version

Summary of OsREG611 (All List)

OrganismOryza sativa  
IDOsREG611  
SequenceGCCCCACA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1907  

Entry Sequences (1907 entries)

LocusGene modelSequenceDescription
Os01g0138900AK058378TGTGGGGCCCAGTAMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE 
006-081-C11CCCGTGGGCCCCACACNONE 
009-050-D04CCCGTGGGCCCCACACNONE 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18CCCGTGGGCCCCACACNONE 
J023112H22CCCGTGGGCCCCACACNONE 
J065048P05CCCGTGGGCCCCACACNONE 
J100068N20CCCGTGGGCCCCACACNONE 
J100073A02CCCGTGGGCCCCACACNONE 
Os01g0158900AK059497GCCCCACANONE 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0254900AK068204CGTGTGGGGCCCGGASimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530CGTGTGGGGCCCGGANONE 
Os01g0270300006-026-A05GCCCCACANONE 
AK060365GCCCCACANONE 
AK101508GCCCCACASimilar to Cationic peroxidase isozyme 40K precursor. 
AK103467GCCCCACANONE 
J033084K19GCCCCACANONE 
J033105B06GCCCCACANONE 
J100043C10GCCCCACANONE 
Os01g0272600015-046-G06CTCGGCCCCACACNONE 
AK067786CTCGGCCCCACACConserved hypothetical protein. 
Os01g0273800AK109645GGCCCCACAFAD dependent oxidoreductase family protein. 
Os01g0281100AK109672TGTGGGGCCConserved hypothetical protein. 
J065013K07TGTGGGGCCNONE 
J065040E15TGTGGGGCCNONE 
J065127F12TGTGGGGCCNONE 
J075155K23TGTGGGGCCNONE 
Os01g0327500AK107756TGTGGGGCCCACTConserved hypothetical protein. 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0379101J075055E21GCCCCACAConserved hypothetical protein. 
J075189O12GCCCCACANONE 
Os01g0501800006-021-B07GCCCCACANONE 
006-021-E12GCCCCACANONE 
006-022-B08GCCCCACANONE 
006-022-C09GCCCCACANONE 
006-022-C12GCCCCACANONE 
006-022-F10GCCCCACANONE 
006-023-A09GCCCCACANONE 
006-023-D02GCCCCACANONE 
006-023-E06GCCCCACANONE 
006-023-E11GCCCCACANONE 
006-025-A01GCCCCACANONE 
006-025-B07GCCCCACANONE 
006-025-F04GCCCCACANONE 
006-025-F11GCCCCACANONE 
006-027-F05GCCCCACANONE 
006-028-C02GCCCCACANONE 
006-029-B01GCCCCACANONE 
006-029-D09GCCCCACANONE 
006-029-G02GCCCCACANONE 
006-029-H08GCCCCACANONE 
006-030-A02GCCCCACANONE 
006-030-B05GCCCCACANONE 
006-031-A01GCCCCACANONE 
006-032-E09GCCCCACANONE 
006-032-G10GCCCCACANONE 
006-032-H11GCCCCACANONE 
006-033-B08GCCCCACANONE 
006-033-E11GCCCCACANONE 
006-034-H01GCCCCACANONE 
006-035-B09GCCCCACANONE 
006-035-D08GCCCCACANONE 
006-036-F01GCCCCACANONE 
006-036-G01GCCCCACANONE 
006-037-E12GCCCCACANONE 
006-039-D07GCCCCACANONE 
006-040-A03GCCCCACANONE 
006-042-G11GCCCCACANONE 
006-044-F11GCCCCACANONE 
006-045-H04GCCCCACANONE 
006-046-A09GCCCCACANONE 
006-046-C12GCCCCACANONE 
006-046-F10GCCCCACANONE 
006-046-H08GCCCCACANONE 
006-047-G05GCCCCACANONE 
006-047-G06GCCCCACANONE 
006-048-C05GCCCCACANONE 
006-049-A07GCCCCACANONE 
006-049-E03GCCCCACANONE 
006-050-D08GCCCCACANONE 
006-050-E02GCCCCACANONE 
006-050-E07GCCCCACANONE 
006-050-F11GCCCCACANONE 
006-051-D04GCCCCACANONE 
006-051-G07GCCCCACANONE 
006-052-B06GCCCCACANONE 
006-052-B11GCCCCACANONE 
006-052-C06GCCCCACANONE 
006-053-G03GCCCCACANONE 
006-054-C01GCCCCACANONE 
006-054-D09GCCCCACANONE 
006-056-B11GCCCCACANONE 
006-056-C07GCCCCACANONE 
006-056-C12GCCCCACANONE 
006-057-C05GCCCCACANONE 
006-057-E08GCCCCACANONE 
006-058-F03GCCCCACANONE 
006-059-A03GCCCCACANONE 
006-059-C12GCCCCACANONE 
006-062-A06GCCCCACANONE 
006-062-H04GCCCCACANONE 
006-063-B08GCCCCACANONE 
006-063-B10GCCCCACANONE 
006-063-D11GCCCCACANONE 
006-063-H07GCCCCACANONE 
006-065-F08GCCCCACANONE 
006-067-F07GCCCCACANONE 
006-067-G04GCCCCACANONE 
006-067-G12GCCCCACANONE 
006-068-A12GCCCCACANONE 
006-068-E08GCCCCACANONE 
006-068-H01GCCCCACANONE 
006-069-C01GCCCCACANONE 
006-069-E08GCCCCACANONE 
006-070-D05GCCCCACANONE 
006-070-E10GCCCCACANONE 
006-071-A02GCCCCACANONE 
006-072-C01GCCCCACANONE 
006-073-B07GCCCCACANONE 
006-073-D02GCCCCACANONE 
006-073-F06GCCCCACANONE 
006-075-B10GCCCCACANONE 
006-075-C01GCCCCACANONE 
006-076-E10GCCCCACANONE 
006-076-H12GCCCCACANONE 
006-077-B10GCCCCACANONE 
006-077-F12GCCCCACANONE 
006-078-C04GCCCCACANONE 
006-078-C10GCCCCACANONE 
006-078-H11GCCCCACANONE 
006-079-A05GCCCCACANONE 
006-079-C01GCCCCACANONE 
006-079-E04GCCCCACANONE 
006-079-H06GCCCCACANONE 
006-080-G05GCCCCACANONE 
006-081-C07GCCCCACANONE 
006-081-H07GCCCCACANONE 
006-082-A09GCCCCACANONE 
006-082-D02GCCCCACANONE 
006-084-B11GCCCCACANONE 
006-085-G10GCCCCACANONE 
006-086-A05GCCCCACANONE 
006-086-B05GCCCCACANONE 
006-086-F09GCCCCACANONE 
006-088-B09GCCCCACANONE 
006-088-D02GCCCCACANONE 
006-088-D10GCCCCACANONE 
006-088-F05GCCCCACANONE 
006-089-C06GCCCCACANONE 
006-092-C07GCCCCACANONE 
006-092-C08GCCCCACANONE 
006-092-G09GCCCCACANONE 
006-093-D12GCCCCACANONE 
006-093-H10GCCCCACANONE 
006-094-E07GCCCCACANONE 
006-095-G01GCCCCACANONE 
006-096-A10GCCCCACANONE 
006-097-B06GCCCCACANONE 
006-097-H12GCCCCACANONE 
006-098-A08GCCCCACANONE 
006-098-A10GCCCCACANONE 
006-098-C10GCCCCACANONE 
006-098-D02GCCCCACANONE 
006-098-F10GCCCCACANONE 
006-099-B08GCCCCACANONE 
006-099-D02GCCCCACANONE 
006-099-D05GCCCCACANONE 
006-099-G10GCCCCACANONE 
006-100-G06GCCCCACANONE 
006-102-G09GCCCCACANONE 
006-104-F06GCCCCACANONE 
006-105-A12GCCCCACANONE 
006-105-D04GCCCCACANONE 
006-105-F05GCCCCACANONE 
006-106-B01GCCCCACANONE 
006-106-D05GCCCCACANONE 
006-107-B01GCCCCACANONE 
006-107-C02GCCCCACANONE 
006-107-E01GCCCCACANONE 
006-107-G03GCCCCACANONE 
006-108-D09GCCCCACANONE 
006-109-G01GCCCCACANONE 
006-109-H07GCCCCACANONE 
006-110-C04GCCCCACANONE 
006-111-B11GCCCCACANONE 
006-112-A02GCCCCACANONE 
006-112-E03GCCCCACANONE 
006-112-H04GCCCCACANONE 
006-113-B07GCCCCACANONE 
006-113-C08GCCCCACANONE 
006-114-C12GCCCCACANONE 
006-114-D06GCCCCACANONE 
006-115-B06GCCCCACANONE 
006-116-B01GCCCCACANONE 
006-116-C02GCCCCACANONE 
006-117-B05GCCCCACANONE 
006-117-C06GCCCCACANONE 
006-117-D10GCCCCACANONE 
006-118-D04GCCCCACANONE 
006-118-E12GCCCCACANONE 
006-119-A06GCCCCACANONE 
006-119-A09GCCCCACANONE 
006-119-D02GCCCCACANONE 
006-119-G07GCCCCACANONE 
006-120-B03GCCCCACANONE 
006-120-B07GCCCCACANONE 
006-120-C01GCCCCACANONE 
006-120-E04GCCCCACANONE 
006-120-F11GCCCCACANONE 
009-014-E11GCCCCACANONE 
009-079-C06GCCCCACANONE 
009-101-H06GCCCCACANONE 
009-113-F07GCCCCACANONE 
009-126-G04GCCCCACANONE 
009-138-F01GCCCCACANONE 
009-147-H02GCCCCACANONE 
009-198-B08GCCCCACANONE 
011-011-H03GCCCCACANONE 
013-053-A06GCCCCACANONE 
AK060886GCCCCACANONE 
AK067715GCCCCACASimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
AK103920GCCCCACANONE 
AK103937GCCCCACANONE 
AK104080GCCCCACANONE 
AK104649GCCCCACANONE 
AK104760GCCCCACANONE 
AK119163GCCCCACANONE 
AK119188GCCCCACANONE 
AK119515GCCCCACANONE 
J013071M07GCCCCACANONE 
J013098E19GCCCCACANONE 
J013119C03GCCCCACANONE 
J013135O08GCCCCACANONE 
J023060H14GCCCCACANONE 
J023075M20GCCCCACANONE 
J023098P12GCCCCACANONE 
J053061C24GCCCCACANONE 
J053065C19GCCCCACANONE 
J053094K19GCCCCACANONE 
J075047M15GCCCCACANONE 
J075083H07GCCCCACANONE 
J075108K14GCCCCACANONE 
J075112B16GCCCCACANONE 
J075169L16GCCCCACANONE 
J075180P05GCCCCACANONE 
J075194D02GCCCCACANONE 
J080013D18GCCCCACANONE 
J080016G20GCCCCACANONE 
J080017E18GCCCCACANONE 
J080018J18GCCCCACANONE 
J080018N18GCCCCACANONE 
J080036G23GCCCCACANONE 
J080038O04GCCCCACANONE 
J080038P09GCCCCACANONE 
J080039N23GCCCCACANONE 
J080043F01GCCCCACANONE 
J080064J05GCCCCACANONE 
J080067C16GCCCCACANONE 
J080069B15GCCCCACANONE 
J080071H03GCCCCACANONE 
J080086L16GCCCCACANONE 
J080088H01GCCCCACANONE 
J080089B09GCCCCACANONE 
J080090K14GCCCCACANONE 
J080090N19GCCCCACANONE 
J080093H07GCCCCACANONE 
J080097B17GCCCCACANONE 
J080301J11GCCCCACANONE 
J080301K18GCCCCACANONE 
J080305K22GCCCCACANONE 
J090008D23GCCCCACANONE 
J090013H02GCCCCACANONE 
J090031N19GCCCCACANONE 
J090053G01GCCCCACANONE 
Os01g0506200AK073118CCCGGGCCCCGCCCCACATetratricopeptide-like helical domain containing protein. 
J065002A07CCCGGGCCCCGCCCCACANONE 
J065079J08CCCGGGCCCCGCCCCACANONE 
J065167M18CCCGGGCCCCGCCCCACANONE 
Os01g0532300J100019F21GCCCCACAConserved hypothetical protein. 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
J013033M01GGGTGGGCCCCACACGNONE 
J013159H24GGGTGGGCCCCACACGNONE 
J023008E13GGGTGGGCCCCACACGNONE 
J023030I11GGGTGGGCCCCACACGNONE 
J065137G08GGGTGGGCCCCACACGNONE 
J065139H16GGGTGGGCCCCACACGNONE 
J065154K13GGGTGGGCCCCACACGNONE 
J075176C02GGGTGGGCCCCACACGNONE 
Os01g0543100014-039-E10GCCCCACACNONE 
AK105363GCCCCACACSimilar to Peroxidase 72 precursor (EC 1.11.1.7) (Atperox P72) (PRXR8) (ATP6a). 
Os01g0631200J023080H07GCCCCACANONE 
J023125G17GCCCCACANONE 
J033132A13GCCCCACANONE 
J065179I22GCCCCACANONE 
J090027C06GCCCCACANONE 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0706000006-098-D12TGTGGGCCCCACANONE 
AK059936TGTGGGCCCCACASimilar to RNA polymerase II transcriptional coactivator KELP. 
AK070545TGTGGGCCCCACANONE 
AK104192TGTGGGCCCCACANONE 
J023055M24TGTGGGCCCCACANONE 
J033102J04TGTGGGCCCCACANONE 
J065050P18TGTGGGCCCCACANONE 
J065076D07TGTGGGCCCCACANONE 
J065078O14TGTGGGCCCCACANONE 
J065104L13TGTGGGCCCCACANONE 
J065115J23TGTGGGCCCCACANONE 
J065143P08TGTGGGCCCCACANONE 
J065178N17TGTGGGCCCCACANONE 
J065179H14TGTGGGCCCCACANONE 
J065187J06TGTGGGCCCCACANONE 
J075047B18TGTGGGCCCCACANONE 
Os01g0745400AK107872GGCCCCACASec34-like protein family protein. 
Os01g0756300014-074-B05GCCCCACANONE 
AK069648GCCCCACAConserved hypothetical protein. 
Os01g0764000006-021-G03GGCCCCACACNONE 
006-025-C07GGCCCCACACNONE 
006-029-G11GGCCCCACACNONE 
006-030-C04GGCCCCACACNONE 
006-035-E05GGCCCCACACNONE 
006-037-G01GGCCCCACACNONE 
006-038-C01GGCCCCACACNONE 
006-039-G05GGCCCCACACNONE 
006-042-E11GGCCCCACACNONE 
006-044-H04GGCCCCACACNONE 
006-045-A10GGCCCCACACNONE 
006-045-C05GGCCCCACACNONE 
006-047-A11GGCCCCACACNONE 
006-048-H10GGCCCCACACNONE 
006-050-C01GGCCCCACACNONE 
006-050-H11GGCCCCACACNONE 
006-051-G10GGCCCCACACNONE 
006-051-G11GGCCCCACACNONE 
006-056-B04GGCCCCACACNONE 
006-063-F04GGCCCCACACNONE 
006-063-H12GGCCCCACACNONE 
006-065-G09GGCCCCACACNONE 
006-067-F11GGCCCCACACNONE 
006-073-D10GGCCCCACACNONE 
006-074-G09GGCCCCACACNONE 
006-075-D04GGCCCCACACNONE 
006-077-C10GGCCCCACACNONE 
006-082-A10GGCCCCACACNONE 
006-084-C12GGCCCCACACNONE 
006-085-F05GGCCCCACACNONE 
006-087-H12GGCCCCACACNONE 
006-092-E10GGCCCCACACNONE 
006-094-C06GGCCCCACACNONE 
006-096-G11GGCCCCACACNONE 
006-097-H11GGCCCCACACNONE 
006-101-A07GGCCCCACACNONE 
006-101-G08GGCCCCACACNONE 
006-110-E08GGCCCCACACNONE 
006-111-D04GGCCCCACACNONE 
006-116-H04GGCCCCACACNONE 
AK058894GGCCCCACACNONE 
AK059818GGCCCCACACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GGCCCCACACNONE 
J013119N15GGCCCCACACNONE 
J013123P15GGCCCCACACNONE 
J023055F24GGCCCCACACNONE 
J023125K17GGCCCCACACNONE 
J053050A20GGCCCCACACNONE 
J053056P10GGCCCCACACNONE 
J053074D19GGCCCCACACNONE 
J053078A14GGCCCCACACNONE 
J053086P10GGCCCCACACNONE 
J053094N23GGCCCCACACNONE 
J053095M23GGCCCCACACNONE 
J065006D02GGCCCCACACNONE 
J065030A17GGCCCCACACNONE 
J065030K04GGCCCCACACNONE 
J065035L12GGCCCCACACNONE 
J065046E12GGCCCCACACNONE 
J065065H19GGCCCCACACNONE 
J065073C01GGCCCCACACNONE 
J065105F01GGCCCCACACNONE 
J065131N16GGCCCCACACNONE 
J065144O13GGCCCCACACNONE 
J065160E12GGCCCCACACNONE 
J065160K02GGCCCCACACNONE 
J065163F09GGCCCCACACNONE 
J065165E18GGCCCCACACNONE 
J065174E04GGCCCCACACNONE 
J065175O08GGCCCCACACNONE 
J065191N24GGCCCCACACNONE 
J065193D19GGCCCCACACNONE 
J065198D04GGCCCCACACNONE 
J065200G09GGCCCCACACNONE 
J075016L06GGCCCCACACNONE 
J075017J11GGCCCCACACNONE 
J075019L08GGCCCCACACNONE 
J075028M08GGCCCCACACNONE 
J075029K05GGCCCCACACNONE 
J075039K04GGCCCCACACNONE 
J075047J22GGCCCCACACNONE 
J075079H13GGCCCCACACNONE 
J075095K14GGCCCCACACNONE 
J075111D21GGCCCCACACNONE 
J075131A19GGCCCCACACNONE 
J075147G20GGCCCCACACNONE 
J075158F11GGCCCCACACNONE 
J075166N10GGCCCCACACNONE 
J075196G09GGCCCCACACNONE 
J075198I24GGCCCCACACNONE 
J090001L08GGCCCCACACNONE 
J090026G07GGCCCCACACNONE 
J090050M15GGCCCCACACNONE 
J090071A01GGCCCCACACNONE 
J090072P16GGCCCCACACNONE 
J090078D22GGCCCCACACNONE 
J090089C18GGCCCCACACNONE 
J100019B07GGCCCCACACNONE 
J100019H15GGCCCCACACNONE 
J100019P09GGCCCCACACNONE 
J100023A16GGCCCCACACNONE 
J100023B09GGCCCCACACNONE 
J100026O18GGCCCCACACNONE 
J100027E09GGCCCCACACNONE 
J100028F22GGCCCCACACNONE 
J100029P05GGCCCCACACNONE 
J100031M19GGCCCCACACNONE 
J100032A11GGCCCCACACNONE 
J100036G19GGCCCCACACNONE 
J100038E22GGCCCCACACNONE 
J100040A12GGCCCCACACNONE 
J100040L02GGCCCCACACNONE 
J100043O13GGCCCCACACNONE 
J100045E20GGCCCCACACNONE 
J100046H18GGCCCCACACNONE 
J100047E08GGCCCCACACNONE 
J100050E08GGCCCCACACNONE 
J100050P14GGCCCCACACNONE 
J100051G10GGCCCCACACNONE 
J100052L12GGCCCCACACNONE 
J100056G24GGCCCCACACNONE 
J100066B15GGCCCCACACNONE 
J100068O15GGCCCCACACNONE 
J100070J16GGCCCCACACNONE 
J100074I22GGCCCCACACNONE 
J100075M12GGCCCCACACNONE 
J100077M09GGCCCCACACNONE 
J100077O14GGCCCCACACNONE 
J100079J08GGCCCCACACNONE 
J100080I16GGCCCCACACNONE 
Os01g0776700J065046N20CATCCCCCGGCCCCACACGConserved hypothetical protein. 
J100086L02CATCCCCCGGCCCCACACGNONE 
Os01g0829266J065010C18TGTGGGGCCCCACTCTNONE 
J065037A22TGTGGGGCCCCACTCTNONE 
J065044B02TGTGGGGCCCCACTCTConserved hypothetical protein. 
J065044B10TGTGGGGCCCCACTCTNONE 
J065051A06TGTGGGGCCCCACTCTNONE 
J065073E06TGTGGGGCCCCACTCTNONE 
J065074I11TGTGGGGCCCCACTCTNONE 
J065086D22TGTGGGGCCCCACTCTNONE 
J065104H10TGTGGGGCCCCACTCTNONE 
J065107C05TGTGGGGCCCCACTCTNONE 
J065124H16TGTGGGGCCCCACTCTNONE 
J065165F22TGTGGGGCCCCACTCTNONE 
J065169B11TGTGGGGCCCCACTCTNONE 
J065172G21TGTGGGGCCCCACTCTNONE 
J065191E05TGTGGGGCCCCACTCTNONE 
J065191F18TGTGGGGCCCCACTCTNONE 
Os01g0837600AK108007GCCCCACAConserved hypothetical protein 1589, plant family protein. 
J065005C19GCCCCACANONE 
J065025H20GCCCCACANONE 
J065061E22GCCCCACANONE 
J065065F14GCCCCACANONE 
J065083O21GCCCCACANONE 
J065201G05GCCCCACANONE 
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment). 
AK102882CCACCAACTGGGCCCCACANONE 
AK103686CCACCAACTGGGCCCCACANONE 
Os01g0852500015-058-H06TGTGGGGCCCGNONE 
AK069637TGTGGGGCCCGELM2 domain containing protein. 
AK100453TGTGGGGCCCGNONE 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
J065066N18CCACTGACATGTGGGCCCCACANONE 
Os01g0897600J065120F23TGTGGGGCCNONE 
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0931300012-055-E05CCTGGGCCCCACANONE 
AK068196CCTGGGCCCCACATafazzin family protein. 
AK099213CCTGGGCCCCACANONE 
Os01g0961200011-099-H06GGCCCCACACNONE 
AK105424GGCCCCACACCBS domain containing protein. 
J065169J18GGCCCCACACNONE 
J075109H12GGCCCCACACNONE 
Os01g0966400AK103064AGTGGGCCCCACALeucine-rich repeat, SDS22 containing protein. 
J023043O12AGTGGGCCCCACANONE 
J053084D04AGTGGGCCCCACANONE 
J090021L08AGTGGGCCCCACANONE 
Os02g0149700AK103492GGGCCCCACAExo70 exocyst complex subunit family protein. 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0192300Os02g0192300GCCCCACACZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0194800AK120869GCCCCACACyclase-associated protein domain containing protein. 
AK121281GCCCCACANONE 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0216200AK108648TGTGGGGCHypothetical protein. 
Os02g0234700009-036-B03CCCAGCCCCACANONE 
AK062439CCCAGCCCCACAConserved hypothetical protein. 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0282600AK070262GTGTGGGCCCCACAConserved hypothetical protein. 
AK070262GTGTGGGGCCCACAConserved hypothetical protein. 
J023041L18GTGTGGGCCCCACANONE 
J023041L18GTGTGGGGCCCACANONE 
Os02g0316200AK073932GGCCCCACACyclin-like F-box domain containing protein. 
AK105757GGCCCCACANONE 
J023039G03GGCCCCACANONE 
J033076K03GGCCCCACANONE 
J075157J22GGCCCCACANONE 
J090097K02GGCCCCACANONE 
J100053F10GGCCCCACANONE 
Os02g0317400AK061254GGCCCCACAClathrin adaptor complex, small chain family protein. 
AK073474GGCCCCACANONE 
J033045O22GGCCCCACANONE 
J053023I18GGCCCCACANONE 
J053034H01GGCCCCACANONE 
J053034M24GGCCCCACANONE 
J065005K14GGCCCCACANONE 
J065092O13GGCCCCACANONE 
J065101K24GGCCCCACANONE 
J065174G18GGCCCCACANONE 
J065203J19GGCCCCACANONE 
J065218B15GGCCCCACANONE 
J090064B16GGCCCCACANONE 
Os02g0438700012-040-C07GCGGGCCCCACACNONE 
AK062610GCGGGCCCCACACNONE 
AK105276GCGGGCCCCACACConserved hypothetical protein. 
J065104J01GCGGGCCCCACACNONE 
Os02g0441000AK108073GCCCCACAConserved hypothetical protein. 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
Os02g0534600Os02g0534600TGTGGGGCCCACAConserved hypothetical protein. 
Os02g0578800009-044-A06CCGTGGGCCCCACANONE 
009-044-A06TGTGGGGCCCACTNONE 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
AK070066TGTGGGGCCCACTProtein of unknown function DUF962 family protein. 
Os02g0601800AB060276GGCCCCACACGNONE 
AK099539GGCCCCACACGNONE 
AK101873GGCCCCACACGBromodomain containing protein. 
AK106801GGCCCCACACGNONE 
AK121758GGCCCCACACGNONE 
AK121891GGCCCCACACGNONE 
J013059H01GGCCCCACACGNONE 
J013092F08GGCCCCACACGNONE 
J013146J04GGCCCCACACGNONE 
J023001K12GGCCCCACACGNONE 
J023002H16GGCCCCACACGNONE 
J023013B10GGCCCCACACGNONE 
J023081I22GGCCCCACACGNONE 
J023084K19GGCCCCACACGNONE 
J023150E24GGCCCCACACGNONE 
J033023B18GGCCCCACACGNONE 
J033025F18GGCCCCACACGNONE 
J033048P08GGCCCCACACGNONE 
J033060M24GGCCCCACACGNONE 
J033070G06GGCCCCACACGNONE 
J033088P12GGCCCCACACGNONE 
J033105C13GGCCCCACACGNONE 
J043009N18GGCCCCACACGNONE 
J065103G21GGCCCCACACGNONE 
J075039H15GGCCCCACACGNONE 
J090014K10GGCCCCACACGNONE 
J090022N02GGCCCCACACGNONE 
J090033F18GGCCCCACACGNONE 
J090033I04GGCCCCACACGNONE 
J090041F11GGCCCCACACGNONE 
J090045P20GGCCCCACACGNONE 
J090054B01GGCCCCACACGNONE 
J090055M12GGCCCCACACGNONE 
J090071K09GGCCCCACACGNONE 
J090098O16GGCCCCACACGNONE 
J090099P15GGCCCCACACGNONE 
J100050I16GGCCCCACACGNONE 
Os02g0629000009-047-E10GCCCCACANONE 
AK062480GCCCCACAProtein of unknown function DUF584 family protein. 
Os02g0677700AK119947TGTGGGCCCCACANONE 
Os02g0686300AK066567TGTGGGGCCConserved hypothetical protein. 
Os02g0696700AK060255TGTGGGGCSimilar to Jumonji domain containing protein 2C (Gene amplified in squamous cell carcinoma 1 protein) (GASC-1 protein). 
J100024M19TGTGGGGCNONE 
J100026K16TGTGGGGCNONE 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0735200015-035-A06GGCCCCACANONE 
015-048-A05GGCCCCACANONE 
015-091-A06GGCCCCACANONE 
016-082-G07GGCCCCACANONE 
016-086-G04GGCCCCACANONE 
AB037595GGCCCCACANONE 
AK061157GGCCCCACANONE 
AK071969GGCCCCACANONE 
AK104987GGCCCCACANONE 
AK109397GGCCCCACAGlutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clone lambda-GS28). 
X14245GGCCCCACANONE 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AF395537GGCCCCACANONE 
AJ308110GACACGTGGGCCCCACACNONE 
AJ308110GGCCCCACANONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
AK066446GGCCCCACASimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0745400AK072229AAAAGCCCCACATGTCAGTGACACGlycosyl transferase, family 8 protein. 
AK108072AAAAGCCCCACATGTCAGTGACACNONE 
Os02g0750500AK101960GTGTCACTGACATGTGGGGCCTGGSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GTGTCACTGACATGTGGGGCCTGGNONE 
J065054F02GTGTCACTGACATGTGGGGCCTGGNONE 
J065124N03GTGTCACTGACATGTGGGGCCTGGNONE 
J090001H12GTGTCACTGACATGTGGGGCCTGGNONE 
J100057J01GTGTCACTGACATGTGGGGCCTGGNONE 
J100062F12GTGTCACTGACATGTGGGGCCTGGNONE 
Os02g0752200AK119887GCCCCACASimilar to Beta-D-xylosidase. 
J013123K24GCCCCACANONE 
J100039M08GCCCCACANONE 
J100053F18GCCCCACANONE 
J100088B07GCCCCACANONE 
Os02g0767500005-017-F10AACGGGCCCCACACGNONE 
AB016065AACGGGCCCCACACGNONE 
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter. 
J013020K11AACGGGCCCCACACGNONE 
J013066I18AACGGGCCCCACACGNONE 
J023012D02AACGGGCCCCACACGNONE 
J023020J16AACGGGCCCCACACGNONE 
J023022H13AACGGGCCCCACACGNONE 
J023044N15AACGGGCCCCACACGNONE 
J023067E15AACGGGCCCCACACGNONE 
J023079C06AACGGGCCCCACACGNONE 
J023080B07AACGGGCCCCACACGNONE 
J023081G11AACGGGCCCCACACGNONE 
J023091H22AACGGGCCCCACACGNONE 
J023092J03AACGGGCCCCACACGNONE 
J023114D02AACGGGCCCCACACGNONE 
J023121J15AACGGGCCCCACACGNONE 
J023128G10AACGGGCCCCACACGNONE 
J023132B15AACGGGCCCCACACGNONE 
J023140G10AACGGGCCCCACACGNONE 
J023142B10AACGGGCCCCACACGNONE 
J033026C15AACGGGCCCCACACGNONE 
J033029F21AACGGGCCCCACACGNONE 
J033037I09AACGGGCCCCACACGNONE 
J033046D11AACGGGCCCCACACGNONE 
J033081L20AACGGGCCCCACACGNONE 
J033097J19AACGGGCCCCACACGNONE 
J033125D19AACGGGCCCCACACGNONE 
J033125I04AACGGGCCCCACACGNONE 
J033141M21AACGGGCCCCACACGNONE 
J033143K08AACGGGCCCCACACGNONE 
J053091N01AACGGGCCCCACACGNONE 
J065093C20AACGGGCCCCACACGNONE 
J065104K11AACGGGCCCCACACGNONE 
J065143L16AACGGGCCCCACACGNONE 
J065205I23AACGGGCCCCACACGNONE 
J090057C12AACGGGCCCCACACGNONE 
J090075P11AACGGGCCCCACACGNONE 
Os02g0781700006-066-G01GTGTGGGGCCNONE 
009-034-D03GTGTGGGGCCNONE 
009-194-D04GTGTGGGGCCNONE 
AK061791GTGTGGGGCCConserved hypothetical protein. 
AK063223GTGTGGGGCCNONE 
AY224477GTGTGGGGCCNONE 
J013045H09GTGTGGGGCCNONE 
J013061I22GTGTGGGGCCNONE 
J013071F11GTGTGGGGCCNONE 
J023130H07GTGTGGGGCCNONE 
J043036K23GTGTGGGGCCNONE 
J065010N07GTGTGGGGCCNONE 
J065219I01GTGTGGGGCCNONE 
J090073I15GTGTGGGGCCNONE 
Os02g0804900J065051L05CGTGTGGGGCCNONE 
J065069D19CGTGTGGGGCCNONE 
J065073L01CGTGTGGGGCCNONE 
J065147K04CGTGTGGGGCCNONE 
J065166D17CGTGTGGGGCCNONE 
Os02g0813300003-101-D04GCCCCACANONE 
AK060823GCCCCACACyclin-like F-box domain containing protein. 
AK098981GCCCCACANONE 
J013092F18GCCCCACANONE 
Os02g0817600006-085-G03TTGTGGGCCCCACANONE 
AJ748648TTGTGGGCCCCACANONE 
AK069892TTGTGGGCCCCACAAUX/IAA protein family protein. 
AK104501TTGTGGGCCCCACANONE 
AK104802TTGTGGGCCCCACANONE 
J013027H10TTGTGGGCCCCACANONE 
J013106L07TTGTGGGCCCCACANONE 
J013118N15TTGTGGGCCCCACANONE 
J013131H01TTGTGGGCCCCACANONE 
J013170C08TTGTGGGCCCCACANONE 
J023060C13TTGTGGGCCCCACANONE 
J033024K10TTGTGGGCCCCACANONE 
J033052I08TTGTGGGCCCCACANONE 
J090010H15TTGTGGGCCCCACANONE 
J090011J11TTGTGGGCCCCACANONE 
J090038P15TTGTGGGCCCCACANONE 
J090060B02TTGTGGGCCCCACANONE 
J100079J16TTGTGGGCCCCACANONE 
Os02g0820600AK066549GTGTGGGGCConserved hypothetical protein. 
J013070F02GTGTGGGGCNONE 
Os03g0121300AK120047GCCCCACANONE 
Os03g0143600AB110188TGTGGGGCCNONE 
AK068424TGTGGGGCCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464TGTGGGGCCNONE 
AY224545TGTGGGGCCNONE 
J013154F02TGTGGGGCCNONE 
Os03g0151900009-084-F09GGCCCCACANONE 
AB032761GGCCCCACANONE 
AK105389GGCCCCACANONE 
AK121527GGCCCCACASimilar to Small GTP-binding protein. 
J075028M03GGCCCCACANONE 
J075031H15GGCCCCACANONE 
J075045L24GGCCCCACANONE 
J075055K14GGCCCCACANONE 
J075100O08GGCCCCACANONE 
J075112B20GGCCCCACANONE 
J075188D21GGCCCCACANONE 
Os03g0156500011-075-F02CGCGGGGGGGTGGGCCCCACACNONE 
012-077-G10CGCGGGGGGGTGGGCCCCACACNONE 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
J013088H17CGCGGGGGGGTGGGCCCCACACNONE 
J013135G21CGCGGGGGGGTGGGCCCCACACNONE 
J033050E10CGCGGGGGGGTGGGCCCCACACNONE 
J033050J01CGCGGGGGGGTGGGCCCCACACNONE 
J033129N23CGCGGGGGGGTGGGCCCCACACNONE 
J065085L16CGCGGGGGGGTGGGCCCCACACNONE 
J065101B19CGCGGGGGGGTGGGCCCCACACNONE 
J065167N03CGCGGGGGGGTGGGCCCCACACNONE 
J090009O21CGCGGGGGGGTGGGCCCCACACNONE 
J090049D11CGCGGGGGGGTGGGCCCCACACNONE 
J100017F23CGCGGGGGGGTGGGCCCCACACNONE 
J100040E12CGCGGGGGGGTGGGCCCCACACNONE 
J100055O18CGCGGGGGGGTGGGCCCCACACNONE 
J100061K08CGCGGGGGGGTGGGCCCCACACNONE 
J100072M05CGCGGGGGGGTGGGCCCCACACNONE 
J100077B08CGCGGGGGGGTGGGCCCCACACNONE 
J100086G03CGCGGGGGGGTGGGCCCCACACNONE 
Os03g0168200AK099530TGTGGGGCCGAAConserved hypothetical protein. 
Os03g0168300AK069941GCCCCACAConserved hypothetical protein. 
J013124L03GCCCCACANONE 
J023037E14GCCCCACANONE 
Os03g0213600AK100407TGTGGGGCCCACCConserved hypothetical protein. 
Os03g0251500AK101151CTCGGCCCCACANONE 
AK119298CTCGGCCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0285900AK073348GGCCCCACASimilar to Splicing factor RSZ33. 
J033025D08GGCCCCACANONE 
J033087M12GGCCCCACANONE 
J065008F11GGCCCCACANONE 
J065059C09GGCCCCACANONE 
J065070J11GGCCCCACANONE 
J065076L20GGCCCCACANONE 
J065083M19GGCCCCACANONE 
J065111I06GGCCCCACANONE 
J065112H18GGCCCCACANONE 
J065112J18GGCCCCACANONE 
J065140C08GGCCCCACANONE 
J065180P06GGCCCCACANONE 
J065187G12GGCCCCACANONE 
J065189B14GGCCCCACANONE 
J090042N02GGCCCCACANONE 
J090087M04GGCCCCACANONE 
Os03g0294200AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
AK069285CGTGTGGGGCCCSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0294600AK110762TGTGGGGCCGTGSimilar to Importin-beta1. 
Os03g0297100006-113-D12ATTTGGGCCCCACANONE 
AK061276ATTTGGGCCCCACASimilar to 40S ribosomal protein S7. 
J033119B03ATTTGGGCCCCACANONE 
J065205G10ATTTGGGCCCCACANONE 
J080069C17ATTTGGGCCCCACANONE 
J100069E15ATTTGGGCCCCACANONE 
J100081D07ATTTGGGCCCCACANONE 
Os03g0338600AK066604TGTGGGGCCtRNA pseudouridine synthase family protein. 
Os03g0340500012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE 
AK099406TGTGGGGCCCACGGGTCAGTGGNONE 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE 
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE 
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE 
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE 
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE 
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE 
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE 
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE 
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE 
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE 
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE 
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE 
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE 
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE 
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE 
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE 
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE 
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE 
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE 
Os03g0352800009-030-G08TGTGGGGCCCACANONE 
AK059673TGTGGGGCCCACASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17TGTGGGGCCCACANONE 
J075050N19TGTGGGGCCCACANONE 
J075104J18TGTGGGGCCCACANONE 
J075142K05TGTGGGGCCCACANONE 
J100050I19TGTGGGGCCCACANONE 
J100057N04TGTGGGGCCCACANONE 
Os03g0356484009-038-H01ACCGGGCCCCACANONE 
AK105146ACCGGGCCCCACATetratricopeptide-like helical domain containing protein. 
J065204G11ACCGGGCCCCACANONE 
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein. 
J023010L17CAACGGCCCCACATGTCAGTGGNONE 
Os03g0387100AB026559GGCCCCACANONE 
AF022735GGCCCCACANONE 
AK058567GGCCCCACAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195GGCCCCACANONE 
J033030J15GGCCCCACANONE 
J033102N16GGCCCCACANONE 
J065056E08GGCCCCACANONE 
J065112M11GGCCCCACANONE 
J065170H07GGCCCCACANONE 
J075003P17GGCCCCACANONE 
J075074D06GGCCCCACANONE 
J075127F20GGCCCCACANONE 
J075129I01GGCCCCACANONE 
J075178A10GGCCCCACANONE 
J090071P12GGCCCCACANONE 
J100090D18GGCCCCACANONE 
Os03g0393900AK069809GGCCCCACASimilar to S.tuberosum patatin (Fragment). 
J023030J03GGCCCCACANONE 
Os03g0565600J090030D24GCCCCACANONE 
Os03g0566500AK070576GCCCCACACLupus La protein family protein. 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0588700Os03g0588700GCGGGCCCCACACConserved hypothetical protein. 
Os03g0626250J075100A11GCCCCACANONE 
J075134H15GCCCCACANONE 
J075142J02GCCCCACANONE 
J075181A14GCCCCACANONE 
J075192K17GCCCCACANONE 
J090046B06GCCCCACANONE 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
AK068169ACGTGGGCCCCACANONE 
Os03g0639800AK103237GGCCCCACASnf7 family protein. 
J023036L02GGCCCCACANONE 
J033108L13GGCCCCACANONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0669200J013037D23CAGGTGGGCCCCACANONE 
J023026K09CAGGTGGGCCCCACANONE 
J075008E21CAGGTGGGCCCCACANONE 
J075061B21CAGGTGGGCCCCACANONE 
J075151B13CAGGTGGGCCCCACANONE 
J075195L02CAGGTGGGCCCCACANONE 
J090061B07CAGGTGGGCCCCACANONE 
Os03g0685500009-034-F03GGCCCCACANONE 
009-034-F03TCTGGCCCCACANONE 
009-081-B02GGCCCCACANONE 
009-081-B02TCTGGCCCCACANONE 
AB110171GGCCCCACANONE 
AB110171TCTGGCCCCACANONE 
AK062080GGCCCCACACHCH domain containing protein. 
AK062080TCTGGCCCCACACHCH domain containing protein. 
AK120726GGCCCCACANONE 
AK120726TCTGGCCCCACANONE 
J013099K19GGCCCCACANONE 
J013099K19TCTGGCCCCACANONE 
J023002L22GGCCCCACANONE 
J023002L22TCTGGCCCCACANONE 
J023052G18GGCCCCACANONE 
J023052G18TCTGGCCCCACANONE 
J023057J22GGCCCCACANONE 
J023057J22TCTGGCCCCACANONE 
J023095A10GGCCCCACANONE 
J023095A10TCTGGCCCCACANONE 
J033097N07GGCCCCACANONE 
J033097N07TCTGGCCCCACANONE 
J033132H15GGCCCCACANONE 
J033132H15TCTGGCCCCACANONE 
J065064M10GGCCCCACANONE 
J065064M10TCTGGCCCCACANONE 
J065069C22GGCCCCACANONE 
J065069C22TCTGGCCCCACANONE 
J065202I16GGCCCCACANONE 
J065202I16TCTGGCCCCACANONE 
J065214M17GGCCCCACANONE 
J065214M17TCTGGCCCCACANONE 
J075007E07GGCCCCACANONE 
J075007E07TCTGGCCCCACANONE 
J075016A20GGCCCCACANONE 
J075016A20TCTGGCCCCACANONE 
J075036C08GGCCCCACANONE 
J075036C08TCTGGCCCCACANONE 
J075057C03GGCCCCACANONE 
J075057C03TCTGGCCCCACANONE 
J075064H21GGCCCCACANONE 
J075064H21TCTGGCCCCACANONE 
J075078B13GGCCCCACANONE 
J075078B13TCTGGCCCCACANONE 
J075078D01GGCCCCACANONE 
J075078D01TCTGGCCCCACANONE 
J075087P03GGCCCCACANONE 
J075087P03TCTGGCCCCACANONE 
J075091N16GGCCCCACANONE 
J075091N16TCTGGCCCCACANONE 
J075110P14GGCCCCACANONE 
J075110P14TCTGGCCCCACANONE 
J075116J17GGCCCCACANONE 
J075116J17TCTGGCCCCACANONE 
J075148J23GGCCCCACANONE 
J075148J23TCTGGCCCCACANONE 
J075171C20GGCCCCACANONE 
J075171C20TCTGGCCCCACANONE 
J075175K20GGCCCCACANONE 
J075175K20TCTGGCCCCACANONE 
J080035F24GGCCCCACANONE 
J080035F24TCTGGCCCCACANONE 
J080058E06GGCCCCACANONE 
J080058E06TCTGGCCCCACANONE 
J080086E16GGCCCCACANONE 
J080086E16TCTGGCCCCACANONE 
J080301L22GGCCCCACANONE 
J080301L22TCTGGCCCCACANONE 
J080304O06GGCCCCACANONE 
J080304O06TCTGGCCCCACANONE 
J080305N09GGCCCCACANONE 
J080305N09TCTGGCCCCACANONE 
J080306J16GGCCCCACANONE 
J080306J16TCTGGCCCCACANONE 
J080306N17GGCCCCACANONE 
J080306N17TCTGGCCCCACANONE 
J080311O12GGCCCCACANONE 
J080311O12TCTGGCCCCACANONE 
J080315L06GGCCCCACANONE 
J080315L06TCTGGCCCCACANONE 
J080317H12GGCCCCACANONE 
J080317H12TCTGGCCCCACANONE 
J080317O05GGCCCCACANONE 
J080317O05TCTGGCCCCACANONE 
J080318L22GGCCCCACANONE 
J080318L22TCTGGCCCCACANONE 
J090065J21GGCCCCACANONE 
J090065J21TCTGGCCCCACANONE 
J090070G13GGCCCCACANONE 
J090070G13TCTGGCCCCACANONE 
J100028F03GGCCCCACANONE 
J100028F03TCTGGCCCCACANONE 
J100073D05GGCCCCACANONE 
J100073D05TCTGGCCCCACANONE 
Os03g0713100J013039M09GGCCCCACANONE 
J023007K01GGCCCCACANONE 
J023073H01GGCCCCACANONE 
J023087M20GGCCCCACANONE 
J023142E01GGCCCCACANONE 
J033048E03GGCCCCACANONE 
J033048F03GGCCCCACASimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11GGCCCCACANONE 
J033074M20GGCCCCACANONE 
J033084M11GGCCCCACANONE 
J033091I23GGCCCCACANONE 
J033100C08GGCCCCACANONE 
J033123K19GGCCCCACANONE 
J090006P21GGCCCCACANONE 
J090045O16GGCCCCACANONE 
J100087M13GGCCCCACANONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0745600014-030-E09CCTGGGCCCCACANONE 
J053057E07CCTGGGCCCCACANONE 
J075044L08CCTGGGCCCCACANONE 
J075069C24CCTGGGCCCCACANONE 
J075127J02CCTGGGCCCCACAProtein of unknown function UPF0005 family protein. 
J075180G21CCTGGGCCCCACANONE 
J075189M22CCTGGGCCCCACANONE 
J075192P11CCTGGGCCCCACANONE 
Os03g0752700011-093-A02GCCCCACACNONE 
AK122157GCCCCACACHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03GCCCCACACNONE 
J033096O19GCCCCACACNONE 
J033145P19GCCCCACACNONE 
J065008K09GCCCCACACNONE 
J065027J08GCCCCACACNONE 
J065073H12GCCCCACACNONE 
J065078G14GCCCCACACNONE 
J065092L12GCCCCACACNONE 
J065108D11GCCCCACACNONE 
J065140G10GCCCCACACNONE 
J065161D24GCCCCACACNONE 
J065170F04GCCCCACACNONE 
J075004K20GCCCCACACNONE 
J075069F16GCCCCACACNONE 
J075085B12GCCCCACACNONE 
J075087D24GCCCCACACNONE 
J075102G15GCCCCACACNONE 
J075123M06GCCCCACACNONE 
J090058D24GCCCCACACNONE 
J090068I12GCCCCACACNONE 
J090094A19GCCCCACACNONE 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0799000013-010-A07TGTGGGGCGCGTGGGNONE 
013-081-H02TGTGGGGCGCGTGGGNONE 
AK067840TGTGGGGCGCGTGGGSimilar to Histone H1. 
AK099211TGTGGGGCGCGTGGGNONE 
J065066F23TGTGGGGCGCGTGGGNONE 
J065138O20TGTGGGGCGCGTGGGNONE 
J065163G22TGTGGGGCGCGTGGGNONE 
J065211J01TGTGGGGCGCGTGGGNONE 
J080027D02TGTGGGGCGCGTGGGNONE 
J080029E20TGTGGGGCGCGTGGGNONE 
J080045D03TGTGGGGCGCGTGGGNONE 
J080060G13TGTGGGGCGCGTGGGNONE 
J080067E14TGTGGGGCGCGTGGGNONE 
J080067J04TGTGGGGCGCGTGGGNONE 
J080067J21TGTGGGGCGCGTGGGNONE 
J080068L09TGTGGGGCGCGTGGGNONE 
J080077E15TGTGGGGCGCGTGGGNONE 
J080078B03TGTGGGGCGCGTGGGNONE 
J080086H09TGTGGGGCGCGTGGGNONE 
J090095G02TGTGGGGCGCGTGGGNONE 
J100058H04TGTGGGGCGCGTGGGNONE 
Os03g0811600009-134-B07TGTGGGCCCCACATGTCAGTGNONE 
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H. 
J023078H22TGTGGGCCCCACATGTCAGTGNONE 
Os03g0825700AK067902TGCGGGCCCCACASimilar to Defective in exine formation. 
Os03g0825900AK109694GCCCCACACConserved hypothetical protein. 
Os03g0832600AK120137GGTGGGCCCCACASimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0836200009-165-F07CGGGCCCCACANONE 
015-092-G01CGGGCCCCACANONE 
AK058443CGGGCCCCACANONE 
AK067084CGGGCCCCACASimilar to RNA-binding protein RZ-1. 
AK101225CGGGCCCCACANONE 
J013092A03CGGGCCCCACANONE 
J013095N17CGGGCCCCACANONE 
J013147J18CGGGCCCCACANONE 
J023019O10CGGGCCCCACANONE 
J023065N18CGGGCCCCACANONE 
J033113E18CGGGCCCCACANONE 
J033133E03CGGGCCCCACANONE 
J065059J15CGGGCCCCACANONE 
J065075O11CGGGCCCCACANONE 
J065119I07CGGGCCCCACANONE 
J065171J03CGGGCCCCACANONE 
J090016D21CGGGCCCCACANONE 
J090081O03CGGGCCCCACANONE 
J100040G18CGGGCCCCACANONE 
J100040L10CGGGCCCCACANONE 
J100055H13CGGGCCCCACANONE 
J100059I22CGGGCCCCACANONE 
J100078A08CGGGCCCCACANONE 
Os04g0282400AK120187CCCGGGCCCCACACSimilar to FPF1 protein-like (RAA1). 
J013034O10CCCGGGCCCCACACNONE 
J013071G20CCCGGGCCCCACACNONE 
Os04g0399300AK105282ATATGGGCCCCACACSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
Os04g0408900009-183-E05TGTGGGGCCCACANONE 
AK058627TGTGGGGCCCACASimilar to DNA-binding protein S1FA. 
J023014N01TGTGGGGCCCACANONE 
J023088K23TGTGGGGCCCACANONE 
J065086B17TGTGGGGCCCACANONE 
J065095F08TGTGGGGCCCACANONE 
J065119N11TGTGGGGCCCACANONE 
J100032H17TGTGGGGCCCACANONE 
Os04g0412900AK073418ATATGGGCCCCACASec23/Sec24 trunk region domain containing protein. 
J033027C24ATATGGGCCCCACANONE 
J033044C16ATATGGGCCCCACANONE 
J090023G03ATATGGGCCCCACANONE 
J090082C21ATATGGGCCCCACANONE 
Os04g0429450009-073-H08GTGTGGGGCNONE 
J065161L02GTGTGGGGCConserved hypothetical protein. 
Os04g0444900AK063657ACCGGGCCCCACACSimilar to Alfin-1. 
AK098960ACCGGGCCCCACACNONE 
J065037L14ACCGGGCCCCACACNONE 
J065037P22ACCGGGCCCCACACNONE 
J065173O15ACCGGGCCCCACACNONE 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0548700AK122006GCCCCACAHomeodomain-like containing protein. 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
Os04g0617050J065197A20TGTGGGGCCCATGNONE 
J090067K01TGTGGGGCCCATGAuxin responsive SAUR protein family protein. 
Os04g0674600AK069645TGTGGGGCCCAGAOligopeptide transporter OPT superfamily protein. 
Os05g0102500009-183-E08CGTGTGGGGCNONE 
AK063894CGTGTGGGGCNONE 
AK073341CGTGTGGGGCConserved hypothetical protein. 
J023022C11CGTGTGGGGCNONE 
J065095B14CGTGTGGGGCNONE 
J065130O12CGTGTGGGGCNONE 
J065142P07CGTGTGGGGCNONE 
J065155L18CGTGTGGGGCNONE 
Os05g0110900AK073169AGTGGGCCCCACASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os05g0111200009-033-A06CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
J065006E13CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075001D12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075005J18CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075009L08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075012M21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075019K17CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075020D07CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075041D11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075051C03CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075060C05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075079N09CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075094B04CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075108E08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075115G05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075147L21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075161G12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168J11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168L11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075174F22CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
Os05g0116100006-049-G01CCTGGGCCCCACANONE 
006-064-F09CCTGGGCCCCACANONE 
006-082-A03CCTGGGCCCCACANONE 
006-092-G06CCTGGGCCCCACANONE 
006-102-F09CCTGGGCCCCACANONE 
AB037970CCTGGGCCCCACANONE 
AK061836CCTGGGCCCCACANONE 
AK070895CCTGGGCCCCACADehydroascorbate reductase. 
AY074786CCTGGGCCCCACANONE 
J013022K21CCTGGGCCCCACANONE 
J013154A03CCTGGGCCCCACANONE 
J023074C02CCTGGGCCCCACANONE 
J023091I19CCTGGGCCCCACANONE 
J023135M05CCTGGGCCCCACANONE 
J065027L11CCTGGGCCCCACANONE 
J065065A08CCTGGGCCCCACANONE 
J065120A08CCTGGGCCCCACANONE 
J065174A05CCTGGGCCCCACANONE 
J065184O22CCTGGGCCCCACANONE 
J065191D07CCTGGGCCCCACANONE 
J065209D04CCTGGGCCCCACANONE 
J075014F11CCTGGGCCCCACANONE 
J075036D03CCTGGGCCCCACANONE 
J075157D23CCTGGGCCCCACANONE 
J080007F15CCTGGGCCCCACANONE 
J080008N12CCTGGGCCCCACANONE 
J080010F22CCTGGGCCCCACANONE 
J080011C19CCTGGGCCCCACANONE 
J080011F12CCTGGGCCCCACANONE 
J080012E11CCTGGGCCCCACANONE 
J080015B12CCTGGGCCCCACANONE 
J080015O16CCTGGGCCCCACANONE 
J080016G24CCTGGGCCCCACANONE 
J080016K13CCTGGGCCCCACANONE 
J080018A02CCTGGGCCCCACANONE 
J080018H03CCTGGGCCCCACANONE 
J080022M01CCTGGGCCCCACANONE 
J080023D20CCTGGGCCCCACANONE 
J080023I01CCTGGGCCCCACANONE 
J080023J05CCTGGGCCCCACANONE 
J080024A09CCTGGGCCCCACANONE 
J080024I09CCTGGGCCCCACANONE 
J080025A10CCTGGGCCCCACANONE 
J080025G04CCTGGGCCCCACANONE 
J080027D21CCTGGGCCCCACANONE 
J080029M05CCTGGGCCCCACANONE 
J080030J01CCTGGGCCCCACANONE 
J080034D10CCTGGGCCCCACANONE 
J080036F18CCTGGGCCCCACANONE 
J080038N11CCTGGGCCCCACANONE 
J080039B07CCTGGGCCCCACANONE 
J080039E01CCTGGGCCCCACANONE 
J080039K11CCTGGGCCCCACANONE 
J080040B09CCTGGGCCCCACANONE 
J080040G11CCTGGGCCCCACANONE 
J080041H08CCTGGGCCCCACANONE 
J080041H19CCTGGGCCCCACANONE 
J080041O20CCTGGGCCCCACANONE 
J080042C15CCTGGGCCCCACANONE 
J080043C16CCTGGGCCCCACANONE 
J080043F18CCTGGGCCCCACANONE 
J080044B17CCTGGGCCCCACANONE 
J080044N10CCTGGGCCCCACANONE 
J080044O07CCTGGGCCCCACANONE 
J080045H15CCTGGGCCCCACANONE 
J080045I03CCTGGGCCCCACANONE 
J080046A05CCTGGGCCCCACANONE 
J080048I06CCTGGGCCCCACANONE 
J080049L04CCTGGGCCCCACANONE 
J080049M09CCTGGGCCCCACANONE 
J080050G11CCTGGGCCCCACANONE 
J080051G20CCTGGGCCCCACANONE 
J080053C09CCTGGGCCCCACANONE 
J080053I05CCTGGGCCCCACANONE 
J080053P18CCTGGGCCCCACANONE 
J080054K10CCTGGGCCCCACANONE 
J080054P14CCTGGGCCCCACANONE 
J080057L05CCTGGGCCCCACANONE 
J080062K11CCTGGGCCCCACANONE 
J080063C19CCTGGGCCCCACANONE 
J080065B03CCTGGGCCCCACANONE 
J080066E15CCTGGGCCCCACANONE 
J080066H05CCTGGGCCCCACANONE 
J080066I05CCTGGGCCCCACANONE 
J080068O11CCTGGGCCCCACANONE 
J080070L22CCTGGGCCCCACANONE 
J080071I12CCTGGGCCCCACANONE 
J080071N20CCTGGGCCCCACANONE 
J080072D10CCTGGGCCCCACANONE 
J080072I10CCTGGGCCCCACANONE 
J080074G03CCTGGGCCCCACANONE 
J080076E23CCTGGGCCCCACANONE 
J080076N03CCTGGGCCCCACANONE 
J080077N23CCTGGGCCCCACANONE 
J080084B13CCTGGGCCCCACANONE 
J080084F07CCTGGGCCCCACANONE 
J080085J15CCTGGGCCCCACANONE 
J080085P20CCTGGGCCCCACANONE 
J080090F21CCTGGGCCCCACANONE 
J080093H16CCTGGGCCCCACANONE 
J080093J01CCTGGGCCCCACANONE 
J080093L04CCTGGGCCCCACANONE 
J080097E24CCTGGGCCCCACANONE 
J090012G04CCTGGGCCCCACANONE 
J090054K05CCTGGGCCCCACANONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
Os05g0148600003-016-C11CGGGTGGGCCCCACACACACCNONE 
AK066168CGGGTGGGCCCCACACACACCNONE 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
AY360145CGGGTGGGCCCCACACACACCNONE 
J013055J22CGGGTGGGCCCCACACACACCNONE 
J013057M24CGGGTGGGCCCCACACACACCNONE 
J013074N03CGGGTGGGCCCCACACACACCNONE 
J013158A22CGGGTGGGCCCCACACACACCNONE 
J075118H09CGGGTGGGCCCCACACACACCNONE 
Os05g0161200AB042936GTGTGGGGCNONE 
AK121808GTGTGGGGCDNA polymerase III clamp loader subunit, C-terminal domain containing protein. 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os05g0319800AK100483TGTGGGGCCSimilar to Plasma membrane H+ ATPase (EC 3.6.3.6). 
Os05g0320700AK100598TGTGGGCCCCACATCCCCCACACSimilar to Cytochrome P450. 
AK104994TGTGGGCCCCACATCCCCCACACNONE 
Os05g0412800AF402803CTCGGCCCCACACSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0454400AK107942GCGTGGGCCCCACAConserved hypothetical protein. 
Os05g0463400AK100354CCGTGGGCCCCACAPWWP domain containing protein. 
AK100354GGCCCCACAPWWP domain containing protein. 
J013022B18CCGTGGGCCCCACANONE 
J013022B18GGCCCCACANONE 
J023083G23CCGTGGGCCCCACANONE 
J023083G23GGCCCCACANONE 
Os05g0474900011-003-B02GCCCCACANONE 
AK102680GCCCCACAProtein of unknown function Cys-rich family protein. 
J023022F04GCCCCACANONE 
J033102J02GCCCCACANONE 
Os05g0487600AK100817TGTGGGGCCCACGTGNONE 
AK103104TGTGGGGCCCACGTGNONE 
J043027P10TGTGGGGCCCACGTGNONE 
J065183N17TGTGGGGCCCACGTGNONE 
Os05g0509400AK108053CAAGTGGGCCCCACASimilar to DNA binding protein-like. 
Os05g0510100Os05g0510100GGCCCCACACProtein of unknown function DUF567 family protein. 
Os05g0519700014-100-B04TCGTGGGCCCCACANONE 
AF332981TCGTGGGCCCCACANONE 
AK100903TCGTGGGCCCCACANONE 
AK105433TCGTGGGCCCCACAHeat shock protein 101. 
Os05g0535900AK101539CAAGGCCCCACACGTCACNONE 
AK101555CAAGGCCCCACACGTCACIQ calmodulin-binding region domain containing protein. 
J013047J05CAAGGCCCCACACGTCACNONE 
Os05g0548100AK060333CGTGTGGGGCCGTGConserved hypothetical protein. 
AK100682CGTGTGGGGCCGTGNONE 
J013151E01CGTGTGGGGCCGTGNONE 
J023113L22CGTGTGGGGCCGTGNONE 
J043027A19CGTGTGGGGCCGTGNONE 
J075093E06CGTGTGGGGCCGTGNONE 
J090060D15CGTGTGGGGCCGTGNONE 
J090082J03CGTGTGGGGCCGTGNONE 
J100050E01CGTGTGGGGCCGTGNONE 
Os05g0549100AK072422TGTGGGGCCSimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0557200AK062090CGTGTGGGGCCCACGCGNONE 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
J013047E13CGTGTGGGGCCCACGCGNONE 
J013089P04CGTGTGGGGCCCACGCGNONE 
J013130H17CGTGTGGGGCCCACGCGNONE 
J013132C20CGTGTGGGGCCCACGCGNONE 
J023001E06CGTGTGGGGCCCACGCGNONE 
J023108C09CGTGTGGGGCCCACGCGNONE 
J023125C12CGTGTGGGGCCCACGCGNONE 
J033023O10CGTGTGGGGCCCACGCGNONE 
J033033K16CGTGTGGGGCCCACGCGNONE 
J033064C11CGTGTGGGGCCCACGCGNONE 
J033071P07CGTGTGGGGCCCACGCGNONE 
J033072H14CGTGTGGGGCCCACGCGNONE 
J033084F06CGTGTGGGGCCCACGCGNONE 
J033084H11CGTGTGGGGCCCACGCGNONE 
J033097C05CGTGTGGGGCCCACGCGNONE 
J043009E20CGTGTGGGGCCCACGCGNONE 
J053035M10CGTGTGGGGCCCACGCGNONE 
J053043J22CGTGTGGGGCCCACGCGNONE 
J053082K10CGTGTGGGGCCCACGCGNONE 
J053094N13CGTGTGGGGCCCACGCGNONE 
Os05g0573700AK065295GGCCCCACACGCCTCSimilar to Ketol-acid reductoisomerase, chloroplast precursor (EC 1.1.1.86) (Acetohydroxy-acid reductoisomerase) (Alpha-keto-beta-hydroxylacil reductoisomerase). 
J065100L13GGCCCCACACGCCTCNONE 
J100062P20GGCCCCACACGCCTCNONE 
Os05g0576700013-062-H04GCCCCACACNONE 
AK063599GCCCCACACNONE 
AK108377GCCCCACACOleosin family protein. 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os06g0105900AK072638ACTGGGCCCCACACConserved hypothetical protein. 
Os06g0115200J100029D05TGTGGGGCCCACACNONE 
J100048P05TGTGGGGCCCACACQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0166500016-094-H06GCCCCACACNONE 
AK102541GCCCCACACSimilar to Auxin-responsive protein IAA20 (Indoleacetic acid-induced protein 20). 
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein. 
Os06g0261300AK073534GCCCCACAConserved hypothetical protein. 
AK111122GCCCCACANONE 
J065001F20GCCCCACANONE 
Os06g0268800AK120796CCCGGCCCCACACGProtein of unknown function UPF0005 family protein. 
Os06g0270900011-086-B03CAAGTGGGCCCCACANONE 
012-051-A02CAAGTGGGCCCCACANONE 
016-033-F07CAAGTGGGCCCCACANONE 
AB044537CAAGTGGGCCCCACANONE 
AF162665CAAGTGGGCCCCACANONE 
AK073079CAAGTGGGCCCCACASimilar to RF2 (EC 1.2.1.3) (T cytoplasm male sterility restorer factor 2). 
AK099248CAAGTGGGCCCCACANONE 
AK120296CAAGTGGGCCCCACANONE 
J013151K07CAAGTGGGCCCCACANONE 
J013156A10CAAGTGGGCCCCACANONE 
J023014D24CAAGTGGGCCCCACANONE 
J023148F09CAAGTGGGCCCCACANONE 
J033113C09CAAGTGGGCCCCACANONE 
J065138H22CAAGTGGGCCCCACANONE 
J090037C14CAAGTGGGCCCCACANONE 
J090053A17CAAGTGGGCCCCACANONE 
J090066L02CAAGTGGGCCCCACANONE 
J100017N17CAAGTGGGCCCCACANONE 
J100040I08CAAGTGGGCCCCACANONE 
Os06g0274200009-090-A02GGCCCCACANONE 
AK073155GGCCCCACASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08GGCCCCACANONE 
J065061C07GGCCCCACANONE 
J065105L08GGCCCCACANONE 
J075013C12GGCCCCACANONE 
J090010N17GGCCCCACANONE 
J090068K07GGCCCCACANONE 
J100058A21GGCCCCACANONE 
J100066C07GGCCCCACANONE 
Os06g0573600AK102756AGTGGGCCCCACACGTCTCSimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23AGTGGGCCCCACACGTCTCNONE 
J033107B05AGTGGGCCCCACACGTCTCNONE 
J090078G02AGTGGGCCCCACACGTCTCNONE 
J090099E09AGTGGGCCCCACACGTCTCNONE 
Os06g0587300AK069419CACTGACATGTGGGCCCCACAConserved hypothetical protein. 
AK121885CACTGACATGTGGGCCCCACANONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
AK110866GCCCCACAConserved hypothetical protein. 
AK110866GGCCCCACATCGGACGConserved hypothetical protein. 
Os06g0627400J075020B18GCCCCACANONE 
J090051A21GCCCCACAConserved hypothetical protein. 
Os06g0673500J100018J12GCCCCACANONE 
J100072F13GCCCCACASimilar to Ubiquitin. 
Os06g0712800AK121236GGCCCCACASimilar to Ankyrin-like protein. 
Os07g0139400AB096864TGTGGGGCCCAGCNONE 
AK065558TGTGGGGCCCAGCUDP-glucose 4-epimerase family protein. 
AK099140TGTGGGGCCCAGCNONE 
AK099183TGTGGGGCCCAGCNONE 
J013033B01TGTGGGGCCCAGCNONE 
J013157B14TGTGGGGCCCAGCNONE 
J023052E04TGTGGGGCCCAGCNONE 
J023086K05TGTGGGGCCCAGCNONE 
J023099C15TGTGGGGCCCAGCNONE 
J033025C08TGTGGGGCCCAGCNONE 
J033072I24TGTGGGGCCCAGCNONE 
J043020I04TGTGGGGCCCAGCNONE 
J090039I21TGTGGGGCCCAGCNONE 
J090078P20TGTGGGGCCCAGCNONE 
J090084C18TGTGGGGCCCAGCNONE 
J100024F07TGTGGGGCCCAGCNONE 
J100054D22TGTGGGGCCCAGCNONE 
J100062O08TGTGGGGCCCAGCNONE 
Os07g0154300009-070-E08GGCCCCACACNONE 
009-077-E01GGCCCCACACNONE 
009-196-F05GGCCCCACACNONE 
AK105386GGCCCCACACConserved hypothetical protein. 
AK122093GGCCCCACACNONE 
J033124K14GGCCCCACACNONE 
J075006I22GGCCCCACACNONE 
J075185G02GGCCCCACACNONE 
J090039C02GGCCCCACACNONE 
Os07g0169600006-027-F04TGTGGGGCCCACTNONE 
006-043-C10TGTGGGGCCCACTNONE 
006-070-A04TGTGGGGCCCACTNONE 
006-081-F03TGTGGGGCCCACTNONE 
006-104-F02TGTGGGGCCCACTNONE 
012-006-D12TGTGGGGCCCACTNONE 
AK060318TGTGGGGCCCACTNONE 
AK121818TGTGGGGCCCACT2OG-Fe(II) oxygenase domain containing protein. 
J023065K01TGTGGGGCCCACTNONE 
J023086G17TGTGGGGCCCACTNONE 
J023093G16TGTGGGGCCCACTNONE 
J033024N04TGTGGGGCCCACTNONE 
J033099A15TGTGGGGCCCACTNONE 
J033107B14TGTGGGGCCCACTNONE 
J043026F14TGTGGGGCCCACTNONE 
J065043P20TGTGGGGCCCACTNONE 
J075118L16TGTGGGGCCCACTNONE 
J075162M22TGTGGGGCCCACTNONE 
J080004K13TGTGGGGCCCACTNONE 
J080024D10TGTGGGGCCCACTNONE 
J080037C21TGTGGGGCCCACTNONE 
J080039M17TGTGGGGCCCACTNONE 
J080040A03TGTGGGGCCCACTNONE 
J080044A07TGTGGGGCCCACTNONE 
J080045I07TGTGGGGCCCACTNONE 
J080052L06TGTGGGGCCCACTNONE 
J080053A20TGTGGGGCCCACTNONE 
J080060L15TGTGGGGCCCACTNONE 
J080060N22TGTGGGGCCCACTNONE 
J080062L23TGTGGGGCCCACTNONE 
J080069B19TGTGGGGCCCACTNONE 
J080086K15TGTGGGGCCCACTNONE 
J080089H16TGTGGGGCCCACTNONE 
J080089I23TGTGGGGCCCACTNONE 
J080094P07TGTGGGGCCCACTNONE 
J090032L18TGTGGGGCCCACTNONE 
J100044E09TGTGGGGCCCACTNONE 
J100045O03TGTGGGGCCCACTNONE 
J100066B11TGTGGGGCCCACTNONE 
J100069J24TGTGGGGCCCACTNONE 
Os07g0171200AK071075AGTGGGCCCCACAGalactose-1-phosphate uridyl transferase, class I family protein. 
Os07g0202400009-155-C12GGGCCCCACANONE 
AK063024GGGCCCCACAConserved hypothetical protein. 
Os07g0274400AK100692TGTGGGGCB12D family protein. 
Os07g0423000AK109714GCCCCACAMitochodrial transcription termination factor-related family protein. 
J065007I23GCCCCACANONE 
Os07g0475400AK102489GGCCCCACASimilar to Expansin-like protein A (Fragment). 
AY100694GGCCCCACANONE 
Os07g0475700006-025-E06GCCCCACACACACCNONE 
AK060076GCCCCACACACACCAuxin responsive SAUR protein family protein. 
Os07g0498300009-045-C02TCGTGGGCCCCACACNONE 
009-060-A09TCGTGGGCCCCACACNONE 
009-121-C04TCGTGGGCCCCACACNONE 
009-157-G09TCGTGGGCCCCACACNONE 
009-197-B02TCGTGGGCCCCACACNONE 
AK059124TCGTGGGCCCCACACConserved hypothetical protein. 
AK119800TCGTGGGCCCCACACNONE 
J065184M18TCGTGGGCCCCACACNONE 
J075009G21TCGTGGGCCCCACACNONE 
J075013O03TCGTGGGCCCCACACNONE 
J075061C22TCGTGGGCCCCACACNONE 
J075094E12TCGTGGGCCCCACACNONE 
J075148C01TCGTGGGCCCCACACNONE 
Os07g0504601J065068H15GCCCCACAConserved hypothetical protein. 
J065095H08GCCCCACANONE 
Os07g0561300AK072982ACCGGGCCCCACACGCyclin-like F-box domain containing protein. 
J023149I22ACCGGGCCCCACACGNONE 
J065149C18ACCGGGCCCCACACGNONE 
J065166N15ACCGGGCCCCACACGNONE 
J075011J01ACCGGGCCCCACACGNONE 
J075013I05ACCGGGCCCCACACGNONE 
J075039H11ACCGGGCCCCACACGNONE 
J075067J09ACCGGGCCCCACACGNONE 
J075084E08ACCGGGCCCCACACGNONE 
J075085E12ACCGGGCCCCACACGNONE 
J075090D11ACCGGGCCCCACACGNONE 
J075092D12ACCGGGCCCCACACGNONE 
J075126N17ACCGGGCCCCACACGNONE 
J075179F01ACCGGGCCCCACACGNONE 
J075184P21ACCGGGCCCCACACGNONE 
Os07g0603700Os07g0603700TGTGGGGCSimilar to Cytochrome P-450. 
Os07g0637300AF323611CTCGGCCCCACANONE 
AK069157CTCGGCCCCACANONE 
J023007C01CTCGGCCCCACANONE 
Os07g0661400006-083-E05CCCGGCCCCACACGNONE 
006-084-B12CCCGGCCCCACACGNONE 
006-096-B03CCCGGCCCCACACGNONE 
009-013-C12CCCGGCCCCACACGNONE 
009-017-C10CCCGGCCCCACACGNONE 
009-027-A02CCCGGCCCCACACGNONE 
009-035-A06CCCGGCCCCACACGNONE 
009-047-H11CCCGGCCCCACACGNONE 
009-050-B11CCCGGCCCCACACGNONE 
009-051-C02CCCGGCCCCACACGNONE 
009-089-G06CCCGGCCCCACACGNONE 
009-091-C05CCCGGCCCCACACGNONE 
009-095-B11CCCGGCCCCACACGNONE 
009-151-C01CCCGGCCCCACACGNONE 
009-154-F06CCCGGCCCCACACGNONE 
009-169-F02CCCGGCCCCACACGNONE 
009-171-G01CCCGGCCCCACACGNONE 
009-179-F07CCCGGCCCCACACGNONE 
013-018-H06CCCGGCCCCACACGNONE 
013-024-E05CCCGGCCCCACACGNONE 
013-038-F09CCCGGCCCCACACGNONE 
013-099-F06CCCGGCCCCACACGNONE 
014-042-E09CCCGGCCCCACACGNONE 
014-086-C02CCCGGCCCCACACGNONE 
014-093-B08CCCGGCCCCACACGNONE 
015-039-G11CCCGGCCCCACACGNONE 
016-036-E05CCCGGCCCCACACGNONE 
AK068814CCCGGCCCCACACGNONE 
AK102682CCCGGCCCCACACGNONE 
AK105973CCCGGCCCCACACGNONE 
AK107202CCCGGCCCCACACGConserved hypothetical protein. 
J053035N21CCCGGCCCCACACGNONE 
J053099D11CCCGGCCCCACACGNONE 
J065023B18CCCGGCCCCACACGNONE 
J065031M15CCCGGCCCCACACGNONE 
J065035G23CCCGGCCCCACACGNONE 
J065060M18CCCGGCCCCACACGNONE 
J065073J18CCCGGCCCCACACGNONE 
J065103E20CCCGGCCCCACACGNONE 
J065105N19CCCGGCCCCACACGNONE 
J065137A08CCCGGCCCCACACGNONE 
J065152K09CCCGGCCCCACACGNONE 
J065156M12CCCGGCCCCACACGNONE 
J065162G23CCCGGCCCCACACGNONE 
J065162L13CCCGGCCCCACACGNONE 
J065163H16CCCGGCCCCACACGNONE 
J065165E06CCCGGCCCCACACGNONE 
J065171J04CCCGGCCCCACACGNONE 
J065180L23CCCGGCCCCACACGNONE 
J065183K23CCCGGCCCCACACGNONE 
J065186H13CCCGGCCCCACACGNONE 
J065195D10CCCGGCCCCACACGNONE 
J065209G11CCCGGCCCCACACGNONE 
J075006J08CCCGGCCCCACACGNONE 
J075112O07CCCGGCCCCACACGNONE 
J080301H14CCCGGCCCCACACGNONE 
J100058C17CCCGGCCCCACACGNONE 
J100077I23CCCGGCCCCACACGNONE 
J100080I24CCCGGCCCCACACGNONE 
Os07g0679300AK065079CACTGACATGTGGGCCCCACANONE 
AK099229CACTGACATGTGGGCCCCACASimilar to Alpha-galactosidase precursor (EC 3.2.1.22) (Melibiase) (Alpha-D- galactoside galactohydrolase). 
J013033F05CACTGACATGTGGGCCCCACANONE 
J013049N18CACTGACATGTGGGCCCCACANONE 
J013071C14CACTGACATGTGGGCCCCACANONE 
J013088P15CACTGACATGTGGGCCCCACANONE 
J013092D24CACTGACATGTGGGCCCCACANONE 
J013093O14CACTGACATGTGGGCCCCACANONE 
J023095E17CACTGACATGTGGGCCCCACANONE 
J043005E21CACTGACATGTGGGCCCCACANONE 
J043015E06CACTGACATGTGGGCCCCACANONE 
J043027P22CACTGACATGTGGGCCCCACANONE 
J065038B15CACTGACATGTGGGCCCCACANONE 
J065073M21CACTGACATGTGGGCCCCACANONE 
J065165P06CACTGACATGTGGGCCCCACANONE 
J065198I06CACTGACATGTGGGCCCCACANONE 
J075007E08CACTGACATGTGGGCCCCACANONE 
J075038I07CACTGACATGTGGGCCCCACANONE 
J075130L20CACTGACATGTGGGCCCCACANONE 
J090057G17CACTGACATGTGGGCCCCACANONE 
J100029K23CACTGACATGTGGGCCCCACANONE 
J100086O16CACTGACATGTGGGCCCCACANONE 
J100087M02CACTGACATGTGGGCCCCACANONE 
Os07g0679500AK102562GCCCCACACSimilar to Transcription factor RF2b. 
Os07g0693500AK064333GCCCCACANONE 
AK102007GCCCCACASimilar to AMP deaminase 2 (EC 3.5.4.6) (AMP deaminase isoform L). Splice isoform Ex1A-3. 
Os08g0107900014-055-C03TGTGGGGCCCGCANONE 
J065062G20TGTGGGGCCCGCANONE 
Os08g0120000006-042-E02GGCCCCACATGTCAGTGNONE 
006-051-F06GGCCCCACATGTCAGTGNONE 
006-052-G03GGCCCCACATGTCAGTGNONE 
006-095-B11GGCCCCACATGTCAGTGNONE 
AB017427GGCCCCACATGTCAGTGNONE 
AB017428GGCCCCACATGTCAGTGNONE 
AK059789GGCCCCACATGTCAGTGNONE 
AK059815GGCCCCACATGTCAGTGSuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077GGCCCCACATGTCAGTGNONE 
AK102607GGCCCCACATGTCAGTGNONE 
AK104303GGCCCCACATGTCAGTGNONE 
AK104304GGCCCCACATGTCAGTGNONE 
AK104421GGCCCCACATGTCAGTGNONE 
D10414GGCCCCACATGTCAGTGNONE 
J013170D08GGCCCCACATGTCAGTGNONE 
J023086D16GGCCCCACATGTCAGTGNONE 
J033099B04GGCCCCACATGTCAGTGNONE 
J065042P05GGCCCCACATGTCAGTGNONE 
J065144E22GGCCCCACATGTCAGTGNONE 
J065162J20GGCCCCACATGTCAGTGNONE 
J065196N13GGCCCCACATGTCAGTGNONE 
J090013B11GGCCCCACATGTCAGTGNONE 
Os08g0128200AK120428GGCCCCACACConserved hypothetical protein. 
Os08g0141300AK058337GTGTGGGGCCCACCANONE 
AK067917GTGTGGGGCCCACCAMajor sperm protein domain containing protein. 
J100039I03GTGTGGGGCCCACCANONE 
Os08g0191900AK067587CGTGTGGGGCCCATGTGGGGCCCATTProtein prenyltransferase domain containing protein. 
AK099016CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013032I08CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013050I24CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013128E05CGTGTGGGGCCCATGTGGGGCCCATTNONE 
Os08g0206900AK071409TGTGGGGCUTP--glucose-1-phosphate uridylyltransferase family protein. 
J023091K19TGTGGGGCNONE 
J033092C24TGTGGGGCNONE 
J043027K24TGTGGGGCNONE 
Os08g0282400AK100935GGTGGGCCCCACASimilar to Alpha-SNAP (Fragment). 
Os08g0305000AK102896TGTGGGGCCCACGTGGGNONE 
AK107492TGTGGGGCCCACGTGGGHypothetical protein. 
Os08g0341700J100085I02GGGCCCCACANONE 
Os08g0398000AK101910CACTGACACGTGGGCCCCACAABC transporter related domain containing protein. 
Os08g0439900AK110628TGTGGGGCCCATGTGGGTCCCACMitochondrial glycoprotein family protein. 
J065118D13TGTGGGGCCCATGTGGGTCCCACNONE 
Os08g0442300006-067-F05GCCCCACACNONE 
AK059843GCCCCACACNONE 
AK071719GCCCCACACSimilar to Calcineurin-like protein. 
AK102411GCCCCACACNONE 
J023108H11GCCCCACACNONE 
J033092P05GCCCCACACNONE 
J075109C09GCCCCACACNONE 
J090070B02GCCCCACACNONE 
J090076M14GCCCCACACNONE 
J100064B16GCCCCACACNONE 
Os08g0452500AK102438TGTGGGCCCCACACNONE 
AK106714TGTGGGCCCCACACAuxin responsive SAUR protein family protein. 
Os08g0459600AK071203GCGGGCCCCACACSimilar to 12-oxophytodienoate reductase 3 (EC 1.3.1.42) (12-oxophytodienoate- 10,11-reductase 3) (OPDA-reductase 3) (LeOPR3). 
AK104843GCGGGCCCCACACNONE 
Os08g0465400AK068332GGCCCCACAConserved hypothetical protein. 
Os08g0490100009-038-D02GTGGTGGGCCCCACANONE 
J065152E11GTGGTGGGCCCCACASimilar to PBF protein. 
J090050K03GTGGTGGGCCCCACANONE 
J090053L01GTGGTGGGCCCCACANONE 
Os08g0544800009-168-G01GTGTGGGGCCCACGCGNONE 
011-046-D09GTGTGGGGCCCACGCGNONE 
012-003-C08GTGTGGGGCCCACGCGNONE 
012-042-B06GTGTGGGGCCCACGCGNONE 
013-035-H12GTGTGGGGCCCACGCGNONE 
013-072-A10GTGTGGGGCCCACGCGNONE 
014-010-B11GTGTGGGGCCCACGCGNONE 
014-097-E06GTGTGGGGCCCACGCGNONE 
015-003-E12GTGTGGGGCCCACGCGNONE 
015-040-B04GTGTGGGGCCCACGCGNONE 
AK060536GTGTGGGGCCCACGCGNONE 
AK102666GTGTGGGGCCCACGCGNONE 
AK119660GTGTGGGGCCCACGCGPCF2. 
D87261GTGTGGGGCCCACGCGNONE 
J090049N23GTGTGGGGCCCACGCGNONE 
J090084G06GTGTGGGGCCCACGCGNONE 
Os08g0547200AK101130GGCCCCACARabGAP/TBC domain containing protein. 
AK119577GGCCCCACANONE 
Os09g0280600AK070961CGTGTGGGGCTTTTMnd1 family protein. 
J023066B13CGTGTGGGGCTTTTNONE 
Os09g0371200J100027I16CCAGGCCCCACAMajor facilitator superfamily MFS_1 protein. 
Os09g0448100AK070293TGTGGGGCCyclin-like F-box domain containing protein. 
AK070628TGTGGGGCNONE 
J023050H06TGTGGGGCNONE 
J053091I22TGTGGGGCNONE 
J065051I11TGTGGGGCNONE 
J065066L13TGTGGGGCNONE 
Os09g0465600AB107218TGTGGGGCCNONE 
AK068061TGTGGGGCCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509TGTGGGGCCNONE 
Os09g0492700AK101104TGTGGGCCCCACASimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
U95816TGTGGGCCCCACANONE 
Os09g0560600AK070937ACATGGGCCCCACACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
J013112M13ACATGGGCCCCACACNONE 
J013151P14ACATGGGCCCCACACNONE 
J023022E01ACATGGGCCCCACACNONE 
J023068C02ACATGGGCCCCACACNONE 
J023107O13ACATGGGCCCCACACNONE 
Os11g0121600009-188-D01AGGTGGGCCCCACANONE 
AK063194AGGTGGGCCCCACANONE 
AK121832AGGTGGGCCCCACAConserved hypothetical protein. 
J065041E23AGGTGGGCCCCACANONE 
J065114N21AGGTGGGCCCCACANONE 
Os11g0156600Os11g0156600CCGTGGGCCCCACATB2/DP1 and HVA22 related protein family protein. 
Os11g0175500015-087-F02TTTTGGGCCCCACANONE 
AK064320TTTTGGGCCCCACAZinc finger, RING-type domain containing protein. 
AK101592TTTTGGGCCCCACANONE 
Os11g0185800AK111265GCCCCACAConserved hypothetical protein. 
Os11g0456200AK060974GTGTGGGGCCCATGConserved hypothetical protein. 
J065010F10GTGTGGGGCCCATGNONE 
J090079O04GTGTGGGGCCCATGNONE 
Os11g0549620006-091-C11GTGTGGGGCCCACCTGNONE 
AK061321GTGTGGGGCCCACCTGSimilar to Purple acid phosphatase. 
AK106004GTGTGGGGCCCACCTGNONE 
Os11g0581900AK069449GGCCCCACATGTCAGTGProtein of unknown function UPF0005 family protein. 
Os11g0586300AK072257TGTGGGCCCCACACCCCCCACGConserved hypothetical protein. 
Os11g0635500AK067543GGCCCCACACytochrome P450 family protein. 
Os11g0657100AK061105TGTGGGGCCCACCAPeptide chain release factor 1 family protein. 
AK066354TGTGGGGCCCACCANONE 
Os11g0682600J090026G08TGTGGGGCCCATGTGGGCTConserved hypothetical protein. 
J090037N19TGTGGGGCCCATGTGGGCTNONE 
J090061M21TGTGGGGCCCATGTGGGCTNONE 
Os12g0118400009-027-G04GCGTGGGCCCCACANONE 
009-129-H07GCGTGGGCCCCACANONE 
AK062407GCGTGGGCCCCACANONE 
AK111804GCGTGGGCCCCACASimilar to Inwardly rectifying potassium channel subunit. 
J065081E04GCGTGGGCCCCACANONE 
J090095O18GCGTGGGCCCCACANONE 
Os12g0145200AK111428GTGGGACCCACGTGGGCCCCACASimilar to Protein MONOCULM 1. 
J065208D22GTGGGACCCACGTGGGCCCCACANONE 
Os12g0151500AK058389GGCCCCACASimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GGCCCCACANONE 
Os12g0245901J053079D19GCCCCACAConserved hypothetical protein. 
J065177J04GCCCCACANONE 
J065178I03GCCCCACANONE 
J065204E20GCCCCACANONE 
Os12g0407100J075130F11GCCCCACACNONE 
J075150G14GCCCCACACConserved hypothetical protein. 
J090089B20GCCCCACACNONE 
J100042D22GCCCCACACNONE 
Os12g0431100014-071-A04TGTGGGGCNONE 
AK063710TGTGGGGCAAA ATPase domain containing protein. 
Os12g0480000AK061316AGATGGGCCCCACACZinc finger, DHHC-type domain containing protein. 
Os12g0554400AK072345GACACGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os12g0560300AK060332GGCCCCACACSimilar to NTGB2 (Fragment). 
AK099125GGCCCCACACNONE 
AK099149GGCCCCACACNONE 
J023044P12GGCCCCACACNONE 
J023063C05GGCCCCACACNONE 
J043006H11GGCCCCACACNONE 
J065055C21GGCCCCACACNONE 
J065104A14GGCCCCACACNONE 
J075156I06GGCCCCACACNONE 
J090083J19GGCCCCACACNONE 
J100069A17GGCCCCACACNONE 
Os12g0560600AK059081TGTGGGGCCConserved hypothetical protein. 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
Os12g0621500AK111785TGTGGGGCCCACGTGSimilar to IRE. 
Os12g0633200009-073-D03TGTGGGGCCGTANONE 
AK062615TGTGGGGCCGTAErg28-like family protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.