 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0722000AK069866GCAGCCCATCCANONE 
Os03g0734700AK072060TTCGGCCCATCCMitochondrial substrate carrier family protein. 
AK120533TTCGGCCCATCCNONE 
J043026E20TTCGGCCCATCCNONE 
Os03g0740700011-093-H12GGCCCGGCCCATCCNONE 
AK102723GGCCCGGCCCATCCProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19GGCCCGGCCCATCCNONE 
J013126N16GGCCCGGCCCATCCNONE 
J033105J16GGCCCGGCCCATCCNONE 
J090059D19GGCCCGGCCCATCCNONE 
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
Os03g0759500AB099524GGATGGGCNONE 
AK063449GGATGGGCOrigin recognition complex 5. 
J065152N07GGATGGGCNONE 
Os03g0786700AK067936AATTGGGCCCATCCN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0798300AK108034GGATGGGCSimilar to Cytosine-5 DNA methyltransferase MET1 (Fragment). 
Os03g0819600006-069-D12GCCCATCCNONE 
009-043-D06GCCCATCCNONE 
009-087-G10GCCCATCCNONE 
009-153-G08GCCCATCCNONE 
009-162-G07GCCCATCCNONE 
AK061390GCCCATCCChalcone isomerase (EC 5.5.1.6). 
AK104791GCCCATCCNONE 
J013092J08GCCCATCCNONE 
J013102G09GCCCATCCNONE 
J013160E06GCCCATCCNONE 
J065046A14GCCCATCCNONE 
J065077M16GCCCATCCNONE 
J065103H02GCCCATCCNONE 
J065164K09GCCCATCCNONE 
J065208D13GCCCATCCNONE 
J075088G06GCCCATCCNONE 
J075093L09GCCCATCCNONE 
J075093N09GCCCATCCNONE 
J090007L08GCCCATCCNONE 
J100024D12GCCCATCCNONE 
J100052L09GCCCATCCNONE 
J100062I20GCCCATCCNONE 
Os03g0829100AK072669TCGGCCCATCCASimilar to Soluble epoxide hydrolase. 
J013073C22TCGGCCCATCCANONE 
J033067O15TCGGCCCATCCANONE 
J065021D04TCGGCCCATCCANONE 
J065102E20TCGGCCCATCCANONE 
Os03g0832600AK120137GCCCATCCASimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0843500AK067985GAGGCCCATCCNONE 
AK101661GAGGCCCATCCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454GAGGCCCATCCNONE 
J080302L23GAGGCCCATCCNONE 
Os03g0846900016-055-F06CCCGGCCCATCCNONE 
AK059297CCCGGCCCATCCConserved hypothetical protein. 
J090028J16CCCGGCCCATCCNONE 
Os03g0854500012-067-H08AAGGCCCATCCNONE 
AK100430AAGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
AK106118AAGGCCCATCCNONE 
AY344485AAGGCCCATCCNONE 
J023088F14AAGGCCCATCCNONE 
J100041G01AAGGCCCATCCNONE 
J100046N19AAGGCCCATCCNONE 
J100052O08AAGGCCCATCCNONE 
Os04g0218600009-123-A05AAGGCCCAAGGCCCATCCNONE 
AK062873AAGGCCCAAGGCCCATCCNONE 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
J090077A20AAGGCCCAAGGCCCATCCNONE 
Os04g0432000AB125308CCAGCCCATCCCCCSerine/threonine-protein kinase SAPK7 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 7). 
AK122087CCAGCCCATCCCCCNONE 
J065206O17CCAGCCCATCCCCCNONE 
Os04g0525000AK067753TGGATGGGCCCATCGConserved hypothetical protein. 
J013118G14TGGATGGGCCCATCGNONE 
J065026J15TGGATGGGCCCATCGNONE 
J065184H21TGGATGGGCCCATCGNONE 
J065186H22TGGATGGGCCCATCGNONE 
J065193D20TGGATGGGCCCATCGNONE 
J075060D12TGGATGGGCCCATCGNONE 
J075179L24TGGATGGGCCCATCGNONE 
Os04g0556000AK063759GGATGGGCTNONE 
Os04g0563700015-005-B06CGCGTCGCCCATCCANONE 
AB024987CGCGTCGCCCATCCANONE 
AK070211CGCGTCGCCCATCCACyclin. 
Os04g0570600AK106747GCCGGCCCATCCCytochrome P450 family protein. 
J080319G08GCCGGCCCATCCNONE 
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein. 
AK103182GGATGGGCCAAGCCCATGTNONE 
AK119612GGATGGGCCAAGCCCATGTNONE 
AK120901GGATGGGCCAAGCCCATGTNONE 
Os04g0574100006-087-B01GGATGGGCCCCGCGTCGCNONE 
AK061150GGATGGGCCCCGCGTCGCNONE 
AK069178GGATGGGCCCCGCGTCGCExostosin-like family protein. 
AK121041GGATGGGCCCCGCGTCGCNONE 
J023008D04GGATGGGCCCCGCGTCGCNONE 
J023052A13GGATGGGCCCCGCGTCGCNONE 
J065046P18GGATGGGCCCCGCGTCGCNONE 
J065105D10GGATGGGCCCCGCGTCGCNONE 
Os04g0592500AK066893ATCTGGGCCCATCCPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ATCTGGGCCCATCCNONE 
Os04g0611300009-006-G08TTGGCCCATCCANONE 
009-011-C01TTGGCCCATCCANONE 
009-036-B09TTGGCCCATCCANONE 
009-116-G09TTGGCCCATCCANONE 
009-126-E09TTGGCCCATCCANONE 
009-132-F09TTGGCCCATCCANONE 
009-151-G07TTGGCCCATCCANONE 
009-155-C07TTGGCCCATCCANONE 
009-163-G01TTGGCCCATCCANONE 
009-169-G08TTGGCCCATCCANONE 
009-191-B02TTGGCCCATCCANONE 
009-196-A08TTGGCCCATCCANONE 
009-198-E07TTGGCCCATCCANONE 
014-015-F04TTGGCCCATCCANONE 
015-087-H04TTGGCCCATCCANONE 
AK062605TTGGCCCATCCANONE 
AK063022TTGGCCCATCCAConserved hypothetical protein. 
AK066749TTGGCCCATCCANONE 
AK104924TTGGCCCATCCANONE 
J065002M20TTGGCCCATCCANONE 
J065045L23TTGGCCCATCCANONE 
J065101E05TTGGCCCATCCANONE 
J065140J23TTGGCCCATCCANONE 
J065179G11TTGGCCCATCCANONE 
J065191B18TTGGCCCATCCANONE 
J065192E03TTGGCCCATCCANONE 
J065199H21TTGGCCCATCCANONE 
J075067F01TTGGCCCATCCANONE 
J075089L01TTGGCCCATCCANONE 
J075147K22TTGGCCCATCCANONE 
J080069G23TTGGCCCATCCANONE 
J100053D10TTGGCCCATCCANONE 
J100078C10TTGGCCCATCCANONE 
Os04g0612800016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0658800AK111108CTGGCCCATCCConserved hypothetical protein. 
Os04g0670800AK073170GGATGGGCCCTNONE 
Os04g0671300AK072414GACAGGTGCCCATCCASimilar to Suppressor of presenilin 5 (P110b homolog). 
Os04g0683900004-009-A11GCCCACCCAGCCCATCCNONE 
014-076-H12GCCCACCCAGCCCATCCNONE 
AK060880GCCCACCCAGCCCATCCNONE 
AK099749GCCCACCCAGCCCATCCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GCCCACCCAGCCCATCCNONE 
J013050K21GCCCACCCAGCCCATCCNONE 
J013092E09GCCCACCCAGCCCATCCNONE 
J013095N06GCCCACCCAGCCCATCCNONE 
J013095P07GCCCACCCAGCCCATCCNONE 
J013130D22GCCCACCCAGCCCATCCNONE 
J013134O15GCCCACCCAGCCCATCCNONE 
J023022I06GCCCACCCAGCCCATCCNONE 
J023062L11GCCCACCCAGCCCATCCNONE 
J023078J11GCCCACCCAGCCCATCCNONE 
J023086J01GCCCACCCAGCCCATCCNONE 
J033125A20GCCCACCCAGCCCATCCNONE 
J065023K13GCCCACCCAGCCCATCCNONE 
J065045N02GCCCACCCAGCCCATCCNONE 
J065129F01GCCCACCCAGCCCATCCNONE 
J065164H14GCCCACCCAGCCCATCCNONE 
J065192H09GCCCACCCAGCCCATCCNONE 
J075064P15GCCCACCCAGCCCATCCNONE 
J075088G17GCCCACCCAGCCCATCCNONE 
J075199D20GCCCACCCAGCCCATCCNONE 
Os04g0684500AK066014GGATGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0691700015-036-C06GGATGGGCNONE 
AK106305GGATGGGCSimilar to Autoimmune regulator (Autoimmune polyendocrinopathy candidiasis ectodermal dystrophy protein) (APECED protein). 
Os05g0103100AK103317GGATGGGCTTGTranslocon-associated beta family protein. 
J033125H15GGATGGGCTTGNONE 
J065021L01GGATGGGCTTGNONE 
J065029M01GGATGGGCTTGNONE 
J065089F17GGATGGGCTTGNONE 
J065112N04GGATGGGCTTGNONE 
J065163L03GGATGGGCTTGNONE 
J065175B04GGATGGGCTTGNONE 
J065192E02GGATGGGCTTGNONE 
J075046C20GGATGGGCTTGNONE 
J075192A01GGATGGGCTTGNONE 
J100018H13GGATGGGCTTGNONE 
J100067K20GGATGGGCTTGNONE 
J100080N03GGATGGGCTTGNONE 
Os05g0110900AK073169CCGTTGGATGCCCATCCGACGGSimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os05g0121500006-117-B10TCAGGCCCATCCANONE 
009-059-D04TCAGGCCCATCCANONE 
J065066C12TCAGGCCCATCCAConserved hypothetical protein. 
J075013I12TCAGGCCCATCCANONE 
J090046D18TCAGGCCCATCCANONE 
Os05g0139100Os05g0139100GCCCATCCABasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os05g0152400Os05g0152400AGCCCATCCGlycosyl transferase, family 14 protein. 
Os05g0194550J075140P14GGATGGGCCAGAConserved hypothetical protein. 
Os05g0210100AK122049AGCCCATAGCCCATCCALipolytic enzyme, G-D-S-L family protein. 
Os05g0227100009-045-C06TGGATGGGCNONE 
009-109-A08TGGATGGGCNONE 
J075072D22TGGATGGGCHypothetical protein. 
Os05g0227300Os05g0227300TGGATGGGCNONE 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0316200AK060608CCAGCCCATCCANONE 
AK101705CCAGCCCATCCAConserved hypothetical protein. 
AK111481CCAGCCCATCCANONE 
Os05g0453700009-171-G06GCCCATCCANONE 
015-019-F02GCCCATCCANONE 
AB110169GCCCATCCANONE 
AK063881GCCCATCCASimilar to ENOD18 protein (Fragment). 
AK073600GCCCATCCANONE 
J033048I03GCCCATCCANONE 
J065026A09GCCCATCCANONE 
J065028M08GCCCATCCANONE 
J075140N01GCCCATCCANONE 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
Os05g0499300009-151-H01GGATGGGCCAGNONE 
013-049-G05GGATGGGCCAGNONE 
AK066855GGATGGGCCAGNONE 
AK104950GGATGGGCCAGSimilar to Peroxidase (EC 1.11.1.7). 
D14997GGATGGGCCAGNONE 
Os05g0542200AK071306AGCCCATCCAEpoxide hydrolase family protein. 
AK071703AGCCCATCCANONE 
Os05g0566800AK065748GCCCATCCCold acclimation protein COR413-TM1. 
AY181210GCCCATCCNONE 
Os05g0588200AK109323TCTGGCCCATCCRuvA domain 2-like containing protein. 
Os06g0101000J023143D21TCTGGCCCATCCANONE 
J033027A19TCTGGCCCATCCANONE 
J033131O18TCTGGCCCATCCANONE 
J043040N17TCTGGCCCATCCANONE 
J090007I16TCTGGCCCATCCANONE 
Os06g0103400009-138-H04AAGGCCCATCCNONE 
AK067021AAGGCCCATCCNucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCATCCNONE 
J080307A01AAGGCCCATCCNONE 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0139700006-052-C07TAAGCCCATCCACCNONE 
009-009-A08TAAGCCCATCCACCNONE 
015-020-D09TAAGCCCATCCACCNONE 
015-087-H06TAAGCCCATCCACCNONE 
016-078-A03TAAGCCCATCCACCNONE 
AK067884TAAGCCCATCCACCNONE 
AK103245TAAGCCCATCCACCConserved hypothetical protein. 
AK106116TAAGCCCATCCACCNONE 
AK106220TAAGCCCATCCACCNONE 
Os06g0168700011-054-F04GCCCATCCANONE 
012-001-G03GCCCATCCANONE 
AK101305GCCCATCCANONE 
AK103637GCCCATCCASimilar to Prolin rich protein. 
J075082N06GCCCATCCANONE 
J100086I19GCCCATCCANONE 
Os06g0247800AK102187CCACCAACTCGGCCCATCCSimilar to Dynamin-like protein (Fragment). 
AY224491CCACCAACTCGGCCCATCCNONE 
Os06g0287700AK067966CCAGGCCCATCCSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17CCAGGCCCATCCNONE 
J065038I02CCAGGCCCATCCNONE 
J065214J02CCAGGCCCATCCNONE 
Os06g0325500011-037-D06GGATGGGCNONE 
011-093-G07GGATGGGCNONE 
AK063974GGATGGGCProtein of unknown function DUF89 family protein. 
AK099286GGATGGGCNONE 
J065124G18GGATGGGCNONE 
J065160K08GGATGGGCNONE 
J065207O08GGATGGGCNONE 
J075011D18GGATGGGCNONE 
J075012D02GGATGGGCNONE 
J075090F13GGATGGGCNONE 
J075164A04GGATGGGCNONE 
J075198I19GGATGGGCNONE 
Os06g0326500AK068142GGATGGGCTMitochondrial glycoprotein family protein. 
AK071483GGATGGGCTNONE 
J053065A20GGATGGGCTNONE 
J065082D14GGATGGGCTNONE 
Os06g0329350009-021-B05TGGATGGGCCCACANONE 
009-043-A04TGGATGGGCCCACANONE 
009-051-G06TGGATGGGCCCACANONE 
009-107-D02TGGATGGGCCCACANONE 
009-111-B11TGGATGGGCCCACANONE 
009-118-B02TGGATGGGCCCACANONE 
009-132-A11TGGATGGGCCCACANONE 
009-186-B06TGGATGGGCCCACANONE 
J065044N12TGGATGGGCCCACANONE 
J065097L15TGGATGGGCCCACANONE 
J065219N02TGGATGGGCCCACANONE 
J080009E03TGGATGGGCCCACANONE 
J080020P03TGGATGGGCCCACANONE 
J080024O15TGGATGGGCCCACANONE 
J080030B22TGGATGGGCCCACANONE 
J080032G04TGGATGGGCCCACANONE 
J080045B12TGGATGGGCCCACANONE 
J080048M05TGGATGGGCCCACANONE 
J080051M16TGGATGGGCCCACANONE 
J080053K12TGGATGGGCCCACANONE 
J080056G17TGGATGGGCCCACANONE 
J080068O22TGGATGGGCCCACANONE 
J080074K04TGGATGGGCCCACANONE 
J080075B20TGGATGGGCCCACANONE 
J080077I03TGGATGGGCCCACANONE 
J080081E17TGGATGGGCCCACANONE 
J080082B08TGGATGGGCCCACANONE 
J080084I03TGGATGGGCCCACANONE 
J080092F08TGGATGGGCCCACANONE 
J090086C01TGGATGGGCCCACAConserved hypothetical protein. 
Os06g0494400AK067594ACAGCCCATCCMulti antimicrobial extrusion protein MatE family protein. 
Os06g0573700015-015-F02GGATGGGCCAGNONE 
015-015-F02TTATGGGCCCATCCANONE 
AK106254GGATGGGCCAGConserved hypothetical protein. 
AK106254TTATGGGCCCATCCAConserved hypothetical protein. 
J065172G24GGATGGGCCAGNONE 
J065172G24TTATGGGCCCATCCANONE 
Os06g0592500AK119729AGCCCATCCSimilar to Ethylene-responsive transcriptional coactivator. 
AK122052AGCCCATCCNONE 
Os06g0625500006-034-A05CGGGCCCATCCNONE 
AK058459CGGGCCCATCCSimilar to Thioredoxin peroxidase. 
AK068955CGGGCCCATCCNONE 
AK104130CGGGCCCATCCNONE 
J023003C09CGGGCCCATCCNONE 
J033043I02CGGGCCCATCCNONE 
J065063E05CGGGCCCATCCNONE 
J065190D24CGGGCCCATCCNONE 
J065198I01CGGGCCCATCCNONE 
J075107A02CGGGCCCATCCNONE 
Os06g0648200009-150-E06TGGATGGGCCGAGNONE 
014-034-H10TGGATGGGCCGAGNONE 
015-035-E11TGGATGGGCCGAGNONE 
AK063001TGGATGGGCCGAGNONE 
AK063675TGGATGGGCCGAGNONE 
AK106303TGGATGGGCCGAGConserved hypothetical protein. 
Os06g0663600AK100787GTGGCCCATCCEndonuclease V family protein. 
Os06g0681000009-105-G11GGATGGGCCTANONE 
AK062780GGATGGGCCTAConserved hypothetical protein. 
J100021E01GGATGGGCCTANONE 
Os06g0705400009-033-D03GCCCATCCANONE 
009-056-H04GCCCATCCANONE 
009-085-B10GCCCATCCANONE 
009-121-F03GCCCATCCANONE 
009-146-H05GCCCATCCANONE 
009-155-E09GCCCATCCANONE 
009-164-H02GCCCATCCANONE 
009-168-G05GCCCATCCANONE 
009-181-B05GCCCATCCANONE 
AK062493GCCCATCCANONE 
AK062667GCCCATCCASimilar to Nonspecific lipid-transfer protein 2P (LTP2P) (Lipid transfer protein 2 isoform 2) (LTP2-2) (7 kDa lipid transfer protein 2). 
J065070I09GCCCATCCANONE 
Os06g0728800J053046C07GCCCATCCConserved hypothetical protein. 
Os07g0154300009-070-E08TAGGCCCATCCNONE 
009-077-E01TAGGCCCATCCNONE 
009-196-F05TAGGCCCATCCNONE 
AK105386TAGGCCCATCCConserved hypothetical protein. 
AK122093TAGGCCCATCCNONE 
J033124K14TAGGCCCATCCNONE 
J075006I22TAGGCCCATCCNONE 
J075185G02TAGGCCCATCCNONE 
J090039C02TAGGCCCATCCNONE 
Os07g0448800003-112-B05AAGGCCCATCCANONE 
003-118-A02AAGGCCCATCCANONE 
006-029-E09AAGGCCCATCCANONE 
006-056-F11AAGGCCCATCCANONE 
006-081-F01AAGGCCCATCCANONE 
006-084-H12AAGGCCCATCCANONE 
006-094-A12AAGGCCCATCCANONE 
006-095-C01AAGGCCCATCCANONE 
006-098-F09AAGGCCCATCCANONE 
009-151-B09AAGGCCCATCCANONE 
009-169-C08AAGGCCCATCCANONE 
009-172-F09AAGGCCCATCCANONE 
009-200-H03AAGGCCCATCCANONE 
011-008-B03AAGGCCCATCCANONE 
011-035-C10AAGGCCCATCCANONE 
011-041-G11AAGGCCCATCCANONE 
011-059-H01AAGGCCCATCCANONE 
011-071-D12AAGGCCCATCCANONE 
013-010-E11AAGGCCCATCCANONE 
013-015-B06AAGGCCCATCCANONE 
013-028-A11AAGGCCCATCCANONE 
013-037-A04AAGGCCCATCCANONE 
013-057-B07AAGGCCCATCCANONE 
014-041-D03AAGGCCCATCCANONE 
014-073-G04AAGGCCCATCCANONE 
014-093-D10AAGGCCCATCCANONE 
016-030-F03AAGGCCCATCCANONE 
016-034-B08AAGGCCCATCCANONE 
016-064-D05AAGGCCCATCCANONE 
AB029446AAGGCCCATCCANONE 
AF062393AAGGCCCATCCANONE 
AK072519AAGGCCCATCCAAquaporin. 
AK103938AAGGCCCATCCANONE 
AK103970AAGGCCCATCCANONE 
AK119656AAGGCCCATCCANONE 
J023026N01AAGGCCCATCCANONE 
J023055M16AAGGCCCATCCANONE 
J023063J21AAGGCCCATCCANONE 
J023128K12AAGGCCCATCCANONE 
J065041P10AAGGCCCATCCANONE 
J065134L07AAGGCCCATCCANONE 
J075198L17AAGGCCCATCCANONE 
J090031G17AAGGCCCATCCANONE 
J090032B21AAGGCCCATCCANONE 
J090032D13AAGGCCCATCCANONE 
J090057J22AAGGCCCATCCANONE 
J090062J02AAGGCCCATCCANONE 
J100028J09AAGGCCCATCCANONE 
J100053C06AAGGCCCATCCANONE 
J100056I11AAGGCCCATCCANONE 
J100067E10AAGGCCCATCCANONE 
Os07g0476200AB057651GCCCATCCNONE 
AK121737GCCCATCCNONE 
Os07g0486000AK069343GGATGGGCCAGASimilar to MSH4. 
Os07g0501900AK067791GCCCATCCCCCNONE 
Os07g0555300AK071161GCCCATCCConserved hypothetical protein. 
AK106624GCCCATCCNONE 
J075086E01GCCCATCCNONE 
J075142B06GCCCATCCNONE 
Os07g0558400003-103-C02TGGGGCCCATCCACCNONE 
003-115-G05TGGGGCCCATCCACCNONE 
006-025-B09TGGGGCCCATCCACCNONE 
006-025-G10TGGGGCCCATCCACCNONE 
006-027-E03TGGGGCCCATCCACCNONE 
006-036-C06TGGGGCCCATCCACCNONE 
006-045-B10TGGGGCCCATCCACCNONE 
006-051-H11TGGGGCCCATCCACCNONE 
006-053-H03TGGGGCCCATCCACCNONE 
006-057-B09TGGGGCCCATCCACCNONE 
006-062-C10TGGGGCCCATCCACCNONE 
006-075-B12TGGGGCCCATCCACCNONE 
006-079-F01TGGGGCCCATCCACCNONE 
006-082-D08TGGGGCCCATCCACCNONE 
006-087-F04TGGGGCCCATCCACCNONE 
006-089-E09TGGGGCCCATCCACCNONE 
006-090-C04TGGGGCCCATCCACCNONE 
006-091-H05TGGGGCCCATCCACCNONE 
006-093-E02TGGGGCCCATCCACCNONE 
006-093-E06TGGGGCCCATCCACCNONE 
006-093-H05TGGGGCCCATCCACCNONE 
006-095-C05TGGGGCCCATCCACCNONE 
006-097-B04TGGGGCCCATCCACCNONE 
006-097-C07TGGGGCCCATCCACCNONE 
006-097-D02TGGGGCCCATCCACCNONE 
006-097-H10TGGGGCCCATCCACCNONE 
006-098-C05TGGGGCCCATCCACCNONE 
006-099-H09TGGGGCCCATCCACCNONE 
006-104-B06TGGGGCCCATCCACCNONE 
006-105-B11TGGGGCCCATCCACCNONE 
006-106-E12TGGGGCCCATCCACCNONE 
006-107-B06TGGGGCCCATCCACCNONE 
006-109-A09TGGGGCCCATCCACCNONE 
006-112-D05TGGGGCCCATCCACCNONE 
006-118-C12TGGGGCCCATCCACCNONE 
006-118-E10TGGGGCCCATCCACCNONE 
006-120-D05TGGGGCCCATCCACCNONE 
006-120-E08TGGGGCCCATCCACCNONE 
009-055-D12TGGGGCCCATCCACCNONE 
009-108-E05TGGGGCCCATCCACCNONE 
009-125-H05TGGGGCCCATCCACCNONE 
009-150-A07TGGGGCCCATCCACCNONE 
009-198-C07TGGGGCCCATCCACCNONE 
AF058796TGGGGCCCATCCACCNONE 
AK058293TGGGGCCCATCCACCNONE 
AK098992TGGGGCCCATCCACCNONE 
AK103924TGGGGCCCATCCACCNONE 
AK104309TGGGGCCCATCCACCNONE 
AK104619TGGGGCCCATCCACCNONE 
AK119534TGGGGCCCATCCACCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13TGGGGCCCATCCACCNONE 
J043039O11TGGGGCCCATCCACCNONE 
J065176D03TGGGGCCCATCCACCNONE 
J075022K10TGGGGCCCATCCACCNONE 
J075065A02TGGGGCCCATCCACCNONE 
J075077D23TGGGGCCCATCCACCNONE 
J075088P15TGGGGCCCATCCACCNONE 
J075125D24TGGGGCCCATCCACCNONE 
J075125H11TGGGGCCCATCCACCNONE 
J075192H21TGGGGCCCATCCACCNONE 
J090080H18TGGGGCCCATCCACCNONE 
Os07g0577600006-021-H11GCCCATCCNONE 
006-022-B11GCCCATCCNONE 
006-022-D10GCCCATCCNONE 
006-022-E02GCCCATCCNONE 
006-022-F03GCCCATCCNONE 
006-023-C11GCCCATCCNONE 
006-024-C10GCCCATCCNONE 
006-024-C12GCCCATCCNONE 
006-024-G12GCCCATCCNONE 
006-026-C04GCCCATCCNONE 
006-026-E05GCCCATCCNONE 
006-026-E11GCCCATCCNONE 
006-026-F09GCCCATCCNONE 
006-026-H05GCCCATCCNONE 
006-027-D03GCCCATCCNONE 
006-028-C04GCCCATCCNONE 
006-029-G10GCCCATCCNONE 
006-030-A11GCCCATCCNONE 
006-030-D12GCCCATCCNONE 
006-031-G05GCCCATCCNONE 
006-032-H06GCCCATCCNONE 
006-033-A02GCCCATCCNONE 
006-033-A06GCCCATCCNONE 
006-034-B10GCCCATCCNONE 
006-034-F07GCCCATCCNONE 
006-035-A08GCCCATCCNONE 
006-035-F07GCCCATCCNONE 
006-036-A04GCCCATCCNONE 
006-036-B04GCCCATCCNONE 
006-037-D02GCCCATCCNONE 
006-037-F12GCCCATCCNONE 
006-037-H12GCCCATCCNONE 
006-040-G12GCCCATCCNONE 
006-040-H03GCCCATCCNONE 
006-040-H06GCCCATCCNONE 
006-042-B12GCCCATCCNONE 
006-042-H10GCCCATCCNONE 
006-044-G09GCCCATCCNONE 
006-045-C04GCCCATCCNONE 
006-046-B10GCCCATCCNONE 
006-047-A05GCCCATCCNONE 
006-048-D05GCCCATCCNONE 
006-049-A08GCCCATCCNONE 
006-050-C07GCCCATCCNONE 
006-050-H10GCCCATCCNONE 
006-051-G03GCCCATCCNONE 
006-052-A01GCCCATCCNONE 
006-052-A05GCCCATCCNONE 
006-052-B03GCCCATCCNONE 
006-052-D10GCCCATCCNONE 
006-054-D03GCCCATCCNONE 
006-055-A12GCCCATCCNONE 
006-055-C05GCCCATCCNONE 
006-055-F05GCCCATCCNONE 
006-055-H10GCCCATCCNONE 
006-056-A02GCCCATCCNONE 
006-056-D07GCCCATCCNONE 
006-057-A03GCCCATCCNONE 
006-057-B06GCCCATCCNONE 
006-057-H08GCCCATCCNONE 
006-058-C04GCCCATCCNONE 
006-058-F06GCCCATCCNONE 
006-059-C10GCCCATCCNONE 
006-059-G08GCCCATCCNONE 
006-060-E10GCCCATCCNONE 
006-061-B10GCCCATCCNONE 
006-062-A05GCCCATCCNONE 
006-062-B04GCCCATCCNONE 
006-063-A04GCCCATCCNONE 
006-063-D01GCCCATCCNONE 
006-063-G12GCCCATCCNONE 
006-064-D12GCCCATCCNONE 
006-066-A03GCCCATCCNONE 
006-066-C03GCCCATCCNONE 
006-067-A03GCCCATCCNONE 
006-067-G07GCCCATCCNONE 
006-068-A06GCCCATCCNONE 
006-069-D04GCCCATCCNONE 
006-069-G05GCCCATCCNONE 
006-070-H08GCCCATCCNONE 
006-071-A05GCCCATCCNONE 
006-071-H11GCCCATCCNONE 
006-072-A07GCCCATCCNONE 
006-072-B02GCCCATCCNONE 
006-072-D11GCCCATCCNONE 
006-072-H12GCCCATCCNONE 
006-075-G06GCCCATCCNONE 
006-077-B09GCCCATCCNONE 
006-078-D01GCCCATCCNONE 
006-078-D02GCCCATCCNONE 
006-078-E05GCCCATCCNONE 
006-078-G07GCCCATCCNONE 
006-079-C03GCCCATCCNONE 
006-079-F12GCCCATCCNONE 
006-079-H01GCCCATCCNONE 
006-080-D04GCCCATCCNONE 
006-080-H04GCCCATCCNONE 
006-081-A10GCCCATCCNONE 
006-082-G02GCCCATCCNONE 
006-082-H07GCCCATCCNONE 
006-083-B03GCCCATCCNONE 
006-085-A09GCCCATCCNONE 
006-085-A12GCCCATCCNONE 
006-085-F07GCCCATCCNONE 
006-086-B11GCCCATCCNONE 
006-086-D01GCCCATCCNONE 
006-086-G04GCCCATCCNONE 
006-087-E04GCCCATCCNONE 
006-087-G09GCCCATCCNONE 
006-088-E11GCCCATCCNONE 
006-088-G10GCCCATCCNONE 
006-088-H01GCCCATCCNONE 
006-089-B04GCCCATCCNONE 
006-089-D05GCCCATCCNONE 
006-089-F07GCCCATCCNONE 
006-089-H07GCCCATCCNONE 
006-090-B06GCCCATCCNONE 
006-090-H05GCCCATCCNONE 
006-091-E11GCCCATCCNONE 
006-092-H01GCCCATCCNONE 
006-093-B08GCCCATCCNONE 
006-093-C07GCCCATCCNONE 
006-093-F02GCCCATCCNONE 
006-093-G05GCCCATCCNONE 
006-093-G06GCCCATCCNONE 
006-094-D10GCCCATCCNONE 
006-094-H07GCCCATCCNONE 
006-095-G03GCCCATCCNONE 
006-096-A06GCCCATCCNONE 
006-096-E03GCCCATCCNONE 
006-097-B03GCCCATCCNONE 
006-097-D03GCCCATCCNONE 
006-098-B07GCCCATCCNONE 
006-098-G05GCCCATCCNONE 
006-099-F05GCCCATCCNONE 
006-100-H10GCCCATCCNONE 
006-100-H12GCCCATCCNONE 
006-101-A06GCCCATCCNONE 
006-101-A08GCCCATCCNONE 
006-101-A12GCCCATCCNONE 
006-101-D04GCCCATCCNONE 
006-101-G07GCCCATCCNONE 
006-102-B12GCCCATCCNONE 
006-102-E09GCCCATCCNONE 
006-102-F02GCCCATCCNONE 
006-103-D09GCCCATCCNONE 
006-105-D05GCCCATCCNONE 
006-105-D08GCCCATCCNONE 
006-106-C07GCCCATCCNONE 
006-106-F12GCCCATCCNONE 
006-107-D01GCCCATCCNONE 
006-109-C05GCCCATCCNONE 
006-109-C08GCCCATCCNONE 
006-109-D02GCCCATCCNONE 
006-111-F03GCCCATCCNONE 
006-112-C12GCCCATCCNONE 
006-112-D08GCCCATCCNONE 
006-113-A01GCCCATCCNONE 
006-113-B03GCCCATCCNONE 
006-113-C11GCCCATCCNONE 
006-113-E07GCCCATCCNONE 
006-113-F08GCCCATCCNONE 
006-114-D08GCCCATCCNONE 
006-114-H08GCCCATCCNONE 
006-115-A08GCCCATCCNONE 
006-115-A09GCCCATCCNONE 
006-115-G05GCCCATCCNONE 
006-117-B06GCCCATCCNONE 
006-117-B09GCCCATCCNONE 
006-117-F11GCCCATCCNONE 
006-117-G10GCCCATCCNONE 
006-117-H08GCCCATCCNONE 
006-118-C06GCCCATCCNONE 
006-118-G11GCCCATCCNONE 
006-119-H03GCCCATCCNONE 
006-120-D01GCCCATCCNONE 
006-120-D12GCCCATCCNONE 
006-120-H04GCCCATCCNONE 
009-022-E12GCCCATCCNONE 
009-044-H02GCCCATCCNONE 
009-074-B08GCCCATCCNONE 
009-145-B08GCCCATCCNONE 
009-156-D09GCCCATCCNONE 
009-163-F03GCCCATCCNONE 
009-193-G03GCCCATCCNONE 
AF010321GCCCATCCNONE 
AK060987GCCCATCCNONE 
AK070051GCCCATCCNONE 
AK103966GCCCATCCNONE 
AK104016GCCCATCCNONE 
AK104127GCCCATCCNONE 
AK104177GCCCATCCNONE 
AK104283GCCCATCCNONE 
AK104608GCCCATCCNONE 
AK104651GCCCATCCNONE 
AK119176GCCCATCCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
J065013J05GCCCATCCNONE 
J065129D23GCCCATCCNONE 
J065138E06GCCCATCCNONE 
J065179N22GCCCATCCNONE 
J065192A07GCCCATCCNONE 
J065208G16GCCCATCCNONE 
J075013K01GCCCATCCNONE 
J075017B12GCCCATCCNONE 
J075018O17GCCCATCCNONE 
J075023H05GCCCATCCNONE 
J075053L02GCCCATCCNONE 
J075067I01GCCCATCCNONE 
J075083D19GCCCATCCNONE 
J075083G03GCCCATCCNONE 
J075084F12GCCCATCCNONE 
J075088K18GCCCATCCNONE 
J075094A18GCCCATCCNONE 
J075094I22GCCCATCCNONE 
J075097E17GCCCATCCNONE 
J075098I24GCCCATCCNONE 
J075110K19GCCCATCCNONE 
J075118G21GCCCATCCNONE 
J075118J20GCCCATCCNONE 
J075120G14GCCCATCCNONE 
J075120H20GCCCATCCNONE 
J075127H23GCCCATCCNONE 
J075139M03GCCCATCCNONE 
J075142E17GCCCATCCNONE 
J075149N17GCCCATCCNONE 
J075152A20GCCCATCCNONE 
J075157N22GCCCATCCNONE 
J075159K21GCCCATCCNONE 
J075173B20GCCCATCCNONE 
J075192N20GCCCATCCNONE 
J075196A07GCCCATCCNONE 
J075199N04GCCCATCCNONE 
J080005P10GCCCATCCNONE 
J080025I24GCCCATCCNONE 
J080064D09GCCCATCCNONE 
J080064N24GCCCATCCNONE 
J080068B02GCCCATCCNONE 
J080097K04GCCCATCCNONE 
J080097K19GCCCATCCNONE 
J080097N20GCCCATCCNONE 
J100055P07GCCCATCCNONE 
Os07g0616900AK071047TGGATGGGCCAAProtein of unknown function DUF500 family protein. 
J013106G03TGGATGGGCCAANONE 
J013124C20TGGATGGGCCAANONE 
J033096D16TGGATGGGCCAANONE 
J043005E08TGGATGGGCCAANONE 
J065197K12TGGATGGGCCAANONE 
J065211I03TGGATGGGCCAANONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0623200AK058506TGGATGGGCNONE 
AK069142TGGATGGGCHeavy metal transport/detoxification protein domain containing protein. 
AK103285TGGATGGGCNONE 
Os07g0659500AK073537GAGGCCCATCCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
AK073537TGGATGGGCCTANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0669700006-042-H01GGATGGGCNONE 
AK059797GGATGGGCNONE 
Os07g0688300AK068325GGATGGGCCGASimilar to Importin alpha 1. 
AK099611GGATGGGCCGANONE 
Os08g0137250J075030L12AAAAGCCCATTTAGCCCATCCANONE 
J075037O21AAAAGCCCATTTAGCCCATCCANONE 
J075078E23AAAAGCCCATTTAGCCCATCCANONE 
J075079C23AAAAGCCCATTTAGCCCATCCANONE 
J075092K02AAAAGCCCATTTAGCCCATCCANONE 
J075108M04AAAAGCCCATTTAGCCCATCCANONE 
J075112N13AAAAGCCCATTTAGCCCATCCANONE 
J075132M13AAAAGCCCATTTAGCCCATCCANONE 
J075146E07AAAAGCCCATTTAGCCCATCCANONE 
J075159F16AAAAGCCCATTTAGCCCATCCANONE 
J075166M12AAAAGCCCATTTAGCCCATCCANONE 
J075185B10AAAAGCCCATTTAGCCCATCCANONE 
J075193J10AAAAGCCCATTTAGCCCATCCANONE 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0379000AK105647ACAGCCCATCCProtein prenyltransferase domain containing protein. 
Os08g0494300AK066150AGTGGGCCCATCCAvon Willebrand factor, type A domain containing protein. 
Os08g0527400AK119389TTGGCCCATCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0549300009-008-F01AAACGGCCCATCCNONE 
009-033-G10AAACGGCCCATCCNONE 
AK120938AAACGGCCCATCCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420AAACGGCCCATCCNONE 
J023037A21AAACGGCCCATCCNONE 
J023066D20AAACGGCCCATCCNONE 
J033099K13AAACGGCCCATCCNONE 
J065116C14AAACGGCCCATCCNONE 
J075009K15AAACGGCCCATCCNONE 
J075071P13AAACGGCCCATCCNONE 
J075080D18AAACGGCCCATCCNONE 
J075124F24AAACGGCCCATCCNONE 
J075198F23AAACGGCCCATCCNONE 
J080006B15AAACGGCCCATCCNONE 
J090078H13AAACGGCCCATCCNONE 
J090089J09AAACGGCCCATCCNONE 
J100017A03AAACGGCCCATCCNONE 
J100023G03AAACGGCCCATCCNONE 
Os09g0363700AK103667GCCCATCCConserved hypothetical protein. 
J075001L14GCCCATCCNONE 
J075049M23GCCCATCCNONE 
J075051I04GCCCATCCNONE 
J075073L04GCCCATCCNONE 
J075077E03GCCCATCCNONE 
J075083J11GCCCATCCNONE 
J075094J22GCCCATCCNONE 
J075112E08GCCCATCCNONE 
J075137J23GCCCATCCNONE 
J075192E02GCCCATCCNONE 
J100039K04GCCCATCCNONE 
Os09g0395400AK109221TAGGCCCATAAGGATGGGCCGTAConserved hypothetical protein. 
J075009I06TAGGCCCATAAGGATGGGCCGTANONE 
Os09g0416200AK065807CCAGCCCATCCSimilar to Glucose transporter (Fragment). 
Os09g0459200AK110733AGCCCATCCAConserved hypothetical protein. 
J065131C07AGCCCATCCANONE 
Os09g0498600AK066995GGGGCCCATCCNONE 
Os09g0517800012-034-H10CCACGGCCTGGATGGGCCCACGTNONE 
AK121391CCACGGCCTGGATGGGCCCACGTCyclin-like F-box domain containing protein. 
J023129D04CCACGGCCTGGATGGGCCCACGTNONE 
J043012D11CCACGGCCTGGATGGGCCCACGTNONE 
Os09g0521700014-005-C08AGCCCATCCNONE 
AK063628AGCCCATCCSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507AGCCCATCCNONE 
Os09g0533900003-104-E05AAAGCCCACGCGAGCCCATCCNONE 
012-076-C03AAAGCCCACGCGAGCCCATCCNONE 
AK067774AAAGCCCACGCGAGCCCATCCNONE 
AK100449AAAGCCCACGCGAGCCCATCCSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07AAAGCCCACGCGAGCCCATCCNONE 
J023026E11AAAGCCCACGCGAGCCCATCCNONE 
J023028B20AAAGCCCACGCGAGCCCATCCNONE 
J023050P11AAAGCCCACGCGAGCCCATCCNONE 
J023052K08AAAGCCCACGCGAGCCCATCCNONE 
J023075J03AAAGCCCACGCGAGCCCATCCNONE 
J023078E15AAAGCCCACGCGAGCCCATCCNONE 
J023090P12AAAGCCCACGCGAGCCCATCCNONE 
J023120E01AAAGCCCACGCGAGCCCATCCNONE 
J023142K01AAAGCCCACGCGAGCCCATCCNONE 
J033027K23AAAGCCCACGCGAGCCCATCCNONE 
J033058A09AAAGCCCACGCGAGCCCATCCNONE 
J033058C12AAAGCCCACGCGAGCCCATCCNONE 
J033125A04AAAGCCCACGCGAGCCCATCCNONE 
J043040L01AAAGCCCACGCGAGCCCATCCNONE 
J053061D06AAAGCCCACGCGAGCCCATCCNONE 
J053096N13AAAGCCCACGCGAGCCCATCCNONE 
J065193H10AAAGCCCACGCGAGCCCATCCNONE 
J090075L17AAAGCCCACGCGAGCCCATCCNONE 
J100050D10AAAGCCCACGCGAGCCCATCCNONE 
Os09g0538200009-076-A07TCGGCCCATCCANONE 
AB032061TCGGCCCATCCAProteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
J065184D10TCGGCCCATCCANONE 
J075134I16TCGGCCCATCCANONE 
J100031G24TCGGCCCATCCANONE 
Os11g0104400D78505TGCGGCCCATCCASimilar to W-3 fatty acid desaturase (Fragment). 
J013109G14TGCGGCCCATCCANONE 
J075027J03TGCGGCCCATCCANONE 
J090006L16TGCGGCCCATCCANONE 
J090021A01TGCGGCCCATCCANONE 
J090049M01TGCGGCCCATCCANONE 
J090084O20TGCGGCCCATCCANONE 
Os11g0106700006-055-F11CCACGTGTGGCCCATCCNONE 
006-099-D08CCACGTGTGGCCCATCCNONE 
009-155-A12CCACGTGTGGCCCATCCNONE 
AF519570CCACGTGTGGCCCATCCNONE 
AK059354CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
AK121845GGATGGGCTNONE 
Os11g0168200005-010-H01TTGTGGGCCAGAGCCCATCCNONE 
009-156-F07TTGTGGGCCAGAGCCCATCCNONE 
012-025-F01TTGTGGGCCAGAGCCCATCCNONE 
012-089-A02TTGTGGGCCAGAGCCCATCCNONE 
016-016-E08TTGTGGGCCAGAGCCCATCCNONE 
AK073392TTGTGGGCCAGAGCCCATCC60S ribosomal protein L3. 
AK099225TTGTGGGCCAGAGCCCATCCNONE 
AK101469TTGTGGGCCAGAGCCCATCCNONE 
AY236158TTGTGGGCCAGAGCCCATCCNONE 
J013152M22TTGTGGGCCAGAGCCCATCCNONE 
J023013N11TTGTGGGCCAGAGCCCATCCNONE 
J023038J11TTGTGGGCCAGAGCCCATCCNONE 
J023054N21TTGTGGGCCAGAGCCCATCCNONE 
J033041E13TTGTGGGCCAGAGCCCATCCNONE 
J033050O09TTGTGGGCCAGAGCCCATCCNONE 
J033093G05TTGTGGGCCAGAGCCCATCCNONE 
J033094J17TTGTGGGCCAGAGCCCATCCNONE 
J033112J24TTGTGGGCCAGAGCCCATCCNONE 
J033113D05TTGTGGGCCAGAGCCCATCCNONE 
J033120K10TTGTGGGCCAGAGCCCATCCNONE 
J033121H19TTGTGGGCCAGAGCCCATCCNONE 
J033129C08TTGTGGGCCAGAGCCCATCCNONE 
J033140H24TTGTGGGCCAGAGCCCATCCNONE 
J065020I18TTGTGGGCCAGAGCCCATCCNONE 
J065058L01TTGTGGGCCAGAGCCCATCCNONE 
J065059G22TTGTGGGCCAGAGCCCATCCNONE 
J065212L09TTGTGGGCCAGAGCCCATCCNONE 
J075047P09TTGTGGGCCAGAGCCCATCCNONE 
J075063C18TTGTGGGCCAGAGCCCATCCNONE 
J075076E07TTGTGGGCCAGAGCCCATCCNONE 
J075077F14TTGTGGGCCAGAGCCCATCCNONE 
J075086C22TTGTGGGCCAGAGCCCATCCNONE 
J075161L09TTGTGGGCCAGAGCCCATCCNONE 
J075177K20TTGTGGGCCAGAGCCCATCCNONE 
J090007L06TTGTGGGCCAGAGCCCATCCNONE 
J090010M02TTGTGGGCCAGAGCCCATCCNONE 
J090013M20TTGTGGGCCAGAGCCCATCCNONE 
J090044I15TTGTGGGCCAGAGCCCATCCNONE 
J090045O06TTGTGGGCCAGAGCCCATCCNONE 
J090060L04TTGTGGGCCAGAGCCCATCCNONE 
J090061C17TTGTGGGCCAGAGCCCATCCNONE 
J090062F10TTGTGGGCCAGAGCCCATCCNONE 
J090066L03TTGTGGGCCAGAGCCCATCCNONE 
J090089E13TTGTGGGCCAGAGCCCATCCNONE 
J090096D21TTGTGGGCCAGAGCCCATCCNONE 
J100039F12TTGTGGGCCAGAGCCCATCCNONE 
J100053N06TTGTGGGCCAGAGCCCATCCNONE 
Os11g0202000AK063427GTATGGGCCTAGGCCCATCCACyclin-like F-box domain containing protein. 
AK122020GTATGGGCCTAGGCCCATCCANONE 
J033111N03GTATGGGCCTAGGCCCATCCANONE 
Os11g0237700J100060P16GGATGGGCCCACCACConserved hypothetical protein. 
J100065I12GGATGGGCCCACCACNONE 
Os11g0264600J100079I22CCCGGCCCATCCANONE 
Os11g0271000AK110686TGGATGGGCNONE 
Os11g0448400AB095094TGGATGGGCCCGSimilar to Sigma factor SIG2A. 
J075053H03TGGATGGGCCCGNONE 
J075062F23TGGATGGGCCCGNONE 
J090029D08TGGATGGGCCCGNONE 
Os11g0481600AK109900TGGATGGGCConserved hypothetical protein. 
Os11g0512000AK107369GCCCATCCANo apical meristem (NAM) protein domain containing protein. 
J075006M23GCCCATCCANONE 
J075069E01GCCCATCCANONE 
J075073J15GCCCATCCANONE 
J075081H21GCCCATCCANONE 
J075081I24GCCCATCCANONE 
J075098E10GCCCATCCANONE 
J075109B07GCCCATCCANONE 
J075109B09GCCCATCCANONE 
J075109K23GCCCATCCANONE 
J075120F18GCCCATCCANONE 
J075121H03GCCCATCCANONE 
J075174O18GCCCATCCANONE 
J075177G19GCCCATCCANONE 
J075179P19GCCCATCCANONE 
J075195P18GCCCATCCANONE 
J075196B20GCCCATCCANONE 
J090068H20GCCCATCCANONE 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os11g0557900009-196-H11CAAGGCCCATCCANONE 
AK063232CAAGGCCCATCCAARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os11g0573900AK064591GGATGGGCConserved hypothetical protein. 
Os12g0106000AF370029CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CCACGTGTGGCCCATCCNONE 
AK102242CCACGTGTGGCCCATCCNONE 
AY324879CCACGTGTGGCCCATCCNONE 
J053063M21CCACGTGTGGCCCATCCNONE 
J090080A16CCACGTGTGGCCCATCCNONE 
Os12g0154000AK101335GGATGGGCTGGNONE 
AK105118GGATGGGCTGGProtein of unknown function DUF250 domain containing protein. 
Os12g0170400012-013-C12AGCCCATCCNONE 
012-078-F04AGCCCATCCNONE 
016-038-B08AGCCCATCCNONE 
AK121826AGCCCATCCZinc finger, C2H2-type domain containing protein. 
J033086P08AGCCCATCCNONE 
J033099G14AGCCCATCCNONE 
J065019L01AGCCCATCCNONE 
J065093E18AGCCCATCCNONE 
J065138J04AGCCCATCCNONE 
J065139B14AGCCCATCCNONE 
J065193K21AGCCCATCCNONE 
J075005D01AGCCCATCCNONE 
J075057B19AGCCCATCCNONE 
J075061A15AGCCCATCCNONE 
J075105N16AGCCCATCCNONE 
J075146K15AGCCCATCCNONE 
J100026B22AGCCCATCCNONE 
Os12g0180100AK058227GGTGGATGGGCNONE 
Os12g0285600AK069104AGTGGGCCCATCCCCCCACCCGOxysterol-binding protein family protein. 
Os12g0291100013-021-D10GCCCATCCNONE 
013-038-B12GCCCATCCNONE 
AK068555GCCCATCCSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AY445627GCCCATCCNONE 
D00644GCCCATCCNONE 
J013156H12GCCCATCCNONE 
J023122F15GCCCATCCNONE 
J065001F13GCCCATCCNONE 
J065001O16GCCCATCCNONE 
J065006D15GCCCATCCNONE 
J065008I17GCCCATCCNONE 
J065008N22GCCCATCCNONE 
J065010K05GCCCATCCNONE 
J065015G11GCCCATCCNONE 
J065019H21GCCCATCCNONE 
J065020N17GCCCATCCNONE 
J065024O18GCCCATCCNONE 
J065025A04GCCCATCCNONE 
J065026I06GCCCATCCNONE 
J065028C06GCCCATCCNONE 
J065029C01GCCCATCCNONE 
J065029C06GCCCATCCNONE 
J065029D16GCCCATCCNONE 
J065029E02GCCCATCCNONE 
J065030P11GCCCATCCNONE 
J065032M13GCCCATCCNONE 
J065034C06GCCCATCCNONE 
J065037H24GCCCATCCNONE 
J065037O14GCCCATCCNONE 
J065038A12GCCCATCCNONE 
J065043A05GCCCATCCNONE 
J065046C06GCCCATCCNONE 
J065046D22GCCCATCCNONE 
J065048C14GCCCATCCNONE 
J065048D24GCCCATCCNONE 
J065049F19GCCCATCCNONE 
J065050C04GCCCATCCNONE 
J065052J16GCCCATCCNONE 
J065055E07GCCCATCCNONE 
J065055I04GCCCATCCNONE 
J065060L04GCCCATCCNONE 
J065062I15GCCCATCCNONE 
J065062J11GCCCATCCNONE 
J065065I12GCCCATCCNONE 
J065068C24GCCCATCCNONE 
J065069M04GCCCATCCNONE 
J065071J22GCCCATCCNONE 
J065076A12GCCCATCCNONE 
J065076C24GCCCATCCNONE 
J065076F09GCCCATCCNONE 
J065076F16GCCCATCCNONE 
J065077O06GCCCATCCNONE 
J065081E14GCCCATCCNONE 
J065082K22GCCCATCCNONE 
J065082L04GCCCATCCNONE 
J065085B02GCCCATCCNONE 
J065089C21GCCCATCCNONE 
J065092L07GCCCATCCNONE 
J065093G08GCCCATCCNONE 
J065093I19GCCCATCCNONE 
J065093K24GCCCATCCNONE 
J065093N04GCCCATCCNONE 
J065094I09GCCCATCCNONE 
J065094N19GCCCATCCNONE 
J065095J17GCCCATCCNONE 
J065095N24GCCCATCCNONE 
J065096B17GCCCATCCNONE 
J065096C02GCCCATCCNONE 
J065097P18GCCCATCCNONE 
J065099E07GCCCATCCNONE 
J065103D23GCCCATCCNONE 
J065104F04GCCCATCCNONE 
J065104L17GCCCATCCNONE 
J065111L14GCCCATCCNONE 
J065112K11GCCCATCCNONE 
J065115P09GCCCATCCNONE 
J065123A02GCCCATCCNONE 
J065127P14GCCCATCCNONE 
J065137E16GCCCATCCNONE 
J065138H20GCCCATCCNONE 
J065138J11GCCCATCCNONE 
J065141K23GCCCATCCNONE 
J065141L14GCCCATCCNONE 
J065143P04GCCCATCCNONE 
J065146N12GCCCATCCNONE 
J065147F21GCCCATCCNONE 
J065147N15GCCCATCCNONE 
J065154L06GCCCATCCNONE 
J065156C09GCCCATCCNONE 
J065156J18GCCCATCCNONE 
J065157C19GCCCATCCNONE 
J065159H23GCCCATCCNONE 
J065159M08GCCCATCCNONE 
J065163B19GCCCATCCNONE 
J065164K14GCCCATCCNONE 
J065166K07GCCCATCCNONE 
J065166O07GCCCATCCNONE 
J065168A18GCCCATCCNONE 
J065170B18GCCCATCCNONE 
J065170D18GCCCATCCNONE 
J065173E05GCCCATCCNONE 
J065174L23GCCCATCCNONE 
J065177F08GCCCATCCNONE 
J065177I05GCCCATCCNONE 
J065178P20GCCCATCCNONE 
J065181G24GCCCATCCNONE 
J065182A07GCCCATCCNONE 
J065183D24GCCCATCCNONE 
J065184K10GCCCATCCNONE 
J065185F09GCCCATCCNONE 
J065185P10GCCCATCCNONE 
J065186J16GCCCATCCNONE 
J065188K23GCCCATCCNONE 
J065190E22GCCCATCCNONE 
J065191D06GCCCATCCNONE 
J065193C05GCCCATCCNONE 
J065193N13GCCCATCCNONE 
J065194B15GCCCATCCNONE 
J065199C03GCCCATCCNONE 
J065200P19GCCCATCCNONE 
J065202O18GCCCATCCNONE 
J065203F16GCCCATCCNONE 
J065204A15GCCCATCCNONE 
J065206P13GCCCATCCNONE 
J065207P12GCCCATCCNONE 
J065210J24GCCCATCCNONE 
J065211K01GCCCATCCNONE 
J065213O21GCCCATCCNONE 
J065215L18GCCCATCCNONE 
J065216N22GCCCATCCNONE 
J065219A16GCCCATCCNONE 
J065219C24GCCCATCCNONE 
J075012P04GCCCATCCNONE 
J075013K19GCCCATCCNONE 
J075028N24GCCCATCCNONE 
J075028P16GCCCATCCNONE 
J075032H22GCCCATCCNONE 
J075032J18GCCCATCCNONE 
J075042O14GCCCATCCNONE 
J075047A04GCCCATCCNONE 
J075053A16GCCCATCCNONE 
J075064C23GCCCATCCNONE 
J075072H11GCCCATCCNONE 
J075073C03GCCCATCCNONE 
J075081G11GCCCATCCNONE 
J075093H04GCCCATCCNONE 
J075095A11GCCCATCCNONE 
J075095C13GCCCATCCNONE 
J075100D18GCCCATCCNONE 
J075101P08GCCCATCCNONE 
J075114G11GCCCATCCNONE 
J075118D19GCCCATCCNONE 
J075122K13GCCCATCCNONE 
J075125G22GCCCATCCNONE 
J075129E22GCCCATCCNONE 
J075129I07GCCCATCCNONE 
J075132C12GCCCATCCNONE 
J075135E24GCCCATCCNONE 
J075136I06GCCCATCCNONE 
J075136O07GCCCATCCNONE 
J075138I07GCCCATCCNONE 
J075142G08GCCCATCCNONE 
J075147J22GCCCATCCNONE 
J075150H20GCCCATCCNONE 
J075151A15GCCCATCCNONE 
J075151G24GCCCATCCNONE 
J075151J20GCCCATCCNONE 
J075156N21GCCCATCCNONE 
J075158O12GCCCATCCNONE 
J075161E05GCCCATCCNONE 
J075166F17GCCCATCCNONE 
J075169M10GCCCATCCNONE 
J075174K15GCCCATCCNONE 
J075179F17GCCCATCCNONE 
J075185G15GCCCATCCNONE 
J075188P12GCCCATCCNONE 
J075191P15GCCCATCCNONE 
J075192A13GCCCATCCNONE 
J075197E23GCCCATCCNONE 
J075197M02GCCCATCCNONE 
J075198M16GCCCATCCNONE 
J080020B11GCCCATCCNONE 
J080021M20GCCCATCCNONE 
J080066K02GCCCATCCNONE 
J080301F01GCCCATCCNONE 
J080301G19GCCCATCCNONE 
J080305G02GCCCATCCNONE 
J080306N09GCCCATCCNONE 
J080309D21GCCCATCCNONE 
J080309I02GCCCATCCNONE 
J080313J11GCCCATCCNONE 
J080313P09GCCCATCCNONE 
J080315B10GCCCATCCNONE 
J080315O13GCCCATCCNONE 
J080316G02GCCCATCCNONE 
J080317F03GCCCATCCNONE 
J080318D17GCCCATCCNONE 
J080319C10GCCCATCCNONE 
J090017E03GCCCATCCNONE 
J090034N22GCCCATCCNONE 
J090042G07GCCCATCCNONE 
J090062P21GCCCATCCNONE 
J090082D08GCCCATCCNONE 
J090096M13GCCCATCCNONE 
J100086J22GCCCATCCNONE 
Os12g0443700AK069541GCCGGGCCCATCCSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881GCCGGGCCCATCCNONE 
Os12g0517100012-071-A03AGCCCATCCAGCCCAATTNONE 
AK073020AGCCCATCCAGCCCAATTCyclin-like F-box domain containing protein. 
J023149K21AGCCCATCCAGCCCAATTNONE 
Os12g0527500AK109836CCAGGCCCATCCGGGCCCACGGCCCyclin-like F-box domain containing protein. 
Os12g0533500AK068646ACCGGCCCATCCACCCACTTGConserved hypothetical protein. 
J013158L10ACCGGCCCATCCACCCACTTGNONE 
J065083J02ACCGGCCCATCCACCCACTTGNONE 
J075079D02ACCGGCCCATCCACCCACTTGNONE 
J100037H16ACCGGCCCATCCACCCACTTGNONE 
J100075P13ACCGGCCCATCCACCCACTTGNONE 
Os12g0554400AK072345CCCAGCCCATCCTetratricopeptide-like helical domain containing protein. 
Os12g0573000AK067552TTGGCCCATCCHypothetical protein. 
AK069292TTGGCCCATCCNONE 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0608600AK059102GGATGGGCNONE 
Os12g0621700AK073528TCCGGCCCATCCConserved hypothetical protein. 
J033043M23TCCGGCCCATCCNONE 
J033114G18TCCGGCCCATCCNONE 
J033120E10TCCGGCCCATCCNONE 
J033143J21TCCGGCCCATCCNONE 
J065080M02TCCGGCCCATCCNONE 
J065138O22TCCGGCCCATCCNONE 
J090048B16TCCGGCCCATCCNONE 
Os12g0636600AK111056GGATGGGCTGAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.