version

Summary of OsREG610 (All List)

OrganismOryza sativa  
IDOsREG610  
SequenceGCCCATTA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1668  

Entry Sequences (1668 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0132800AK068422TAATGGGCCGAAAPeptidyl-tRNA hydrolase family protein. 
Os01g0155600006-048-F03TAATGGGCCTTNONE 
AK060171TAATGGGCCTTNONE 
AK071635TAATGGGCCTTSimilar to Splicing factor RSZ33. 
J023080A03TAATGGGCCTTNONE 
J023100L15TAATGGGCCTTNONE 
J033075I17TAATGGGCCTTNONE 
J033085O09TAATGGGCCTTNONE 
J033105E15TAATGGGCCTTNONE 
J033132N10TAATGGGCCTTNONE 
J033132P12TAATGGGCCTTNONE 
J033149H12TAATGGGCCTTNONE 
J043026M03TAATGGGCCTTNONE 
J080305J10TAATGGGCCTTNONE 
J080308K03TAATGGGCCTTNONE 
J090023M04TAATGGGCCTTNONE 
J090078F24TAATGGGCCTTNONE 
J100066P05TAATGGGCCTTNONE 
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0219100J065130F20TAATGGGCCGAANONE 
J065208O10TAATGGGCCGAASFT2-like family protein. 
Os01g0229100006-113-G08GAGGCCCATTANONE 
011-075-E08GAGGCCCATTANONE 
AK061285GAGGCCCATTANONE 
AK070838GAGGCCCATTATetratricopeptide-like helical domain containing protein. 
J013059F08GAGGCCCATTANONE 
J013059G08GAGGCCCATTANONE 
J013059G09GAGGCCCATTANONE 
J013069M12GAGGCCCATTANONE 
J013105A19GAGGCCCATTANONE 
J013149F07GAGGCCCATTANONE 
J023073J07GAGGCCCATTANONE 
J023130F24GAGGCCCATTANONE 
J023147J08GAGGCCCATTANONE 
J033028F13GAGGCCCATTANONE 
J033115A16GAGGCCCATTANONE 
J033135F02GAGGCCCATTANONE 
J065031G16GAGGCCCATTANONE 
J065058A09GAGGCCCATTANONE 
J065089N15GAGGCCCATTANONE 
J065130I09GAGGCCCATTANONE 
J065191P09GAGGCCCATTANONE 
J065197P14GAGGCCCATTANONE 
J080306D15GAGGCCCATTANONE 
J080308M06GAGGCCCATTANONE 
J080315A03GAGGCCCATTANONE 
J080315N11GAGGCCCATTANONE 
J090046E14GAGGCCCATTANONE 
J090058G09GAGGCCCATTANONE 
J090077H05GAGGCCCATTANONE 
J090087O20GAGGCCCATTANONE 
Os01g0229200AK066024TAATGGGCCTCVHS domain containing protein. 
Os01g0247500AK065614GCCCATTAProtein kinase-like domain containing protein. 
J013026J11GCCCATTANONE 
Os01g0495900AK065221TAATGGGCTTTTSimilar to CRS2-associated factor 1. 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE 
012-005-A05GTTGGGCCGGGGCCCATTANONE 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
AK099235GTTGGGCCGGGGCCCATTANONE 
AK105022GTTGGGCCGGGGCCCATTANONE 
J065030D21GTTGGGCCGGGGCCCATTANONE 
J065031C10GTTGGGCCGGGGCCCATTANONE 
J065105A22GTTGGGCCGGGGCCCATTANONE 
J065173M19GTTGGGCCGGGGCCCATTANONE 
J075188F15GTTGGGCCGGGGCCCATTANONE 
J090050C15GTTGGGCCGGGGCCCATTANONE 
J100058K07GTTGGGCCGGGGCCCATTANONE 
Os01g0618500011-019-D03TAATGGGCCGANONE 
AK067476TAATGGGCCGASimilar to RNA helicase (Fragment). 
J013020E19TAATGGGCCGANONE 
J033046J12TAATGGGCCGANONE 
J033055D06TAATGGGCCGANONE 
Os01g0626100AK066892TAATGGGCCCACTTGAdaptin, N-terminal domain containing protein. 
J013050G23TAATGGGCCCACTTGNONE 
J013060F03TAATGGGCCCACTTGNONE 
J013088A19TAATGGGCCCACTTGNONE 
J013105M18TAATGGGCCCACTTGNONE 
J013108D15TAATGGGCCCACTTGNONE 
J013118M09TAATGGGCCCACTTGNONE 
J023009J17TAATGGGCCCACTTGNONE 
J023078I22TAATGGGCCCACTTGNONE 
J023103F15TAATGGGCCCACTTGNONE 
J023105B22TAATGGGCCCACTTGNONE 
J033024C18TAATGGGCCCACTTGNONE 
J033032N02TAATGGGCCCACTTGNONE 
J033041E20TAATGGGCCCACTTGNONE 
J033068L19TAATGGGCCCACTTGNONE 
J033076E16TAATGGGCCCACTTGNONE 
J033084J03TAATGGGCCCACTTGNONE 
J033090A13TAATGGGCCCACTTGNONE 
J033106C19TAATGGGCCCACTTGNONE 
J033116N13TAATGGGCCCACTTGNONE 
J033127C24TAATGGGCCCACTTGNONE 
J033129M02TAATGGGCCCACTTGNONE 
J033145J02TAATGGGCCCACTTGNONE 
J043005F08TAATGGGCCCACTTGNONE 
J043007L22TAATGGGCCCACTTGNONE 
J043031E03TAATGGGCCCACTTGNONE 
J043035J19TAATGGGCCCACTTGNONE 
J053027K20TAATGGGCCCACTTGNONE 
J065058I24TAATGGGCCCACTTGNONE 
J065078A06TAATGGGCCCACTTGNONE 
J065085E09TAATGGGCCCACTTGNONE 
J065093L04TAATGGGCCCACTTGNONE 
J065099H07TAATGGGCCCACTTGNONE 
J065102D09TAATGGGCCCACTTGNONE 
J065136J19TAATGGGCCCACTTGNONE 
J065182P21TAATGGGCCCACTTGNONE 
J065200F03TAATGGGCCCACTTGNONE 
J090004E22TAATGGGCCCACTTGNONE 
J090013K22TAATGGGCCCACTTGNONE 
J090019A03TAATGGGCCCACTTGNONE 
J090057B09TAATGGGCCCACTTGNONE 
J090066F19TAATGGGCCCACTTGNONE 
J090071M22TAATGGGCCCACTTGNONE 
J090075E16TAATGGGCCCACTTGNONE 
J090086D23TAATGGGCCCACTTGNONE 
Os01g0643900AK108288TAATGGGCOleosin family protein. 
Os01g0784600AK067527ACATGGGCTAATGGGCCTAConserved hypothetical protein. 
Os01g0786700J065061D03GCCCATTAConserved hypothetical protein. 
Os01g0805000009-045-H11TAATGGGCCTANONE 
009-196-H08TAATGGGCCTANONE 
J013094D22TAATGGGCCTARibosomal protein L34 family protein. 
J013119F23TAATGGGCCTANONE 
J065128B11TAATGGGCCTANONE 
Os01g0829266J065010C18TGTTGGGCCCATTANONE 
J065037A22TGTTGGGCCCATTANONE 
J065044B02TGTTGGGCCCATTAConserved hypothetical protein. 
J065044B10TGTTGGGCCCATTANONE 
J065051A06TGTTGGGCCCATTANONE 
J065073E06TGTTGGGCCCATTANONE 
J065074I11TGTTGGGCCCATTANONE 
J065086D22TGTTGGGCCCATTANONE 
J065104H10TGTTGGGCCCATTANONE 
J065107C05TGTTGGGCCCATTANONE 
J065124H16TGTTGGGCCCATTANONE 
J065165F22TGTTGGGCCCATTANONE 
J065169B11TGTTGGGCCCATTANONE 
J065172G21TGTTGGGCCCATTANONE 
J065191E05TGTTGGGCCCATTANONE 
J065191F18TGTTGGGCCCATTANONE 
Os01g0847700AK103729GCCCATAATGGGCTGTSimilar to Aldose reductase. 
J033031B19GCCCATAATGGGCTGTNONE 
J065110K09GCCCATAATGGGCTGTNONE 
J065135H06GCCCATAATGGGCTGTNONE 
J075015H10GCCCATAATGGGCTGTNONE 
Os01g0872100AK099405TCAGCCCATTATGF-beta receptor, type I/II extracellular region family protein. 
J013001K17TCAGCCCATTANONE 
Os01g0895100AK058611TAATGGGCCCATTTSimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698TAATGGGCCCATTTNONE 
AK099166TAATGGGCCCATTTNONE 
J023065I03TAATGGGCCCATTTNONE 
J023081J06TAATGGGCCCATTTNONE 
J023126H17TAATGGGCCCATTTNONE 
J023126O09TAATGGGCCCATTTNONE 
J033035I06TAATGGGCCCATTTNONE 
J090065C10TAATGGGCCCATTTNONE 
J090095O16TAATGGGCCCATTTNONE 
Os01g0954400003-009-F12TAATGGGCCGANONE 
012-080-B09TAATGGGCCGANONE 
AK065709TAATGGGCCGASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335TAATGGGCCGANONE 
J013039J02TAATGGGCCGANONE 
J033081E17TAATGGGCCGANONE 
J075058B02TAATGGGCCGANONE 
J075067K19TAATGGGCCGANONE 
J075120E23TAATGGGCCGANONE 
J075147I16TAATGGGCCGANONE 
Os01g0960800AK073977TAATGGGCCTAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGGProtein Transporter, Pam16 family protein. 
AY313247TAATGGGCCTANONE 
AY313247TAATGGGCCTGANONE 
AY313247TAATGGGCCTGGNONE 
J033075P16TAATGGGCCTANONE 
J033075P16TAATGGGCCTGANONE 
J033075P16TAATGGGCCTGGNONE 
J065051H06TAATGGGCCTANONE 
J065051H06TAATGGGCCTGANONE 
J065051H06TAATGGGCCTGGNONE 
J065167L02TAATGGGCCTANONE 
J065167L02TAATGGGCCTGANONE 
J065167L02TAATGGGCCTGGNONE 
J090083C22TAATGGGCCTANONE 
J090083C22TAATGGGCCTGANONE 
J090083C22TAATGGGCCTGGNONE 
Os02g0116900009-017-C02TAATGGGCCTANONE 
AK121401TAATGGGCCTASimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09TAATGGGCCTANONE 
J023131N03TAATGGGCCTANONE 
J033145N08TAATGGGCCTANONE 
J065105G09TAATGGGCCTANONE 
J075086L06TAATGGGCCTANONE 
Os02g0148400AK070451TAATGGGCNONE 
AK072039TAATGGGCPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10TAATGGGCNONE 
Os02g0190900AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
J033023N03AAGGCCCAAGGCCCATTANONE 
J033031C22AAGGCCCAAGGCCCATTANONE 
J033037P22AAGGCCCAAGGCCCATTANONE 
J090013J10AAGGCCCAAGGCCCATTANONE 
J090030I04AAGGCCCAAGGCCCATTANONE 
Os02g0266500AK100307TAATGGGCCTASimilar to RASPBERRY3. 
Os02g0304800Os02g0304800TCCGGCCCATTAProtein prenyltransferase domain containing protein. 
Os02g0321000AK121840TAATGGGCCGTTTTetratricopeptide-like helical domain containing protein. 
Os02g0531450J065097O14TAATGGGCTHypothetical protein. 
J075155C16TAATGGGCTNONE 
Os02g0601500016-057-F12GTGGCCCATTANONE 
J075091F02GTGGCCCATTACytochrome P450 family protein. 
Os02g0622400005-010-C04TAATGGGCCGGCCCATTTNONE 
AK061679TAATGGGCCGGCCCATTTConserved hypothetical protein. 
J013058H01TAATGGGCCGGCCCATTTNONE 
J013095D07TAATGGGCCGGCCCATTTNONE 
J023054G05TAATGGGCCGGCCCATTTNONE 
J023093A17TAATGGGCCGGCCCATTTNONE 
J023146P16TAATGGGCCGGCCCATTTNONE 
J033089D16TAATGGGCCGGCCCATTTNONE 
J033099G12TAATGGGCCGGCCCATTTNONE 
J033131N10TAATGGGCCGGCCCATTTNONE 
J053073J04TAATGGGCCGGCCCATTTNONE 
J053074P03TAATGGGCCGGCCCATTTNONE 
J053075M06TAATGGGCCGGCCCATTTNONE 
J053088K13TAATGGGCCGGCCCATTTNONE 
J090039F18TAATGGGCCGGCCCATTTNONE 
J090045M03TAATGGGCCGGCCCATTTNONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0658300AK073923AAGGCCCATTAConserved hypothetical protein. 
AK073923ACAGCCCATTAConserved hypothetical protein. 
J065152M15AAGGCCCATTANONE 
J065152M15ACAGCCCATTANONE 
Os02g0666800AK101444TAATGGGCCTCProtein of unknown function DUF788 family protein. 
J033039F09TAATGGGCCTCNONE 
J065041E15TAATGGGCCTCNONE 
J075087I24TAATGGGCCTCNONE 
J100079A10TAATGGGCCTCNONE 
Os02g0717100014-089-G06CACGGCCCATTANONE 
AK063741CACGGCCCATTAEsterase/lipase/thioesterase domain containing protein. 
J065052A22CACGGCCCATTANONE 
Os02g0732900AK065796GCAGCCCATTACGGCCCProtein of unknown function DUF794, plant family protein. 
AK104342GCAGCCCATTACGGCCCNONE 
Os02g0736500AK065166TAATGGGCCGAANicastrin family protein. 
J013099D16TAATGGGCCGAANONE 
Os02g0787100Os02g0787100AGCCCATTAProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0816700009-132-E07TAATGGGCCGTAGGCCCATTTNONE 
009-132-E07TAATGGGCCTANONE 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
AK059572TAATGGGCCTAConserved hypothetical protein. 
Os02g0816800013-089-A09AAATGGGCCTACGGCCCATTANONE 
013-089-A09TAGGCCCATTANONE 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
AK102271TAGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
J013105O04AAATGGGCCTACGGCCCATTANONE 
J013105O04TAGGCCCATTANONE 
J013124I08AAATGGGCCTACGGCCCATTANONE 
J013124I08TAGGCCCATTANONE 
J023002E08AAATGGGCCTACGGCCCATTANONE 
J023002E08TAGGCCCATTANONE 
J023025C01AAATGGGCCTACGGCCCATTANONE 
J023025C01TAGGCCCATTANONE 
J023037O12AAATGGGCCTACGGCCCATTANONE 
J023037O12TAGGCCCATTANONE 
J023049N06AAATGGGCCTACGGCCCATTANONE 
J023049N06TAGGCCCATTANONE 
J023069G18AAATGGGCCTACGGCCCATTANONE 
J023069G18TAGGCCCATTANONE 
J033029M02AAATGGGCCTACGGCCCATTANONE 
J033029M02TAGGCCCATTANONE 
J033037L22AAATGGGCCTACGGCCCATTANONE 
J033037L22TAGGCCCATTANONE 
J033089A08AAATGGGCCTACGGCCCATTANONE 
J033089A08TAGGCCCATTANONE 
J033103L07AAATGGGCCTACGGCCCATTANONE 
J033103L07TAGGCCCATTANONE 
J033125L19AAATGGGCCTACGGCCCATTANONE 
J033125L19TAGGCCCATTANONE 
J090008N20AAATGGGCCTACGGCCCATTANONE 
J090008N20TAGGCCCATTANONE 
J090041F23AAATGGGCCTACGGCCCATTANONE 
J090041F23TAGGCCCATTANONE 
J090092H16AAATGGGCCTACGGCCCATTANONE 
J090092H16TAGGCCCATTANONE 
Os02g0819100AK100156TTCGGCCCATTAZinc finger, DHHC-type domain containing protein. 
J013088C21TTCGGCCCATTANONE 
Os02g0820600AK066549TAGGCCCATTAConserved hypothetical protein. 
J013070F02TAGGCCCATTANONE 
Os02g0820700006-025-E04TAATGGGCCTANONE 
006-025-E04TAATGGGCCTCNONE 
006-052-F06TAATGGGCCTANONE 
006-052-F06TAATGGGCCTCNONE 
006-082-A05TAATGGGCCTANONE 
006-082-A05TAATGGGCCTCNONE 
006-089-B06TAATGGGCCTANONE 
006-089-B06TAATGGGCCTCNONE 
AK060869TAATGGGCCTASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK060869TAATGGGCCTCSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365TAATGGGCCTANONE 
AK061365TAATGGGCCTCNONE 
AK103008TAATGGGCCTANONE 
AK103008TAATGGGCCTCNONE 
AK104724TAATGGGCCTANONE 
AK104724TAATGGGCCTCNONE 
J013049H21TAATGGGCCTANONE 
J013049H21TAATGGGCCTCNONE 
J043027N22TAATGGGCCTANONE 
J043027N22TAATGGGCCTCNONE 
J075031I15TAATGGGCCTANONE 
J075031I15TAATGGGCCTCNONE 
J075132D23TAATGGGCCTANONE 
J075132D23TAATGGGCCTCNONE 
Os02g0823600AK070498TAATGGGCCGCConserved hypothetical protein. 
J065055C02TAATGGGCCGCNONE 
J065098A17TAATGGGCCGCNONE 
J065119B13TAATGGGCCGCNONE 
J065146F10TAATGGGCCGCNONE 
J065209G06TAATGGGCCGCNONE 
J080001K12TAATGGGCCGCNONE 
J080004O17TAATGGGCCGCNONE 
J080005P21TAATGGGCCGCNONE 
J080009M18TAATGGGCCGCNONE 
J080013O18TAATGGGCCGCNONE 
J080014B04TAATGGGCCGCNONE 
J080014O21TAATGGGCCGCNONE 
J080015B04TAATGGGCCGCNONE 
J080016B17TAATGGGCCGCNONE 
J080017G09TAATGGGCCGCNONE 
J080022A17TAATGGGCCGCNONE 
J080024M10TAATGGGCCGCNONE 
J080025F17TAATGGGCCGCNONE 
J080025O16TAATGGGCCGCNONE 
J080029H09TAATGGGCCGCNONE 
J080030G24TAATGGGCCGCNONE 
J080031E02TAATGGGCCGCNONE 
J080032A18TAATGGGCCGCNONE 
J080032G24TAATGGGCCGCNONE 
J080033C05TAATGGGCCGCNONE 
J080033N19TAATGGGCCGCNONE 
J080035H10TAATGGGCCGCNONE 
J080035L05TAATGGGCCGCNONE 
J080042N09TAATGGGCCGCNONE 
J080044C14TAATGGGCCGCNONE 
J080048K16TAATGGGCCGCNONE 
J080050L07TAATGGGCCGCNONE 
J080051L06TAATGGGCCGCNONE 
J080051P22TAATGGGCCGCNONE 
J080053D09TAATGGGCCGCNONE 
J080053J15TAATGGGCCGCNONE 
J080053O12TAATGGGCCGCNONE 
J080057L01TAATGGGCCGCNONE 
J080062E08TAATGGGCCGCNONE 
J080062I09TAATGGGCCGCNONE 
J080063A21TAATGGGCCGCNONE 
J080063E04TAATGGGCCGCNONE 
J080063E08TAATGGGCCGCNONE 
J080064D15TAATGGGCCGCNONE 
J080064N15TAATGGGCCGCNONE 
J080068F13TAATGGGCCGCNONE 
J080070L16TAATGGGCCGCNONE 
J080072O17TAATGGGCCGCNONE 
J080075A07TAATGGGCCGCNONE 
J080076H10TAATGGGCCGCNONE 
J080077K19TAATGGGCCGCNONE 
J080078E19TAATGGGCCGCNONE 
J080082A02TAATGGGCCGCNONE 
J080083O05TAATGGGCCGCNONE 
J080091I07TAATGGGCCGCNONE 
J080094K10TAATGGGCCGCNONE 
J080094N03TAATGGGCCGCNONE 
J080096F09TAATGGGCCGCNONE 
J080097O04TAATGGGCCGCNONE 
J090037B19TAATGGGCCGCNONE 
J100017A13TAATGGGCCGCNONE 
J100068N22TAATGGGCCGCNONE 
J100072C06TAATGGGCCGCNONE 
Os02g0832700AK099439CAGGCCCATTASimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0100400AK068556TAATGGGCTNONE 
AK121880TAATGGGCTSimilar to DNA repair endonuclease UVH1 (EC 3.1.-.-) (Ultraviolet hypersensitive 1) (AtRAD1) (DNA excision repair protein XP-F homolog). 
Os03g0115200009-112-E09AGCCCATTANONE 
009-112-E09GCGGCCCATTANONE 
AK071287AGCCCATTASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
AK071287GCGGCCCATTASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06AGCCCATTANONE 
J023088J06GCGGCCCATTANONE 
J065075D17AGCCCATTANONE 
J065075D17GCGGCCCATTANONE 
J065108G15AGCCCATTANONE 
J065108G15GCGGCCCATTANONE 
J065165A16AGCCCATTANONE 
J065165A16GCGGCCCATTANONE 
J075015O12AGCCCATTANONE 
J075015O12GCGGCCCATTANONE 
J075022O06AGCCCATTANONE 
J075022O06GCGGCCCATTANONE 
J075031H14AGCCCATTANONE 
J075031H14GCGGCCCATTANONE 
J075033D10AGCCCATTANONE 
J075033D10GCGGCCCATTANONE 
J075070A04AGCCCATTANONE 
J075070A04GCGGCCCATTANONE 
J075127A05AGCCCATTANONE 
J075127A05GCGGCCCATTANONE 
J100070B16AGCCCATTANONE 
J100070B16GCGGCCCATTANONE 
Os03g0116500AF106844TAATGGGCCGANONE 
AK101870TAATGGGCCGAConstitutive photomorphogenic 11. 
J023055L16TAATGGGCCGANONE 
J023088I16TAATGGGCCGANONE 
J033070E21TAATGGGCCGANONE 
J065124N22TAATGGGCCGANONE 
J075152A19TAATGGGCCGANONE 
J075181J21TAATGGGCCGANONE 
J090011F23TAATGGGCCGANONE 
Os03g0125700009-132-G03TAATGGGCCGAAANONE 
AK062913TAATGGGCCGAAAConserved hypothetical protein. 
J075046C16TAATGGGCCGAAANONE 
J075115L05TAATGGGCCGAAANONE 
J075143I05TAATGGGCCGAAANONE 
J075197O07TAATGGGCCGAAANONE 
Os03g0192400009-081-A03TAAGCCCATTANONE 
009-159-B02TAAGCCCATTANONE 
AK070573TAAGCCCATTAGRIM-19 family protein. 
J023056B01TAAGCCCATTANONE 
J023075G06TAAGCCCATTANONE 
J033048K16TAAGCCCATTANONE 
J033048L16TAAGCCCATTANONE 
J053031H23TAAGCCCATTANONE 
J065002H14TAAGCCCATTANONE 
J065006G22TAAGCCCATTANONE 
J065032G13TAAGCCCATTANONE 
J065056A09TAAGCCCATTANONE 
J065078I01TAAGCCCATTANONE 
J065095G01TAAGCCCATTANONE 
J065095I18TAAGCCCATTANONE 
J065134M18TAAGCCCATTANONE 
J065158P07TAAGCCCATTANONE 
J065165K17TAAGCCCATTANONE 
J065181J12TAAGCCCATTANONE 
J065189N09TAAGCCCATTANONE 
J065200D13TAAGCCCATTANONE 
J065202H20TAAGCCCATTANONE 
J065215K20TAAGCCCATTANONE 
J075049N19TAAGCCCATTANONE 
J075147J16TAAGCCCATTANONE 
J090081E19TAAGCCCATTANONE 
J100017C16TAAGCCCATTANONE 
J100039M16TAAGCCCATTANONE 
J100043E23TAAGCCCATTANONE 
J100063L12TAAGCCCATTANONE 
J100079F22TAAGCCCATTANONE 
Os03g0204900009-041-G04TAATGGGCCGGGNONE 
AK062601TAATGGGCCGGGSimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0240700009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
Os03g0249200009-103-B08TAGGCCCATTANONE 
AK069944TAGGCCCATTAClass I peptide chain release factor domain containing protein. 
J065166E13TAGGCCCATTANONE 
Os03g0265400006-022-A01TAATGGGCCGTTTNONE 
006-033-E05TAATGGGCCGTTTNONE 
006-035-A03TAATGGGCCGTTTNONE 
006-057-D09TAATGGGCCGTTTNONE 
006-058-D03TAATGGGCCGTTTNONE 
006-061-B04TAATGGGCCGTTTNONE 
006-076-C01TAATGGGCCGTTTNONE 
006-089-C09TAATGGGCCGTTTNONE 
006-092-D01TAATGGGCCGTTTNONE 
006-100-D06TAATGGGCCGTTTNONE 
009-014-G04TAATGGGCCGTTTNONE 
009-060-C06TAATGGGCCGTTTNONE 
009-098-A06TAATGGGCCGTTTNONE 
AK061468TAATGGGCCGTTTNONE 
AK104116TAATGGGCCGTTTNONE 
AK104424TAATGGGCCGTTTNONE 
AK120527TAATGGGCCGTTTSimilar to 50S ribosomal protein L4, chloroplast precursor (R-protein L4). 
J013127C20TAATGGGCCGTTTNONE 
J023031E11TAATGGGCCGTTTNONE 
J023150F18TAATGGGCCGTTTNONE 
J033037G14TAATGGGCCGTTTNONE 
J065073K02TAATGGGCCGTTTNONE 
J065085P13TAATGGGCCGTTTNONE 
J065161B21TAATGGGCCGTTTNONE 
J065197G23TAATGGGCCGTTTNONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0282900006-088-H05TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK061166TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK102161TAATGGGCCTAGCCCATTTAGGCCCATTTConserved hypothetical protein. 
AK104514TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
Os03g0332700AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0338600AK066604TCAGCCCATTAtRNA pseudouridine synthase family protein. 
Os03g0343500009-042-G06CTCGGCCCATTANONE 
009-063-D01CTCGGCCCATTANONE 
009-156-H09CTCGGCCCATTANONE 
AB117995CTCGGCCCATTANONE 
AK058737CTCGGCCCATTANONE 
AK059599CTCGGCCCATTASimilar to 60S ribosomal protein L22-2. 
AK121502CTCGGCCCATTANONE 
J023082D10CTCGGCCCATTANONE 
J033022G11CTCGGCCCATTANONE 
J075048M16CTCGGCCCATTANONE 
J075049O20CTCGGCCCATTANONE 
J075082I02CTCGGCCCATTANONE 
J075105G01CTCGGCCCATTANONE 
J075131K05CTCGGCCCATTANONE 
J080002H01CTCGGCCCATTANONE 
J080003H01CTCGGCCCATTANONE 
J080005G08CTCGGCCCATTANONE 
J080011M13CTCGGCCCATTANONE 
J080020M02CTCGGCCCATTANONE 
J080026N24CTCGGCCCATTANONE 
J080028L09CTCGGCCCATTANONE 
J080032O14CTCGGCCCATTANONE 
J080033J12CTCGGCCCATTANONE 
J080035D05CTCGGCCCATTANONE 
J080039H01CTCGGCCCATTANONE 
J080044B07CTCGGCCCATTANONE 
J080044E23CTCGGCCCATTANONE 
J080049N11CTCGGCCCATTANONE 
J080050A21CTCGGCCCATTANONE 
J080055L24CTCGGCCCATTANONE 
J080059N20CTCGGCCCATTANONE 
J080061F04CTCGGCCCATTANONE 
J080078I16CTCGGCCCATTANONE 
J080079G24CTCGGCCCATTANONE 
J080080K13CTCGGCCCATTANONE 
J080083G20CTCGGCCCATTANONE 
J080087B08CTCGGCCCATTANONE 
J080091L19CTCGGCCCATTANONE 
J080094D06CTCGGCCCATTANONE 
J090038L06CTCGGCCCATTANONE 
J090075H06CTCGGCCCATTANONE 
J090081D12CTCGGCCCATTANONE 
Os03g0569800AK070080CCCATCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK120873CCCATCCAGCCCATTANONE 
Os03g0569900009-027-A11CAAGGCCCATTANONE 
AK063783CAAGGCCCATTANONE 
Os03g0598200AK068322TAGGCCCATTANop14-like protein family protein. 
Os03g0681900006-042-F08ATGGCCCATTANONE 
009-043-F12ATGGCCCATTANONE 
AK061750ATGGCCCATTANONE 
AK062094ATGGCCCATTASimilar to RGP-3 (Fragment). 
J033034F01ATGGCCCATTANONE 
J033131F11ATGGCCCATTANONE 
J033143N03ATGGCCCATTANONE 
Os03g0725300011-085-E09TAATGGGCTTCNONE 
AK063969TAATGGGCTTCSimilar to Dbr1-prov protein. 
AK073636TAATGGGCTTCNONE 
J033050L15TAATGGGCTTCNONE 
J053082G03TAATGGGCTTCNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0746600AK069559TAATGGGCCACWD40-like domain containing protein. 
J023141K22TAATGGGCCACNONE 
Os03g0754800AK101584TAATGGGCCTAMitochondrial substrate carrier family protein. 
J080305A09TAATGGGCCTANONE 
J080310E24TAATGGGCCTANONE 
J080310O12TAATGGGCCTANONE 
J080311N04TAATGGGCCTANONE 
J080313N20TAATGGGCCTANONE 
J080317H24TAATGGGCCTANONE 
Os03g0766000AK070596GAAGCCCATTANONE 
AK104743GAAGCCCATTANONE 
AK106079GAAGCCCATTANONE 
J013063M09GAAGCCCATTANONE 
J023056A03GAAGCCCATTANONE 
J043038L07GAAGCCCATTANONE 
J053067N16GAAGCCCATTANONE 
J053073G09GAAGCCCATTANONE 
J053075I19GAAGCCCATTANONE 
Os03g0766900AK066137TAATGGGCCAGAllene oxide synthase. 
AK071361TAATGGGCCAGNONE 
AK103989TAATGGGCCAGNONE 
J023090K09TAATGGGCCAGNONE 
J043022H11TAATGGGCCAGNONE 
J053078F12TAATGGGCCAGNONE 
Os03g0770900AK106660CCAACGGCTAATGGGCTConserved hypothetical protein. 
Os03g0786000AK061286ACAGCCCATTAConserved hypothetical protein. 
AK073187ACAGCCCATTANONE 
Os03g0788200AK106623TAGGCCCATTAE1 protein and Def2/Der2 allergen family protein. 
J065112K18TAGGCCCATTANONE 
J065123A19TAGGCCCATTANONE 
J065131C15TAGGCCCATTANONE 
J065174D05TAGGCCCATTANONE 
J075011P16TAGGCCCATTANONE 
J075017N24TAGGCCCATTANONE 
J075028P19TAGGCCCATTANONE 
J075052I01TAGGCCCATTANONE 
J075057H20TAGGCCCATTANONE 
J075080F06TAGGCCCATTANONE 
J075091A10TAGGCCCATTANONE 
J075140L23TAGGCCCATTANONE 
J075156J08TAGGCCCATTANONE 
J075182D16TAGGCCCATTANONE 
J075191O21TAGGCCCATTANONE 
J090079E21TAGGCCCATTANONE 
Os03g0795900012-092-G05CCAGGCCCATTANONE 
015-043-D09CCAGGCCCATTANONE 
016-078-G11CCAGGCCCATTANONE 
AK068660CCAGGCCCATTASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CCAGGCCCATTANONE 
J023001L04CCAGGCCCATTANONE 
J053032K11CCAGGCCCATTANONE 
J065059E10CCAGGCCCATTANONE 
J065095H19CCAGGCCCATTANONE 
J065181M06CCAGGCCCATTANONE 
J100047D11CCAGGCCCATTANONE 
J100068G04CCAGGCCCATTANONE 
Os03g0811800AK063320ACTGGGCCACTAATGGGCTTGGRibosomal protein L36 family protein. 
J065094F18ACTGGGCCACTAATGGGCTTGGNONE 
J090029B04ACTGGGCCACTAATGGGCTTGGNONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0843400009-195-F11TAATGGGCCTCNONE 
AK061198TAATGGGCCTCSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076TAATGGGCCTCNONE 
Os03g0844100AK067164TAATGGGCCCCACGTCTCSimilar to Pti1 kinase-like protein. 
Os03g0850100AK101126ATTGGGCCTTAATGGGCCAANLI interacting factor domain containing protein. 
Os03g0851900AK102145TCAGCCCATTAAFG1-like ATPase family protein. 
J033086B08TCAGCCCATTANONE 
Os03g0852600009-174-G04TTGGCCCATTANONE 
AK063101TTGGCCCATTAProtein of unknown function DUF565 family protein. 
J065131H12TTGGCCCATTANONE 
J090046K24TTGGCCCATTANONE 
Os03g0854000009-186-C03TAATGGGCTGGNONE 
AK061374TAATGGGCTGGProtein of unknown function UPF0131 family protein. 
J065138B11TAATGGGCTGGNONE 
Os03g0855600006-029-G09TAATGGGCTTTNONE 
006-033-E02TAATGGGCTTTNONE 
006-069-G07TAATGGGCTTTNONE 
006-083-A02TAATGGGCTTTNONE 
006-098-H04TAATGGGCTTTNONE 
009-054-C04TAATGGGCTTTNONE 
AK060030TAATGGGCTTTNONE 
AK061467TAATGGGCTTTConserved hypothetical protein. 
AK067858TAATGGGCTTTNONE 
AK106030TAATGGGCTTTNONE 
J013123A10TAATGGGCTTTNONE 
J065001I24TAATGGGCTTTNONE 
J065015N21TAATGGGCTTTNONE 
J065016H07TAATGGGCTTTNONE 
J065040A05TAATGGGCTTTNONE 
J065040F01TAATGGGCTTTNONE 
J065066G17TAATGGGCTTTNONE 
J065077I09TAATGGGCTTTNONE 
J065099M22TAATGGGCTTTNONE 
J065135B13TAATGGGCTTTNONE 
J065144H19TAATGGGCTTTNONE 
J065146I03TAATGGGCTTTNONE 
J065169E02TAATGGGCTTTNONE 
J065177D21TAATGGGCTTTNONE 
J065189L20TAATGGGCTTTNONE 
J065207H13TAATGGGCTTTNONE 
J065210D24TAATGGGCTTTNONE 
J065212I03TAATGGGCTTTNONE 
J075007E21TAATGGGCTTTNONE 
J075013H07TAATGGGCTTTNONE 
J075023K06TAATGGGCTTTNONE 
J075031D23TAATGGGCTTTNONE 
J075038K09TAATGGGCTTTNONE 
J075084C08TAATGGGCTTTNONE 
J075098K20TAATGGGCTTTNONE 
J090028E04TAATGGGCTTTNONE 
J090031E20TAATGGGCTTTNONE 
J090042F06TAATGGGCTTTNONE 
J090049L05TAATGGGCTTTNONE 
J090086G03TAATGGGCTTTNONE 
J090096J04TAATGGGCTTTNONE 
J100035O03TAATGGGCTTTNONE 
J100053H24TAATGGGCTTTNONE 
J100056L17TAATGGGCTTTNONE 
J100058K06TAATGGGCTTTNONE 
J100059G09TAATGGGCTTTNONE 
J100081C15TAATGGGCTTTNONE 
Os03g0858200AK110744GCCCATTAConserved hypothetical protein. 
Os04g0128700AK107172TGCGGGCCCATTAThioredoxin-like fold domain containing protein. 
J065102M16TGCGGGCCCATTANONE 
J065124K01TGCGGGCCCATTANONE 
J065129I12TGCGGGCCCATTANONE 
J065192C08TGCGGGCCCATTANONE 
Os04g0221000012-059-A06GCCCATTANONE 
AK102514GCCCATTAConserved hypothetical protein. 
J090020I10GCCCATTANONE 
J090030I17GCCCATTANONE 
J090061D12GCCCATTANONE 
J090073K22GCCCATTANONE 
Os04g0271200AK060035GCCCATTASilent information regulator protein Sir2 family protein. 
J053065P14GCCCATTANONE 
J065030K14GCCCATTANONE 
J090008K24GCCCATTANONE 
J090047J16GCCCATTANONE 
Os04g0430100009-125-A01AAGGCCCATTANONE 
AK102190AAGGCCCATTASimilar to 40S ribosomal protein S10-1. 
J033087A06AAGGCCCATTANONE 
J053032M06AAGGCCCATTANONE 
J065033D05AAGGCCCATTANONE 
J065045D15AAGGCCCATTANONE 
J065045K10AAGGCCCATTANONE 
J065049N05AAGGCCCATTANONE 
J065064N09AAGGCCCATTANONE 
J065068F17AAGGCCCATTANONE 
J065088F17AAGGCCCATTANONE 
J065104N22AAGGCCCATTANONE 
J065117B19AAGGCCCATTANONE 
J065119O12AAGGCCCATTANONE 
J065134G24AAGGCCCATTANONE 
J065150G16AAGGCCCATTANONE 
J065176C03AAGGCCCATTANONE 
J065212M23AAGGCCCATTANONE 
J075009P18AAGGCCCATTANONE 
J075019G06AAGGCCCATTANONE 
J075037H14AAGGCCCATTANONE 
J075057C13AAGGCCCATTANONE 
J075100E14AAGGCCCATTANONE 
J075120I16AAGGCCCATTANONE 
J075130F07AAGGCCCATTANONE 
J075156M16AAGGCCCATTANONE 
J100043J03AAGGCCCATTANONE 
Os04g0433600009-128-C01GCCCATTANONE 
AK061916GCCCATTANONE 
AK068114GCCCATTAProtein of unknown function DUF668 family protein. 
J080307M16GCCCATTANONE 
J080307P14GCCCATTANONE 
J080308I20GCCCATTANONE 
Os04g0462900006-094-A02AGCCCATTANONE 
006-097-F05AGCCCATTANONE 
009-129-A10AGCCCATTANONE 
015-042-F07AGCCCATTANONE 
AK058481AGCCCATTANONE 
AK059483AGCCCATTANONE 
AK061324AGCCCATTANONE 
AK099100AGCCCATTANONE 
AK102579AGCCCATTANONE 
AK106322AGCCCATTASimilar to Prohibitin. 
J065059J20AGCCCATTANONE 
J065085I02AGCCCATTANONE 
J065118N23AGCCCATTANONE 
J065208K24AGCCCATTANONE 
J075053B14AGCCCATTANONE 
J075097M22AGCCCATTANONE 
J075184B07AGCCCATTANONE 
J075194A15AGCCCATTANONE 
J080315G03AGCCCATTANONE 
J090088H19AGCCCATTANONE 
Os04g0473400AK067896GAAGCCCATTASimilar to 60S ribosomal protein L6-B (L17) (YL16) (RP18). 
J013123D20GAAGCCCATTANONE 
J033108A09GAAGCCCATTANONE 
J065196E24GAAGCCCATTANONE 
J100066B16GAAGCCCATTANONE 
Os04g0475300AK066351GCAGCCCATTAConserved hypothetical protein. 
J065138J21GCAGCCCATTANONE 
Os04g0495800003-009-C11GCCCATTANONE 
AK060753GCCCATTANONE 
Os04g0498700AK059661AGCCCATTAHaem peroxidase family protein. 
AK121011AGCCCATTANONE 
Os04g0504600J065162K24TAATGGGCCGCNONE 
Os04g0542900AK068610TCGGCCCATTAConserved hypothetical protein. 
Os04g0551800016-049-G12TAATGGGCTGGGCTNONE 
AK121568TAATGGGCTGGGCTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06TAATGGGCTGGGCTNONE 
J013111B11TAATGGGCTGGGCTNONE 
J013121H23TAATGGGCTGGGCTNONE 
J023012A17TAATGGGCTGGGCTNONE 
J023092M05TAATGGGCTGGGCTNONE 
J033026P14TAATGGGCTGGGCTNONE 
J033033C10TAATGGGCTGGGCTNONE 
J033033M10TAATGGGCTGGGCTNONE 
J033035C24TAATGGGCTGGGCTNONE 
J033052E19TAATGGGCTGGGCTNONE 
J033140K19TAATGGGCTGGGCTNONE 
J065036F18TAATGGGCTGGGCTNONE 
J065067L12TAATGGGCTGGGCTNONE 
J065095G09TAATGGGCTGGGCTNONE 
J065115B08TAATGGGCTGGGCTNONE 
J065218E24TAATGGGCTGGGCTNONE 
J090002N13TAATGGGCTGGGCTNONE 
J090008B12TAATGGGCTGGGCTNONE 
J090016F24TAATGGGCTGGGCTNONE 
J090019H14TAATGGGCTGGGCTNONE 
J090020G20TAATGGGCTGGGCTNONE 
J090029L18TAATGGGCTGGGCTNONE 
J090057C23TAATGGGCTGGGCTNONE 
J090073H23TAATGGGCTGGGCTNONE 
J090081C16TAATGGGCTGGGCTNONE 
J090081E21TAATGGGCTGGGCTNONE 
J090084L14TAATGGGCTGGGCTNONE 
J090086M01TAATGGGCTGGGCTNONE 
J090089E16TAATGGGCTGGGCTNONE 
J100031P12TAATGGGCTGGGCTNONE 
J100090N23TAATGGGCTGGGCTNONE 
Os04g0555900009-154-G03GAGGCCCATTANONE 
AK063168GAGGCCCATTAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11GAGGCCCATTANONE 
Os04g0592500AK066893TAATGGGCCAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TAATGGGCCAANONE 
Os04g0597900J065038C09GAGGCCCATTANONE 
J065059G21GAGGCCCATTANONE 
J065079G06GAGGCCCATTAConserved hypothetical protein. 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0634500AK071656AAAGCCCATTASimilar to S-receptor kinase-like protein 2. 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0636400006-064-G07GAGGCCCATTANONE 
006-097-D05GAGGCCCATTANONE 
AK061848GAGGCCCATTASimilar to Senescence-associated protein 6. 
AK099573GAGGCCCATTANONE 
J013035J20GAGGCCCATTANONE 
Os04g0658300AK067399ATTTGGGCCCATTASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
AK067399TAATGGGCCGGTSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0665000009-149-A12GCCCATTANONE 
AK062995GCCCATTACHCH domain containing protein. 
J065017G19GCCCATTANONE 
J080301G12GCCCATTANONE 
Os04g0674100J080097J12TAATGGGCCGAGThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965CTCGGCCCATTANONE 
AK103795CTCGGCCCATTACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14CTCGGCCCATTANONE 
J065020P20CTCGGCCCATTANONE 
J065057I21CTCGGCCCATTANONE 
J065059P11CTCGGCCCATTANONE 
J065083A22CTCGGCCCATTANONE 
J065093K10CTCGGCCCATTANONE 
J065097D03CTCGGCCCATTANONE 
J065103P05CTCGGCCCATTANONE 
J065113K09CTCGGCCCATTANONE 
J065118F23CTCGGCCCATTANONE 
J065119M06CTCGGCCCATTANONE 
J065146K17CTCGGCCCATTANONE 
J065161N12CTCGGCCCATTANONE 
J065169L02CTCGGCCCATTANONE 
J065189H12CTCGGCCCATTANONE 
J065192E24CTCGGCCCATTANONE 
J065193K17CTCGGCCCATTANONE 
J065197O21CTCGGCCCATTANONE 
J065214D09CTCGGCCCATTANONE 
J065217B11CTCGGCCCATTANONE 
J075132K07CTCGGCCCATTANONE 
J100059D14CTCGGCCCATTANONE 
Os04g0678800AK072212CTGGCCCATTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065CTGGCCCATTANONE 
Os05g0122900009-052-C11TAATGGGCCGCNONE 
009-132-C12TAATGGGCCGCNONE 
014-091-G03TAATGGGCCGCNONE 
AB072977TAATGGGCCGCNONE 
AK071296TAATGGGCCGCNONE 
AK099375TAATGGGCCGCNONE 
AK104970TAATGGGCCGCBLE1 protein. 
J065007I09TAATGGGCCGCNONE 
J065081H07TAATGGGCCGCNONE 
J065122B18TAATGGGCCGCNONE 
J065181G15TAATGGGCCGCNONE 
J065182J07TAATGGGCCGCNONE 
J065197D23TAATGGGCCGCNONE 
J065197G08TAATGGGCCGCNONE 
J065201H20TAATGGGCCGCNONE 
J090034E11TAATGGGCCGCNONE 
J100077M04TAATGGGCCGCNONE 
Os05g0128100009-051-B07TAATGGGCTTCNONE 
009-127-B08TAATGGGCTTCNONE 
009-144-H03TAATGGGCTTCNONE 
009-176-B05TAATGGGCTTCNONE 
AK108556TAATGGGCTTCNONE 
AK119308TAATGGGCTTCNONE 
AK120934TAATGGGCTTCConserved hypothetical protein. 
J023036J15TAATGGGCTTCNONE 
J065122L01TAATGGGCTTCNONE 
J075104P10TAATGGGCTTCNONE 
Os05g0168400006-039-A06TAATGGGCCAANONE 
AK069800TAATGGGCCAANONE 
AK106195TAATGGGCCAAConserved hypothetical protein. 
J065086N09TAATGGGCCAANONE 
J065137B10TAATGGGCCAANONE 
J075062B04TAATGGGCCAANONE 
J075193I07TAATGGGCCAANONE 
J075193K24TAATGGGCCAANONE 
J075194D10TAATGGGCCAANONE 
J100037F01TAATGGGCCAANONE 
J100071E09TAATGGGCCAANONE 
Os05g0169400AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0182800AK121273TAATGGGCCAAGTGGCCCAATGlutamyl-tRNA synthetase, class Ic family protein. 
AK121273TAATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0295900AK069962TAGGCCCATTAGCCCAAACConserved hypothetical protein. 
Os05g0327000014-005-A12GAGGCCCATTANONE 
AK064059GAGGCCCATTACyclin-like domain containing protein. 
AK101588GAGGCCCATTANONE 
J033051A05GAGGCCCATTANONE 
J065106E02GAGGCCCATTANONE 
J065183D01GAGGCCCATTANONE 
Os05g0363600AK108572TAATGGGCCTConserved hypothetical protein. 
AK108572TAATGGGCTTCConserved hypothetical protein. 
Os05g0367100AK108334TAATGGGCCTCConserved hypothetical protein. 
Os05g0392300AK062401TAATGGGCNONE 
Os05g0417200AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0452600009-022-A05AAGGCCCATTANONE 
009-166-F05AAGGCCCATTANONE 
AK121541AAGGCCCATTASimilar to Ribosomal protein L33. 
J033031N19AAGGCCCATTANONE 
Os05g0459400AK104040GCCCATTANONE 
Os05g0480700AK100850TAATGGGCTSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11TAATGGGCTNONE 
Os05g0481600009-067-H08TACGGCCCATTANONE 
009-085-H10TACGGCCCATTANONE 
009-147-F04TACGGCCCATTANONE 
AK063820TACGGCCCATTAConserved hypothetical protein. 
AK121540TACGGCCCATTANONE 
J023027H12TACGGCCCATTANONE 
J033031M01TACGGCCCATTANONE 
J053031M02TACGGCCCATTANONE 
Os05g0520200006-031-F07TACGGCCCACTGGCCCATTANONE 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
AK099433TACGGCCCACTGGCCCATTANONE 
Os05g0526300AK099438GAAGCCCATTANONE 
Os05g0558000015-029-G05TAATGGGCCTGACTGGGCCTGANONE 
AK073857TAATGGGCCTGACTGGGCCTGARibosomal protein L1 family protein. 
J033074P11TAATGGGCCTGACTGGGCCTGANONE 
J090060I16TAATGGGCCTGACTGGGCCTGANONE 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043006N08GAAGCCCACGGCCCATTANONE 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os05g0587400AK102121GCCCATTAPrefoldin domain containing protein. 
J033084N12GCCCATTANONE 
Os05g0593100AK061855TTCGGCCCATTANONE 
AK100119TTCGGCCCATTASimilar to Vacuolar ATP synthase subunit C (EC 3.6.3.14) (V-ATPase C subunit) (Vacuolar proton pump C subunit). 
AY224442TTCGGCCCATTANONE 
Os05g0596600AK107823TCAGGCCCATTANONE 
AK121149TCAGGCCCATTASimilar to SMC5 protein. 
Os06g0116400006-082-G06AGCCCATTANONE 
AK058327AGCCCATTANONE 
AK105979AGCCCATTAHigh-affinity nickel-transporter family protein. 
J065083I24AGCCCATTANONE 
J100072O18AGCCCATTANONE 
Os06g0168400AK109865GCCCATTAConserved hypothetical protein. 
J065035K18GCCCATTANONE 
J065050N10GCCCATTANONE 
Os06g0304500AK119441CCAGCCCATTACRS1/YhbY domain containing protein. 
AK119441GAAGCCCATTAAGGCCCACTCRS1/YhbY domain containing protein. 
J075143M24CCAGCCCATTANONE 
J075143M24GAAGCCCATTAAGGCCCACTNONE 
J075194D03CCAGCCCATTANONE 
J075194D03GAAGCCCATTAAGGCCCACTNONE 
Os06g0325500011-037-D06TAATGGGCCAGNONE 
011-093-G07TAATGGGCCAGNONE 
AK063974TAATGGGCCAGProtein of unknown function DUF89 family protein. 
AK099286TAATGGGCCAGNONE 
J065124G18TAATGGGCCAGNONE 
J065160K08TAATGGGCCAGNONE 
J065207O08TAATGGGCCAGNONE 
J075011D18TAATGGGCCAGNONE 
J075012D02TAATGGGCCAGNONE 
J075090F13TAATGGGCCAGNONE 
J075164A04TAATGGGCCAGNONE 
J075198I19TAATGGGCCAGNONE 
Os06g0607900AK070879TAATGGGCCATNONE 
Os06g0616900AK107912TGCGGCCCATTAConserved hypothetical protein. 
Os06g0646600AB061818ATATGGGCCCATTAKNOX family class 2 homeodomain protein. 
J023088C09ATATGGGCCCATTANONE 
J065162G03ATATGGGCCCATTANONE 
Os06g0667600AK058606AAAAGCCCATTANONE 
AK071621AAAAGCCCATTASimilar to Glycine decarboxylase complex H-protein. 
J023101D03AAAAGCCCATTANONE 
J033095E17AAAAGCCCATTANONE 
J065020B16AAAAGCCCATTANONE 
Os06g0715000AK107114TAATGGGCCGGAConserved hypothetical protein. 
Os06g0725400J065086O07TCAGGCCCATTASimilar to BLE1 protein. 
J065114J19TCAGGCCCATTANONE 
Os07g0123000AK070836GCCCATTAGGCCCACAACyclin-like F-box domain containing protein. 
Os07g0130500AK066085TAATGGGCTNONE 
AK068045TAATGGGCTNONE 
J013050A21TAATGGGCTNONE 
Os07g0154300009-070-E08TAATGGGCCATNONE 
009-077-E01TAATGGGCCATNONE 
009-196-F05TAATGGGCCATNONE 
AK105386TAATGGGCCATConserved hypothetical protein. 
AK122093TAATGGGCCATNONE 
J033124K14TAATGGGCCATNONE 
J075006I22TAATGGGCCATNONE 
J075185G02TAATGGGCCATNONE 
J090039C02TAATGGGCCATNONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
006-049-G04TACGGCCCATTANONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188TACGGCCCATTANONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773TACGGCCCATTANONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16TACGGCCCATTANONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22TACGGCCCATTANONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02TACGGCCCATTANONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03TACGGCCCATTANONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08TACGGCCCATTANONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05TACGGCCCATTANONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10TACGGCCCATTANONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13TACGGCCCATTANONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08TACGGCCCATTANONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21TACGGCCCATTANONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02TACGGCCCATTANONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21TACGGCCCATTANONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17TACGGCCCATTANONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04TACGGCCCATTANONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17TACGGCCCATTANONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14TACGGCCCATTANONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12TACGGCCCATTANONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16TACGGCCCATTANONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23TACGGCCCATTANONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22TACGGCCCATTANONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04TACGGCCCATTANONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06TACGGCCCATTANONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14TACGGCCCATTANONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09TACGGCCCATTANONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18TACGGCCCATTANONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10TACGGCCCATTANONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05TACGGCCCATTANONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22TACGGCCCATTANONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17TACGGCCCATTANONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18TACGGCCCATTANONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02TACGGCCCATTANONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06TACGGCCCATTANONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05TACGGCCCATTANONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15TACGGCCCATTANONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04TACGGCCCATTANONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20TACGGCCCATTANONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14TACGGCCCATTANONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05TACGGCCCATTANONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08TACGGCCCATTANONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07TACGGCCCATTANONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04TACGGCCCATTANONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15TACGGCCCATTANONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07TACGGCCCATTANONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22TACGGCCCATTANONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20TACGGCCCATTANONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22TACGGCCCATTANONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09TACGGCCCATTANONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04TACGGCCCATTANONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09TACGGCCCATTANONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13TACGGCCCATTANONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18TACGGCCCATTANONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10TACGGCCCATTANONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06TACGGCCCATTANONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21TACGGCCCATTANONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19TACGGCCCATTANONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0189400AK106788TAATGGGCTCyclin-like F-box domain containing protein. 
Os07g0202100AK101736TAATGGGCCTCSimilar to ATP-dependent RNA helicase ded1. 
Os07g0213600AK107696CACGGCCCATTAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09CACGGCCCATTANONE 
J100082J05CACGGCCCATTANONE 
Os07g0224000009-060-E01GCCCGGCCCATTANONE 
J065042D20GCCCGGCCCATTANONE 
J065127D14GCCCGGCCCATTANONE 
J065176C24GCCCGGCCCATTANONE 
J065188M12GCCCGGCCCATTANONE 
J065194L14GCCCGGCCCATTANONE 
J075060P09GCCCGGCCCATTANONE 
J075134C14GCCCGGCCCATTARibosomal protein L24E family protein. 
J075192M12GCCCGGCCCATTANONE 
J100032N01GCCCGGCCCATTANONE 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0435400AK111603TAATGGGCCTCSimilar to WD40. 
Os07g0515700AK103117TAATGGGCCTCAnkyrin repeat containing protein. 
Os07g0543000AB110196TCAGCCCATTANONE 
AK058889TCAGCCCATTASimilar to Helix-loop-helix-like protein (Fragment). 
Os07g0546700009-110-H10TAATGGGCCCGNONE 
AK058262TAATGGGCCCGNONE 
J065154I05TAATGGGCCCGNONE 
J065175P09TAATGGGCCCGNONE 
J065187F11TAATGGGCCCGNONE 
J075114K16TAATGGGCCCGNONE 
J090031L21TAATGGGCCCGNONE 
U86017TAATGGGCCCGSimilar to 60S ribosomal protein L38. 
Os07g0558200AK065243TAATGGGCCAAInositol monophosphatase family protein. 
Os07g0568900009-083-H02TAATGGGCCTTATTGGGCTTANONE 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0570700AK065242AAACGGCCCATTARibosome recycling factor family protein. 
J013002I12AAACGGCCCATTANONE 
Os07g0614000015-078-C05TAATGGGCNONE 
AK069163TAATGGGCNONE 
AK109489TAATGGGCStrictosidine synthase family protein. 
J065123D15TAATGGGCNONE 
J065124L12TAATGGGCNONE 
J065180F02TAATGGGCNONE 
J075143N04TAATGGGCNONE 
J080014B10TAATGGGCNONE 
J080026L16TAATGGGCNONE 
J080044H09TAATGGGCNONE 
J080071M17TAATGGGCNONE 
Os07g0681600AK073504TAATGGGCTATP-dependent DNA helicase RecQ family protein. 
Os08g0112800009-113-D03AAGGCCCATTANONE 
AK121176AAGGCCCATTARickettsia 17 kDa surface antigen family protein. 
J023083C18AAGGCCCATTANONE 
J033074M10AAGGCCCATTANONE 
J033097G10AAGGCCCATTANONE 
J065090F05AAGGCCCATTANONE 
J090001J03AAGGCCCATTANONE 
J090044F23AAGGCCCATTANONE 
J090078H09AAGGCCCATTANONE 
J100088G23AAGGCCCATTANONE 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0155100AK069865GCCCATTAMajor sperm protein domain containing protein. 
AK104886GCCCATTANONE 
J013089M01GCCCATTANONE 
J023037M15GCCCATTANONE 
J033068E03GCCCATTANONE 
J090021P19GCCCATTANONE 
Os08g0176800AK111670GCCCATTASimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
J013030D15GCCCATTANONE 
J013157K01GCCCATTANONE 
J023108A20GCCCATTANONE 
J033125F09GCCCATTANONE 
Os08g0178100AK101717TAATGGGCCAGAPep3/Vps18/deep orange domain containing protein. 
Os08g0258200AK067289GCCCATTAZinc finger, RING-type domain containing protein. 
AK120159GCCCATTANONE 
Os08g0363000015-090-A07TAATGGGCCTCCGGCCCGGTNONE 
AK103677TAATGGGCCTCCGGCCCGGTNONE 
AK106532TAATGGGCCTCCGGCCCGGTProtein of unknown function DUF295 family protein. 
J033136B21TAATGGGCCTCCGGCCCGGTNONE 
J033136E01TAATGGGCCTCCGGCCCGGTNONE 
J043029N11TAATGGGCCTCCGGCCCGGTNONE 
J065071G13TAATGGGCCTCCGGCCCGGTNONE 
J065105J22TAATGGGCCTCCGGCCCGGTNONE 
J075084B18TAATGGGCCTCCGGCCCGGTNONE 
Os08g0375800AK101199TAATGGGCCACProtein prenyltransferase domain containing protein. 
J033030L22TAATGGGCCACNONE 
Os08g0387200AK120787TAATGGGCTGCProtein of unknown function DUF81 family protein. 
Os08g0438400Os08g0438400CAGGCCCATTAZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein. 
Os08g0440500AK058761CCACGGCCCATTAMIR domain containing protein. 
Os08g0485700AK068131TAATGGGCCGAGNONE 
AK069097TAATGGGCCGAGMethyl-CpG binding domain containing protein. 
J013130L03TAATGGGCCGAGNONE 
Os08g0496400AK110964ACAGCCCATTAConserved hypothetical protein. 
Os08g0517900015-019-D06AAAAGCCCATTACGGCCCACACNONE 
015-019-D06CAAGCCCATTANONE 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
AK064304CAAGCCCATTASimilar to 30S ribosomal protein S16. 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os08g0530200009-166-A09AGCCCACAATAATGGGCCAGNONE 
AK062052AGCCCACAATAATGGGCCAGNONE 
AK120448AGCCCACAATAATGGGCCAGSimilar to 60S ribosomal protein L17. 
J013100M19AGCCCACAATAATGGGCCAGNONE 
J023045K22AGCCCACAATAATGGGCCAGNONE 
J033046D13AGCCCACAATAATGGGCCAGNONE 
J033066N01AGCCCACAATAATGGGCCAGNONE 
J033143N05AGCCCACAATAATGGGCCAGNONE 
J053070P13AGCCCACAATAATGGGCCAGNONE 
J065011C18AGCCCACAATAATGGGCCAGNONE 
J065013C23AGCCCACAATAATGGGCCAGNONE 
J065016B09AGCCCACAATAATGGGCCAGNONE 
J065016C21AGCCCACAATAATGGGCCAGNONE 
J065023K18AGCCCACAATAATGGGCCAGNONE 
J065028F12AGCCCACAATAATGGGCCAGNONE 
J065030L02AGCCCACAATAATGGGCCAGNONE 
J065042H15AGCCCACAATAATGGGCCAGNONE 
J065078H02AGCCCACAATAATGGGCCAGNONE 
J065092D07AGCCCACAATAATGGGCCAGNONE 
J065092E01AGCCCACAATAATGGGCCAGNONE 
J065104M21AGCCCACAATAATGGGCCAGNONE 
J065119P21AGCCCACAATAATGGGCCAGNONE 
J065124B15AGCCCACAATAATGGGCCAGNONE 
J065146H09AGCCCACAATAATGGGCCAGNONE 
J065149L09AGCCCACAATAATGGGCCAGNONE 
J065156A09AGCCCACAATAATGGGCCAGNONE 
J065157H23AGCCCACAATAATGGGCCAGNONE 
J065165L14AGCCCACAATAATGGGCCAGNONE 
J065165M18AGCCCACAATAATGGGCCAGNONE 
J065172O03AGCCCACAATAATGGGCCAGNONE 
J065192M18AGCCCACAATAATGGGCCAGNONE 
J065198D21AGCCCACAATAATGGGCCAGNONE 
J065200D05AGCCCACAATAATGGGCCAGNONE 
J065202B20AGCCCACAATAATGGGCCAGNONE 
J065212P11AGCCCACAATAATGGGCCAGNONE 
J065215E08AGCCCACAATAATGGGCCAGNONE 
J065217P19AGCCCACAATAATGGGCCAGNONE 
J075005I19AGCCCACAATAATGGGCCAGNONE 
J075134J06AGCCCACAATAATGGGCCAGNONE 
J075162G12AGCCCACAATAATGGGCCAGNONE 
J075178H07AGCCCACAATAATGGGCCAGNONE 
J075186K01AGCCCACAATAATGGGCCAGNONE 
J080315I17AGCCCACAATAATGGGCCAGNONE 
J080318P19AGCCCACAATAATGGGCCAGNONE 
J090004H16AGCCCACAATAATGGGCCAGNONE 
J090020A16AGCCCACAATAATGGGCCAGNONE 
J090047J12AGCCCACAATAATGGGCCAGNONE 
J090080E07AGCCCACAATAATGGGCCAGNONE 
J090090H23AGCCCACAATAATGGGCCAGNONE 
J100021G24AGCCCACAATAATGGGCCAGNONE 
J100037L04AGCCCACAATAATGGGCCAGNONE 
J100043L09AGCCCACAATAATGGGCCAGNONE 
J100044A10AGCCCACAATAATGGGCCAGNONE 
Os08g0542100AK058490TAATGGGCCTARibosomal protein L7, eukaryotic form family protein. 
AK101416TAATGGGCCTANONE 
J033037N08TAATGGGCCTANONE 
J033086B16TAATGGGCCTANONE 
J043036J02TAATGGGCCTANONE 
J065137E02TAATGGGCCTANONE 
J090015L07TAATGGGCCTANONE 
J100036D02TAATGGGCCTANONE 
Os08g0546300AK064717ATGGCCCATTAConserved hypothetical protein. 
AK119794ATGGCCCATTANONE 
D10982ATGGCCCATTANONE 
J080044B21ATGGCCCATTANONE 
Os09g0347900AK071224TGCGGCCCATTAConserved hypothetical protein. 
J023087B12TGCGGCCCATTANONE 
Os09g0355400AK105685ATTTGGGCCCATTANONE 
Os09g0411700005-017-C05TCTGGCCCATTANONE 
009-163-B01TCTGGCCCATTANONE 
AK058290TCTGGCCCATTAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919TCTGGCCCATTANONE 
AK121091TCTGGCCCATTANONE 
J013039D20TCTGGCCCATTANONE 
J023066F16TCTGGCCCATTANONE 
J023082H09TCTGGCCCATTANONE 
J023088H05TCTGGCCCATTANONE 
J065013G09TCTGGCCCATTANONE 
J065065C12TCTGGCCCATTANONE 
J065111I04TCTGGCCCATTANONE 
J065179H22TCTGGCCCATTANONE 
J075023N14TCTGGCCCATTANONE 
J090041J17TCTGGCCCATTANONE 
J100031J21TCTGGCCCATTANONE 
J100057A18TCTGGCCCATTANONE 
J100068P22TCTGGCCCATTANONE 
Os09g0433650J075094M19TAATGGGCCATTobacco mosaic virus coat protein family protein. 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0460400009-057-E06GCCCATTANONE 
AK067180GCCCATTAEsterase/lipase/thioesterase domain containing protein. 
J013094M19GCCCATTANONE 
J090050O05GCCCATTANONE 
Os09g0464000AK060777TAATGGGCCCCAGNONE 
AK069530TAATGGGCCCCAGSimilar to Carbonate dehydratase-like protein. 
Os09g0467700AK061600TGCGGCCCATTAConserved hypothetical protein. 
Os09g0485800AK108749TTGGCCCATTAConserved hypothetical protein. 
J065137H03TTGGCCCATTANONE 
Os09g0497400AK058354TAATGGGCCTCNONE 
AK068677TAATGGGCCTCProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19TAATGGGCCTCNONE 
J023011D22TAATGGGCCTCNONE 
J023081K05TAATGGGCCTCNONE 
J033060O14TAATGGGCCTCNONE 
J075020I08TAATGGGCCTCNONE 
J075034J03TAATGGGCCTCNONE 
J075049M15TAATGGGCCTCNONE 
J075065K02TAATGGGCCTCNONE 
J075099L06TAATGGGCCTCNONE 
Os09g0537600006-054-B05TAATGGGCCATNONE 
AK061004TAATGGGCCATSimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20TAATGGGCCATNONE 
J075029H16TAATGGGCCATNONE 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK101798TAATGGGCTAATGGGCCTCNONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
AK103397TAATGGGCTAATGGGCCTCSimilar to WD-40 repeat protein MSI1. 
Os09g0549700J053039F06TAATGGGCTTTCGGCCCATGTNONE 
J065089F23TAATGGGCTTTCGGCCCATGTRibosomal protein L18P/L5E family protein. 
J065090G14TAATGGGCTTTCGGCCCATGTNONE 
J065093M17TAATGGGCTTTCGGCCCATGTNONE 
J065096L23TAATGGGCTTTCGGCCCATGTNONE 
J065152A18TAATGGGCTTTCGGCCCATGTNONE 
J065155H12TAATGGGCTTTCGGCCCATGTNONE 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os09g0560400Os09g0560400GCCCATTAConserved hypothetical protein. 
Os09g0571400AK103109AGCCCATTAAGCCCATTCyclophilin 1. 
J023011A12AGCCCATTAAGCCCATTNONE 
J033119A20AGCCCATTAAGCCCATTNONE 
J053034N16AGCCCATTAAGCCCATTNONE 
J053045N23AGCCCATTAAGCCCATTNONE 
J053052J12AGCCCATTAAGCCCATTNONE 
J053052K04AGCCCATTAAGCCCATTNONE 
J053099M15AGCCCATTAAGCCCATTNONE 
J065071H23AGCCCATTAAGCCCATTNONE 
J065131B16AGCCCATTAAGCCCATTNONE 
J075003F19AGCCCATTAAGCCCATTNONE 
J075116F02AGCCCATTAAGCCCATTNONE 
J075126G05AGCCCATTAAGCCCATTNONE 
J075145E09AGCCCATTAAGCCCATTNONE 
J075149O22AGCCCATTAAGCCCATTNONE 
J075163A09AGCCCATTAAGCCCATTNONE 
J075194A09AGCCCATTAAGCCCATTNONE 
L29471AGCCCATTAAGCCCATTNONE 
Os11g0111200AK109277TAATGGGCCCTConserved hypothetical protein. 
Os11g0157100012-010-F03TAATGGGCCGGGNONE 
J013028H01TAATGGGCCGGGNONE 
J013061L19TAATGGGCCGGGNONE 
J033044L03TAATGGGCCGGGNONE 
J033064P09TAATGGGCCGGGNONE 
J033076A10TAATGGGCCGGGNONE 
J033076K22TAATGGGCCGGGNONE 
J033084J05TAATGGGCCGGGNONE 
J033145A22TAATGGGCCGGGNONE 
J033148L19TAATGGGCCGGGNONE 
J065027P20TAATGGGCCGGGNONE 
J065085D16TAATGGGCCGGGNONE 
J065091L03TAATGGGCCGGGNONE 
J065195C18TAATGGGCCGGGNONE 
J090018N23TAATGGGCCGGGNONE 
J090048A10TAATGGGCCGGGNONE 
J090048M03TAATGGGCCGGGNONE 
J090066L11TAATGGGCCGGGNONE 
J090075G16TAATGGGCCGGGNONE 
J090083G23TAATGGGCCGGGNONE 
J090087E24TAATGGGCCGGGNONE 
J090096H16TAATGGGCCGGGNONE 
Os11g0167300AK071335TAATGGGCCGCProtein of unknown function DUF537 family protein. 
AK101314TAATGGGCCGCNONE 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0199600AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein. 
AK120040TCGGCCCATTAACGGCCCACGTNONE 
J023047I06TCGGCCCATTAACGGCCCACGTNONE 
J033064L23TCGGCCCATTAACGGCCCACGTNONE 
J033117I01TCGGCCCATTAACGGCCCACGTNONE 
J033123I18TCGGCCCATTAACGGCCCACGTNONE 
J053026H17TCGGCCCATTAACGGCCCACGTNONE 
J053078G05TCGGCCCATTAACGGCCCACGTNONE 
J065102A09TCGGCCCATTAACGGCCCACGTNONE 
J065113G11TCGGCCCATTAACGGCCCACGTNONE 
J065207F20TCGGCCCATTAACGGCCCACGTNONE 
J075027K21TCGGCCCATTAACGGCCCACGTNONE 
Os11g0227600AK101375TAATGGGCTTAGCGTGGGCCGGAConserved hypothetical protein. 
AK102193TAATGGGCTTAGCGTGGGCCGGANONE 
J033087C03TAATGGGCTTAGCGTGGGCCGGANONE 
Os11g0231400AK108047TAATGGGCTTCProtein of unknown function DUF295 family protein. 
Os11g0425800AK066603TTGGCCCATTASimilar to 60S ribosomal protein L13a. 
J065063A20TTGGCCCATTANONE 
J075021H08TTGGCCCATTANONE 
J075058J10TTGGCCCATTANONE 
J075088B15TTGGCCCATTANONE 
J075099E15TTGGCCCATTANONE 
J075110F13TTGGCCCATTANONE 
J075150G18TTGGCCCATTANONE 
J080312E14TTGGCCCATTANONE 
Os11g0570400AK070108TAATGGGCConserved hypothetical protein. 
J023027D04TAATGGGCNONE 
J023045F18TAATGGGCNONE 
Os11g0584100AK069971GCCCATTANONE 
AK106960GCCCATTAProtein of unknown function DUF295 family protein. 
J065029I16GCCCATTANONE 
J075075K05GCCCATTANONE 
Os11g0602600006-046-H02TAATGGGCCGAGANONE 
006-056-H08TAATGGGCCGAGANONE 
009-116-D05TAATGGGCCGAGANONE 
AK072671TAATGGGCCGAGASimilar to 40S ribosomal protein S9. 
AK104660TAATGGGCCGAGANONE 
J023134P20TAATGGGCCGAGANONE 
J023141O13TAATGGGCCGAGANONE 
J033066I15TAATGGGCCGAGANONE 
J033076A08TAATGGGCCGAGANONE 
J033150J23TAATGGGCCGAGANONE 
J065114P19TAATGGGCCGAGANONE 
J065176B01TAATGGGCCGAGANONE 
J065207H21TAATGGGCCGAGANONE 
J080301L21TAATGGGCCGAGANONE 
J080308A08TAATGGGCCGAGANONE 
J080318K23TAATGGGCCGAGANONE 
J080319F17TAATGGGCCGAGANONE 
J080319I10TAATGGGCCGAGANONE 
J090028C08TAATGGGCCGAGANONE 
J090051I24TAATGGGCCGAGANONE 
J090053L21TAATGGGCCGAGANONE 
J090069C20TAATGGGCCGAGANONE 
J100017G08TAATGGGCCGAGANONE 
J100042B06TAATGGGCCGAGANONE 
J100045G24TAATGGGCCGAGANONE 
J100050J19TAATGGGCCGAGANONE 
J100052D23TAATGGGCCGAGANONE 
J100053M03TAATGGGCCGAGANONE 
J100056D08TAATGGGCCGAGANONE 
J100066B19TAATGGGCCGAGANONE 
J100071N23TAATGGGCCGAGANONE 
J100074H01TAATGGGCCGAGANONE 
J100074H19TAATGGGCCGAGANONE 
J100077C06TAATGGGCCGAGANONE 
Os11g0642100AK107010TAATGGGCCCAGCCCCyclin-like F-box domain containing protein. 
Os12g0120400AK099904TAATGGGCCTGASimilar to ATPase-like protein. 
J065169A07TAATGGGCCTGANONE 
Os12g0193800AK111754GCCCATTAConserved hypothetical protein. 
Os12g0279600AK070295CTCGGCCCATTAExodeoxyribonuclease III xth family protein. 
Os12g0407100J075130F11GCCCATTANONE 
J075150G14GCCCATTAConserved hypothetical protein. 
J090089B20GCCCATTANONE 
J100042D22GCCCATTANONE 
Os12g0481100AK073151CCCGGCCCATTASimilar to RNA helicase. 
Os12g0508300009-006-G07AAAAGCCCATTANONE 
009-133-E05AAAAGCCCATTANONE 
009-137-F10AAAAGCCCATTANONE 
014-024-A06AAAAGCCCATTANONE 
AK059123AAAAGCCCATTARibosomal protein S14 family protein. 
J100088E22AAAAGCCCATTANONE 
Os12g0540000AK108630TAATGGGCTTGGGCTConserved hypothetical protein. 
J065046N02TAATGGGCTTGGGCTNONE 
J065100H24TAATGGGCTTGGGCTNONE 
J065142M24TAATGGGCTTGGGCTNONE 
Os12g0592200Os12g0592200TAATGGGCCGGAConserved hypothetical protein. 
Os12g0605900AK109696AGGGCCCATGGGCCCTGGCCCATTASimilar to Kinase like protein. 
Os12g0611000AK111837GCCGGCCCATTASimilar to Zinc-finger protein Lsd1. 
Os12g0624800AK103828TAATGGGCCTGGHypothetical protein. 
Os12g0634600009-019-G12TAATGGGCTTCNONE 
AK070357TAATGGGCTTCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.