version

Summary of OsREG609 (All List)

OrganismOryza sativa  
IDOsREG609  
SequenceGCCCATGA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1498  

Entry Sequences (1498 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10TCATGGGCCTTSurfeit locus 5 family protein. 
J065164N24TCATGGGCCTTNONE 
J065167H04TCATGGGCCTTNONE 
J065187N12TCATGGGCCTTNONE 
Os01g0134700AK111442AGCCCATGACalmodulin binding protein-like family protein. 
J065141F12AGCCCATGANONE 
J065156K22AGCCCATGANONE 
J065160A12AGCCCATGANONE 
Os01g0172000012-070-G06GGGCCGGAGGCCCATGANONE 
AK068405GGGCCGGAGGCCCATGAALG3 family protein. 
J013149A07GGGCCGGAGGCCCATGANONE 
J053047H05GGGCCGGAGGCCCATGANONE 
J065075N03GGGCCGGAGGCCCATGANONE 
J065093G22GGGCCGGAGGCCCATGANONE 
J065130N21GGGCCGGAGGCCCATGANONE 
J065143P05GGGCCGGAGGCCCATGANONE 
J065216H07GGGCCGGAGGCCCATGANONE 
J075013B06GGGCCGGAGGCCCATGANONE 
J075196M05GGGCCGGAGGCCCATGANONE 
J100039G24GGGCCGGAGGCCCATGANONE 
J100041B11GGGCCGGAGGCCCATGANONE 
J100069A16GGGCCGGAGGCCCATGANONE 
J100069L12GGGCCGGAGGCCCATGANONE 
J100074P16GGGCCGGAGGCCCATGANONE 
Os01g0210300AK106937AGCCCATGAConserved hypothetical protein. 
Os01g0231700012-002-F11TCATGGGCTTTTNONE 
013-082-F05TCATGGGCTTTTNONE 
AK107453TCATGGGCTTTTSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22TCATGGGCTTTTNONE 
J065023E21TCATGGGCTTTTNONE 
J065036H21TCATGGGCTTTTNONE 
J065037M24TCATGGGCTTTTNONE 
J065049L04TCATGGGCTTTTNONE 
J065072F17TCATGGGCTTTTNONE 
J065085H10TCATGGGCTTTTNONE 
J065109N19TCATGGGCTTTTNONE 
J065117M19TCATGGGCTTTTNONE 
J065144C15TCATGGGCTTTTNONE 
J065159G24TCATGGGCTTTTNONE 
J065164N14TCATGGGCTTTTNONE 
J075025K16TCATGGGCTTTTNONE 
J075057L05TCATGGGCTTTTNONE 
J075070I16TCATGGGCTTTTNONE 
J075089D10TCATGGGCTTTTNONE 
J075138F10TCATGGGCTTTTNONE 
J090018C11TCATGGGCTTTTNONE 
J100018L19TCATGGGCTTTTNONE 
J100024B14TCATGGGCTTTTNONE 
J100048L02TCATGGGCTTTTNONE 
J100055A22TCATGGGCTTTTNONE 
J100069K01TCATGGGCTTTTNONE 
Os01g0506200AK073118TCATGGGCCTGTetratricopeptide-like helical domain containing protein. 
J065002A07TCATGGGCCTGNONE 
J065079J08TCATGGGCCTGNONE 
J065167M18TCATGGGCCTGNONE 
Os01g0508300AK101435GCGGCCCATGANONE 
AK111287GCGGCCCATGAConserved hypothetical protein. 
J065096N08GCGGCCCATGANONE 
J075003F13GCGGCCCATGANONE 
J075014I16GCGGCCCATGANONE 
J075022D23GCGGCCCATGANONE 
J075040N19GCGGCCCATGANONE 
J075121O06GCGGCCCATGANONE 
J075131E17GCGGCCCATGANONE 
J075136N22GCGGCCCATGANONE 
J075147D01GCGGCCCATGANONE 
J075173C07GCGGCCCATGANONE 
J075196L22GCGGCCCATGANONE 
Os01g0585400AK103584TCATGGGCCCAAATConserved hypothetical protein. 
J033133B01TCATGGGCCCAAATNONE 
Os01g0596300016-083-D09TCATGGGCCTTNONE 
AK069151TCATGGGCCTTCyclin-like F-box domain containing protein. 
J023007D17TCATGGGCCTTNONE 
J065141M02TCATGGGCCTTNONE 
Os01g0613900014-018-D04GCGGCCCATGANONE 
AK119181GCGGCCCATGAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14GCGGCCCATGANONE 
J065019A15GCGGCCCATGANONE 
J075090J10GCGGCCCATGANONE 
J075195H12GCGGCCCATGANONE 
Os01g0679000AK058515ACCGGCCCATGARNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08ACCGGCCCATGANONE 
J033064N24ACCGGCCCATGANONE 
J043022M20ACCGGCCCATGANONE 
J065075K20ACCGGCCCATGANONE 
J065081K04ACCGGCCCATGANONE 
J065128K13ACCGGCCCATGANONE 
J065131K12ACCGGCCCATGANONE 
J065137H20ACCGGCCCATGANONE 
J065205A09ACCGGCCCATGANONE 
J090030C13ACCGGCCCATGANONE 
J090053I08ACCGGCCCATGANONE 
J090054O22ACCGGCCCATGANONE 
J090082C15ACCGGCCCATGANONE 
J090097P12ACCGGCCCATGANONE 
Os01g0706100AK072799TCATGGGCTConserved hypothetical protein. 
J013049G14TCATGGGCTNONE 
J023136E17TCATGGGCTNONE 
Os01g0727900AK102017AAGGCCCATGAConserved hypothetical protein. 
J033080F19AAGGCCCATGANONE 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
Os01g0773600AK067004TCATGGGCCTAGlycoside hydrolase, family 47 protein. 
J013091F09TCATGGGCCTANONE 
J013134K14TCATGGGCCTANONE 
J013158J15TCATGGGCCTANONE 
J033060O20TCATGGGCCTANONE 
J033074C16TCATGGGCCTANONE 
J075086F05TCATGGGCCTANONE 
J075150H08TCATGGGCCTANONE 
J090006E02TCATGGGCCTANONE 
J090074E02TCATGGGCCTANONE 
J100030M05TCATGGGCCTANONE 
J100036M16TCATGGGCCTANONE 
J100063H18TCATGGGCCTANONE 
Os01g0805000009-045-H11AAGGCCCATGANONE 
009-196-H08AAGGCCCATGANONE 
J013094D22AAGGCCCATGARibosomal protein L34 family protein. 
J013119F23AAGGCCCATGANONE 
J065128B11AAGGCCCATGANONE 
Os01g0833000AK067226CAGGCCCATGAProtein prenyltransferase domain containing protein. 
J013098M23CAGGCCCATGANONE 
Os01g0850900009-089-D11CCAGCCCATGANONE 
AK063822CCAGCCCATGANONE 
AK102887CCAGCCCATGASOUL heme-binding protein family protein. 
J033112K22CCAGCCCATGANONE 
J065087B10CCAGCCCATGANONE 
J065100A05CCAGCCCATGANONE 
J075077M10CCAGCCCATGANONE 
Os01g0857700006-045-F05GAGGCCCATGANONE 
AK066959GAGGCCCATGASimilar to G10. 
AK099794GAGGCCCATGANONE 
J013093N15GAGGCCCATGANONE 
J023105B19GAGGCCCATGANONE 
Os01g0914300009-174-C06GCCCATGANONE 
014-073-B09GCCCATGANONE 
AK103489GCCCATGANONE 
AK105463GCCCATGAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J033076A02GCCCATGANONE 
J033130M24GCCCATGANONE 
Os01g0926400AK063916TCATGGGCTTANONE 
AK073976TCATGGGCTTASimilar to Pectin-glucuronyltransferase. 
Os01g0945300003-104-D07TCATGGGCTTTTNONE 
AK065371TCATGGGCTTTTAmino acid/polyamine transporter I family protein. 
AK072189TCATGGGCTTTTNONE 
J013023D09TCATGGGCTTTTNONE 
J013055J18TCATGGGCTTTTNONE 
J013146P21TCATGGGCTTTTNONE 
J075109G14TCATGGGCTTTTNONE 
J075158O19TCATGGGCTTTTNONE 
Os01g0948100AK111411GAGGCCCATGAERCC4 domain containing protein. 
J090089O16GAGGCCCATGANONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0958100AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os01g0965400006-063-H08TCATGGGCNONE 
011-037-A03TCATGGGCNONE 
AK069647TCATGGGCSimilar to Uridylate kinase (EC 2.7.4.-) (UK) (Uridine monophosphate kinase) (UMP kinase). 
AK104789TCATGGGCNONE 
J013072N21TCATGGGCNONE 
J023027E20TCATGGGCNONE 
J023075O12TCATGGGCNONE 
J033111H12TCATGGGCNONE 
J080001F12TCATGGGCNONE 
J080004J12TCATGGGCNONE 
J080005N15TCATGGGCNONE 
J080008D06TCATGGGCNONE 
J080010I10TCATGGGCNONE 
J080011D19TCATGGGCNONE 
J080015G04TCATGGGCNONE 
J080018O05TCATGGGCNONE 
J080024K13TCATGGGCNONE 
J080026M08TCATGGGCNONE 
J080027H22TCATGGGCNONE 
J080027L18TCATGGGCNONE 
J080029C13TCATGGGCNONE 
J080030A02TCATGGGCNONE 
J080031C10TCATGGGCNONE 
J080038L14TCATGGGCNONE 
J080039B17TCATGGGCNONE 
J080041C13TCATGGGCNONE 
J080042A06TCATGGGCNONE 
J080043L15TCATGGGCNONE 
J080047C08TCATGGGCNONE 
J080049C07TCATGGGCNONE 
J080051M10TCATGGGCNONE 
J080053F03TCATGGGCNONE 
J080054B13TCATGGGCNONE 
J080063K02TCATGGGCNONE 
J080064L04TCATGGGCNONE 
J080071B19TCATGGGCNONE 
J080071M13TCATGGGCNONE 
J080083P09TCATGGGCNONE 
J080088G09TCATGGGCNONE 
J080089I16TCATGGGCNONE 
J080092E23TCATGGGCNONE 
J080093B19TCATGGGCNONE 
J080097H14TCATGGGCNONE 
Os02g0103800006-046-H11GTGGCCCATGANONE 
006-060-B05GTGGCCCATGANONE 
006-097-A09GTGGCCCATGANONE 
006-102-A10GTGGCCCATGANONE 
006-104-E11GTGGCCCATGANONE 
006-112-D09GTGGCCCATGANONE 
AK061774GTGGCCCATGANONE 
AK065309GTGGCCCATGANONE 
AK106213GTGGCCCATGASimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13GTGGCCCATGANONE 
J013026F06GTGGCCCATGANONE 
J013037O14GTGGCCCATGANONE 
J013066N06GTGGCCCATGANONE 
J013108G22GTGGCCCATGANONE 
J023050M15GTGGCCCATGANONE 
J023054B21GTGGCCCATGANONE 
J023073C23GTGGCCCATGANONE 
J023086H17GTGGCCCATGANONE 
J023105A20GTGGCCCATGANONE 
J065019E16GTGGCCCATGANONE 
J065064G10GTGGCCCATGANONE 
J065071C18GTGGCCCATGANONE 
J065103B02GTGGCCCATGANONE 
J065153G06GTGGCCCATGANONE 
J075152G24GTGGCCCATGANONE 
J075166P04GTGGCCCATGANONE 
J080001F02GTGGCCCATGANONE 
J080001M07GTGGCCCATGANONE 
J080001O05GTGGCCCATGANONE 
J080003I19GTGGCCCATGANONE 
J080004C12GTGGCCCATGANONE 
J080008E17GTGGCCCATGANONE 
J080008M08GTGGCCCATGANONE 
J080010H21GTGGCCCATGANONE 
J080011F22GTGGCCCATGANONE 
J080012C16GTGGCCCATGANONE 
J080013D20GTGGCCCATGANONE 
J080018K15GTGGCCCATGANONE 
J080020O14GTGGCCCATGANONE 
J080020P21GTGGCCCATGANONE 
J080021A07GTGGCCCATGANONE 
J080021B06GTGGCCCATGANONE 
J080022G21GTGGCCCATGANONE 
J080022P14GTGGCCCATGANONE 
J080023H24GTGGCCCATGANONE 
J080023M08GTGGCCCATGANONE 
J080027E08GTGGCCCATGANONE 
J080027E18GTGGCCCATGANONE 
J080027O16GTGGCCCATGANONE 
J080029M22GTGGCCCATGANONE 
J080034A17GTGGCCCATGANONE 
J080038G04GTGGCCCATGANONE 
J080040F13GTGGCCCATGANONE 
J080040F22GTGGCCCATGANONE 
J080041L15GTGGCCCATGANONE 
J080042L04GTGGCCCATGANONE 
J080042M14GTGGCCCATGANONE 
J080043C22GTGGCCCATGANONE 
J080043O09GTGGCCCATGANONE 
J080045N17GTGGCCCATGANONE 
J080046N08GTGGCCCATGANONE 
J080047K11GTGGCCCATGANONE 
J080047O06GTGGCCCATGANONE 
J080048H10GTGGCCCATGANONE 
J080048N03GTGGCCCATGANONE 
J080050N02GTGGCCCATGANONE 
J080051A05GTGGCCCATGANONE 
J080052I20GTGGCCCATGANONE 
J080053E08GTGGCCCATGANONE 
J080055P05GTGGCCCATGANONE 
J080056F15GTGGCCCATGANONE 
J080056H07GTGGCCCATGANONE 
J080057M20GTGGCCCATGANONE 
J080059K09GTGGCCCATGANONE 
J080059M10GTGGCCCATGANONE 
J080060B12GTGGCCCATGANONE 
J080061N09GTGGCCCATGANONE 
J080062H11GTGGCCCATGANONE 
J080062M13GTGGCCCATGANONE 
J080063D14GTGGCCCATGANONE 
J080063G10GTGGCCCATGANONE 
J080063H18GTGGCCCATGANONE 
J080066J23GTGGCCCATGANONE 
J080067J06GTGGCCCATGANONE 
J080069I11GTGGCCCATGANONE 
J080069O22GTGGCCCATGANONE 
J080070P11GTGGCCCATGANONE 
J080072D06GTGGCCCATGANONE 
J080072J22GTGGCCCATGANONE 
J080075A20GTGGCCCATGANONE 
J080076F11GTGGCCCATGANONE 
J080076J24GTGGCCCATGANONE 
J080076K05GTGGCCCATGANONE 
J080077O10GTGGCCCATGANONE 
J080078L19GTGGCCCATGANONE 
J080080I08GTGGCCCATGANONE 
J080081J23GTGGCCCATGANONE 
J080083A17GTGGCCCATGANONE 
J080085C05GTGGCCCATGANONE 
J080086G24GTGGCCCATGANONE 
J080087H02GTGGCCCATGANONE 
J080089A13GTGGCCCATGANONE 
J080090K08GTGGCCCATGANONE 
J080092M01GTGGCCCATGANONE 
J080095A19GTGGCCCATGANONE 
J080095B20GTGGCCCATGANONE 
J100028F13GTGGCCCATGANONE 
J100040G22GTGGCCCATGANONE 
Os02g0148400AK070451TCCGGCCCATGANONE 
AK072039TCCGGCCCATGAPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10TCCGGCCCATGANONE 
Os02g0163600AK068043TCATGGGCTTAConserved hypothetical protein. 
J013131O20TCATGGGCTTANONE 
J065006E03TCATGGGCTTANONE 
Os02g0176400009-099-H11TCATGGGCCGAAANONE 
AK062746TCATGGGCCGAAAProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0180100005-013-B11TCATGGGCCCGNONE 
AK067359TCATGGGCCCGPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700TCATGGGCCCGNONE 
J013090O22TCATGGGCCCGNONE 
J013099P19TCATGGGCCCGNONE 
J090041M21TCATGGGCCCGNONE 
J090049C14TCATGGGCCCGNONE 
Os02g0198000AK067695CTGGCCCATGAProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
Os02g0274000006-082-B11TCATGGGCCATNONE 
009-149-B01TCATGGGCCATNONE 
013-005-D02TCATGGGCCATNONE 
AK061802TCATGGGCCATNONE 
AK099750TCATGGGCCATConserved hypothetical protein. 
J013092A18TCATGGGCCATNONE 
J065205D02TCATGGGCCATNONE 
J080305A06TCATGGGCCATNONE 
J080306D13TCATGGGCCATNONE 
J090043E14TCATGGGCCATNONE 
J100023E14TCATGGGCCATNONE 
J100041A16TCATGGGCCATNONE 
J100078K21TCATGGGCCATNONE 
Os02g0562300AK073250GAGGCCCATGACalmodulin binding protein-like family protein. 
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein. 
J075034A17GTGTGGGCCCATGANONE 
J075129I09GTGTGGGCCCATGANONE 
Os02g0584700009-044-F06AGCCCATGANONE 
J065178P16AGCCCATGANONE 
J075029H13AGCCCATGANONE 
J075042D04AGCCCATGAHeavy metal transport/detoxification protein domain containing protein. 
J075048C14AGCCCATGANONE 
J075068P06AGCCCATGANONE 
J075094M11AGCCCATGANONE 
J075101D19AGCCCATGANONE 
J075121E10AGCCCATGANONE 
J075170D07AGCCCATGANONE 
J075174C22AGCCCATGANONE 
J075178D09AGCCCATGANONE 
J075187A20AGCCCATGANONE 
J075190I15AGCCCATGANONE 
Os02g0605600016-017-B02TCATGGGCCGCNONE 
AK066104TCATGGGCCGCLUC7 related family protein. 
J013052G16TCATGGGCCGCNONE 
J043022E03TCATGGGCCGCNONE 
J065105P10TCATGGGCCGCNONE 
Os02g0621700011-079-F10TAGGCCCATGANONE 
AK101006TAGGCCCATGASimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525TAGGCCCATGANONE 
J013026C02TAGGCCCATGANONE 
J013104M10TAGGCCCATGANONE 
J023003D01TAGGCCCATGANONE 
J023007H13TAGGCCCATGANONE 
J023019G09TAGGCCCATGANONE 
J023020L19TAGGCCCATGANONE 
J023022L12TAGGCCCATGANONE 
J023022O14TAGGCCCATGANONE 
J023036F16TAGGCCCATGANONE 
J023047D16TAGGCCCATGANONE 
J023052P08TAGGCCCATGANONE 
J023077C01TAGGCCCATGANONE 
J023083M06TAGGCCCATGANONE 
J023105A11TAGGCCCATGANONE 
J023117F21TAGGCCCATGANONE 
J023119D20TAGGCCCATGANONE 
J023148E03TAGGCCCATGANONE 
J023149B13TAGGCCCATGANONE 
J033029A10TAGGCCCATGANONE 
J033046L17TAGGCCCATGANONE 
J033052M04TAGGCCCATGANONE 
J033057M14TAGGCCCATGANONE 
J033066K24TAGGCCCATGANONE 
J033069K02TAGGCCCATGANONE 
J033079G14TAGGCCCATGANONE 
J033101E06TAGGCCCATGANONE 
J033116E06TAGGCCCATGANONE 
J033118L18TAGGCCCATGANONE 
J033135B13TAGGCCCATGANONE 
J033136C10TAGGCCCATGANONE 
J033136P08TAGGCCCATGANONE 
J043027B13TAGGCCCATGANONE 
J065039I03TAGGCCCATGANONE 
J065185N21TAGGCCCATGANONE 
J090008D14TAGGCCCATGANONE 
J090029K17TAGGCCCATGANONE 
J090047H20TAGGCCCATGANONE 
J090048N17TAGGCCCATGANONE 
J090085G08TAGGCCCATGANONE 
J090089F07TAGGCCCATGANONE 
Os02g0634800003-004-F03TCAGCCCATGANONE 
AK059694TCAGCCCATGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCAGCCCATGANONE 
J053077G20TCAGCCCATGANONE 
J075195F14TCAGCCCATGANONE 
Os02g0634900006-032-G12TCATGGGCTGANONE 
006-033-E09TCATGGGCTGANONE 
006-117-F10TCATGGGCTGANONE 
006-118-E01TCATGGGCTGANONE 
013-056-G08TCATGGGCTGANONE 
AK059769TCATGGGCTGANONE 
AK068583TCATGGGCTGANONE 
AK072855TCATGGGCTGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210TCATGGGCTGANONE 
J023138P05TCATGGGCTGANONE 
J023143J07TCATGGGCTGANONE 
J033022O09TCATGGGCTGANONE 
J033111L02TCATGGGCTGANONE 
J033135O03TCATGGGCTGANONE 
J065005K19TCATGGGCTGANONE 
J065044C17TCATGGGCTGANONE 
J065116K09TCATGGGCTGANONE 
J065119O21TCATGGGCTGANONE 
J075014L05TCATGGGCTGANONE 
J075109H16TCATGGGCTGANONE 
J075117D04TCATGGGCTGANONE 
Os02g0643500AK068423TCATGGGCCAAPentapeptide repeat containing protein. 
Os02g0651500AK066333TCAGCCCATGANONE 
AK121865TCAGCCCATGAHypothetical protein. 
J090038J11TCAGCCCATGANONE 
Os02g0665400AK073914TCATGGGCCACNONE 
AK109787TCATGGGCCACNONE 
AK120141TCATGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19TCATGGGCCACNONE 
J075165B08TCATGGGCCACNONE 
J075177B03TCATGGGCCACNONE 
J075191K02TCATGGGCCACNONE 
J090051I12TCATGGGCCACNONE 
J090057E21TCATGGGCCACNONE 
J090058E01TCATGGGCCACNONE 
J090087C06TCATGGGCCACNONE 
J100025K07TCATGGGCCACNONE 
J100026I21TCATGGGCCACNONE 
J100041E12TCATGGGCCACNONE 
J100083B01TCATGGGCCACNONE 
Os02g0670900003-115-B09TGTGGGCCCATGANONE 
005-004-F12TGTGGGCCCATGANONE 
006-037-B11TGTGGGCCCATGANONE 
006-094-B07TGTGGGCCCATGANONE 
011-020-A12TGTGGGCCCATGANONE 
AK061649TGTGGGCCCATGANONE 
AK061743TGTGGGCCCATGANONE 
AK064827TGTGGGCCCATGANONE 
AK100650TGTGGGCCCATGASimilar to Amino acid transporter protein-like. 
AK119517TGTGGGCCCATGANONE 
J013000F07TGTGGGCCCATGANONE 
J013027M02TGTGGGCCCATGANONE 
J013027M22TGTGGGCCCATGANONE 
J013031G16TGTGGGCCCATGANONE 
J013044H17TGTGGGCCCATGANONE 
J013045G22TGTGGGCCCATGANONE 
J013059N20TGTGGGCCCATGANONE 
J013063G15TGTGGGCCCATGANONE 
J013064J09TGTGGGCCCATGANONE 
J013089F14TGTGGGCCCATGANONE 
J013099L15TGTGGGCCCATGANONE 
J013119A08TGTGGGCCCATGANONE 
J013119B13TGTGGGCCCATGANONE 
J013126K07TGTGGGCCCATGANONE 
J023019J06TGTGGGCCCATGANONE 
J023019K19TGTGGGCCCATGANONE 
J023038I17TGTGGGCCCATGANONE 
J023042O17TGTGGGCCCATGANONE 
J023060G23TGTGGGCCCATGANONE 
J023064A12TGTGGGCCCATGANONE 
J023072G01TGTGGGCCCATGANONE 
J023108K16TGTGGGCCCATGANONE 
J023111D04TGTGGGCCCATGANONE 
J023134O14TGTGGGCCCATGANONE 
J023142P09TGTGGGCCCATGANONE 
J033039F01TGTGGGCCCATGANONE 
J033068J18TGTGGGCCCATGANONE 
J033117B05TGTGGGCCCATGANONE 
J033118I01TGTGGGCCCATGANONE 
J033136E10TGTGGGCCCATGANONE 
J033140C15TGTGGGCCCATGANONE 
J043024E09TGTGGGCCCATGANONE 
J043038B21TGTGGGCCCATGANONE 
J090005F19TGTGGGCCCATGANONE 
J090022N04TGTGGGCCCATGANONE 
J090023F15TGTGGGCCCATGANONE 
J090038O19TGTGGGCCCATGANONE 
J090042N22TGTGGGCCCATGANONE 
J090051C06TGTGGGCCCATGANONE 
J090063O09TGTGGGCCCATGANONE 
J090079N05TGTGGGCCCATGANONE 
J090096L17TGTGGGCCCATGANONE 
J100038G08TGTGGGCCCATGANONE 
J100041F17TGTGGGCCCATGANONE 
J100042G15TGTGGGCCCATGANONE 
J100042N11TGTGGGCCCATGANONE 
J100048B10TGTGGGCCCATGANONE 
J100056C24TGTGGGCCCATGANONE 
J100059K07TGTGGGCCCATGANONE 
J100069A06TGTGGGCCCATGANONE 
J100077B01TGTGGGCCCATGANONE 
J100089D17TGTGGGCCCATGANONE 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0681100AK100584AAAGCCCATGAProtein of unknown function DUF604 family protein. 
J023106A15AAAGCCCATGANONE 
Os02g0754500AK069965AGCCCATGACAAGCCCACGGNONE 
AK105696AGCCCATGACAAGCCCACGGAmidase family protein. 
Os02g0782200AK070439AAGGCCCATGANONE 
AK101869AAGGCCCATGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0798300AK120999GTGGCCCATGAConserved hypothetical protein. 
Os02g0803600AK064750AGCCCATGALongin-like domain containing protein. 
Os02g0804300006-046-D12GAGGCCCATGANONE 
AK060165GAGGCCCATGANONE 
AK067584GAGGCCCATGASAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12GAGGCCCATGANONE 
J023098C22GAGGCCCATGANONE 
J033123P06GAGGCCCATGANONE 
J065060N24GAGGCCCATGANONE 
J065069H22GAGGCCCATGANONE 
J065155N20GAGGCCCATGANONE 
J065170K07GAGGCCCATGANONE 
J090033D12GAGGCCCATGANONE 
Os02g0813700Os02g0813700CAAGCCCATGANONE 
Os02g0823000AK122065CTGGCCCATGAPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0823600AK070498CAGGCCCATGAConserved hypothetical protein. 
J065055C02CAGGCCCATGANONE 
J065098A17CAGGCCCATGANONE 
J065119B13CAGGCCCATGANONE 
J065146F10CAGGCCCATGANONE 
J065209G06CAGGCCCATGANONE 
J080001K12CAGGCCCATGANONE 
J080004O17CAGGCCCATGANONE 
J080005P21CAGGCCCATGANONE 
J080009M18CAGGCCCATGANONE 
J080013O18CAGGCCCATGANONE 
J080014B04CAGGCCCATGANONE 
J080014O21CAGGCCCATGANONE 
J080015B04CAGGCCCATGANONE 
J080016B17CAGGCCCATGANONE 
J080017G09CAGGCCCATGANONE 
J080022A17CAGGCCCATGANONE 
J080024M10CAGGCCCATGANONE 
J080025F17CAGGCCCATGANONE 
J080025O16CAGGCCCATGANONE 
J080029H09CAGGCCCATGANONE 
J080030G24CAGGCCCATGANONE 
J080031E02CAGGCCCATGANONE 
J080032A18CAGGCCCATGANONE 
J080032G24CAGGCCCATGANONE 
J080033C05CAGGCCCATGANONE 
J080033N19CAGGCCCATGANONE 
J080035H10CAGGCCCATGANONE 
J080035L05CAGGCCCATGANONE 
J080042N09CAGGCCCATGANONE 
J080044C14CAGGCCCATGANONE 
J080048K16CAGGCCCATGANONE 
J080050L07CAGGCCCATGANONE 
J080051L06CAGGCCCATGANONE 
J080051P22CAGGCCCATGANONE 
J080053D09CAGGCCCATGANONE 
J080053J15CAGGCCCATGANONE 
J080053O12CAGGCCCATGANONE 
J080057L01CAGGCCCATGANONE 
J080062E08CAGGCCCATGANONE 
J080062I09CAGGCCCATGANONE 
J080063A21CAGGCCCATGANONE 
J080063E04CAGGCCCATGANONE 
J080063E08CAGGCCCATGANONE 
J080064D15CAGGCCCATGANONE 
J080064N15CAGGCCCATGANONE 
J080068F13CAGGCCCATGANONE 
J080070L16CAGGCCCATGANONE 
J080072O17CAGGCCCATGANONE 
J080075A07CAGGCCCATGANONE 
J080076H10CAGGCCCATGANONE 
J080077K19CAGGCCCATGANONE 
J080078E19CAGGCCCATGANONE 
J080082A02CAGGCCCATGANONE 
J080083O05CAGGCCCATGANONE 
J080091I07CAGGCCCATGANONE 
J080094K10CAGGCCCATGANONE 
J080094N03CAGGCCCATGANONE 
J080096F09CAGGCCCATGANONE 
J080097O04CAGGCCCATGANONE 
J090037B19CAGGCCCATGANONE 
J100017A13CAGGCCCATGANONE 
J100068N22CAGGCCCATGANONE 
J100072C06CAGGCCCATGANONE 
Os02g0827300AK069159TCATGGGCCATProtein of unknown function DUF382 domain containing protein. 
Os02g0830100J013032G02TTGGCCCATGANONE 
J013052O21TTGGCCCATGANONE 
J023078A05TTGGCCCATGANONE 
J033114C07TTGGCCCATGANONE 
J033125M07TTGGCCCATGANONE 
J053045C11TTGGCCCATGANONE 
J100055G05TTGGCCCATGANONE 
J100080J22TTGGCCCATGANONE 
Os02g0833900003-009-D08AGCCCATGANONE 
006-021-A06AGCCCATGANONE 
006-021-C05AGCCCATGANONE 
006-026-E10AGCCCATGANONE 
006-030-E06AGCCCATGANONE 
006-057-B10AGCCCATGANONE 
006-063-H09AGCCCATGANONE 
006-068-H02AGCCCATGANONE 
006-074-H10AGCCCATGANONE 
006-077-F08AGCCCATGANONE 
006-078-F01AGCCCATGANONE 
006-079-A12AGCCCATGANONE 
006-086-F02AGCCCATGANONE 
006-086-G01AGCCCATGANONE 
006-101-A03AGCCCATGANONE 
006-108-C11AGCCCATGANONE 
006-113-G12AGCCCATGANONE 
006-117-F12AGCCCATGANONE 
006-119-D10AGCCCATGANONE 
006-119-F09AGCCCATGANONE 
009-106-G05AGCCCATGANONE 
009-126-B08AGCCCATGANONE 
009-166-F06AGCCCATGANONE 
AK060083AGCCCATGANONE 
AK099584AGCCCATGANONE 
AK106092AGCCCATGANONE 
AK106171AGCCCATGASimilar to Peroxidase 64 precursor (EC 1.11.1.7) (Atperox P64) (PRXR4) (ATP17a). 
J013042D08AGCCCATGANONE 
J013042E08AGCCCATGANONE 
J075002G19AGCCCATGANONE 
J075030K18AGCCCATGANONE 
J075065P19AGCCCATGANONE 
J075091B17AGCCCATGANONE 
Os03g0107700014-091-A02GCCCATGAGGAGTGGGNONE 
AK063743GCCCATGAGGAGTGGGSimilar to EL2 protein. 
D64038GCCCATGAGGAGTGGGNONE 
J065001A12GCCCATGAGGAGTGGGNONE 
J065046K10GCCCATGAGGAGTGGGNONE 
J065063C24GCCCATGAGGAGTGGGNONE 
J065094D16GCCCATGAGGAGTGGGNONE 
J065152A12GCCCATGAGGAGTGGGNONE 
J065158D05GCCCATGAGGAGTGGGNONE 
J065166L15GCCCATGAGGAGTGGGNONE 
J065190D04GCCCATGAGGAGTGGGNONE 
J075056F01GCCCATGAGGAGTGGGNONE 
J075148A07GCCCATGAGGAGTGGGNONE 
J080074L17GCCCATGAGGAGTGGGNONE 
J080094A13GCCCATGAGGAGTGGGNONE 
J090044B15GCCCATGAGGAGTGGGNONE 
J090065N04GCCCATGAGGAGTGGGNONE 
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
J023055L16TAGGCCCATGAAAGCCCAAACNONE 
J023088I16TAGGCCCATGAAAGCCCAAACNONE 
J033070E21TAGGCCCATGAAAGCCCAAACNONE 
J065124N22TAGGCCCATGAAAGCCCAAACNONE 
J075152A19TAGGCCCATGAAAGCCCAAACNONE 
J075181J21TAGGCCCATGAAAGCCCAAACNONE 
J090011F23TAGGCCCATGAAAGCCCAAACNONE 
Os03g0130700015-052-H06TCATGGGCTGTNONE 
AK073872TCATGGGCTGTNONE 
AK100822TCATGGGCTGTNONE 
AK119886TCATGGGCTGTNONE 
J090060L05TCATGGGCTGTNONE 
J100059N01TCATGGGCTGTNONE 
Os03g0131400015-012-D11TCTGGGCCCATGANONE 
AK103714TCTGGGCCCATGAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TCATGGGCCCAGAVitamin K epoxide reductase domain containing protein. 
Os03g0139000006-059-C06TCATGGGCTNONE 
009-055-F07TCATGGGCTNONE 
AK060973TCATGGGCTConserved hypothetical protein. 
AK103850TCATGGGCTNONE 
Os03g0143400AK073999CAGGCCCATGASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21CAGGCCCATGANONE 
J033073C08CAGGCCCATGANONE 
J033094C19CAGGCCCATGANONE 
J065017L10CAGGCCCATGANONE 
J065070H22CAGGCCCATGANONE 
J065079M09CAGGCCCATGANONE 
J065091N18CAGGCCCATGANONE 
J065109N03CAGGCCCATGANONE 
J065113F05CAGGCCCATGANONE 
J065135D23CAGGCCCATGANONE 
J065156L16CAGGCCCATGANONE 
J065207O04CAGGCCCATGANONE 
J065208F03CAGGCCCATGANONE 
J090010M15CAGGCCCATGANONE 
J090056J18CAGGCCCATGANONE 
Os03g0179900AK121637GCCCATGASimilar to Avr9/Cf-9 rapidly elicited protein 44 (Fragment). 
Os03g0195900J065063O15GAGGCCCATGANONE 
Os03g0226300AK111731AGCCCATGASimilar to Pto kinase interactor 1. 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0300700AK071770TCATGGGCCTARetrotransposon gag protein family protein. 
J023112P05TCATGGGCCTANONE 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0308100AB116073TAAGCCCATGAPeptidase S14, ClpP family protein. 
AK060518TAAGCCCATGANONE 
AK099107TAAGCCCATGANONE 
AK105977TAAGCCCATGANONE 
J065005O19TAAGCCCATGANONE 
J065007L02TAAGCCCATGANONE 
J065128G15TAAGCCCATGANONE 
J065128N14TAAGCCCATGANONE 
J075010E21TAAGCCCATGANONE 
J075101J24TAAGCCCATGANONE 
J075124O14TAAGCCCATGANONE 
J075126O07TAAGCCCATGANONE 
Os03g0308900AK064183GAGGCCCATGAConserved hypothetical protein. 
Os03g0324900014-018-F11GTGGCCCATGANONE 
AK068144GTGGCCCATGAZinc finger, RING-type domain containing protein. 
Os03g0330300AK060756GCCCATGAViral attachment protein, fibre shaft repeat containing protein. 
AK072405GCCCATGANONE 
J013043H13GCCCATGANONE 
J013097M19GCCCATGANONE 
J023080M15GCCCATGANONE 
Os03g0337100AK107981GCCCATGAConserved hypothetical protein. 
Os03g0364000J065042L07TCATGGGCCTGNONE 
J065061O16TCATGGGCCTGNONE 
J065075L02TCATGGGCCTGNONE 
J065138N02TCATGGGCCTGNONE 
J065209H20TCATGGGCCTGNONE 
J075019G03TCATGGGCCTGNONE 
J075086E23TCATGGGCCTGNONE 
J075094M12TCATGGGCCTGNONE 
J075139L07TCATGGGCCTGNONE 
J075162I16TCATGGGCCTGNONE 
J075199G20TCATGGGCCTGNONE 
Os03g0381500AK108125TCATGGGCCTCATGGGCCTCConserved hypothetical protein. 
Os03g0383100AK107106CTGGCCCATGAConserved hypothetical protein. 
Os03g0410700J065102A22GCGGCCCATGANONE 
Os03g0410900J065067F10TCATGGGCCGCNONE 
J065073D08TCATGGGCCGCNONE 
J065176C06TCATGGGCCGCNONE 
J065189O13TCATGGGCCGCNONE 
J065214E05TCATGGGCCGCNONE 
J080007H09TCATGGGCCGCNONE 
J080012B19TCATGGGCCGCNONE 
J080020J16TCATGGGCCGCNONE 
J080038J22TCATGGGCCGCNONE 
J080045I09TCATGGGCCGCNONE 
J080059M16TCATGGGCCGCNONE 
J080060C19TCATGGGCCGCNONE 
J080080P22TCATGGGCCGCNONE 
J080083C03TCATGGGCCGCNONE 
J080093M17TCATGGGCCGCNONE 
J100029F12TCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
Os03g0411500AK058696TAGGCCCATGANONE 
AK071057TAGGCCCATGAPeptidase S14, ClpP family protein. 
Os03g0441000AK108726TCATGGGCTranscription initiation factor TFIID component TAF4 domain containing protein. 
Os03g0578200003-117-B07ACATGGGCCCAATGGGCCCATGANONE 
009-175-C06ACATGGGCCCAATGGGCCCATGANONE 
009-179-H05ACATGGGCCCAATGGGCCCATGANONE 
013-078-G11ACATGGGCCCAATGGGCCCATGANONE 
AK062224ACATGGGCCCAATGGGCCCATGANONE 
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein. 
J013096L16ACATGGGCCCAATGGGCCCATGANONE 
J100042G12ACATGGGCCCAATGGGCCCATGANONE 
J100069F04ACATGGGCCCAATGGGCCCATGANONE 
J100073H14ACATGGGCCCAATGGGCCCATGANONE 
Os03g0581600J065037H09TCATGGGCCTGNONE 
J065183O12TCATGGGCCTGNONE 
Os03g0586800003-114-H11TCATGGGCCAGGCCCNONE 
AK063765TCATGGGCCAGGCCCSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TCATGGGCCAGGCCCNONE 
J090004H06TCATGGGCCAGGCCCNONE 
J090022N15TCATGGGCCAGGCCCNONE 
J100035E05TCATGGGCCAGGCCCNONE 
J100041L05TCATGGGCCAGGCCCNONE 
J100041M18TCATGGGCCAGGCCCNONE 
J100057P04TCATGGGCCAGGCCCNONE 
J100089H06TCATGGGCCAGGCCCNONE 
J100090C23TCATGGGCCAGGCCCNONE 
Os03g0656900AK066416TTTCGGCCCATGANusB/RsmB/TIM44 domain containing protein. 
J065157L23TTTCGGCCCATGANONE 
J065166P22TTTCGGCCCATGANONE 
Os03g0669600009-081-F01TCATGGGCTNONE 
AK073152TCATGGGCTNONE 
AK104971TCATGGGCTHypothetical protein. 
J065166I17TCATGGGCTNONE 
Os03g0679000AK059913TCATGGGCCTGConserved hypothetical protein. 
J065094N08TCATGGGCCTGNONE 
J065108H06TCATGGGCCTGNONE 
Os03g0699700AB099850TCATGGGC9-lipoxigenase. 
AK103565TCATGGGCNONE 
J033041M05TCATGGGCNONE 
J033074I05TCATGGGCNONE 
J033105I23TCATGGGCNONE 
J033126I24TCATGGGCNONE 
J033132L12TCATGGGCNONE 
Os03g0734700AK072060GCGGCCCATGAMitochondrial substrate carrier family protein. 
AK120533GCGGCCCATGANONE 
J043026E20GCGGCCCATGANONE 
Os03g0743200J065049G14TCAGCCCATGANONE 
J065158O18TCAGCCCATGANONE 
Os03g0746800AK101718TCATGGGCCGGGCWD-40 repeat containing protein. 
Os03g0766000AK070596CCAAGCCCATGANONE 
AK104743CCAAGCCCATGANONE 
AK106079CCAAGCCCATGANONE 
J013063M09CCAAGCCCATGANONE 
J023056A03CCAAGCCCATGANONE 
J043038L07CCAAGCCCATGANONE 
J053067N16CCAAGCCCATGANONE 
J053073G09CCAAGCCCATGANONE 
J053075I19CCAAGCCCATGANONE 
Os03g0769600AK100054TCATGGGCCCTResB-like family protein. 
Os03g0787100006-022-G04CAAGGCCCATGANONE 
AK110858CAAGGCCCATGAConserved hypothetical protein. 
J065197C24CAAGGCCCATGANONE 
J075147E03CAAGGCCCATGANONE 
J100065K06CAAGGCCCATGANONE 
Os03g0824400AK070153TCATGGGCTNONE 
AK104298TCATGGGCTSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0824500AK058990TCATGGGCCCATTTConserved hypothetical protein. 
AK058990TCATGGGCCGAGCCGConserved hypothetical protein. 
J065057L18TCATGGGCCCATTTNONE 
J065057L18TCATGGGCCGAGCCGNONE 
J065083L02TCATGGGCCCATTTNONE 
J065083L02TCATGGGCCGAGCCGNONE 
J065086L24TCATGGGCCCATTTNONE 
J065086L24TCATGGGCCGAGCCGNONE 
J065121L10TCATGGGCCCATTTNONE 
J065121L10TCATGGGCCGAGCCGNONE 
J065168N03TCATGGGCCCATTTNONE 
J065168N03TCATGGGCCGAGCCGNONE 
J100035J22TCATGGGCCCATTTNONE 
J100035J22TCATGGGCCGAGCCGNONE 
J100050G18TCATGGGCCCATTTNONE 
J100050G18TCATGGGCCGAGCCGNONE 
J100055F15TCATGGGCCCATTTNONE 
J100055F15TCATGGGCCGAGCCGNONE 
Os03g0833700011-060-A10TCATGGGCCGTTTNONE 
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein. 
Os04g0270100AK063713TCATGGGCTGANONE 
AK107968TCATGGGCTGANONE 
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0447300AK111006TCATGGGCTConserved hypothetical protein. 
Os04g0475500Os04g0475500TCATGGGCCATConserved hypothetical protein. 
Os04g0479000AK106344TCATGGGCCGASimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0504600J065162K24TCTGGGCCCATGANONE 
Os04g0506100AK059053TCATGGGCSimilar to Receptor-like protein kinase. 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
Os04g0525900AK065806AGCCCATGAMajor facilitator superfamily protein. 
Os04g0542900AK068610TCATGGGCTTAConserved hypothetical protein. 
Os04g0581100AK100853TCATGGGCTIsopenicillin N synthase family protein. 
J023123J08TCATGGGCTNONE 
Os04g0585100012-055-B08GGACGGCCCATGANONE 
AK105286GGACGGCCCATGAZinc finger, DHHC-type domain containing protein. 
Os04g0595000AK106907TCATGGGCTTGPeptidase A1, pepsin family protein. 
AK106907TCCGGCCCATGAPeptidase A1, pepsin family protein. 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0674100J080097J12TCATGGGCCGCAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TGCGGCCCATGANONE 
AK103795TGCGGCCCATGACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TGCGGCCCATGANONE 
J065020P20TGCGGCCCATGANONE 
J065057I21TGCGGCCCATGANONE 
J065059P11TGCGGCCCATGANONE 
J065083A22TGCGGCCCATGANONE 
J065093K10TGCGGCCCATGANONE 
J065097D03TGCGGCCCATGANONE 
J065103P05TGCGGCCCATGANONE 
J065113K09TGCGGCCCATGANONE 
J065118F23TGCGGCCCATGANONE 
J065119M06TGCGGCCCATGANONE 
J065146K17TGCGGCCCATGANONE 
J065161N12TGCGGCCCATGANONE 
J065169L02TGCGGCCCATGANONE 
J065189H12TGCGGCCCATGANONE 
J065192E24TGCGGCCCATGANONE 
J065193K17TGCGGCCCATGANONE 
J065197O21TGCGGCCCATGANONE 
J065214D09TGCGGCCCATGANONE 
J065217B11TGCGGCCCATGANONE 
J075132K07TGCGGCCCATGANONE 
J100059D14TGCGGCCCATGANONE 
Os05g0123400AK069521CCAGCCCATGAConserved hypothetical protein. 
J023022O05CCAGCCCATGANONE 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
AK102515ATCTCGGCCCATGAAAAGCCCNONE 
Os05g0182700003-102-E07CCCGGCCCATGANONE 
011-019-D04CCCGGCCCATGANONE 
013-068-D09CCCGGCCCATGANONE 
014-032-G03CCCGGCCCATGANONE 
AK065911CCCGGCCCATGAProtein of unknown function DUF1664 family protein. 
AK104343CCCGGCCCATGANONE 
J013045E01CCCGGCCCATGANONE 
J013156L15CCCGGCCCATGANONE 
J023029P17CCCGGCCCATGANONE 
J023134I24CCCGGCCCATGANONE 
J033099A10CCCGGCCCATGANONE 
J033115L16CCCGGCCCATGANONE 
J090007M24CCCGGCCCATGANONE 
J090019F02CCCGGCCCATGANONE 
Os05g0186000006-103-D10TCATGGGCTTGGNONE 
009-047-D06TCATGGGCTTGGNONE 
009-073-G05TCATGGGCTTGGNONE 
009-084-G09TCATGGGCTTGGNONE 
009-097-G04TCATGGGCTTGGNONE 
009-111-D11TCATGGGCTTGGNONE 
009-115-G01TCATGGGCTTGGNONE 
009-131-B04TCATGGGCTTGGNONE 
009-144-F05TCATGGGCTTGGNONE 
009-154-D08TCATGGGCTTGGNONE 
014-004-H02TCATGGGCTTGGNONE 
AK058675TCATGGGCTTGGNONE 
AK060420TCATGGGCTTGGSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231TCATGGGCTTGGNONE 
J065155C08TCATGGGCTTGGNONE 
J075143K12TCATGGGCTTGGNONE 
Os05g0193800AK058865TCATGGGCCTCNONE 
AK067940TCATGGGCCTCConserved hypothetical protein. 
J065043K19TCATGGGCCTCNONE 
J065095O10TCATGGGCCTCNONE 
J065095O12TCATGGGCCTCNONE 
J080002K02TCATGGGCCTCNONE 
J080012L17TCATGGGCCTCNONE 
J080013J02TCATGGGCCTCNONE 
J080013O11TCATGGGCCTCNONE 
J080020A17TCATGGGCCTCNONE 
J080028E18TCATGGGCCTCNONE 
J080036P11TCATGGGCCTCNONE 
J080042E10TCATGGGCCTCNONE 
J080042L10TCATGGGCCTCNONE 
J080047B11TCATGGGCCTCNONE 
J080048N05TCATGGGCCTCNONE 
J080057E20TCATGGGCCTCNONE 
J080057K13TCATGGGCCTCNONE 
J080058L03TCATGGGCCTCNONE 
J080063H07TCATGGGCCTCNONE 
J080066L23TCATGGGCCTCNONE 
J080069G22TCATGGGCCTCNONE 
J080072E12TCATGGGCCTCNONE 
J080076D06TCATGGGCCTCNONE 
J080077A22TCATGGGCCTCNONE 
J080081A01TCATGGGCCTCNONE 
J080090M13TCATGGGCCTCNONE 
J080093G07TCATGGGCCTCNONE 
J080094O20TCATGGGCCTCNONE 
J080097F13TCATGGGCCTCNONE 
Os05g0195700006-027-E05TCATGGGCTNONE 
AK061427TCATGGGCTNONE 
AK065594TCATGGGCTSimilar to Transcription factor MYBS2. 
J013029P13TCATGGGCTNONE 
J065048A06TCATGGGCTNONE 
J065080L03TCATGGGCTNONE 
J065103D11TCATGGGCTNONE 
J065106I19TCATGGGCTNONE 
J065198K16TCATGGGCTNONE 
Os05g0312500AK069307GCCCATGAReticulon family protein. 
J023075D16GCCCATGANONE 
J023097K08GCCCATGANONE 
Os05g0332600AK098926TCATGGGCNONE 
Os05g0377000Os05g0377000GCCCATGAAGTTGGGCTSimilar to Acyl carrier protein (ACP). 
Os05g0400600AK072045GAGGCCCATGACobalt transport protein family protein. 
Os05g0417200AK071955CTCGGCCCATGAThioredoxin-like fold domain containing protein. 
Os05g0445500009-021-C05TCATGGGCTNONE 
009-129-D11TCATGGGCTNONE 
009-147-E04TCATGGGCTNONE 
009-169-C11TCATGGGCTNONE 
AK121459TCATGGGCTSimilar to 60S acidic ribosomal protein P2B. 
D21114TCATGGGCTNONE 
J023001K23TCATGGGCTNONE 
J023107J19TCATGGGCTNONE 
J023143J09TCATGGGCTNONE 
J065049D04TCATGGGCTNONE 
J065092I06TCATGGGCTNONE 
J065188H04TCATGGGCTNONE 
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE 
Os05g0503000AK068335TCATGGGCCGAAASimilar to Secretory carrier membrane protein. 
AK104049TCATGGGCCGAAANONE 
J013149D04TCATGGGCCGAAANONE 
J075085A06TCATGGGCCGAAANONE 
Os05g0509200AK061566TAAGCCCATGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007TAAGCCCATGANONE 
AK100226TAAGCCCATGANONE 
J013114B12TAAGCCCATGANONE 
J023048D09TAAGCCCATGANONE 
Os05g0528200009-146-C01TTGGCCCATGANONE 
AK062985TTGGCCCATGASimilar to 50S ribosomal protein L20. 
Os05g0558900AK101679TCATGGGCCATSimilar to Frsb-prov protein. 
J013028M08TCATGGGCCATNONE 
J013074E16TCATGGGCCATNONE 
J013096L01TCATGGGCCATNONE 
J023085M19TCATGGGCCATNONE 
J033058I10TCATGGGCCATNONE 
J033091D18TCATGGGCCATNONE 
J033111H13TCATGGGCCATNONE 
J033114C18TCATGGGCCATNONE 
Os05g0563500AK121924TCATGGGCTConserved hypothetical protein. 
J033106F17TCATGGGCTNONE 
Os05g0568600009-024-B09TCATGGGCCCACGCNONE 
AK063781TCATGGGCCCACGCProtein of unknown function DUF1645 family protein. 
J080049H14TCATGGGCCCACGCNONE 
J080062M08TCATGGGCCCACGCNONE 
J080064I07TCATGGGCCCACGCNONE 
J080068A12TCATGGGCCCACGCNONE 
J080086J10TCATGGGCCCACGCNONE 
Os05g0580500AK102000TTGGCCCATGANONE 
AY371049TTGGCCCATGARad21/Rec8 like protein, N-terminal domain containing protein. 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0106000006-086-D02TCATGGGCTTANONE 
AK059897TCATGGGCTTASeptum site-determining protein MinD family protein. 
AK105653TCATGGGCTTANONE 
J065059N03TCATGGGCTTANONE 
J065138F18TCATGGGCTTANONE 
J065158D02TCATGGGCTTANONE 
Os06g0130000AK064427TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK070084TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK119321TATTGGGCTCAGCCCATGAGCCCATGTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0135340J065061D17TAAGCCCATGANONE 
J065159A10TAAGCCCATGAConserved hypothetical protein. 
Os06g0157800AK121504TCATGGGCCGGASimilar to CG7224 (Fragment). 
J033022L20TCATGGGCCGGANONE 
J075033D09TCATGGGCCGGANONE 
Os06g0220800AK059876AATTGGGCCCATGANONE 
AY739306AATTGGGCCCATGAThioredoxin domain 2 containing protein. 
J075093C09AATTGGGCCCATGANONE 
J100026J18AATTGGGCCCATGANONE 
J100041O16AATTGGGCCCATGANONE 
J100089K16AATTGGGCCCATGANONE 
Os06g0499500016-028-E11TCATGGGCNONE 
AK064372TCATGGGCNONE 
AK099376TCATGGGCSimilar to Indole-3-acetic acid-amido synthetase GH3.17 (EC 6.3.2.-) (Auxin- responsive GH3-like protein 17) (AtGH3-17). 
AK107353TCATGGGCNONE 
J023004L08TCATGGGCNONE 
J033067D17TCATGGGCNONE 
J033092L22TCATGGGCNONE 
J033133P04TCATGGGCNONE 
Os06g0583500J013034M04TTGGCCCATGAGGCCCATANONE 
J013169I02TTGGCCCATGAGGCCCATANONE 
J023024B09TTGGCCCATGAGGCCCATANONE 
J023132L02TTGGCCCATGAGGCCCATANONE 
J033026C23TTGGCCCATGAGGCCCATANONE 
J033094E23TTGGCCCATGAGGCCCATANONE 
J033101D23TTGGCCCATGAGGCCCATANONE 
J033125B15TTGGCCCATGAGGCCCATANONE 
J033144I11TTGGCCCATGAGGCCCATANONE 
J033145E13TTGGCCCATGAGGCCCATANONE 
J033145I11TTGGCCCATGAGGCCCATANONE 
J065022M23TTGGCCCATGAGGCCCATANONE 
J065043I24TTGGCCCATGAGGCCCATANONE 
J065053G06TTGGCCCATGAGGCCCATANONE 
J065088K03TTGGCCCATGAGGCCCATANONE 
J065121L09TTGGCCCATGAGGCCCATANONE 
J065143M08TTGGCCCATGAGGCCCATANONE 
J065146H02TTGGCCCATGAGGCCCATANONE 
J065206M03TTGGCCCATGAGGCCCATANONE 
J075004L13TTGGCCCATGAGGCCCATANONE 
J075005L17TTGGCCCATGAGGCCCATANONE 
J075007G18TTGGCCCATGAGGCCCATANONE 
J075027E20TTGGCCCATGAGGCCCATANONE 
J075029A19TTGGCCCATGAGGCCCATANONE 
J075041C15TTGGCCCATGAGGCCCATANONE 
J075046M05TTGGCCCATGAGGCCCATANONE 
J075066P21TTGGCCCATGAGGCCCATANONE 
J075069E07TTGGCCCATGAGGCCCATANONE 
J075107P21TTGGCCCATGAGGCCCATANONE 
J075123F03TTGGCCCATGAGGCCCATANONE 
J075124E07TTGGCCCATGAGGCCCATANONE 
J075140J22TTGGCCCATGAGGCCCATANONE 
J075160N03TTGGCCCATGAGGCCCATANONE 
Os06g0593100AK060274AACGGCCCATGASimilar to UDP-galactose/UDP-glucose transporter. 
AK071175AACGGCCCATGANONE 
Os06g0609400AK109185TCATGGGCConserved hypothetical protein. 
Os06g0647900AK073750TCATGGGCTConserved hypothetical protein. 
J033029K17TCATGGGCTNONE 
J033070L21TCATGGGCTNONE 
Os06g0659500AK058431GCCCATGASimilar to Glutaredoxin. 
J075110D04GCCCATGANONE 
J090010C23GCCCATGANONE 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os06g0702800009-039-E05GGACGGCCCATGANONE 
AK073948GGACGGCCCATGAHypothetical protein. 
J023108K23GGACGGCCCATGANONE 
J033072H04GGACGGCCCATGANONE 
J065008G05GGACGGCCCATGANONE 
J065128J12GGACGGCCCATGANONE 
J065131A01GGACGGCCCATGANONE 
J065173B12GGACGGCCCATGANONE 
Os06g0705400009-033-D03GCCCATGANONE 
009-056-H04GCCCATGANONE 
009-085-B10GCCCATGANONE 
009-121-F03GCCCATGANONE 
009-146-H05GCCCATGANONE 
009-155-E09GCCCATGANONE 
009-164-H02GCCCATGANONE 
009-168-G05GCCCATGANONE 
009-181-B05GCCCATGANONE 
AK062493GCCCATGANONE 
AK062667GCCCATGASimilar to Nonspecific lipid-transfer protein 2P (LTP2P) (Lipid transfer protein 2 isoform 2) (LTP2-2) (7 kDa lipid transfer protein 2). 
J065070I09GCCCATGANONE 
Os06g0709100006-057-D06TTCGGCCCATGANONE 
011-040-A08TTCGGCCCATGANONE 
016-044-A01TTCGGCCCATGANONE 
AK059732TTCGGCCCATGANONE 
AK070881TTCGGCCCATGACyclin-like F-box domain containing protein. 
AK103683TTCGGCCCATGANONE 
J065026P10TTCGGCCCATGANONE 
J090017L13TTCGGCCCATGANONE 
Os06g0711600016-047-G09TCATGGGCTGGNONE 
AK064384TCATGGGCTGGmRNA splicing factor SYF2 family protein. 
AK102831TCATGGGCTGGNONE 
J013072P18TCATGGGCTGGNONE 
J023049G01TCATGGGCTGGNONE 
J023088I01TCATGGGCTGGNONE 
J033023I22TCATGGGCTGGNONE 
J033106I12TCATGGGCTGGNONE 
J033109G07TCATGGGCTGGNONE 
J065030F22TCATGGGCTGGNONE 
J065132H19TCATGGGCTGGNONE 
J080301D07TCATGGGCTGGNONE 
J080305C09TCATGGGCTGGNONE 
J080312C03TCATGGGCTGGNONE 
J080313I15TCATGGGCTGGNONE 
J080315B09TCATGGGCTGGNONE 
J090056N21TCATGGGCTGGNONE 
J100027B07TCATGGGCTGGNONE 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os07g0110100009-059-D11AGCCCATGANONE 
AK071499AGCCCATGAConserved hypothetical protein. 
J065064P17AGCCCATGANONE 
J065111B09AGCCCATGANONE 
J075099A14AGCCCATGANONE 
J075139C23AGCCCATGANONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0150200009-152-C07AGCCCATGANONE 
AK058680AGCCCATGANONE 
AK121635AGCCCATGASimilar to 40S ribosomal protein S12-1. 
J033051C16AGCCCATGANONE 
J033123H15AGCCCATGANONE 
J065093I01AGCCCATGANONE 
J065197C05AGCCCATGANONE 
J075037B11AGCCCATGANONE 
J075114B08AGCCCATGANONE 
J075123N01AGCCCATGANONE 
J075129O04AGCCCATGANONE 
J075160H17AGCCCATGANONE 
J075166H17AGCCCATGANONE 
J080310F11AGCCCATGANONE 
J080315P11AGCCCATGANONE 
J090025A22AGCCCATGANONE 
Os07g0192000AK065505GCCCATGAAAA ATPase domain containing protein. 
J013027N01GCCCATGANONE 
J100039B05GCCCATGANONE 
J100062N08GCCCATGANONE 
J100082N21GCCCATGANONE 
Os07g0546700009-110-H10TCATGGGCCGGCNONE 
AK058262TCATGGGCCGGCNONE 
J065154I05TCATGGGCCGGCNONE 
J065175P09TCATGGGCCGGCNONE 
J065187F11TCATGGGCCGGCNONE 
J075114K16TCATGGGCCGGCNONE 
J090031L21TCATGGGCCGGCNONE 
U86017TCATGGGCCGGCSimilar to 60S ribosomal protein L38. 
Os07g0558800AK100986CAAGCCCATGAMajor sperm protein domain containing protein. 
Os07g0596600012-067-F07TCATGGGCNONE 
Os07g0603100AK101352TCATGGGCCGGANuclear transport factor 2 domain containing protein. 
AK101352TCATGGGCCTGGNuclear transport factor 2 domain containing protein. 
J023077E09TCATGGGCCGGANONE 
J023077E09TCATGGGCCTGGNONE 
J023081N15TCATGGGCCGGANONE 
J023081N15TCATGGGCCTGGNONE 
J033022N22TCATGGGCCGGANONE 
J033022N22TCATGGGCCTGGNONE 
J033024M18TCATGGGCCGGANONE 
J033024M18TCATGGGCCTGGNONE 
J033034P09TCATGGGCCGGANONE 
J033034P09TCATGGGCCTGGNONE 
J033046A06TCATGGGCCGGANONE 
J033046A06TCATGGGCCTGGNONE 
J033051K01TCATGGGCCGGANONE 
J033051K01TCATGGGCCTGGNONE 
J033081P09TCATGGGCCGGANONE 
J033081P09TCATGGGCCTGGNONE 
J033091B17TCATGGGCCGGANONE 
J033091B17TCATGGGCCTGGNONE 
J033092K23TCATGGGCCGGANONE 
J033092K23TCATGGGCCTGGNONE 
J033132J09TCATGGGCCGGANONE 
J033132J09TCATGGGCCTGGNONE 
J033144A14TCATGGGCCGGANONE 
J033144A14TCATGGGCCTGGNONE 
J033145A14TCATGGGCCGGANONE 
J033145A14TCATGGGCCTGGNONE 
J043021B20TCATGGGCCGGANONE 
J043021B20TCATGGGCCTGGNONE 
J053024D23TCATGGGCCGGANONE 
J053024D23TCATGGGCCTGGNONE 
J065212J10TCATGGGCCGGANONE 
J065212J10TCATGGGCCTGGNONE 
J090055M05TCATGGGCCGGANONE 
J090055M05TCATGGGCCTGGNONE 
J090065E14TCATGGGCCGGANONE 
J090065E14TCATGGGCCTGGNONE 
J090092J06TCATGGGCCGGANONE 
J090092J06TCATGGGCCTGGNONE 
Os07g0641600AK068478AGCCCATGASAM (and some other nucleotide) binding motif domain containing protein. 
AK073802AGCCCATGANONE 
Os07g0653100J065130E21TCATGGGCCGGAConserved hypothetical protein. 
J065186P07TCATGGGCCGGANONE 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0673100AK060100TCATGGGCTNONE 
AK103678TCATGGGCTRibosomal protein S8E family protein. 
AK104794TCATGGGCTNONE 
Os07g0688100AK101635TCATGGGCTTCProtein prenyltransferase domain containing protein. 
J033055B02TCATGGGCTTCNONE 
J090013O08TCATGGGCTTCNONE 
J090074A17TCATGGGCTTCNONE 
Os07g0691100AK071728TCATGGGCTGASimilar to Pectin methylesterase 6 (Fragment). 
J023108P03TCATGGGCTGANONE 
J023112F11TCATGGGCTGANONE 
J023143A10TCATGGGCTGANONE 
Os08g0139000009-092-A05TCAGCCCATGANONE 
009-150-B08TCAGCCCATGANONE 
AK070704TCAGCCCATGANONE 
AK119802TCAGCCCATGASimilar to RNA-binding glycine rich protein (RGP-2). 
J023024E19TCAGCCCATGANONE 
J023056N10TCAGCCCATGANONE 
J065028B04TCAGCCCATGANONE 
J065119H20TCAGCCCATGANONE 
J065121E01TCAGCCCATGANONE 
J065139C18TCAGCCCATGANONE 
J065160O15TCAGCCCATGANONE 
J065211A15TCAGCCCATGANONE 
J090038G23TCAGCCCATGANONE 
J100024D11TCAGCCCATGANONE 
J100032C04TCAGCCCATGANONE 
J100038G14TCAGCCCATGANONE 
J100051E19TCAGCCCATGANONE 
Os08g0167500006-063-D04TCATGGGCCGGGCCGGGNONE 
006-066-G09TCATGGGCCGGGCCGGGNONE 
AK061061TCATGGGCCGGGCCGGGConserved hypothetical protein. 
AK071197TCATGGGCCGGGCCGGGNONE 
J023082N10TCATGGGCCGGGCCGGGNONE 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0192900AK103422AGTGGGCCAGCCCATGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AGTGGGCCAGCCCATGANONE 
Os08g0227100AK071657TCATGGGCCGCTRAF-like domain containing protein. 
AK103481TCATGGGCCGCNONE 
J065183O06TCATGGGCCGCNONE 
J090013C07TCATGGGCCGCNONE 
J090081F11TCATGGGCCGCNONE 
Os08g0433400AJ495796TCATGGGCCATSimilar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4). 
AK059468TCATGGGCCATNONE 
Os08g0499700AK109726TCATGGGCNONE 
AK119271TCATGGGCSimilar to Pherophorin-S precursor. 
Os08g0504400014-015-C10TCATGGGCCGAANONE 
AK069190TCATGGGCCGAASimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089TCATGGGCCGAANONE 
J023006O19TCATGGGCCGAANONE 
J033041C11TCATGGGCCGAANONE 
Os08g0535400004-001-H10GCGGCCCATGANONE 
AK071527GCGGCCCATGAZinc finger, DHHC-type domain containing protein. 
J023107B02GCGGCCCATGANONE 
Os08g0553450Os08g0553450GAAGCCCATGAHypothetical protein. 
Os08g0553450TCATGGGCCAAHypothetical protein. 
Os08g0564100AK063258GTGGCCCATGASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0467400AK066610GAGGCCCATGAProtein of unknown function DUF6, transmembrane domain containing protein. 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
Os11g0116200006-033-D08GCCCATGANONE 
009-007-G11GCCCATGANONE 
009-121-D06GCCCATGANONE 
009-121-G11GCCCATGANONE 
009-127-D08GCCCATGANONE 
009-129-E05GCCCATGANONE 
009-136-F04GCCCATGANONE 
009-139-D10GCCCATGANONE 
009-142-C08GCCCATGANONE 
009-154-D01GCCCATGANONE 
009-178-A08GCCCATGANONE 
009-188-A05GCCCATGANONE 
009-191-E10GCCCATGANONE 
009-192-D03GCCCATGANONE 
AJ704771GCCCATGANONE 
AK060108GCCCATGASimilar to Nonspecific lipid-transfer protein 1 (LTP 1) (Major allergen Pru d 3). 
AK064888GCCCATGANONE 
J013000K13GCCCATGANONE 
J065028C11GCCCATGANONE 
J065037A12GCCCATGANONE 
J065071A22GCCCATGANONE 
J065108L01GCCCATGANONE 
Os11g0162200009-059-H04TCATGGGCCAAAAGCCCAAAANONE 
AK060396TCATGGGCCAAAAGCCCAAAASimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11TCATGGGCCAAAAGCCCAAAANONE 
J065105K09TCATGGGCCAAAAGCCCAAAANONE 
J075024G12TCATGGGCCAAAAGCCCAAAANONE 
J075040K04TCATGGGCCAAAAGCCCAAAANONE 
J075066D13TCATGGGCCAAAAGCCCAAAANONE 
J075108A11TCATGGGCCAAAAGCCCAAAANONE 
J100031D04TCATGGGCCAAAAGCCCAAAANONE 
J100060O05TCATGGGCCAAAAGCCCAAAANONE 
J100075M22TCATGGGCCAAAAGCCCAAAANONE 
Os11g0175500015-087-F02TCAGGCCCATGAAAGCCCATGTNONE 
AK064320TCAGGCCCATGAAAGCCCATGTZinc finger, RING-type domain containing protein. 
AK101592TCAGGCCCATGAAAGCCCATGTNONE 
Os11g0187500012-002-D06TCATGGGCTATGGCCCACGTNONE 
012-035-H04TCATGGGCTATGGCCCACGTNONE 
012-065-F08TCATGGGCTATGGCCCACGTNONE 
AK063977TCATGGGCTATGGCCCACGTSimilar to Heat shock protein 70. 
AK103083TCATGGGCTATGGCCCACGTNONE 
J033118G15TCATGGGCTATGGCCCACGTNONE 
J065115E02TCATGGGCTATGGCCCACGTNONE 
J065178K04TCATGGGCTATGGCCCACGTNONE 
J065178L03TCATGGGCTATGGCCCACGTNONE 
J090064A22TCATGGGCTATGGCCCACGTNONE 
Os11g0199600AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein. 
AK120040TCATGGGCCCATCACCGGCCCACANONE 
J023047I06TCATGGGCCCATCACCGGCCCACANONE 
J033064L23TCATGGGCCCATCACCGGCCCACANONE 
J033117I01TCATGGGCCCATCACCGGCCCACANONE 
J033123I18TCATGGGCCCATCACCGGCCCACANONE 
J053026H17TCATGGGCCCATCACCGGCCCACANONE 
J053078G05TCATGGGCCCATCACCGGCCCACANONE 
J065102A09TCATGGGCCCATCACCGGCCCACANONE 
J065113G11TCATGGGCCCATCACCGGCCCACANONE 
J065207F20TCATGGGCCCATCACCGGCCCACANONE 
J075027K21TCATGGGCCCATCACCGGCCCACANONE 
Os11g0202000AK063427CAGGCCCATGACyclin-like F-box domain containing protein. 
AK122020CAGGCCCATGANONE 
J033111N03CAGGCCCATGANONE 
Os11g0483000J100057I07GCCCATGACytochrome P450 family protein. 
Os11g0523700AK109915TCATGGGCSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116). 
Os11g0525200011-005-B12GCCCATGANONE 
012-006-A10GCCCATGANONE 
012-093-G03GCCCATGANONE 
014-088-E05GCCCATGANONE 
015-100-F08GCCCATGANONE 
AB025047GCCCATGANONE 
AK060487GCCCATGANONE 
AK121491GCCCATGASimilar to Cytochrome P450 51 (EC 1.14.13.70) (CYPLI) (P450-LIA1) (Obtusifoliol 14-alpha demethylase) (Fragment). 
J013130H02GCCCATGANONE 
J013158G17GCCCATGANONE 
J023063C20GCCCATGANONE 
J023079N18GCCCATGANONE 
J023082P17GCCCATGANONE 
J023086I09GCCCATGANONE 
J023112D17GCCCATGANONE 
J023121B06GCCCATGANONE 
J023122G16GCCCATGANONE 
J023147J07GCCCATGANONE 
J023150P16GCCCATGANONE 
J033076I22GCCCATGANONE 
J033129I15GCCCATGANONE 
J075155F06GCCCATGANONE 
J075163E02GCCCATGANONE 
J075168H23GCCCATGANONE 
J100022M11GCCCATGANONE 
Os11g0657200AK059959TCATGGGCTTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AAAGCCCATGANONE 
AK062752AAAGCCCATGASimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0664700012-064-D03TCATGGGCCTGGGCCTGNONE 
AK100084TCATGGGCCTGGGCCTGConserved hypothetical protein. 
J023002K05TCATGGGCCTGGGCCTGNONE 
J023037C21TCATGGGCCTGGGCCTGNONE 
J033029N10TCATGGGCCTGGGCCTGNONE 
J090047F07TCATGGGCCTGGGCCTGNONE 
Os12g0124400AK071024CACGGCCCATGAExostosin-like family protein. 
Os12g0233500Os12g0233500TCATGGGCCGANONE 
Os12g0506500AK119779GCCCATGAGalactokinase/homoserine kinase family protein. 
Os12g0507600009-155-B05GGGTGGGCCCATCTCGGCCCATGANONE 
009-155-B05TCCGGCCCACTTGTCGGCCCATGANONE 
AK070613GGGTGGGCCCATCTCGGCCCATGAConserved hypothetical protein. 
AK070613TCCGGCCCACTTGTCGGCCCATGAConserved hypothetical protein. 
J023063G03GGGTGGGCCCATCTCGGCCCATGANONE 
J023063G03TCCGGCCCACTTGTCGGCCCATGANONE 
Os12g0540000AK108630TCATGGGCCAGAConserved hypothetical protein. 
J065046N02TCATGGGCCAGANONE 
J065100H24TCATGGGCCAGANONE 
J065142M24TCATGGGCCAGANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.