version

Summary of OsREG612 (All List)

OrganismOryza sativa  
IDOsREG612  
SequenceGCCCCACC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count3026  

Entry Sequences (3026 entries)

LocusGene modelSequenceDescription
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
J033107B12CAGGTGGGCCCCACCNONE 
Os01g0229500AK108111GCCCCACCPhenylacetic acid degradation-related protein domain containing protein. 
J100034B16GCCCCACCNONE 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
Os01g0266400009-169-A06GCCCCACCNONE 
AK121188GCCCCACCConserved hypothetical protein. 
J023085H22GCCCCACCNONE 
J080301K14GCCCCACCNONE 
J080303B07GCCCCACCNONE 
J080303H21GCCCCACCNONE 
J080308F24GCCCCACCNONE 
Os01g0270100006-096-H09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-009-C10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-054-E06GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
014-085-F09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK073275GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK104155GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J033025K21GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075065H10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075143G10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J100059J02GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0277700006-081-F10AGGTGGGCCCCACCNONE 
014-013-D02AGGTGGGCCCCACCNONE 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
AK099198AGGTGGGCCCCACCNONE 
J023115B14AGGTGGGCCCCACCNONE 
J065017F22AGGTGGGCCCCACCNONE 
J065090C03AGGTGGGCCCCACCNONE 
J065165H07AGGTGGGCCCCACCNONE 
Os01g0305900Os01g0305900GGTGGGGCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0314000015-084-B08GCCCCACCNONE 
AK102427GCCCCACCNONE 
AK106418GCCCCACCNONE 
Os01g0331100J090084H20GCCCCACCNONE 
Os01g0355500AK100317GGTGGGGCTolA family protein. 
AK119920GGTGGGGCNONE 
Os01g0369000AK064940GCCCCACCSimilar to Cullin-1. 
AK104340GCCCCACCNONE 
AY336990GCCCCACCNONE 
J013000P07GCCCCACCNONE 
J013056B18GCCCCACCNONE 
J013056B20GCCCCACCNONE 
J013098C09GCCCCACCNONE 
J013099E23GCCCCACCNONE 
J023007E10GCCCCACCNONE 
J023064L04GCCCCACCNONE 
J023119B15GCCCCACCNONE 
J023126O19GCCCCACCNONE 
J033120G16GCCCCACCNONE 
J043007K19GCCCCACCNONE 
J065037I22GCCCCACCNONE 
J065051D18GCCCCACCNONE 
J065073N09GCCCCACCNONE 
J065084K20GCCCCACCNONE 
J065115C15GCCCCACCNONE 
J065115M01GCCCCACCNONE 
J065121O10GCCCCACCNONE 
J065197H21GCCCCACCNONE 
J065211L23GCCCCACCNONE 
J065214M19GCCCCACCNONE 
J090006F13GCCCCACCNONE 
J090012M21GCCCCACCNONE 
J090029M05GCCCCACCNONE 
J090048P16GCCCCACCNONE 
J090051H13GCCCCACCNONE 
J090062C14GCCCCACCNONE 
J090072F21GCCCCACCNONE 
J090085D11GCCCCACCNONE 
J090090N24GCCCCACCNONE 
J090095K17GCCCCACCNONE 
J090099H12GCCCCACCNONE 
J100031B11GCCCCACCNONE 
J100053C15GCCCCACCNONE 
J100075F19GCCCCACCNONE 
J100087L22GCCCCACCNONE 
Os01g0371500009-137-G05GGTGGGGCNONE 
AK062937GGTGGGGCSimilar to Glutathione-S-transferase 19E50. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0580300AK063468GCGGGCCCCACCTGTCConserved hypothetical protein. 
Os01g0581300AK066182GGTGGGGCSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015GGTGGGGCNONE 
Os01g0588700AK066951GCCCCACCProtein of unknown function DUF572 family protein. 
AK071911GCCCCACCNONE 
J013059D18GCCCCACCNONE 
J013090C12GCCCCACCNONE 
J090043F17GCCCCACCNONE 
Os01g0667900013-097-A02GCGTCGCGCGGGCCCCACCNONE 
014-011-C01GCGTCGCGCGGGCCCCACCNONE 
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein. 
J065156F10GCGTCGCGCGGGCCCCACCNONE 
J065163D22GCGTCGCGCGGGCCCCACCNONE 
J065197J04GCGTCGCGCGGGCCCCACCNONE 
J075122C02GCGTCGCGCGGGCCCCACCNONE 
J100047L16GCGTCGCGCGGGCCCCACCNONE 
Os01g0672400AK060901GCCCCACCCGNONE 
AK061329GCCCCACCCGDrought induced 19 family protein. 
AK101922GCCCCACCCGNONE 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0693800006-060-A01GCCCCACCTGTCNONE 
006-074-B11GCCCCACCTGTCNONE 
AK073138GCCCCACCTGTCSimilar to Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS). 
AK109336GCCCCACCTGTCNONE 
J033024E01GCCCCACCTGTCNONE 
Os01g0700500AK072715GGTGGGGCCytochrome P450 family protein. 
AK119264GGTGGGGCNONE 
Os01g0716200AK062106TCTGGCCCCACCIQ calmodulin-binding region domain containing protein. 
AK098920TCTGGCCCCACCNONE 
J013002N06TCTGGCCCCACCNONE 
J013050O19TCTGGCCCCACCNONE 
J013074N19TCTGGCCCCACCNONE 
J013127F17TCTGGCCCCACCNONE 
J013155C17TCTGGCCCCACCNONE 
J013158K07TCTGGCCCCACCNONE 
J053086D01TCTGGCCCCACCNONE 
Os01g0730300AK101207GGTGGGGCGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GGTGGGGCGGGCCCCNONE 
Os01g0749400AK064990GGTGGGGCNONE 
AK067731GGTGGGGCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775GGTGGGGCNONE 
J023001B06GGTGGGGCNONE 
Os01g0757200AB092485GCCCCACCNONE 
AK060666GCCCCACCNONE 
AK060714GCCCCACCNONE 
AK099350GCCCCACCNONE 
AK101713GCCCCACCSimilar to GA 2-oxidase 4. 
Os01g0757400AB110177GCCGGCCCCACCAACNONE 
AB110177GCGGGCCCCACCAACNONE 
AK058626GCCGGCCCCACCAACNONE 
AK058626GCGGGCCCCACCAACNONE 
AK102585GCCGGCCCCACCAACNONE 
AK102585GCGGGCCCCACCAACNONE 
AK105474GCCGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK105474GCGGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
J033098E22GCCGGCCCCACCAACNONE 
J033098E22GCGGGCCCCACCAACNONE 
J033105O19GCCGGCCCCACCAACNONE 
J033105O19GCGGGCCCCACCAACNONE 
J065019C21GCCGGCCCCACCAACNONE 
J065019C21GCGGGCCCCACCAACNONE 
J090082H11GCCGGCCCCACCAACNONE 
J090082H11GCGGGCCCCACCAACNONE 
J100050B19GCCGGCCCCACCAACNONE 
J100050B19GCGGGCCCCACCAACNONE 
J100078H19GCCGGCCCCACCAACNONE 
J100078H19GCGGGCCCCACCAACNONE 
Os01g0758400AK059301CAGGTGGGGCCCNONE 
AK071777CAGGTGGGGCCCSimilar to Phosphatidate cytidylyltransferase (EC 2.7.7.41) (CDP-diglyceride synthetase) (CDP-diglyceride pyrophosphorylase) (CDP-diacylglycerol synthase) (CDS) (CTP:phosphatidate cytidylyltransferase) (CDP-DAG synthase) (CDP-DG synthetase). 
Os01g0767600AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
J013131M12GGTGGGGCCCACGGNONE 
J023027B15GGTGGGGCCCACGGNONE 
J023059I06GGTGGGGCCCACGGNONE 
J023095L05GGTGGGGCCCACGGNONE 
J033033E20GGTGGGGCCCACGGNONE 
J033105F24GGTGGGGCCCACGGNONE 
J033148N05GGTGGGGCCCACGGNONE 
J065060H14GGTGGGGCCCACGGNONE 
J090093E17GGTGGGGCCCACGGNONE 
Os01g0778700AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
Os01g0780500AF225922GGCCCCACCTGTCNONE 
AK068498GGCCCCACCTGTCSCAMP family protein. 
J013157H06GGCCCCACCTGTCNONE 
J033088P18GGCCCCACCTGTCNONE 
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein. 
Os01g0797800013-017-E01GGTGGGGCNONE 
AK122155GGTGGGGCConserved hypothetical protein. 
Os01g0812200003-009-E06GGTGGGGCCCACCTNONE 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AK104334GGTGGGGCCCACCTNONE 
J013030E13GGTGGGGCCCACCTNONE 
J013169M21GGTGGGGCCCACCTNONE 
J023012J16GGTGGGGCCCACCTNONE 
J023103F22GGTGGGGCCCACCTNONE 
J023123A01GGTGGGGCCCACCTNONE 
J023131F07GGTGGGGCCCACCTNONE 
J023146I01GGTGGGGCCCACCTNONE 
J033040K02GGTGGGGCCCACCTNONE 
J033079F06GGTGGGGCCCACCTNONE 
J033105G06GGTGGGGCCCACCTNONE 
J033117E08GGTGGGGCCCACCTNONE 
J043030C01GGTGGGGCCCACCTNONE 
J053043H16GGTGGGGCCCACCTNONE 
J053061H01GGTGGGGCCCACCTNONE 
J065044A03GGTGGGGCCCACCTNONE 
J065068E12GGTGGGGCCCACCTNONE 
J065069D09GGTGGGGCCCACCTNONE 
J065143M19GGTGGGGCCCACCTNONE 
J065193C10GGTGGGGCCCACCTNONE 
J065209D07GGTGGGGCCCACCTNONE 
J090083C17GGTGGGGCCCACCTNONE 
J090086G06GGTGGGGCCCACCTNONE 
J090093I09GGTGGGGCCCACCTNONE 
J100023G21GGTGGGGCCCACCTNONE 
J100025D15GGTGGGGCCCACCTNONE 
J100034B13GGTGGGGCCCACCTNONE 
J100040F10GGTGGGGCCCACCTNONE 
J100051E15GGTGGGGCCCACCTNONE 
J100056L08GGTGGGGCCCACCTNONE 
J100057H04GGTGGGGCCCACCTNONE 
J100085K20GGTGGGGCCCACCTNONE 
J100088G21GGTGGGGCCCACCTNONE 
Os01g0813400006-025-B06GTGGTGGGGCNONE 
006-030-C07GTGGTGGGGCNONE 
006-068-F06GTGGTGGGGCNONE 
006-096-E09GTGGTGGGGCNONE 
006-097-B11GTGGTGGGGCNONE 
006-104-H02GTGGTGGGGCNONE 
AK062251GTGGTGGGGCNONE 
AK065370GTGGTGGGGCSimilar to ADP-ribosylation factor 1. 
J013022G24GTGGTGGGGCNONE 
J013104C07GTGGTGGGGCNONE 
J023074M17GTGGTGGGGCNONE 
J043027C07GTGGTGGGGCNONE 
J065026K05GTGGTGGGGCNONE 
J065103I01GTGGTGGGGCNONE 
J090025M17GTGGTGGGGCNONE 
J100027L03GTGGTGGGGCNONE 
J100054I20GTGGTGGGGCNONE 
Os01g0835500AK100241GCCCCACCSimilar to Respiratory burst oxidase protein. 
Os01g0838725J065088G05GGCCCCACCTGNONE 
J065135D24GGCCCCACCTGConserved hypothetical protein. 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0847300AK071164GCCCCACCGCACProtein of unknown function DUF588 family protein. 
AK104027GCCCCACCGCACNONE 
Os01g0858900AK107493GACGGCCCCACCTGTCGlycosyl transferase, family 29 protein. 
J065097H23GACGGCCCCACCTGTCNONE 
J100070A02GACGGCCCCACCTGTCNONE 
J100072M10GACGGCCCCACCTGTCNONE 
Os01g0860700009-026-D05GGTGGGGCCCACANONE 
AK062402GGTGGGGCCCACAConserved hypothetical protein. 
Os01g0865100016-066-A05AGTGGGCCCCACCNONE 
016-066-A05TCCGGGCCCCACCNONE 
AK065779AGTGGGCCCCACCNONE 
AK065779TCCGGGCCCCACCNONE 
AK071410AGTGGGCCCCACCSimilar to Uricase (Fragment). 
AK071410TCCGGGCCCCACCSimilar to Uricase (Fragment). 
J013039E23AGTGGGCCCCACCNONE 
J013039E23TCCGGGCCCCACCNONE 
J023024I07AGTGGGCCCCACCNONE 
J023024I07TCCGGGCCCCACCNONE 
J065160J15AGTGGGCCCCACCNONE 
J065160J15TCCGGGCCCCACCNONE 
J090052J17AGTGGGCCCCACCNONE 
J090052J17TCCGGGCCCCACCNONE 
Os01g0867900AK061366ACTGACAGGTGGGGCCProtein of unknown function DUF502 family protein. 
Os01g0869000AK067351CGGGTGGGGCCCACCGCCCACGCCCAAACNONE 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0870100AK067564CACTGACAGGTGGGGCProtein of unknown function DUF1012 family protein. 
AK072312CACTGACAGGTGGGGCNONE 
AK103428CACTGACAGGTGGGGCNONE 
Os01g0874700011-001-F02ACGTGGGCCCCACCNONE 
012-048-H01ACGTGGGCCCCACCNONE 
012-094-B02ACGTGGGCCCCACCNONE 
AK073077ACGTGGGCCCCACCNONE 
AK105447ACGTGGGCCCCACCNONE 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
J100026G07ACGTGGGCCCCACCNONE 
J100030F07ACGTGGGCCCCACCNONE 
J100066J18ACGTGGGCCCCACCNONE 
J100077G12ACGTGGGCCCCACCNONE 
J100081K23ACGTGGGCCCCACCNONE 
Os01g0884400AK072566GGTGGGGCCCU box domain containing protein. 
Os01g0897200AK061505GGGCCCCACCTGTCAGTGNONE 
AK065055GGGCCCCACCTGTCAGTGNONE 
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GGGCCCCACCTGTCAGTGNONE 
AK121862GGGCCCCACCTGTCAGTGNONE 
J013001J04GGGCCCCACCTGTCAGTGNONE 
J033103A19GGGCCCCACCTGTCAGTGNONE 
J075005P18GGGCCCCACCTGTCAGTGNONE 
J090027D12GGGCCCCACCTGTCAGTGNONE 
J090032M01GGGCCCCACCTGTCAGTGNONE 
J090079K10GGGCCCCACCTGTCAGTGNONE 
J100018O17GGGCCCCACCTGTCAGTGNONE 
J100080H14GGGCCCCACCTGTCAGTGNONE 
J100088D08GGGCCCCACCTGTCAGTGNONE 
Os01g0904200AK068432GGCCCCACCProtein kinase-like domain containing protein. 
J100027C22GGCCCCACCNONE 
J100064A19GGCCCCACCNONE 
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CACTGACAGGTGGGGCCGGANONE 
J013109E03CACTGACAGGTGGGGCCGGANONE 
J023081J12CACTGACAGGTGGGGCCGGANONE 
J023091E24CACTGACAGGTGGGGCCGGANONE 
J033022A01CACTGACAGGTGGGGCCGGANONE 
J033074C13CACTGACAGGTGGGGCCGGANONE 
J065199E03CACTGACAGGTGGGGCCGGANONE 
J075172O04CACTGACAGGTGGGGCCGGANONE 
J090007G18CACTGACAGGTGGGGCCGGANONE 
J090052B17CACTGACAGGTGGGGCCGGANONE 
J090074H01CACTGACAGGTGGGGCCGGANONE 
J100043J09CACTGACAGGTGGGGCCGGANONE 
J100059J05CACTGACAGGTGGGGCCGGANONE 
Os01g0931300012-055-E05GGCCCCACCNONE 
012-055-E05GGGCCCCACCNONE 
AK068196GGCCCCACCTafazzin family protein. 
AK068196GGGCCCCACCTafazzin family protein. 
AK099213GGCCCCACCNONE 
AK099213GGGCCCCACCNONE 
Os01g0939600AK068569GGTGGGGCCSimilar to Glycerol-3-phosphate dehydrogenase-like protein (Fragment). 
Os01g0952600AK067525CAGGTGGGGCCCAGATNONE 
AK070047CAGGTGGGGCCCAGATSimilar to LacZ (Fragment). 
Os02g0102900012-093-F04GGTGGGGCCNONE 
AK070603GGTGGGGCCSimilar to RuBisCO subunit binding-protein beta subunit, chloroplast (60 kDa chaperonin beta subunit) (CPN-60 beta) (Fragment). 
AK101537GGTGGGGCCNONE 
J013021H14GGTGGGGCCNONE 
J013162G08GGTGGGGCCNONE 
J023001E11GGTGGGGCCNONE 
J023059D06GGTGGGGCCNONE 
J023064K16GGTGGGGCCNONE 
J033022K15GGTGGGGCCNONE 
J033025O05GGTGGGGCCNONE 
J033035H05GGTGGGGCCNONE 
J033037A05GGTGGGGCCNONE 
J033066D15GGTGGGGCCNONE 
J033073N13GGTGGGGCCNONE 
J033088A22GGTGGGGCCNONE 
J033111I24GGTGGGGCCNONE 
J033114F06GGTGGGGCCNONE 
J033120I01GGTGGGGCCNONE 
J043001I24GGTGGGGCCNONE 
J090049O14GGTGGGGCCNONE 
J090061B20GGTGGGGCCNONE 
J090063P20GGTGGGGCCNONE 
J090073G18GGTGGGGCCNONE 
Os02g0109200AK108815GGCCCCACCNONE 
J100030O18GGCCCCACCNONE 
Os02g0118400012-047-C10GCCCCACCNONE 
AK064002GCCCCACCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75). 
AK101004GCCCCACCNONE 
J065022L23GCCCCACCNONE 
J065087F24GCCCCACCNONE 
Os02g0121100012-035-F06GGCCCCACCCGNONE 
013-031-H05GGCCCCACCCGNONE 
013-058-E11GGCCCCACCCGNONE 
014-010-D01GGCCCCACCCGNONE 
AK070711GGCCCCACCCGConserved hypothetical protein. 
AK119758GGCCCCACCCGNONE 
J013033G12GGCCCCACCCGNONE 
J023007M16GGCCCCACCCGNONE 
J023020K20GGCCCCACCCGNONE 
J023061H10GGCCCCACCCGNONE 
J033027H20GGCCCCACCCGNONE 
J033051E18GGCCCCACCCGNONE 
J090005F12GGCCCCACCCGNONE 
J090017A20GGCCCCACCCGNONE 
J090018G11GGCCCCACCCGNONE 
J090062C18GGCCCCACCCGNONE 
J100027N10GGCCCCACCCGNONE 
J100032L14GGCCCCACCCGNONE 
J100045C14GGCCCCACCCGNONE 
J100061M09GGCCCCACCCGNONE 
J100062K11GGCCCCACCCGNONE 
J100064H11GGCCCCACCCGNONE 
J100074H16GGCCCCACCCGNONE 
J100082N01GGCCCCACCCGNONE 
Os02g0123200016-017-F04AGGTGGGCCCCACCTGNONE 
J033057C03AGGTGGGCCCCACCTGNONE 
J033087C11AGGTGGGCCCCACCTGNONE 
J033108J20AGGTGGGCCCCACCTGNONE 
J043015P08AGGTGGGCCCCACCTGNONE 
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE 
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE 
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE 
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE 
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE 
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE 
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE 
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE 
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE 
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE 
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE 
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE 
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE 
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE 
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE 
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE 
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE 
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE 
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE 
Os02g0129800AK109213GTGGTGGGGCCConserved hypothetical protein. 
Os02g0137800AK060530ACCGGGCCCCACCCCCCAConserved hypothetical protein. 
AK101629ACCGGGCCCCACCCCCCANONE 
J065195A10ACCGGGCCCCACCCCCCANONE 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
Os02g0173100AK066680GCCCCACCCGNONE 
AK100596GCCCCACCCGSimilar to Cytochrome P450 97B3 (EC 1.14.-.-). 
J023106P10GCCCCACCCGNONE 
Os02g0177700AK119941CAAGTGGGCCCCACCProtein of unknown function DUF588 family protein. 
Os02g0186500AK068056GGGCCCCACCSimilar to Protein kinase-like protein. 
AK099031GGGCCCCACCNONE 
J013111A12GGGCCCCACCNONE 
J013127K13GGGCCCCACCNONE 
J013132O11GGGCCCCACCNONE 
J023056A11GGGCCCCACCNONE 
J023078M08GGGCCCCACCNONE 
J033081F07GGGCCCCACCNONE 
J090079E24GGGCCCCACCNONE 
J090097I02GGGCCCCACCNONE 
Os02g0202600AK068376ACTGGGCCCCACCTGNONE 
AK099277ACTGGGCCCCACCTGNONE 
AK101844ACTGGGCCCCACCTGTetratricopeptide-like helical domain containing protein. 
J080001G13ACTGGGCCCCACCTGNONE 
J080011J23ACTGGGCCCCACCTGNONE 
J080015F12ACTGGGCCCCACCTGNONE 
J080017J03ACTGGGCCCCACCTGNONE 
J080030J24ACTGGGCCCCACCTGNONE 
J080038H02ACTGGGCCCCACCTGNONE 
J080041G13ACTGGGCCCCACCTGNONE 
J080044B13ACTGGGCCCCACCTGNONE 
J080044L10ACTGGGCCCCACCTGNONE 
J080046H11ACTGGGCCCCACCTGNONE 
J080057J01ACTGGGCCCCACCTGNONE 
J080062E13ACTGGGCCCCACCTGNONE 
J080062N11ACTGGGCCCCACCTGNONE 
J080063C17ACTGGGCCCCACCTGNONE 
J080064K11ACTGGGCCCCACCTGNONE 
J080064N09ACTGGGCCCCACCTGNONE 
J080067C17ACTGGGCCCCACCTGNONE 
J080067C23ACTGGGCCCCACCTGNONE 
J080069J21ACTGGGCCCCACCTGNONE 
J080070L23ACTGGGCCCCACCTGNONE 
J080085N15ACTGGGCCCCACCTGNONE 
J080094F03ACTGGGCCCCACCTGNONE 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0219900004-018-E11CCGTGGGCCCCACCCCCCACACNONE 
AK060915CCGTGGGCCCCACCCCCCACACNONE 
AK099194CCGTGGGCCCCACCCCCCACACNONE 
AK104206CCGTGGGCCCCACCCCCCACACNONE 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07CCGTGGGCCCCACCCCCCACACNONE 
Os02g0282900AK121560GGTGGGGCCSimilar to 68 kDa protein HP68. 
Os02g0460200004-018-C06GGCCCCACCNONE 
004-018-C06GGGCCCCACCNONE 
AK060911GGCCCCACCNONE 
AK060911GGGCCCCACCNONE 
AK065150GGCCCCACCConserved hypothetical protein. 
AK065150GGGCCCCACCConserved hypothetical protein. 
AK104536GGCCCCACCNONE 
AK104536GGGCCCCACCNONE 
J013002B08GGCCCCACCNONE 
J013002B08GGGCCCCACCNONE 
J075002P07GGCCCCACCNONE 
J075002P07GGGCCCCACCNONE 
J080003O09GGCCCCACCNONE 
J080003O09GGGCCCCACCNONE 
J080022O16GGCCCCACCNONE 
J080022O16GGGCCCCACCNONE 
J080027J03GGCCCCACCNONE 
J080027J03GGGCCCCACCNONE 
J080040A05GGCCCCACCNONE 
J080040A05GGGCCCCACCNONE 
J080051N22GGCCCCACCNONE 
J080051N22GGGCCCCACCNONE 
J080072G20GGCCCCACCNONE 
J080072G20GGGCCCCACCNONE 
J080077E08GGCCCCACCNONE 
J080077E08GGGCCCCACCNONE 
J080086I15GGCCCCACCNONE 
J080086I15GGGCCCCACCNONE 
J080087C19GGCCCCACCNONE 
J080087C19GGGCCCCACCNONE 
J080096E18GGCCCCACCNONE 
J080096E18GGGCCCCACCNONE 
Os02g0475300AK072737CCCCCGCGTCGTGGGCCCCACCTGNONE 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
Os02g0491400AK073233CCCGGCCCCACCTGTCSimilar to Peptidylprolyl isomerase. 
J090046J15CCCGGCCCCACCTGTCNONE 
Os02g0498650J075129C20GGCCCCACCTGConserved hypothetical protein. 
J090063B16GGCCCCACCTGNONE 
J090081H04GGCCCCACCTGNONE 
J090087C03GGCCCCACCTGNONE 
Os02g0559300AK100088AGTGGGCCCCACCCCGTCCGANONE 
AK121206AGTGGGCCCCACCCCGTCCGAProtein kinase-like domain containing protein. 
J023003H24AGTGGGCCCCACCCCGTCCGANONE 
J023088A16AGTGGGCCCCACCCCGTCCGANONE 
J023100K01AGTGGGCCCCACCCCGTCCGANONE 
J023127H24AGTGGGCCCCACCCCGTCCGANONE 
Os02g0564000AJ486976GGTGGGGCCCACCTGTCNONE 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
J065021E14GGTGGGGCCCACCTGTCNONE 
J065139E02GGTGGGGCCCACCTGTCNONE 
J065165G05GGTGGGGCCCACCTGTCNONE 
J065181H16GGTGGGGCCCACCTGTCNONE 
J065217K07GGTGGGGCCCACCTGTCNONE 
J065218L13GGTGGGGCCCACCTGTCNONE 
J100082K21GGTGGGGCCCACCTGTCNONE 
J100084K19GGTGGGGCCCACCTGTCNONE 
Os02g0564100006-072-A11GACAGGTGGGCCCCACCNONE 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK105951GACAGGTGGGCCCCACCNONE 
J100045C15GACAGGTGGGCCCCACCNONE 
Os02g0566400AK101019GGGCCCCACCTGConserved hypothetical protein. 
Os02g0574600AK059246CCACGCGTGCCCCACCConserved hypothetical protein. 
Os02g0574800AK108451GTGGTGGGGCConserved hypothetical protein. 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0608500AK071922GACGGCCCCACCCGNONE 
AK099756GACGGCCCCACCCGSimilar to Ankyrin-kinase protein (Fragment). 
Os02g0629000009-047-E10CCCGGGCCCCACCCGNONE 
AK062480CCCGGGCCCCACCCGProtein of unknown function DUF584 family protein. 
Os02g0634700AK071869GCCCCACCACNONE 
J013129B13GCCCCACCACNONE 
J013134D24GCCCCACCACNONE 
Os02g0649300014-043-A05GGTGGGGCCCACGCGTNONE 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0653900006-024-H11GGTGGGGCGGTGGGCTNONE 
006-069-F05GGTGGGGCGGTGGGCTNONE 
012-005-H01GGTGGGGCGGTGGGCTNONE 
AK064950GGTGGGGCGGTGGGCTSimilar to Avr9/Cf-9 rapidly elicited protein 14 (Fragment). 
AK098925GGTGGGGCGGTGGGCTNONE 
AK104793GGTGGGGCGGTGGGCTNONE 
AK106154GGTGGGGCGGTGGGCTNONE 
J013000P22GGTGGGGCGGTGGGCTNONE 
J013002P22GGTGGGGCGGTGGGCTNONE 
J013072L24GGTGGGGCGGTGGGCTNONE 
J013110J23GGTGGGGCGGTGGGCTNONE 
J013126I23GGTGGGGCGGTGGGCTNONE 
J013160D23GGTGGGGCGGTGGGCTNONE 
J023056H01GGTGGGGCGGTGGGCTNONE 
J033058I09GGTGGGGCGGTGGGCTNONE 
J065183H09GGTGGGGCGGTGGGCTNONE 
J065214P06GGTGGGGCGGTGGGCTNONE 
J075071L23GGTGGGGCGGTGGGCTNONE 
J090042C11GGTGGGGCGGTGGGCTNONE 
J090057H07GGTGGGGCGGTGGGCTNONE 
J090071O22GGTGGGGCGGTGGGCTNONE 
J100029M07GGTGGGGCGGTGGGCTNONE 
J100040O18GGTGGGGCGGTGGGCTNONE 
J100041P12GGTGGGGCGGTGGGCTNONE 
J100047J02GGTGGGGCGGTGGGCTNONE 
J100063L09GGTGGGGCGGTGGGCTNONE 
J100065B12GGTGGGGCGGTGGGCTNONE 
J100066N05GGTGGGGCGGTGGGCTNONE 
J100080O21GGTGGGGCGGTGGGCTNONE 
J100083F13GGTGGGGCGGTGGGCTNONE 
J100087G04GGTGGGGCGGTGGGCTNONE 
J100090J20GGTGGGGCGGTGGGCTNONE 
J100090N08GGTGGGGCGGTGGGCTNONE 
Os02g0667000AK058849GCCCCACCComplex 1 LYR protein family protein. 
Os02g0673000AK108650GCCCCACCProtein of unknown function UPF0005 family protein. 
Os02g0689200011-024-D04GCCCCACCNONE 
AK065336GCCCCACCNONE 
AK071254GCCCCACCNONE 
J013000O22GCCCCACCNONE 
J023087G23GCCCCACCNONE 
J033095E21GCCCCACCNONE 
J033113F12GCCCCACCNONE 
J033124F02GCCCCACCNONE 
J065070A01GCCCCACCNONE 
J065129C05GCCCCACCNONE 
J065165M19GCCCCACCNONE 
J090015K07GCCCCACCNONE 
J090016L11GCCCCACCNONE 
J090066D21GCCCCACCNONE 
J090075M20GCCCCACCNONE 
Os02g0715300006-052-F10GGCCCCACCNONE 
006-099-G08GGCCCCACCNONE 
006-120-A02GGCCCCACCNONE 
009-114-D11GGCCCCACCNONE 
009-134-G11GGCCCCACCNONE 
009-151-H05GGCCCCACCNONE 
009-194-A09GGCCCCACCNONE 
AK059816GGCCCCACCConserved hypothetical protein. 
AK069489GGCCCCACCNONE 
J023024J01GGCCCCACCNONE 
J065087M04GGCCCCACCNONE 
J065089E20GGCCCCACCNONE 
J065137K15GGCCCCACCNONE 
Os02g0741100AK068712GCCCCACCSimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK068712GGTGGGGCCCACASimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK071144GCCCCACCNONE 
AK071144GGTGGGGCCCACANONE 
J065056A02GCCCCACCNONE 
J065056A02GGTGGGGCCCACANONE 
J065212F10GCCCCACCNONE 
J065212F10GGTGGGGCCCACANONE 
J080005J10GCCCCACCNONE 
J080005J10GGTGGGGCCCACANONE 
J080013A11GCCCCACCNONE 
J080013A11GGTGGGGCCCACANONE 
J080015E01GCCCCACCNONE 
J080015E01GGTGGGGCCCACANONE 
J080022G23GCCCCACCNONE 
J080022G23GGTGGGGCCCACANONE 
J080025C13GCCCCACCNONE 
J080025C13GGTGGGGCCCACANONE 
J080026P14GCCCCACCNONE 
J080026P14GGTGGGGCCCACANONE 
J080027D22GCCCCACCNONE 
J080027D22GGTGGGGCCCACANONE 
J080027G13GCCCCACCNONE 
J080027G13GGTGGGGCCCACANONE 
J080027L23GCCCCACCNONE 
J080027L23GGTGGGGCCCACANONE 
J080027N23GCCCCACCNONE 
J080027N23GGTGGGGCCCACANONE 
J080028F21GCCCCACCNONE 
J080028F21GGTGGGGCCCACANONE 
J080028J18GCCCCACCNONE 
J080028J18GGTGGGGCCCACANONE 
J080028P22GCCCCACCNONE 
J080028P22GGTGGGGCCCACANONE 
J080038P04GCCCCACCNONE 
J080038P04GGTGGGGCCCACANONE 
J080042M11GCCCCACCNONE 
J080042M11GGTGGGGCCCACANONE 
J080043B19GCCCCACCNONE 
J080043B19GGTGGGGCCCACANONE 
J080045J23GCCCCACCNONE 
J080045J23GGTGGGGCCCACANONE 
J080047B06GCCCCACCNONE 
J080047B06GGTGGGGCCCACANONE 
J080052F04GCCCCACCNONE 
J080052F04GGTGGGGCCCACANONE 
J080057F01GCCCCACCNONE 
J080057F01GGTGGGGCCCACANONE 
J080057G03GCCCCACCNONE 
J080057G03GGTGGGGCCCACANONE 
J080060H12GCCCCACCNONE 
J080060H12GGTGGGGCCCACANONE 
J080061L12GCCCCACCNONE 
J080061L12GGTGGGGCCCACANONE 
J080062J17GCCCCACCNONE 
J080062J17GGTGGGGCCCACANONE 
J080062M22GCCCCACCNONE 
J080062M22GGTGGGGCCCACANONE 
J080072C01GCCCCACCNONE 
J080072C01GGTGGGGCCCACANONE 
J080075F01GCCCCACCNONE 
J080075F01GGTGGGGCCCACANONE 
J080076A09GCCCCACCNONE 
J080076A09GGTGGGGCCCACANONE 
J080076I01GCCCCACCNONE 
J080076I01GGTGGGGCCCACANONE 
J080077D01GCCCCACCNONE 
J080077D01GGTGGGGCCCACANONE 
J080077F19GCCCCACCNONE 
J080077F19GGTGGGGCCCACANONE 
J080079L19GCCCCACCNONE 
J080079L19GGTGGGGCCCACANONE 
J080088B03GCCCCACCNONE 
J080088B03GGTGGGGCCCACANONE 
J080090J15GCCCCACCNONE 
J080090J15GGTGGGGCCCACANONE 
J080092J21GCCCCACCNONE 
J080092J21GGTGGGGCCCACANONE 
J080095J12GCCCCACCNONE 
J080095J12GGTGGGGCCCACANONE 
J090012C05GCCCCACCNONE 
J090012C05GGTGGGGCCCACANONE 
J090039K19GCCCCACCNONE 
J090039K19GGTGGGGCCCACANONE 
J090078L12GCCCCACCNONE 
J090078L12GGTGGGGCCCACANONE 
Os02g0744200AF247162GCCCCACCCGNONE 
AK073572GCCCCACCCGAlpha-expansin OsEXPA5. 
AK107334GCCCCACCCGNONE 
J065006L24GCCCCACCCGNONE 
J065184I10GCCCCACCCGNONE 
J065205G12GCCCCACCCGNONE 
J090051J23GCCCCACCCGNONE 
Os02g0744700AF395537GGTGGGGCCCACTTGNONE 
AJ308110GGTGGGGCCCACTTGNONE 
AK066446GGTGGGGCCCACTTGSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0774300AK065228GACGTGGCGCCCCACCGCCCAGCCSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0778200AK065948TCTGGGCCCCACCAminoacyl-tRNA synthetase, class I family protein. 
Os02g0781700006-066-G01GGCCCCACCTGTCAGTGGNONE 
009-034-D03GGCCCCACCTGTCAGTGGNONE 
009-194-D04GGCCCCACCTGTCAGTGGNONE 
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein. 
AK063223GGCCCCACCTGTCAGTGGNONE 
AY224477GGCCCCACCTGTCAGTGGNONE 
J013045H09GGCCCCACCTGTCAGTGGNONE 
J013061I22GGCCCCACCTGTCAGTGGNONE 
J013071F11GGCCCCACCTGTCAGTGGNONE 
J023130H07GGCCCCACCTGTCAGTGGNONE 
J043036K23GGCCCCACCTGTCAGTGGNONE 
J065010N07GGCCCCACCTGTCAGTGGNONE 
J065219I01GGCCCCACCTGTCAGTGGNONE 
J090073I15GGCCCCACCTGTCAGTGGNONE 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0817500AK072707CGGGCCCCACCACKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135CGGGCCCCACCACNONE 
U46758CGGGCCCCACCACNONE 
Os02g0817600006-085-G03GACAGGTGGGGCCCAGGNONE 
AJ748648GACAGGTGGGGCCCAGGNONE 
AK069892GACAGGTGGGGCCCAGGAUX/IAA protein family protein. 
AK104501GACAGGTGGGGCCCAGGNONE 
AK104802GACAGGTGGGGCCCAGGNONE 
J013027H10GACAGGTGGGGCCCAGGNONE 
J013106L07GACAGGTGGGGCCCAGGNONE 
J013118N15GACAGGTGGGGCCCAGGNONE 
J013131H01GACAGGTGGGGCCCAGGNONE 
J013170C08GACAGGTGGGGCCCAGGNONE 
J023060C13GACAGGTGGGGCCCAGGNONE 
J033024K10GACAGGTGGGGCCCAGGNONE 
J033052I08GACAGGTGGGGCCCAGGNONE 
J090010H15GACAGGTGGGGCCCAGGNONE 
J090011J11GACAGGTGGGGCCCAGGNONE 
J090038P15GACAGGTGGGGCCCAGGNONE 
J090060B02GACAGGTGGGGCCCAGGNONE 
J100079J16GACAGGTGGGGCCCAGGNONE 
Os03g0113900AK107900GTGTGGGCCCCACCProtein of unknown function DUF584 family protein. 
AK119700GTGTGGGCCCCACCNONE 
Os03g0116800012-097-D10GCCCCACCNONE 
016-024-H10GCCCCACCNONE 
AK066955GCCCCACCConserved hypothetical protein. 
AK068678GCCCCACCNONE 
AK104839GCCCCACCNONE 
J013033G16GCCCCACCNONE 
J013091C10GCCCCACCNONE 
J013158H22GCCCCACCNONE 
J023106K11GCCCCACCNONE 
J065051O15GCCCCACCNONE 
J065129G22GCCCCACCNONE 
J075001K02GCCCCACCNONE 
J075011O03GCCCCACCNONE 
J075024K04GCCCCACCNONE 
J075026E07GCCCCACCNONE 
J075037O14GCCCCACCNONE 
J075071D17GCCCCACCNONE 
J075084M05GCCCCACCNONE 
J075114B06GCCCCACCNONE 
J075128C23GCCCCACCNONE 
J075153A13GCCCCACCNONE 
J075158A15GCCCCACCNONE 
J075165P09GCCCCACCNONE 
J075167M21GCCCCACCNONE 
J075170F11GCCCCACCNONE 
J075186F12GCCCCACCNONE 
J075186L13GCCCCACCNONE 
J075189A01GCCCCACCNONE 
J075192D19GCCCCACCNONE 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
AK106076ACGCGTGGGCCCCACCNONE 
J023003G19ACGCGTGGGCCCCACCNONE 
Os03g0137400AK072057GCCCCACCNONE 
AK101118GCCCCACCProtein of unknown function DUF221 domain containing protein. 
J013129L02GCCCCACCNONE 
J033025H22GCCCCACCNONE 
J033034L15GCCCCACCNONE 
J033044F21GCCCCACCNONE 
J033046F15GCCCCACCNONE 
J033101I17GCCCCACCNONE 
J033150K16GCCCCACCNONE 
J065042G12GCCCCACCNONE 
J065083F17GCCCCACCNONE 
J100044G19GCCCCACCNONE 
Os03g0138600Os03g0138600CGGGTGGGGCCProtein of unknown function DUF810 family protein. 
Os03g0138600GCCGGGCCCCACCACProtein of unknown function DUF810 family protein. 
Os03g0138700009-045-H03GCCCCACCNONE 
AK072119GCCCCACCTGF-beta receptor, type I/II extracellular region family protein. 
J013025I16GCCCCACCNONE 
J013123D02GCCCCACCNONE 
J023048B09GCCCCACCNONE 
J023048C09GCCCCACCNONE 
J065027O03GCCCCACCNONE 
J065028C03GCCCCACCNONE 
J065080H22GCCCCACCNONE 
J065102H03GCCCCACCNONE 
J065137P14GCCCCACCNONE 
J065143C23GCCCCACCNONE 
J065168G06GCCCCACCNONE 
J065192N07GCCCCACCNONE 
J065205I11GCCCCACCNONE 
J075040F03GCCCCACCNONE 
J075052H20GCCCCACCNONE 
J075118L18GCCCCACCNONE 
J075126C19GCCCCACCNONE 
J075173L07GCCCCACCNONE 
Os03g0141200AK068968GCCCCACCGCGCGCGACGTGGCSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092GCCCCACCGCGCGCGACGTGGCNONE 
J023003L18GCCCCACCGCGCGCGACGTGGCNONE 
J023022K18GCCCCACCGCGCGCGACGTGGCNONE 
J023107H13GCCCCACCGCGCGCGACGTGGCNONE 
J023107K02GCCCCACCGCGCGCGACGTGGCNONE 
Os03g0143700AK066360GCCCCACCCGConserved hypothetical protein. 
J013066M09GCCCCACCCGNONE 
J023087N24GCCCCACCCGNONE 
Os03g0152000AK102357GGCCCCACCHeavy metal transport/detoxification protein domain containing protein. 
J023072F16GGCCCCACCNONE 
J033091H19GGCCCCACCNONE 
J065037B07GGCCCCACCNONE 
J065087E11GGCCCCACCNONE 
J065098H09GGCCCCACCNONE 
J065105L15GGCCCCACCNONE 
J065165N20GGCCCCACCNONE 
J065166C14GGCCCCACCNONE 
J065183M01GGCCCCACCNONE 
J065187C11GGCCCCACCNONE 
J075001H11GGCCCCACCNONE 
J075044D12GGCCCCACCNONE 
J075088L19GGCCCCACCNONE 
J075124A10GGCCCCACCNONE 
J075155D14GGCCCCACCNONE 
J075173I10GGCCCCACCNONE 
J090009D11GGCCCCACCNONE 
J090056G24GGCCCCACCNONE 
J100028I24GGCCCCACCNONE 
J100029D09GGCCCCACCNONE 
Os03g0157900J043036K05GCCCCACCCACCAACNONE 
Os03g0161000AK121425CTGACAGGTGGGGCNONE 
AK121425CTGACAGGTGGGGCNONE 
AK121425CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
Os03g0169500Os03g0169500CTGGGGCCCCACCTGTCSimilar to Cellulose synthase-like A4. 
Os03g0169600004-013-C11CCGTGGGCCCCACCACNONE 
011-035-C04CCGTGGGCCCCACCACNONE 
AK060900CCGTGGGCCCCACCACNONE 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
AK104523CCGTGGGCCCCACCACNONE 
AY224429CCGTGGGCCCCACCACNONE 
J013026L11CCGTGGGCCCCACCACNONE 
J013026N04CCGTGGGCCCCACCACNONE 
J013030D16CCGTGGGCCCCACCACNONE 
J013049P17CCGTGGGCCCCACCACNONE 
J013099D17CCGTGGGCCCCACCACNONE 
J013114M09CCGTGGGCCCCACCACNONE 
J013124F12CCGTGGGCCCCACCACNONE 
J013131J05CCGTGGGCCCCACCACNONE 
J023025M09CCGTGGGCCCCACCACNONE 
J090042J08CCGTGGGCCCCACCACNONE 
J090094F11CCGTGGGCCCCACCACNONE 
J100051I17CCGTGGGCCCCACCACNONE 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0184100AK067400GGTGGGGCCCAGCHypothetical protein. 
J013030J24GGTGGGGCCCAGCNONE 
J013037M23GGTGGGGCCCAGCNONE 
J013106B15GGTGGGGCCCAGCNONE 
J013130H10GGTGGGGCCCAGCNONE 
J013152B03GGTGGGGCCCAGCNONE 
J013157J24GGTGGGGCCCAGCNONE 
J013157K04GGTGGGGCCCAGCNONE 
J033093A19GGTGGGGCCCAGCNONE 
J033106E24GGTGGGGCCCAGCNONE 
J090043G12GGTGGGGCCCAGCNONE 
Os03g0188200AK058578GGTGGGGCCCACTZinc finger, RING-type domain containing protein. 
Os03g0201600AK067825GGTGGGGCCCACCTGTCNONE 
Os03g0201700AK102580GGTGGGGCHypothetical protein. 
J033098B09GGTGGGGCNONE 
J065068H09GGTGGGGCNONE 
J100048D12GGTGGGGCNONE 
J100049K21GGTGGGGCNONE 
Os03g0207400AK072292GCCCCACCACSimilar to Protein phosphatase 2C-like. 
Os03g0251500AK101151GGCCCCACCNONE 
AK119298GGCCCCACCSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0255200AK058212CAGGTGGGGCCCACTCCNONE 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0262700006-072-A10GGGCCCCACCNONE 
006-075-F12GGGCCCCACCNONE 
006-088-D03GGGCCCCACCNONE 
AK061109GGGCCCCACCHarpin-induced 1 domain containing protein. 
AK099159GGGCCCCACCNONE 
AK099322GGGCCCCACCNONE 
AK104530GGGCCCCACCNONE 
J053024C09GGGCCCCACCNONE 
J075142N24GGGCCCCACCNONE 
J100064C18GGGCCCCACCNONE 
Os03g0278200AK103544GCGGGCCCCACCACNAD-dependent epimerase/dehydratase family protein. 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCATGGGCCCCACCTGNONE 
J023079P21CCATGGGCCCCACCTGNONE 
J023120G14CCATGGGCCCCACCTGNONE 
J090042F16CCATGGGCCCCACCTGNONE 
Os03g0293500015-054-D06GCCCCACCNONE 
AK101594GCCCCACCSimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC) (Fragment). 
AK119500GCCCCACCNONE 
J033051F01GCCCCACCNONE 
J090058D14GCCCCACCNONE 
J100037N18GCCCCACCNONE 
J100042J23GCCCCACCNONE 
J100053E20GCCCCACCNONE 
J100060G07GCCCCACCNONE 
U27350GCCCCACCNONE 
Os03g0300300AK099693GGTGGGGCWD40-like domain containing protein. 
Os03g0302800AK061293GCGGGCCCCACCCCCCAConserved hypothetical protein. 
AK061293GGGCCCCACCConserved hypothetical protein. 
Os03g0305400009-198-D04GCCCCACCNONE 
009-198-D04GGTGGGGCCCACCTGTCNONE 
013-012-C06GCCCCACCNONE 
013-012-C06GGTGGGGCCCACCTGTCNONE 
014-034-D01GCCCCACCNONE 
014-034-D01GGTGGGGCCCACCTGTCNONE 
AK071397GCCCCACCUniversal stress protein (Usp) family protein. 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
J023012O22GCCCCACCNONE 
J023012O22GGTGGGGCCCACCTGTCNONE 
J023097A13GCCCCACCNONE 
J023097A13GGTGGGGCCCACCTGTCNONE 
J023107P16GCCCCACCNONE 
J023107P16GGTGGGGCCCACCTGTCNONE 
J023113C14GCCCCACCNONE 
J023113C14GGTGGGGCCCACCTGTCNONE 
Os03g0323100009-108-G02CGGGTGGGGCGTCGGATCNONE 
AK062803CGGGTGGGGCGTCGGATCHypothetical protein. 
AK070776CGGGTGGGGCGTCGGATCNONE 
Os03g0323200AK067323GATCCGACGCCCCACCCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0327100006-119-C12GCCCCACCNONE 
011-018-C10GCCCCACCNONE 
AK065989GCCCCACCSimilar to CUC1. 
J013046E14GCCCCACCNONE 
J065066N20GCCCCACCNONE 
Os03g0335300AK098846GGTGGGGCCCACCCNONE 
AK098891GGTGGGGCCCACCCNONE 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847GGTGGGGCCCACCCNONE 
AK121413GGTGGGGCCCACCCNONE 
Os03g0337600AF119232CAAGTGGGCCCCACCNONE 
AK070859CAAGTGGGCCCCACCSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CAAGTGGGCCCCACCNONE 
J013147M17CAAGTGGGCCCCACCNONE 
J065083M01CAAGTGGGCCCCACCNONE 
J065199H24CAAGTGGGCCCCACCNONE 
Os03g0339400AK065305AAAAGCCCCACCHaem peroxidase, plant/fungal/bacterial family protein. 
J013002O02AAAAGCCCCACCNONE 
Os03g0370000AK100033CCTGGGCCCCACCACSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
AK100033GGTGGGGCCCACCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0374400016-027-B12GGCCGGGCCCCACCCGNONE 
AK069719GGCCGGGCCCCACCCGConserved hypothetical protein. 
J023020L05GGCCGGGCCCCACCCGNONE 
J023026H16GGCCGGGCCCCACCCGNONE 
J033025P22GGCCGGGCCCCACCCGNONE 
J075016I21GGCCGGGCCCCACCCGNONE 
J090015G21GGCCGGGCCCCACCCGNONE 
Os03g0374500Os03g0374500GGCCGGGCCCCACCCGHypothetical protein. 
Os03g0403600016-047-G02GGTGGGGCNONE 
AK064220GGTGGGGCvon Willebrand factor, type A domain containing protein. 
Os03g0437600006-051-A10GCCCCACCNONE 
006-059-D02GCCCCACCNONE 
006-074-A04GCCCCACCNONE 
006-089-G11GCCCCACCNONE 
006-095-H02GCCCCACCNONE 
006-118-B09GCCCCACCNONE 
009-156-G04GCCCCACCNONE 
015-015-G01GCCCCACCNONE 
016-089-D06GCCCCACCNONE 
AK061303GCCCCACCNONE 
AK070773GCCCCACCNONE 
AK073355GCCCCACCSimilar to Hydrolase. 
AK104138GCCCCACCNONE 
AK104400GCCCCACCNONE 
J033030A08GCCCCACCNONE 
J065056E01GCCCCACCNONE 
J065061F16GCCCCACCNONE 
J065075L21GCCCCACCNONE 
J065102E09GCCCCACCNONE 
J065175K12GCCCCACCNONE 
J065197D14GCCCCACCNONE 
J065199D08GCCCCACCNONE 
J075029F13GCCCCACCNONE 
J075042F07GCCCCACCNONE 
J075056E23GCCCCACCNONE 
J075077L02GCCCCACCNONE 
J075086N01GCCCCACCNONE 
J075095I08GCCCCACCNONE 
J075099N21GCCCCACCNONE 
J075099O09GCCCCACCNONE 
J075109L06GCCCCACCNONE 
J075114H11GCCCCACCNONE 
J075120E09GCCCCACCNONE 
J075137F08GCCCCACCNONE 
J075154D10GCCCCACCNONE 
J075158A18GCCCCACCNONE 
J075197N10GCCCCACCNONE 
Os03g0588600AK109508GGCCCCACCFrigida-like family protein. 
Os03g0588700Os03g0588700GGCCCCACCConserved hypothetical protein. 
Os03g0633800AK073044CCCGGGCCCCACCTGTCSimilar to IAA6 (Fragment). 
AK073044GCCCCACCCGSimilar to IAA6 (Fragment). 
J065038L22CCCGGGCCCCACCTGTCNONE 
J065038L22GCCCCACCCGNONE 
J065185C13CCCGGGCCCCACCTGTCNONE 
J065185C13GCCCCACCCGNONE 
Os03g0639800AK103237GGCCCCACCSnf7 family protein. 
J023036L02GGCCCCACCNONE 
J033108L13GGCCCCACCNONE 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
AK108010AGTGGGCCCCACCACNONE 
Os03g0670200011-069-G05TGTGGGCCCCACCGATCCGNONE 
AK069553TGTGGGCCCCACCGATCCGSimilar to YJR013Wp (Fragment). 
J023020O11TGTGGGCCCCACCGATCCGNONE 
J023114J22TGTGGGCCCCACCGATCCGNONE 
J100084F17TGTGGGCCCCACCGATCCGNONE 
J100087A11TGTGGGCCCCACCGATCCGNONE 
Os03g0684400AK100086AACTGGGCCCCACCMg2+ transporter protein, CorA-like family protein. 
Os03g0687800AK106820GCCCCACCTGTCConserved hypothetical protein. 
Os03g0698900013-074-A08CGGGCCCCACCAACNONE 
AK073303CGGGCCCCACCAACAlkaline phytoceramidase family protein. 
AK103953CGGGCCCCACCAACNONE 
J033024P22CGGGCCCCACCAACNONE 
J065194N16CGGGCCCCACCAACNONE 
J065195O11CGGGCCCCACCAACNONE 
J075020F03CGGGCCCCACCAACNONE 
J075032P18CGGGCCCCACCAACNONE 
J075037H13CGGGCCCCACCAACNONE 
J075147I01CGGGCCCCACCAACNONE 
J075187B13CGGGCCCCACCAACNONE 
J100043G08CGGGCCCCACCAACNONE 
J100060L06CGGGCCCCACCAACNONE 
J100063O21CGGGCCCCACCAACNONE 
J100066O13CGGGCCCCACCAACNONE 
J100072K20CGGGCCCCACCAACNONE 
J100083G21CGGGCCCCACCAACNONE 
J100085D07CGGGCCCCACCAACNONE 
Os03g0701500009-150-F12GCCCCACCNONE 
AK063166GCCCCACCGNS1/SUR4 membrane protein family protein. 
Os03g0712200AK073205GTGGTGGGGCCCAACZinc finger, RanBP2-type domain containing protein. 
AK098968GTGGTGGGGCCCAACNONE 
Os03g0716200Os03g0716200GGCCCCACCConserved hypothetical protein. 
Os03g0722000AK069866GTGGTGGGGCNONE 
Os03g0741400AK121838GGCCCCACCSimilar to SUSIBA2. 
J100032E12GGCCCCACCNONE 
Os03g0746400AK063445GCCCCACCProtein prenyltransferase domain containing protein. 
AK070923GCCCCACCNONE 
J065008K24GCCCCACCNONE 
Os03g0761200011-038-H02GGTGGGGCNONE 
015-055-D12GGTGGGGCNONE 
016-032-B01GGTGGGGCNONE 
AK064205GGTGGGGCNONE 
AK101534GGTGGGGCAnkyrin repeat containing protein. 
J075033L23GGTGGGGCNONE 
J075046K09GGTGGGGCNONE 
J075134K18GGTGGGGCNONE 
J075157I10GGTGGGGCNONE 
Os03g0784500AK109744ACAGGTGGGGCCCACAANONE 
AK109744GGTGGGCCCCACCACNONE 
Os03g0793500AK103407GCCCGGCCCCACCACNONE 
AK103407GGCCCCACCTGTCNONE 
AK121620GCCCGGCCCCACCACSimilar to Casein kinase-like protein. 
AK121620GGCCCCACCTGTCSimilar to Casein kinase-like protein. 
Os03g0796600003-113-D10TCGTGGGCCCCACCNONE 
011-076-B12TCGTGGGCCCCACCNONE 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
J075105C03TCGTGGGCCCCACCNONE 
J080036O17TCGTGGGCCCCACCNONE 
J080064E16TCGTGGGCCCCACCNONE 
J080069E03TCGTGGGCCCCACCNONE 
J080079E23TCGTGGGCCCCACCNONE 
J090036H20TCGTGGGCCCCACCNONE 
J100029L10TCGTGGGCCCCACCNONE 
J100055G09TCGTGGGCCCCACCNONE 
Os03g0800500006-075-C12TCCGGCCCCACCNONE 
AK061104TCCGGCCCCACCNONE 
AK070229TCCGGCCCCACCPutative small multi-drug export family protein. 
J065152L13TCCGGCCCCACCNONE 
Os03g0805300004-009-D11GGCCCCACCNONE 
005-014-F01GGCCCCACCNONE 
009-019-H04GGCCCCACCNONE 
AK060885GGCCCCACCSimilar to Phosphoprotein phosphatase 2A isoform 4. 
AK099257GGCCCCACCNONE 
AK100350GGCCCCACCNONE 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
J013059D03CAGGTGGGCCCCACCNONE 
J013099J05CAGGTGGGCCCCACCNONE 
J013106M06CAGGTGGGCCCCACCNONE 
J013151H03CAGGTGGGCCCCACCNONE 
J023003G18CAGGTGGGCCCCACCNONE 
J023038M11CAGGTGGGCCCCACCNONE 
J023056M17CAGGTGGGCCCCACCNONE 
J023105F22CAGGTGGGCCCCACCNONE 
J033023F17CAGGTGGGCCCCACCNONE 
J033028J21CAGGTGGGCCCCACCNONE 
J033131J19CAGGTGGGCCCCACCNONE 
J033132E06CAGGTGGGCCCCACCNONE 
J090007L14CAGGTGGGCCCCACCNONE 
J090011H02CAGGTGGGCCCCACCNONE 
J090026D20CAGGTGGGCCCCACCNONE 
J090029H09CAGGTGGGCCCCACCNONE 
J090033B18CAGGTGGGCCCCACCNONE 
J090039J02CAGGTGGGCCCCACCNONE 
J090050D17CAGGTGGGCCCCACCNONE 
J090050I15CAGGTGGGCCCCACCNONE 
J090063G20CAGGTGGGCCCCACCNONE 
J090064J21CAGGTGGGCCCCACCNONE 
J090071E19CAGGTGGGCCCCACCNONE 
J090075F10CAGGTGGGCCCCACCNONE 
Os03g0822300AK060050GGTGGGGCRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
J065198I20GGTGGGGCNONE 
Os03g0823800AK058223GTTGGTGGGGCNONE 
Os03g0833900AK073655GGTGGGGCCCSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800GGTGGGGCCCNONE 
AK104068GGTGGGGCCCNONE 
J075031J11GGTGGGGCCCNONE 
J075051N01GGTGGGGCCCNONE 
J075166D18GGTGGGGCCCNONE 
J075171E14GGTGGGGCCCNONE 
Os03g0836200009-165-F07GGGTGGGCCCCACCTGNONE 
015-092-G01GGGTGGGCCCCACCTGNONE 
AK058443GGGTGGGCCCCACCTGNONE 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
AK101225GGGTGGGCCCCACCTGNONE 
J013092A03GGGTGGGCCCCACCTGNONE 
J013095N17GGGTGGGCCCCACCTGNONE 
J013147J18GGGTGGGCCCCACCTGNONE 
J023019O10GGGTGGGCCCCACCTGNONE 
J023065N18GGGTGGGCCCCACCTGNONE 
J033113E18GGGTGGGCCCCACCTGNONE 
J033133E03GGGTGGGCCCCACCTGNONE 
J065059J15GGGTGGGCCCCACCTGNONE 
J065075O11GGGTGGGCCCCACCTGNONE 
J065119I07GGGTGGGCCCCACCTGNONE 
J065171J03GGGTGGGCCCCACCTGNONE 
J090016D21GGGTGGGCCCCACCTGNONE 
J090081O03GGGTGGGCCCCACCTGNONE 
J100040G18GGGTGGGCCCCACCTGNONE 
J100040L10GGGTGGGCCCCACCTGNONE 
J100055H13GGGTGGGCCCCACCTGNONE 
J100059I22GGGTGGGCCCCACCTGNONE 
J100078A08GGGTGGGCCCCACCTGNONE 
Os03g0837900AK068346GCCCCACCStreptomyces cyclase/dehydrase family protein. 
Os03g0858400AK102968GTTGGTGGGGCCGGGWD40-like domain containing protein. 
Os03g0858700006-024-D11GGTGGGGCTGGGCCGTCNONE 
AK061723GGTGGGGCTGGGCCGTCProtein of unknown function DUF1499 family protein. 
AK064976GGTGGGGCTGGGCCGTCNONE 
J013001B23GGTGGGGCTGGGCCGTCNONE 
Os04g0118100006-100-G08GGCCCCACCNONE 
AK058463GGCCCCACCNONE 
J065078C03GGCCCCACCNONE 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0266400AK065632GTGGTGGGCCCCACCACNONE 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK072046GTGGTGGGCCCCACCACNONE 
AK105688GTGGTGGGCCCCACCACNONE 
Os04g0271700AK059031ATCCAACGGCCCCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110ATCCAACGGCCCCACCNONE 
AK099145ATCCAACGGCCCCACCNONE 
J065045A03ATCCAACGGCCCCACCNONE 
Os04g0282400AK120187GCTGGGCCCCACCSimilar to FPF1 protein-like (RAA1). 
J013034O10GCTGGGCCCCACCNONE 
J013071G20GCTGGGCCCCACCNONE 
Os04g0321700003-103-G02AGTGGGCCCCACCNONE 
AK068732AGTGGGCCCCACCSimilar to Serine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
AK099397AGTGGGCCCCACCNONE 
Os04g0382300AK071912TGCGGGCCCCACCNONE 
AK101795TGCGGGCCCCACCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0412900AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
J033027C24TGTGGGCCCCACCACNONE 
J033044C16TGTGGGCCCCACCACNONE 
J090023G03TGTGGGCCCCACCACNONE 
J090082C21TGTGGGCCCCACCACNONE 
Os04g0434400014-079-B10GCCCCACCNONE 
AK063725GCCCCACCConserved hypothetical protein. 
Os04g0456700009-080-F10CAGGTGGGCCCCACCCGNONE 
009-143-C10CAGGTGGGCCCCACCCGNONE 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
J013002D12CAGGTGGGCCCCACCCGNONE 
J065027N14CAGGTGGGCCCCACCCGNONE 
J065139E16CAGGTGGGCCCCACCCGNONE 
J065165D09CAGGTGGGCCCCACCCGNONE 
J065179D14CAGGTGGGCCCCACCCGNONE 
J065198C03CAGGTGGGCCCCACCCGNONE 
J065198L22CAGGTGGGCCCCACCCGNONE 
J075139M08CAGGTGGGCCCCACCCGNONE 
J075150D14CAGGTGGGCCCCACCCGNONE 
J075172F01CAGGTGGGCCCCACCCGNONE 
J075197F03CAGGTGGGCCCCACCCGNONE 
J090059E16CAGGTGGGCCCCACCCGNONE 
J100063J01CAGGTGGGCCCCACCCGNONE 
J100085F13CAGGTGGGCCCCACCCGNONE 
J100088O10CAGGTGGGCCCCACCCGNONE 
Os04g0462500006-073-E08GTGGTGGGGCCGTGNONE 
006-073-E08TGTGGGCCCCACCNONE 
AK062065GTGGTGGGGCCGTGNONE 
AK062065TGTGGGCCCCACCNONE 
AK071311GTGGTGGGGCCGTGSimilar to 14-3-3-like protein GF14-6. 
AK071311TGTGGGCCCCACCSimilar to 14-3-3-like protein GF14-6. 
AK071822GTGGTGGGGCCGTGNONE 
AK071822TGTGGGCCCCACCNONE 
AK099243GTGGTGGGGCCGTGNONE 
AK099243TGTGGGCCCCACCNONE 
AK101938GTGGTGGGGCCGTGNONE 
AK101938TGTGGGCCCCACCNONE 
J013056F02GTGGTGGGGCCGTGNONE 
J013056F02TGTGGGCCCCACCNONE 
J023020E08GTGGTGGGGCCGTGNONE 
J023020E08TGTGGGCCCCACCNONE 
J023085B16GTGGTGGGGCCGTGNONE 
J023085B16TGTGGGCCCCACCNONE 
J023117D08GTGGTGGGGCCGTGNONE 
J023117D08TGTGGGCCCCACCNONE 
J023133K12GTGGTGGGGCCGTGNONE 
J023133K12TGTGGGCCCCACCNONE 
J033025G04GTGGTGGGGCCGTGNONE 
J033025G04TGTGGGCCCCACCNONE 
J033052A15GTGGTGGGGCCGTGNONE 
J033052A15TGTGGGCCCCACCNONE 
J033074G16GTGGTGGGGCCGTGNONE 
J033074G16TGTGGGCCCCACCNONE 
J033090A16GTGGTGGGGCCGTGNONE 
J033090A16TGTGGGCCCCACCNONE 
J033122A07GTGGTGGGGCCGTGNONE 
J033122A07TGTGGGCCCCACCNONE 
J033133G09GTGGTGGGGCCGTGNONE 
J033133G09TGTGGGCCCCACCNONE 
J065002F16GTGGTGGGGCCGTGNONE 
J065002F16TGTGGGCCCCACCNONE 
J065030M09GTGGTGGGGCCGTGNONE 
J065030M09TGTGGGCCCCACCNONE 
J065056B11GTGGTGGGGCCGTGNONE 
J065056B11TGTGGGCCCCACCNONE 
J065115I10GTGGTGGGGCCGTGNONE 
J065115I10TGTGGGCCCCACCNONE 
J065120O09GTGGTGGGGCCGTGNONE 
J065120O09TGTGGGCCCCACCNONE 
J065124G21GTGGTGGGGCCGTGNONE 
J065124G21TGTGGGCCCCACCNONE 
J075031C14GTGGTGGGGCCGTGNONE 
J075031C14TGTGGGCCCCACCNONE 
J075040H07GTGGTGGGGCCGTGNONE 
J075040H07TGTGGGCCCCACCNONE 
J075047F04GTGGTGGGGCCGTGNONE 
J075047F04TGTGGGCCCCACCNONE 
J075065F14GTGGTGGGGCCGTGNONE 
J075065F14TGTGGGCCCCACCNONE 
J075066G20GTGGTGGGGCCGTGNONE 
J075066G20TGTGGGCCCCACCNONE 
J075105D01GTGGTGGGGCCGTGNONE 
J075105D01TGTGGGCCCCACCNONE 
J075147B04GTGGTGGGGCCGTGNONE 
J075147B04TGTGGGCCCCACCNONE 
J075149A12GTGGTGGGGCCGTGNONE 
J075149A12TGTGGGCCCCACCNONE 
J075172D07GTGGTGGGGCCGTGNONE 
J075172D07TGTGGGCCCCACCNONE 
J075190J11GTGGTGGGGCCGTGNONE 
J075190J11TGTGGGCCCCACCNONE 
J090038H18GTGGTGGGGCCGTGNONE 
J090038H18TGTGGGCCCCACCNONE 
J090087G05GTGGTGGGGCCGTGNONE 
J090087G05TGTGGGCCCCACCNONE 
J100025A10GTGGTGGGGCCGTGNONE 
J100025A10TGTGGGCCCCACCNONE 
J100025O10GTGGTGGGGCCGTGNONE 
J100025O10TGTGGGCCCCACCNONE 
J100027D02GTGGTGGGGCCGTGNONE 
J100027D02TGTGGGCCCCACCNONE 
J100027P06GTGGTGGGGCCGTGNONE 
J100027P06TGTGGGCCCCACCNONE 
J100032K04GTGGTGGGGCCGTGNONE 
J100032K04TGTGGGCCCCACCNONE 
J100056D21GTGGTGGGGCCGTGNONE 
J100056D21TGTGGGCCCCACCNONE 
J100060J08GTGGTGGGGCCGTGNONE 
J100060J08TGTGGGCCCCACCNONE 
J100063N19GTGGTGGGGCCGTGNONE 
J100063N19TGTGGGCCCCACCNONE 
J100064C14GTGGTGGGGCCGTGNONE 
J100064C14TGTGGGCCCCACCNONE 
J100064K18GTGGTGGGGCCGTGNONE 
J100064K18TGTGGGCCCCACCNONE 
J100070L21GTGGTGGGGCCGTGNONE 
J100070L21TGTGGGCCCCACCNONE 
J100072M17GTGGTGGGGCCGTGNONE 
J100072M17TGTGGGCCCCACCNONE 
J100074F21GTGGTGGGGCCGTGNONE 
J100074F21TGTGGGCCCCACCNONE 
J100087E05GTGGTGGGGCCGTGNONE 
J100087E05TGTGGGCCCCACCNONE 
U65956GTGGTGGGGCCGTGNONE 
U65956TGTGGGCCCCACCNONE 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08TCGTGGGCCCCACCCGNONE 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
J100049D17TGGTGGGCCCCACCNONE 
J100080K12TGGTGGGCCCCACCNONE 
Os04g0526800006-051-F03GGTGGGGCNONE 
AK061581GGTGGGGCGRAM domain containing protein. 
J065188M01GGTGGGGCNONE 
J100043J05GGTGGGGCNONE 
Os04g0549700AK107119GCCCCACCSimilar to Dehydration responsive element binding protein 1F (DREB1F protein). 
Os04g0559400AK106376AGATGGGCCCCACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0569900AK100392GGCCCCACCIQ calmodulin-binding region domain containing protein. 
J023086B08GGCCCCACCNONE 
Os04g0586100009-190-F11CGCGACGCGACGCCCCACCNONE 
AK063206CGCGACGCGACGCCCCACCProtein of unknown function DUF581 family protein. 
Os04g0600200AB004864GGCCCCACCACNONE 
AB007452GGCCCCACCACNONE 
AK064040GGCCCCACCACSimilar to Alternative oxidase 1a (Fragment). 
Os04g0619500011-051-B09GGTGGGGCNONE 
016-006-B12GGTGGGGCNONE 
016-012-H10GGTGGGGCNONE 
AK066247GGTGGGGCOvarian tumour, otubain domain containing protein. 
J013052H21GGTGGGGCNONE 
J033136I05GGTGGGGCNONE 
J090080J12GGTGGGGCNONE 
J100065N24GGTGGGGCNONE 
J100087L02GGTGGGGCNONE 
Os04g0673300006-055-C10CGTGTGGGTGTGGGCCCCACCCGNONE 
AK059734CGTGTGGGTGTGGGCCCCACCCGSimilar to ZmRR2 protein (Response regulator 2). 
J065006D12CGTGTGGGTGTGGGCCCCACCCGNONE 
J065218N11CGTGTGGGTGTGGGCCCCACCCGNONE 
Os04g0678300AK102779GGGCCCCACCTGTCWD40-like domain containing protein. 
J033107J24GGGCCCCACCTGTCNONE 
J065165H03GGGCCCCACCTGTCNONE 
J065186I23GGGCCCCACCTGTCNONE 
J065194C13GGGCCCCACCTGTCNONE 
J090039O08GGGCCCCACCTGTCNONE 
J100029O21GGGCCCCACCTGTCNONE 
Os04g0679800AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
AK099987GACAGGTGGGCCCCACCNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J013130B11GACAGGTGGGCCCCACCNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J065049C17GACAGGTGGGCCCCACCNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191N12GACAGGTGGGCCCCACCNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12GACAGGTGGGCCCCACCNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
J100031C07GACAGGTGGGCCCCACCNONE 
Os05g0104800006-022-G08GGTGGGGCNONE 
AK070215GGTGGGGCSimilar to Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) (eIF3 p32 subunit) (eIF3f). 
AK104207GGTGGGGCNONE 
AK104554GGTGGGGCNONE 
J023043K07GGTGGGGCNONE 
J023079C24GGTGGGGCNONE 
J033050A14GGTGGGGCNONE 
J033095G11GGTGGGGCNONE 
J033097D16GGTGGGGCNONE 
J033108J11GGTGGGGCNONE 
J053037E01GGTGGGGCNONE 
J053061I17GGTGGGGCNONE 
J065040F22GGTGGGGCNONE 
J065055B15GGTGGGGCNONE 
J065091N23GGTGGGGCNONE 
J090062J16GGTGGGGCNONE 
J100065J21GGTGGGGCNONE 
Os05g0113000AK067079TGTGGGCCCCACCTGAmino acid-binding ACT domain containing protein. 
Os05g0119000AK069359GCGTGGGCCCCACCConserved hypothetical protein 245 family protein. 
J065020A09GCGTGGGCCCCACCNONE 
J065043F11GCGTGGGCCCCACCNONE 
J065182D16GCGTGGGCCCCACCNONE 
J065211L04GCGTGGGCCCCACCNONE 
Os05g0119300004-011-B09GGCCCCACCNONE 
006-063-A03GGCCCCACCNONE 
006-077-E12GGCCCCACCNONE 
006-079-E12GGCCCCACCNONE 
006-100-B11GGCCCCACCNONE 
009-109-A12GGCCCCACCNONE 
009-123-C07GGCCCCACCNONE 
009-163-D09GGCCCCACCNONE 
009-170-D11GGCCCCACCNONE 
009-173-C01GGCCCCACCNONE 
009-192-E01GGCCCCACCNONE 
011-048-G01GGCCCCACCNONE 
AK060883GGCCCCACCNONE 
AK068289GGCCCCACCNONE 
AK071554GGCCCCACCNONE 
AK099495GGCCCCACCXYPPX repeat containing protein. 
AY348312GGCCCCACCNONE 
J013037L16GGCCCCACCNONE 
J013088P04GGCCCCACCNONE 
J013099D14GGCCCCACCNONE 
J013146E19GGCCCCACCNONE 
J013147E18GGCCCCACCNONE 
J023104E19GGCCCCACCNONE 
J023128O20GGCCCCACCNONE 
J023132D16GGCCCCACCNONE 
J023143E13GGCCCCACCNONE 
J033028F15GGCCCCACCNONE 
J033133D24GGCCCCACCNONE 
J053091M07GGCCCCACCNONE 
J075029L15GGCCCCACCNONE 
J075097M12GGCCCCACCNONE 
J075103J11GGCCCCACCNONE 
J075138J10GGCCCCACCNONE 
J075172K18GGCCCCACCNONE 
J080001C15GGCCCCACCNONE 
J080002M13GGCCCCACCNONE 
J080009K01GGCCCCACCNONE 
J080010N01GGCCCCACCNONE 
J080011D23GGCCCCACCNONE 
J080013C13GGCCCCACCNONE 
J080013M16GGCCCCACCNONE 
J080018J02GGCCCCACCNONE 
J080020F03GGCCCCACCNONE 
J080020G05GGCCCCACCNONE 
J080021D05GGCCCCACCNONE 
J080030A19GGCCCCACCNONE 
J080031A16GGCCCCACCNONE 
J080033J23GGCCCCACCNONE 
J080035H07GGCCCCACCNONE 
J080039M24GGCCCCACCNONE 
J080042B16GGCCCCACCNONE 
J080043B03GGCCCCACCNONE 
J080045G01GGCCCCACCNONE 
J080045K17GGCCCCACCNONE 
J080047A09GGCCCCACCNONE 
J080047I22GGCCCCACCNONE 
J080048M14GGCCCCACCNONE 
J080049J02GGCCCCACCNONE 
J080052C15GGCCCCACCNONE 
J080052E11GGCCCCACCNONE 
J080052M22GGCCCCACCNONE 
J080056O21GGCCCCACCNONE 
J080059J04GGCCCCACCNONE 
J080059O17GGCCCCACCNONE 
J080064N04GGCCCCACCNONE 
J080066A03GGCCCCACCNONE 
J080066I22GGCCCCACCNONE 
J080069C13GGCCCCACCNONE 
J080069J03GGCCCCACCNONE 
J080069N04GGCCCCACCNONE 
J080071A01GGCCCCACCNONE 
J080071C03GGCCCCACCNONE 
J080071J02GGCCCCACCNONE 
J080080D17GGCCCCACCNONE 
J080084O06GGCCCCACCNONE 
J080085O20GGCCCCACCNONE 
J080086H15GGCCCCACCNONE 
J080094K06GGCCCCACCNONE 
J080095C05GGCCCCACCNONE 
J080095G04GGCCCCACCNONE 
J080096F03GGCCCCACCNONE 
J080096F20GGCCCCACCNONE 
J090004H05GGCCCCACCNONE 
J090012P10GGCCCCACCNONE 
J090021B09GGCCCCACCNONE 
J090034M08GGCCCCACCNONE 
J090046G21GGCCCCACCNONE 
J090055K24GGCCCCACCNONE 
J090055L05GGCCCCACCNONE 
J090057H17GGCCCCACCNONE 
J090082K21GGCCCCACCNONE 
J100022A07GGCCCCACCNONE 
J100022M02GGCCCCACCNONE 
J100069K11GGCCCCACCNONE 
J100086C24GGCCCCACCNONE 
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor. 
D12777CCACTGACATGTGGGCCCCACCTGNONE 
J013002F13CCACTGACATGTGGGCCCCACCTGNONE 
J013029I15CCACTGACATGTGGGCCCCACCTGNONE 
J013033A10CCACTGACATGTGGGCCCCACCTGNONE 
J013035H24CCACTGACATGTGGGCCCCACCTGNONE 
J013051H21CCACTGACATGTGGGCCCCACCTGNONE 
J013098H05CCACTGACATGTGGGCCCCACCTGNONE 
J023060B04CCACTGACATGTGGGCCCCACCTGNONE 
J023130D23CCACTGACATGTGGGCCCCACCTGNONE 
J033140N08CCACTGACATGTGGGCCCCACCTGNONE 
J053039L22CCACTGACATGTGGGCCCCACCTGNONE 
J080007K21CCACTGACATGTGGGCCCCACCTGNONE 
Os05g0148600003-016-C11GGGCCCCACCCGNONE 
003-016-C11GGTGGGGCCCGTTNONE 
AK066168GGGCCCCACCCGNONE 
AK066168GGTGGGGCCCGTTNONE 
AK104336GGGCCCCACCCGSimilar to Na+/H+ antiporter. 
AK104336GGTGGGGCCCGTTSimilar to Na+/H+ antiporter. 
AY360145GGGCCCCACCCGNONE 
AY360145GGTGGGGCCCGTTNONE 
J013055J22GGGCCCCACCCGNONE 
J013055J22GGTGGGGCCCGTTNONE 
J013057M24GGGCCCCACCCGNONE 
J013057M24GGTGGGGCCCGTTNONE 
J013074N03GGGCCCCACCCGNONE 
J013074N03GGTGGGGCCCGTTNONE 
J013158A22GGGCCCCACCCGNONE 
J013158A22GGTGGGGCCCGTTNONE 
J075118H09GGGCCCCACCCGNONE 
J075118H09GGTGGGGCCCGTTNONE 
Os05g0163700AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0164100AF456329CCCCCGCGTGGGCCCCACCCGNONE 
AF456329CGGGTGGGGCCCACCCGNONE 
AK065086CCCCCGCGTGGGCCCCACCCGNONE 
AK065086CGGGTGGGGCCCACCCGNONE 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
AK072243CGGGTGGGGCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CCCCCGCGTGGGCCCCACCCGNONE 
J013001L18CGGGTGGGGCCCACCCGNONE 
J013132O12CCCCCGCGTGGGCCCCACCCGNONE 
J013132O12CGGGTGGGGCCCACCCGNONE 
J023003N09CCCCCGCGTGGGCCCCACCCGNONE 
J023003N09CGGGTGGGGCCCACCCGNONE 
Os05g0213500003-114-G10GGGTGGGCCCCACCACNONE 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
J013002L23GGGTGGGCCCCACCACNONE 
J023056H04GGGTGGGCCCCACCACNONE 
J075051G09GGGTGGGCCCCACCACNONE 
J075139N23GGGTGGGCCCCACCACNONE 
J100031B01GGGTGGGCCCCACCACNONE 
J100075M20GGGTGGGCCCCACCACNONE 
Os05g0217000AK062517GGTGGGGCCCACCProtein of unknown function DUF1070 family protein. 
J075142D02GGTGGGGCCCACCNONE 
Os05g0291700AK073234GCCCCACCNONE 
AK099865GCCCCACCConserved hypothetical protein. 
AK108453GCCCCACCNONE 
Os05g0342100AK111106TGTGGGCCCCACCWound-induced WI12 family protein. 
Os05g0350600AK066244ACCGGGCCCCACCCCACCACSimilar to Atranbp1b protein. 
AK066244GGCCCCACCSimilar to Atranbp1b protein. 
J075100E12ACCGGGCCCCACCCCACCACNONE 
J075100E12GGCCCCACCNONE 
J090024D03ACCGGGCCCCACCCCACCACNONE 
J090024D03GGCCCCACCNONE 
J100027C02ACCGGGCCCCACCCCACCACNONE 
J100027C02GGCCCCACCNONE 
J100053P05ACCGGGCCCCACCCCACCACNONE 
J100053P05GGCCCCACCNONE 
J100055P22ACCGGGCCCCACCCCACCACNONE 
J100055P22GGCCCCACCNONE 
Os05g0358000006-083-G07CCCGTGGGCCCCACCNONE 
006-083-G07CTCGGCCCCACCAACNONE 
AK061141CCCGTGGGCCCCACCNONE 
AK061141CTCGGCCCCACCAACNONE 
AK070900CCCGTGGGCCCCACCNONE 
AK070900CTCGGCCCCACCAACNONE 
AK101263CCCGTGGGCCCCACCDrought induced 19 family protein. 
AK101263CTCGGCCCCACCAACDrought induced 19 family protein. 
J023098C13CCCGTGGGCCCCACCNONE 
J023098C13CTCGGCCCCACCAACNONE 
J033032J06CCCGTGGGCCCCACCNONE 
J033032J06CTCGGCCCCACCAACNONE 
J065014A09CCCGTGGGCCCCACCNONE 
J065014A09CTCGGCCCCACCAACNONE 
J065121L01CCCGTGGGCCCCACCNONE 
J065121L01CTCGGCCCCACCAACNONE 
J065130K19CCCGTGGGCCCCACCNONE 
J065130K19CTCGGCCCCACCAACNONE 
J065208B21CCCGTGGGCCCCACCNONE 
J065208B21CTCGGCCCCACCAACNONE 
J075080G14CCCGTGGGCCCCACCNONE 
J075080G14CTCGGCCCCACCAACNONE 
J075135L01CCCGTGGGCCCCACCNONE 
J075135L01CTCGGCCCCACCAACNONE 
J075180J15CCCGTGGGCCCCACCNONE 
J075180J15CTCGGCCCCACCAACNONE 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962CAGGTGGGCCCCACCTGTCAGNONE 
J065083M07CAGGTGGGCCCCACCTGTCAGNONE 
Os05g0386900AK071425GCTGGGCCCCACCCGNONE 
AK073634GCTGGGCCCCACCCGReticulon family protein. 
Os05g0388600AK105904GGCCCCACCTGConserved hypothetical protein. 
Os05g0410800AK108312GCCCCACCACTGF-beta receptor, type I/II extracellular region family protein. 
Os05g0415400AK107330CAGGTGGGGCCCAACTSimilar to OsNAC6 protein. 
AK119651CAGGTGGGGCCCAACTNONE 
Os05g0423400AK100233GCCCCACCSimilar to PISTILLATA-like MADS box protein. 
J075063D08GCCCCACCNONE 
J075077H10GCCCCACCNONE 
J075118P06GCCCCACCNONE 
J075126P19GCCCCACCNONE 
J075162O13GCCCCACCNONE 
J075180L03GCCCCACCNONE 
J075187L07GCCCCACCNONE 
L37527GCCCCACCNONE 
Os05g0423500015-048-C11AGGTGGGCCCCACCTGTCNONE 
AK066000AGGTGGGCCCCACCTGTCProtein kinase-like domain containing protein. 
J013049L02AGGTGGGCCCCACCTGTCNONE 
Os05g0429700AK069203CCACTGACGGCTCGGCCCCACCNONE 
AK069203TCGTGGGCCCCACCACNONE 
AK103559CCACTGACGGCTCGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK103559TCGTGGGCCCCACCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0451300AK108341GGGCCCCACCTGTCAGConserved hypothetical protein. 
Os05g0480000AK061052GGTGGGGCProtein kinase domain containing protein. 
Os05g0494100AK068320GGTGGGGCCCACAAHistone-fold domain containing protein. 
Os05g0497625Os05g0497625GCCCCACCConserved hypothetical protein. 
Os05g0503300011-013-H12GGCCCCACCTGTCNONE 
011-013-H12GGTGGGGCCNONE 
012-072-B03GGCCCCACCTGTCNONE 
012-072-B03GGTGGGGCCNONE 
AK073969GGCCCCACCTGTCSimilar to Sulfite reductase (Fragment). 
AK073969GGTGGGGCCSimilar to Sulfite reductase (Fragment). 
AK100773GGCCCCACCTGTCNONE 
AK100773GGTGGGGCCNONE 
AK103289GGCCCCACCTGTCNONE 
AK103289GGTGGGGCCNONE 
J013045K07GGCCCCACCTGTCNONE 
J013045K07GGTGGGGCCNONE 
J033075F01GGCCCCACCTGTCNONE 
J033075F01GGTGGGGCCNONE 
J033125N07GGCCCCACCTGTCNONE 
J033125N07GGTGGGGCCNONE 
J033130G12GGCCCCACCTGTCNONE 
J033130G12GGTGGGGCCNONE 
Os05g0511500AK101807GCCCCACCSimilar to Lipoic acid synthase-like protein. 
Os05g0512400011-014-B07GGCCCCACCCGNONE 
AK120770GGCCCCACCCGConserved hypothetical protein. 
Os05g0533600AK067577GGTGGGGCCCAGASimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560GGTGGGGCCCAGANONE 
AY373258GGTGGGGCCCAGANONE 
Os05g0535900AK101539GGTGGGGCCCGCANONE 
AK101555GGTGGGGCCCGCAIQ calmodulin-binding region domain containing protein. 
J013047J05GGTGGGGCCCGCANONE 
Os05g0542600AK060408GGCCCCACCTGNONE 
AK101373GGCCCCACCTGMov34/MPN/PAD-1 family protein. 
J023081F17GGCCCCACCTGNONE 
J033035N15GGCCCCACCTGNONE 
J033124K20GGCCCCACCTGNONE 
Os05g0543700AK071113GGTGGGGCCCAGCCSimilar to Chaperone protein dnaJ. 
AK103912GGTGGGGCCCAGCCNONE 
Os05g0562200AK061766GGCCCCACCDrought induced 19 family protein. 
AK109438GGCCCCACCNONE 
Os05g0568600009-024-B09GGTGGGGCCCACCTGTCNONE 
AK063781GGTGGGGCCCACCTGTCProtein of unknown function DUF1645 family protein. 
J080049H14GGTGGGGCCCACCTGTCNONE 
J080062M08GGTGGGGCCCACCTGTCNONE 
J080064I07GGTGGGGCCCACCTGTCNONE 
J080068A12GGTGGGGCCCACCTGTCNONE 
J080086J10GGTGGGGCCCACCTGTCNONE 
Os05g0576300015-055-B11ACCGGCCCCACCNONE 
AK106354ACCGGCCCCACCZinc finger, CCCH-type domain containing protein. 
Os06g0125200015-099-F09GCCCCACCNONE 
AK102200GCCCCACCProtein of unknown function DUF581 family protein. 
J033030E04GCCCCACCNONE 
J033058K06GCCCCACCNONE 
J033060O13GCCCCACCNONE 
J033068B04GCCCCACCNONE 
J033087E11GCCCCACCNONE 
J033113N12GCCCCACCNONE 
J065110P15GCCCCACCNONE 
J075174B01GCCCCACCNONE 
Os06g0140700009-041-G05CTGGGGCCCCACCNONE 
AF145726CTGGGGCCCCACCNONE 
AK105150CTGGGGCCCCACCNONE 
AY206864CTGGGGCCCCACCSimilar to Homeodomain leucine zipper protein (Fragment). 
Os06g0153200AK072625GCCCCCACCGGGTGGGGCCCACCCCCACCACNONE 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0161800AK064664TGCGGCCCCACCTGProtein of unknown function DUF569 family protein. 
Os06g0171700AK103771GCGCGGGTGGTGGGGCTTGGCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20GCGCGGGTGGTGGGGCTTGGNONE 
Os06g0199300J065045H01GTGGTGGGCCCCACCCGNONE 
J075177C22GTGGTGGGCCCCACCCGNONE 
J080068H06GTGGTGGGCCCCACCCGNONE 
J090048F01GTGGTGGGCCCCACCCGNONE 
J100066F17GTGGTGGGCCCCACCCGNONE 
Os06g0219900AK058704GCCCCACCSimilar to Phi-1 protein. 
Os06g0229800AB115915GGTGGGGCCCNONE 
AB115916GGTGGGGCCCNONE 
AB115917GGTGGGGCCCNONE 
AB115918GGTGGGGCCCNONE 
AF419099GGTGGGGCCCSimilar to Starch synthase IIA. 
AK101978GGTGGGGCCCNONE 
Os06g0524900AK101846GCCCCACCCGDisease resistance protein family protein. 
AK121910GCCCCACCCGNONE 
J033069I17GCCCCACCCGNONE 
J033105O17GCCCCACCCGNONE 
Os06g0552300011-011-G12GCCACGTGGGCCCCACCNONE 
011-011-G12GGGCCCCACCNONE 
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein. 
AK101229GGGCCCCACCBZR1, transcriptional repressor family protein. 
J023061O03GCCACGTGGGCCCCACCNONE 
J023061O03GGGCCCCACCNONE 
J033031H19GCCACGTGGGCCCCACCNONE 
J033031H19GGGCCCCACCNONE 
J075103K14GCCACGTGGGCCCCACCNONE 
J075103K14GGGCCCCACCNONE 
J075108I16GCCACGTGGGCCCCACCNONE 
J075108I16GGGCCCCACCNONE 
J075194I23GCCACGTGGGCCCCACCNONE 
J075194I23GGGCCCCACCNONE 
J090008K01GCCACGTGGGCCCCACCNONE 
J090008K01GGGCCCCACCNONE 
J100062P15GCCACGTGGGCCCCACCNONE 
J100062P15GGGCCCCACCNONE 
Os06g0597000006-049-F03GGTGGGCCCCACCNONE 
006-113-H01GGTGGGCCCCACCNONE 
AK061037GGTGGGCCCCACCNONE 
AK069376GGTGGGCCCCACCSimilar to Auxin responsive protein IAA-Re. 
J023012K19GGTGGGCCCCACCNONE 
Os06g0604200AK100278TCCGGCCCCACCPhospholipase D. 
AK121264TCCGGCCCCACCNONE 
J023003G11TCCGGCCCCACCNONE 
J023012G13TCCGGCCCCACCNONE 
J023036E06TCCGGCCCCACCNONE 
J023054O05TCCGGCCCCACCNONE 
J023060H02TCCGGCCCCACCNONE 
J023073L15TCCGGCCCCACCNONE 
J023093E12TCCGGCCCCACCNONE 
J023095B08TCCGGCCCCACCNONE 
J023098K03TCCGGCCCCACCNONE 
J023109O19TCCGGCCCCACCNONE 
J023127M22TCCGGCCCCACCNONE 
J023135H10TCCGGCCCCACCNONE 
J023139M05TCCGGCCCCACCNONE 
J023145B08TCCGGCCCCACCNONE 
J043005P03TCCGGCCCCACCNONE 
J090054L01TCCGGCCCCACCNONE 
Os06g0608600006-096-D06GCCCCACCNONE 
006-113-C04GCCCCACCNONE 
009-170-C10GCCCCACCNONE 
AK061418GCCCCACCSFT2-like family protein. 
AK104440GCCCCACCNONE 
J065214B09GCCCCACCNONE 
J100025L19GCCCCACCNONE 
Os06g0609600AK072533CCTGGGCCCCACCTGEF-Hand type domain containing protein. 
AK099872CCTGGGCCCCACCTGNONE 
BT014680CCTGGGCCCCACCTGNONE 
J023008M02CCTGGGCCCCACCTGNONE 
J023127M12CCTGGGCCCCACCTGNONE 
J065049L24CCTGGGCCCCACCTGNONE 
J065102K24CCTGGGCCCCACCTGNONE 
J065205O14CCTGGGCCCCACCTGNONE 
J075127F01CCTGGGCCCCACCTGNONE 
J080033F07CCTGGGCCCCACCTGNONE 
Os06g0622300AK064549GGTGGGGCCGCANONE 
AK071559GGTGGGGCCGCANONE 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05CGCGTGGGCCCCACCACNONE 
J065100L18CGCGTGGGCCCCACCACNONE 
J065129N15CGCGTGGGCCCCACCACNONE 
J065152M08CGCGTGGGCCCCACCACNONE 
J065198M12CGCGTGGGCCCCACCACNONE 
J090077J22CGCGTGGGCCCCACCACNONE 
J100024G23CGCGTGGGCCCCACCACNONE 
J100027L01CGCGTGGGCCCCACCACNONE 
J100047C06CGCGTGGGCCCCACCACNONE 
J100055D01CGCGTGGGCCCCACCACNONE 
J100067M05CGCGTGGGCCCCACCACNONE 
J100077M16CGCGTGGGCCCCACCACNONE 
J100078M22CGCGTGGGCCCCACCACNONE 
Os06g0636700AK058562GGCCCCACCACLipolytic enzyme, G-D-S-L family protein. 
Os06g0639000AK102470CCCCCGCGGGGGGCCCCACCNONE 
J013106M02CCCCCGCGGGGGGCCCCACCNONE 
J100051K23CCCCCGCGGGGGGCCCCACCNONE 
Os06g0648500AK106895CGGGTGGGGCCCACGGConserved hypothetical protein. 
Os06g0679500AK063283GCCCCACCCGSimilar to Avr9 elicitor response-like protein. 
AK108015GCCCCACCCGNONE 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0695900011-023-F07ACTGGGCCCCACCNONE 
011-023-F07GGCCCCACCNONE 
J023143A16ACTGGGCCCCACCZinc finger, RING-type domain containing protein. 
J023143A16GGCCCCACCZinc finger, RING-type domain containing protein. 
Os06g0704700AK120907CCCCCGCGCCCCACCACNmrA-like family protein. 
AY224493CCCCCGCGCCCCACCACNONE 
Os06g0715500AK059749GCCCCACCNONE 
AK060137GCCCCACCNONE 
AK100782GCCCCACCSimilar to Translocon-associated protein alpha subunit precursor (TRAP-alpha) (Signal sequence receptor alpha subunit) (SSR-alpha). 
Os06g0715700AK121440GGCCCCACCProtein of unknown function DUF803 family protein. 
Os06g0728700AK111637CAGGTGGGGCCHomeodomain-like containing protein. 
AK119632CAGGTGGGGCCNONE 
J075015J02CAGGTGGGGCCNONE 
J075016L14CAGGTGGGGCCNONE 
J075078O03CAGGTGGGGCCNONE 
J075098O14CAGGTGGGGCCNONE 
J075171L20CAGGTGGGGCCNONE 
Os07g0136500011-084-F06CGGGTGGGGCCConserved hypothetical protein. 
J065137B11CGGGTGGGGCCNONE 
J075015A10CGGGTGGGGCCNONE 
J075048L03CGGGTGGGGCCNONE 
J075051C17CGGGTGGGGCCNONE 
J075163H13CGGGTGGGGCCNONE 
Os07g0152800AK065458GGTGGGCCCCACCTGConserved hypothetical protein. 
J013022G05GGTGGGCCCCACCTGNONE 
J013023D18GGTGGGCCCCACCTGNONE 
J013048J16GGTGGGCCCCACCTGNONE 
J013055I03GGTGGGCCCCACCTGNONE 
J013057F12GGTGGGCCCCACCTGNONE 
J023109A22GGTGGGCCCCACCTGNONE 
J023148E09GGTGGGCCCCACCTGNONE 
J033069G17GGTGGGCCCCACCTGNONE 
J033092I18GGTGGGCCCCACCTGNONE 
J033093C02GGTGGGCCCCACCTGNONE 
J033141M17GGTGGGCCCCACCTGNONE 
J043016M18GGTGGGCCCCACCTGNONE 
J090016D12GGTGGGCCCCACCTGNONE 
J090071B10GGTGGGCCCCACCTGNONE 
J090098K07GGTGGGCCCCACCTGNONE 
J100035K14GGTGGGCCCCACCTGNONE 
Os07g0160600011-014-G11CCCGGCCCCACCTGNONE 
015-033-C08CCCGGCCCCACCTGNONE 
AK065047CCCGGCCCCACCTGBeta-Ig-H3/fasciclin domain containing protein. 
AK098844CCCGGCCCCACCTGNONE 
J013000B24CCCGGCCCCACCTGNONE 
J013001I08CCCGGCCCCACCTGNONE 
J023150E13CCCGGCCCCACCTGNONE 
J033026K03CCCGGCCCCACCTGNONE 
J065093N10CCCGGCCCCACCTGNONE 
J075054B05CCCGGCCCCACCTGNONE 
J075131H23CCCGGCCCCACCTGNONE 
J090007M18CCCGGCCCCACCTGNONE 
J090029B19CCCGGCCCCACCTGNONE 
J100026A09CCCGGCCCCACCTGNONE 
Os07g0185200AK066157GGCCCCACCSimilar to Membrane related protein-like. 
Os07g0188700011-058-D09CAGGTGGGGCCCACCCNONE 
AK063957CAGGTGGGGCCCACCCNONE 
AK073755CAGGTGGGGCCCACCCSimilar to EXO. 
AK107609CAGGTGGGGCCCACCCNONE 
J033066N03CAGGTGGGGCCCACCCNONE 
Os07g0202400009-155-C12GGTGGGGCCNONE 
AK063024GGTGGGGCCConserved hypothetical protein. 
Os07g0209000AK059111CCACTGACGGTGGGGCCGGASimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319CCACTGACGGTGGGGCCGGANONE 
Os07g0240300AK072205GACGTGGCCCCACCTGConserved hypothetical protein. 
AK072205GGCCCCACCTGTCConserved hypothetical protein. 
AK098977GACGTGGCCCCACCTGNONE 
AK098977GGCCCCACCTGTCNONE 
Os07g0245100J023048C16GGGCCCCACCTGTCAGTNONE 
J023110L14GGGCCCCACCTGTCAGTNONE 
J053023B18GGGCCCCACCTGTCAGTNONE 
J053031L17GGGCCCCACCTGTCAGTNONE 
J065035I22GGGCCCCACCTGTCAGTNONE 
J065043D21GGGCCCCACCTGTCAGTNONE 
J065072L16GGGCCCCACCTGTCAGTNONE 
J065214I23GGGCCCCACCTGTCAGTNONE 
Os07g0252400AK100914GGCCCCACCSimilar to Cellulose synthase-8. 
Os07g0296100015-052-G08GGCCCCACCNONE 
J033119E16GGCCCCACCNONE 
J065147B22GGCCCCACCNONE 
J075101G03GGCCCCACCHypothetical protein. 
J075181A17GGCCCCACCNONE 
J090064H24GGCCCCACCNONE 
Os07g0410300AK108503GCGGGCCCCACCGCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0419500J065210A06GCCACGTGGGTGGGCCCCACCCCCACCCGCGCNONE 
Os07g0438800AK060412CCCGGCCCCACCTGTCAGNONE 
AK100065CCCGGCCCCACCTGTCAGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195CCCGGCCCCACCTGTCAGNONE 
AY224478CCCGGCCCCACCTGTCAGNONE 
J013160O05CCCGGCCCCACCTGTCAGNONE 
J023030C05CCCGGCCCCACCTGTCAGNONE 
J033025O04CCCGGCCCCACCTGTCAGNONE 
J033121P15CCCGGCCCCACCTGTCAGNONE 
J043034I23CCCGGCCCCACCTGTCAGNONE 
J065022N01CCCGGCCCCACCTGTCAGNONE 
J065022N02CCCGGCCCCACCTGTCAGNONE 
J065023M01CCCGGCCCCACCTGTCAGNONE 
J065101G13CCCGGCCCCACCTGTCAGNONE 
J075058P13CCCGGCCCCACCTGTCAGNONE 
J075186K10CCCGGCCCCACCTGTCAGNONE 
J075199F17CCCGGCCCCACCTGTCAGNONE 
Os07g0537300015-019-C12GCTGGGCCCCACCTGTCSimilar to Serine/threonine kinase receptor-like protein. 
J033140L16GCTGGGCCCCACCTGTCNONE 
J043034B12GCTGGGCCCCACCTGTCNONE 
Os07g0541900AK109699GTGGTGGGGCCSimilar to KI domain interacting kinase 1. 
Os07g0545400009-136-E03CGGGTGGGGCCCACCNONE 
013-015-G08CGGGTGGGGCCCACCNONE 
AK059228CGGGTGGGGCCCACCNONE 
J065040D09CGGGTGGGGCCCACCNONE 
J065051C19CGGGTGGGGCCCACCNONE 
J065139B05CGGGTGGGGCCCACCNONE 
J065160E20CGGGTGGGGCCCACCNONE 
J065207I17CGGGTGGGGCCCACCNONE 
J080319M24CGGGTGGGGCCCACCNONE 
Os07g0546000AF188065GGCCCCACCNONE 
AK061800GGCCCCACCNONE 
AK065871GGCCCCACCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02GGCCCCACCNONE 
J013035F03GGCCCCACCNONE 
J013044J20GGCCCCACCNONE 
Os07g0556000AK121938CTGACAGGTGGGCCCCACCCyclin-like domain containing protein. 
J065161E07CTGACAGGTGGGCCCCACCNONE 
Os07g0567700AK059008GGTGGGGCNONE 
Os07g0568300AK067784TCGTGGGCCCCACCCGCGCNONE 
AK067895TCGTGGGCCCCACCCGCGCSimilar to ZF protein (Fragment). 
J013119M01TCGTGGGCCCCACCCGCGCNONE 
J013120B09TCGTGGGCCCCACCCGCGCNONE 
J013123G12TCGTGGGCCCCACCCGCGCNONE 
J023012C12TCGTGGGCCCCACCCGCGCNONE 
J023020G17TCGTGGGCCCCACCCGCGCNONE 
J023037E23TCGTGGGCCCCACCCGCGCNONE 
J033076I01TCGTGGGCCCCACCCGCGCNONE 
J033108A07TCGTGGGCCCCACCCGCGCNONE 
J033138J02TCGTGGGCCCCACCCGCGCNONE 
J075033L09TCGTGGGCCCCACCCGCGCNONE 
J075049E02TCGTGGGCCCCACCCGCGCNONE 
J075060N23TCGTGGGCCCCACCCGCGCNONE 
J075094H13TCGTGGGCCCCACCCGCGCNONE 
J075179L18TCGTGGGCCCCACCCGCGCNONE 
J080005P09TCGTGGGCCCCACCCGCGCNONE 
J080044J03TCGTGGGCCCCACCCGCGCNONE 
J080062G20TCGTGGGCCCCACCCGCGCNONE 
J080063L23TCGTGGGCCCCACCCGCGCNONE 
J080065B16TCGTGGGCCCCACCCGCGCNONE 
J080071K09TCGTGGGCCCCACCCGCGCNONE 
J080089C23TCGTGGGCCCCACCCGCGCNONE 
J090008P21TCGTGGGCCCCACCCGCGCNONE 
J090046B22TCGTGGGCCCCACCCGCGCNONE 
J090094C19TCGTGGGCCCCACCCGCGCNONE 
J090096B19TCGTGGGCCCCACCCGCGCNONE 
J100060G03TCGTGGGCCCCACCCGCGCNONE 
J100082D16TCGTGGGCCCCACCCGCGCNONE 
Os07g0577600006-021-H11CGGGCCCCACCNONE 
006-022-B11CGGGCCCCACCNONE 
006-022-D10CGGGCCCCACCNONE 
006-022-E02CGGGCCCCACCNONE 
006-022-F03CGGGCCCCACCNONE 
006-023-C11CGGGCCCCACCNONE 
006-024-C10CGGGCCCCACCNONE 
006-024-C12CGGGCCCCACCNONE 
006-024-G12CGGGCCCCACCNONE 
006-026-C04CGGGCCCCACCNONE 
006-026-E05CGGGCCCCACCNONE 
006-026-E11CGGGCCCCACCNONE 
006-026-F09CGGGCCCCACCNONE 
006-026-H05CGGGCCCCACCNONE 
006-027-D03CGGGCCCCACCNONE 
006-028-C04CGGGCCCCACCNONE 
006-029-G10CGGGCCCCACCNONE 
006-030-A11CGGGCCCCACCNONE 
006-030-D12CGGGCCCCACCNONE 
006-031-G05CGGGCCCCACCNONE 
006-032-H06CGGGCCCCACCNONE 
006-033-A02CGGGCCCCACCNONE 
006-033-A06CGGGCCCCACCNONE 
006-034-B10CGGGCCCCACCNONE 
006-034-F07CGGGCCCCACCNONE 
006-035-A08CGGGCCCCACCNONE 
006-035-F07CGGGCCCCACCNONE 
006-036-A04CGGGCCCCACCNONE 
006-036-B04CGGGCCCCACCNONE 
006-037-D02CGGGCCCCACCNONE 
006-037-F12CGGGCCCCACCNONE 
006-037-H12CGGGCCCCACCNONE 
006-040-G12CGGGCCCCACCNONE 
006-040-H03CGGGCCCCACCNONE 
006-040-H06CGGGCCCCACCNONE 
006-042-B12CGGGCCCCACCNONE 
006-042-H10CGGGCCCCACCNONE 
006-044-G09CGGGCCCCACCNONE 
006-045-C04CGGGCCCCACCNONE 
006-046-B10CGGGCCCCACCNONE 
006-047-A05CGGGCCCCACCNONE 
006-048-D05CGGGCCCCACCNONE 
006-049-A08CGGGCCCCACCNONE 
006-050-C07CGGGCCCCACCNONE 
006-050-H10CGGGCCCCACCNONE 
006-051-G03CGGGCCCCACCNONE 
006-052-A01CGGGCCCCACCNONE 
006-052-A05CGGGCCCCACCNONE 
006-052-B03CGGGCCCCACCNONE 
006-052-D10CGGGCCCCACCNONE 
006-054-D03CGGGCCCCACCNONE 
006-055-A12CGGGCCCCACCNONE 
006-055-C05CGGGCCCCACCNONE 
006-055-F05CGGGCCCCACCNONE 
006-055-H10CGGGCCCCACCNONE 
006-056-A02CGGGCCCCACCNONE 
006-056-D07CGGGCCCCACCNONE 
006-057-A03CGGGCCCCACCNONE 
006-057-B06CGGGCCCCACCNONE 
006-057-H08CGGGCCCCACCNONE 
006-058-C04CGGGCCCCACCNONE 
006-058-F06CGGGCCCCACCNONE 
006-059-C10CGGGCCCCACCNONE 
006-059-G08CGGGCCCCACCNONE 
006-060-E10CGGGCCCCACCNONE 
006-061-B10CGGGCCCCACCNONE 
006-062-A05CGGGCCCCACCNONE 
006-062-B04CGGGCCCCACCNONE 
006-063-A04CGGGCCCCACCNONE 
006-063-D01CGGGCCCCACCNONE 
006-063-G12CGGGCCCCACCNONE 
006-064-D12CGGGCCCCACCNONE 
006-066-A03CGGGCCCCACCNONE 
006-066-C03CGGGCCCCACCNONE 
006-067-A03CGGGCCCCACCNONE 
006-067-G07CGGGCCCCACCNONE 
006-068-A06CGGGCCCCACCNONE 
006-069-D04CGGGCCCCACCNONE 
006-069-G05CGGGCCCCACCNONE 
006-070-H08CGGGCCCCACCNONE 
006-071-A05CGGGCCCCACCNONE 
006-071-H11CGGGCCCCACCNONE 
006-072-A07CGGGCCCCACCNONE 
006-072-B02CGGGCCCCACCNONE 
006-072-D11CGGGCCCCACCNONE 
006-072-H12CGGGCCCCACCNONE 
006-075-G06CGGGCCCCACCNONE 
006-077-B09CGGGCCCCACCNONE 
006-078-D01CGGGCCCCACCNONE 
006-078-D02CGGGCCCCACCNONE 
006-078-E05CGGGCCCCACCNONE 
006-078-G07CGGGCCCCACCNONE 
006-079-C03CGGGCCCCACCNONE 
006-079-F12CGGGCCCCACCNONE 
006-079-H01CGGGCCCCACCNONE 
006-080-D04CGGGCCCCACCNONE 
006-080-H04CGGGCCCCACCNONE 
006-081-A10CGGGCCCCACCNONE 
006-082-G02CGGGCCCCACCNONE 
006-082-H07CGGGCCCCACCNONE 
006-083-B03CGGGCCCCACCNONE 
006-085-A09CGGGCCCCACCNONE 
006-085-A12CGGGCCCCACCNONE 
006-085-F07CGGGCCCCACCNONE 
006-086-B11CGGGCCCCACCNONE 
006-086-D01CGGGCCCCACCNONE 
006-086-G04CGGGCCCCACCNONE 
006-087-E04CGGGCCCCACCNONE 
006-087-G09CGGGCCCCACCNONE 
006-088-E11CGGGCCCCACCNONE 
006-088-G10CGGGCCCCACCNONE 
006-088-H01CGGGCCCCACCNONE 
006-089-B04CGGGCCCCACCNONE 
006-089-D05CGGGCCCCACCNONE 
006-089-F07CGGGCCCCACCNONE 
006-089-H07CGGGCCCCACCNONE 
006-090-B06CGGGCCCCACCNONE 
006-090-H05CGGGCCCCACCNONE 
006-091-E11CGGGCCCCACCNONE 
006-092-H01CGGGCCCCACCNONE 
006-093-B08CGGGCCCCACCNONE 
006-093-C07CGGGCCCCACCNONE 
006-093-F02CGGGCCCCACCNONE 
006-093-G05CGGGCCCCACCNONE 
006-093-G06CGGGCCCCACCNONE 
006-094-D10CGGGCCCCACCNONE 
006-094-H07CGGGCCCCACCNONE 
006-095-G03CGGGCCCCACCNONE 
006-096-A06CGGGCCCCACCNONE 
006-096-E03CGGGCCCCACCNONE 
006-097-B03CGGGCCCCACCNONE 
006-097-D03CGGGCCCCACCNONE 
006-098-B07CGGGCCCCACCNONE 
006-098-G05CGGGCCCCACCNONE 
006-099-F05CGGGCCCCACCNONE 
006-100-H10CGGGCCCCACCNONE 
006-100-H12CGGGCCCCACCNONE 
006-101-A06CGGGCCCCACCNONE 
006-101-A08CGGGCCCCACCNONE 
006-101-A12CGGGCCCCACCNONE 
006-101-D04CGGGCCCCACCNONE 
006-101-G07CGGGCCCCACCNONE 
006-102-B12CGGGCCCCACCNONE 
006-102-E09CGGGCCCCACCNONE 
006-102-F02CGGGCCCCACCNONE 
006-103-D09CGGGCCCCACCNONE 
006-105-D05CGGGCCCCACCNONE 
006-105-D08CGGGCCCCACCNONE 
006-106-C07CGGGCCCCACCNONE 
006-106-F12CGGGCCCCACCNONE 
006-107-D01CGGGCCCCACCNONE 
006-109-C05CGGGCCCCACCNONE 
006-109-C08CGGGCCCCACCNONE 
006-109-D02CGGGCCCCACCNONE 
006-111-F03CGGGCCCCACCNONE 
006-112-C12CGGGCCCCACCNONE 
006-112-D08CGGGCCCCACCNONE 
006-113-A01CGGGCCCCACCNONE 
006-113-B03CGGGCCCCACCNONE 
006-113-C11CGGGCCCCACCNONE 
006-113-E07CGGGCCCCACCNONE 
006-113-F08CGGGCCCCACCNONE 
006-114-D08CGGGCCCCACCNONE 
006-114-H08CGGGCCCCACCNONE 
006-115-A08CGGGCCCCACCNONE 
006-115-A09CGGGCCCCACCNONE 
006-115-G05CGGGCCCCACCNONE 
006-117-B06CGGGCCCCACCNONE 
006-117-B09CGGGCCCCACCNONE 
006-117-F11CGGGCCCCACCNONE 
006-117-G10CGGGCCCCACCNONE 
006-117-H08CGGGCCCCACCNONE 
006-118-C06CGGGCCCCACCNONE 
006-118-G11CGGGCCCCACCNONE 
006-119-H03CGGGCCCCACCNONE 
006-120-D01CGGGCCCCACCNONE 
006-120-D12CGGGCCCCACCNONE 
006-120-H04CGGGCCCCACCNONE 
009-022-E12CGGGCCCCACCNONE 
009-044-H02CGGGCCCCACCNONE 
009-074-B08CGGGCCCCACCNONE 
009-145-B08CGGGCCCCACCNONE 
009-156-D09CGGGCCCCACCNONE 
009-163-F03CGGGCCCCACCNONE 
009-193-G03CGGGCCCCACCNONE 
AF010321CGGGCCCCACCNONE 
AK060987CGGGCCCCACCNONE 
AK070051CGGGCCCCACCNONE 
AK103966CGGGCCCCACCNONE 
AK104016CGGGCCCCACCNONE 
AK104127CGGGCCCCACCNONE 
AK104177CGGGCCCCACCNONE 
AK104283CGGGCCCCACCNONE 
AK104608CGGGCCCCACCNONE 
AK104651CGGGCCCCACCNONE 
AK119176CGGGCCCCACCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
J065013J05CGGGCCCCACCNONE 
J065129D23CGGGCCCCACCNONE 
J065138E06CGGGCCCCACCNONE 
J065179N22CGGGCCCCACCNONE 
J065192A07CGGGCCCCACCNONE 
J065208G16CGGGCCCCACCNONE 
J075013K01CGGGCCCCACCNONE 
J075017B12CGGGCCCCACCNONE 
J075018O17CGGGCCCCACCNONE 
J075023H05CGGGCCCCACCNONE 
J075053L02CGGGCCCCACCNONE 
J075067I01CGGGCCCCACCNONE 
J075083D19CGGGCCCCACCNONE 
J075083G03CGGGCCCCACCNONE 
J075084F12CGGGCCCCACCNONE 
J075088K18CGGGCCCCACCNONE 
J075094A18CGGGCCCCACCNONE 
J075094I22CGGGCCCCACCNONE 
J075097E17CGGGCCCCACCNONE 
J075098I24CGGGCCCCACCNONE 
J075110K19CGGGCCCCACCNONE 
J075118G21CGGGCCCCACCNONE 
J075118J20CGGGCCCCACCNONE 
J075120G14CGGGCCCCACCNONE 
J075120H20CGGGCCCCACCNONE 
J075127H23CGGGCCCCACCNONE 
J075139M03CGGGCCCCACCNONE 
J075142E17CGGGCCCCACCNONE 
J075149N17CGGGCCCCACCNONE 
J075152A20CGGGCCCCACCNONE 
J075157N22CGGGCCCCACCNONE 
J075159K21CGGGCCCCACCNONE 
J075173B20CGGGCCCCACCNONE 
J075192N20CGGGCCCCACCNONE 
J075196A07CGGGCCCCACCNONE 
J075199N04CGGGCCCCACCNONE 
J080005P10CGGGCCCCACCNONE 
J080025I24CGGGCCCCACCNONE 
J080064D09CGGGCCCCACCNONE 
J080064N24CGGGCCCCACCNONE 
J080068B02CGGGCCCCACCNONE 
J080097K04CGGGCCCCACCNONE 
J080097K19CGGGCCCCACCNONE 
J080097N20CGGGCCCCACCNONE 
J100055P07CGGGCCCCACCNONE 
Os07g0586500AK072668GGCCCCACCNONE 
AK120683GGCCCCACCSimilar to SUMO activating enzyme 2. 
J065033L18GGCCCCACCNONE 
J065038H20GGCCCCACCNONE 
J065045M20GGCCCCACCNONE 
J065046E10GGCCCCACCNONE 
J065055A10GGCCCCACCNONE 
J065098P14GGCCCCACCNONE 
J065156B19GGCCCCACCNONE 
J065195P22GGCCCCACCNONE 
J075002O06GGCCCCACCNONE 
J075003D13GGCCCCACCNONE 
J075004K05GGCCCCACCNONE 
J075010C10GGCCCCACCNONE 
J075011C14GGCCCCACCNONE 
J075026E16GGCCCCACCNONE 
J075041L23GGCCCCACCNONE 
J075044C21GGCCCCACCNONE 
J075071M16GGCCCCACCNONE 
J075076O13GGCCCCACCNONE 
J075080G12GGCCCCACCNONE 
J075091A03GGCCCCACCNONE 
J075091A21GGCCCCACCNONE 
J075106K17GGCCCCACCNONE 
J075120G20GGCCCCACCNONE 
J075125H10GGCCCCACCNONE 
J075129E05GGCCCCACCNONE 
J075143B18GGCCCCACCNONE 
J075153P22GGCCCCACCNONE 
J075156A12GGCCCCACCNONE 
J075156E19GGCCCCACCNONE 
J075159E16GGCCCCACCNONE 
J075165E16GGCCCCACCNONE 
J075174L21GGCCCCACCNONE 
J075176N06GGCCCCACCNONE 
J075176N13GGCCCCACCNONE 
J075179L20GGCCCCACCNONE 
J075186P20GGCCCCACCNONE 
J090044I17GGCCCCACCNONE 
J090051K13GGCCCCACCNONE 
Os07g0596600AK067238CCCGTGGGCCCCACCSimilar to Cdc2MsC protein. 
Os07g0604500009-018-C07AGTGGGCCCCACCNONE 
009-194-C02AGTGGGCCCCACCNONE 
011-023-C06AGTGGGCCCCACCNONE 
015-035-B10AGTGGGCCCCACCNONE 
AK064312AGTGGGCCCCACCSimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085AGTGGGCCCCACCNONE 
J090050I12AGTGGGCCCCACCNONE 
J100027C10AGTGGGCCCCACCNONE 
J100029A05AGTGGGCCCCACCNONE 
J100031P17AGTGGGCCCCACCNONE 
J100039E20AGTGGGCCCCACCNONE 
J100064L15AGTGGGCCCCACCNONE 
J100066K08AGTGGGCCCCACCNONE 
Os07g0605200AF091458CCCGTGGGCCCCACCGGGCCNONE 
AF139665CCCGTGGGCCCCACCGGGCCNONE 
AJ011675CCCGTGGGCCCCACCGGGCCNONE 
AK064704CCCGTGGGCCCCACCGGGCCMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15CCCGTGGGCCCCACCGGGCCNONE 
J090034M06CCCGTGGGCCCCACCGGGCCNONE 
J090079L24CCCGTGGGCCCCACCGGGCCNONE 
Os07g0606600AK111621GCCCCACCACNONE 
AK112118GCCCCACCACSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22GCCCCACCACNONE 
Os07g0606900011-039-F09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
011-058-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-014-C08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-062-H02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-067-G01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-029-A08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-039-H09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-044-A09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-047-G10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-065-C04GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-067-C10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-078-H10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-084-A06GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-050-F01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J065170E01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J075122G11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
Os07g0623600AK063642GGGCCCCACCConserved hypothetical protein. 
Os07g0637300AF323611CCACTGACACCTGGGCCCCACCNONE 
AK069157CCACTGACACCTGGGCCCCACCNONE 
J023007C01CCACTGACACCTGGGCCCCACCNONE 
Os07g0659500AK073537GACACGTGGGCCCCACCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0661400006-083-E05CCCGGCCCCACCACCCCACCCGNONE 
006-083-E05GGCCCCACCCCCCANONE 
006-084-B12CCCGGCCCCACCACCCCACCCGNONE 
006-084-B12GGCCCCACCCCCCANONE 
006-096-B03CCCGGCCCCACCACCCCACCCGNONE 
006-096-B03GGCCCCACCCCCCANONE 
009-013-C12CCCGGCCCCACCACCCCACCCGNONE 
009-013-C12GGCCCCACCCCCCANONE 
009-017-C10CCCGGCCCCACCACCCCACCCGNONE 
009-017-C10GGCCCCACCCCCCANONE 
009-027-A02CCCGGCCCCACCACCCCACCCGNONE 
009-027-A02GGCCCCACCCCCCANONE 
009-035-A06CCCGGCCCCACCACCCCACCCGNONE 
009-035-A06GGCCCCACCCCCCANONE 
009-047-H11CCCGGCCCCACCACCCCACCCGNONE 
009-047-H11GGCCCCACCCCCCANONE 
009-050-B11CCCGGCCCCACCACCCCACCCGNONE 
009-050-B11GGCCCCACCCCCCANONE 
009-051-C02CCCGGCCCCACCACCCCACCCGNONE 
009-051-C02GGCCCCACCCCCCANONE 
009-089-G06CCCGGCCCCACCACCCCACCCGNONE 
009-089-G06GGCCCCACCCCCCANONE 
009-091-C05CCCGGCCCCACCACCCCACCCGNONE 
009-091-C05GGCCCCACCCCCCANONE 
009-095-B11CCCGGCCCCACCACCCCACCCGNONE 
009-095-B11GGCCCCACCCCCCANONE 
009-151-C01CCCGGCCCCACCACCCCACCCGNONE 
009-151-C01GGCCCCACCCCCCANONE 
009-154-F06CCCGGCCCCACCACCCCACCCGNONE 
009-154-F06GGCCCCACCCCCCANONE 
009-169-F02CCCGGCCCCACCACCCCACCCGNONE 
009-169-F02GGCCCCACCCCCCANONE 
009-171-G01CCCGGCCCCACCACCCCACCCGNONE 
009-171-G01GGCCCCACCCCCCANONE 
009-179-F07CCCGGCCCCACCACCCCACCCGNONE 
009-179-F07GGCCCCACCCCCCANONE 
013-018-H06CCCGGCCCCACCACCCCACCCGNONE 
013-018-H06GGCCCCACCCCCCANONE 
013-024-E05CCCGGCCCCACCACCCCACCCGNONE 
013-024-E05GGCCCCACCCCCCANONE 
013-038-F09CCCGGCCCCACCACCCCACCCGNONE 
013-038-F09GGCCCCACCCCCCANONE 
013-099-F06CCCGGCCCCACCACCCCACCCGNONE 
013-099-F06GGCCCCACCCCCCANONE 
014-042-E09CCCGGCCCCACCACCCCACCCGNONE 
014-042-E09GGCCCCACCCCCCANONE 
014-086-C02CCCGGCCCCACCACCCCACCCGNONE 
014-086-C02GGCCCCACCCCCCANONE 
014-093-B08CCCGGCCCCACCACCCCACCCGNONE 
014-093-B08GGCCCCACCCCCCANONE 
015-039-G11CCCGGCCCCACCACCCCACCCGNONE 
015-039-G11GGCCCCACCCCCCANONE 
016-036-E05CCCGGCCCCACCACCCCACCCGNONE 
016-036-E05GGCCCCACCCCCCANONE 
AK068814CCCGGCCCCACCACCCCACCCGNONE 
AK068814GGCCCCACCCCCCANONE 
AK102682CCCGGCCCCACCACCCCACCCGNONE 
AK102682GGCCCCACCCCCCANONE 
AK105973CCCGGCCCCACCACCCCACCCGNONE 
AK105973GGCCCCACCCCCCANONE 
AK107202CCCGGCCCCACCACCCCACCCGConserved hypothetical protein. 
AK107202GGCCCCACCCCCCAConserved hypothetical protein. 
J053035N21CCCGGCCCCACCACCCCACCCGNONE 
J053035N21GGCCCCACCCCCCANONE 
J053099D11CCCGGCCCCACCACCCCACCCGNONE 
J053099D11GGCCCCACCCCCCANONE 
J065023B18CCCGGCCCCACCACCCCACCCGNONE 
J065023B18GGCCCCACCCCCCANONE 
J065031M15CCCGGCCCCACCACCCCACCCGNONE 
J065031M15GGCCCCACCCCCCANONE 
J065035G23CCCGGCCCCACCACCCCACCCGNONE 
J065035G23GGCCCCACCCCCCANONE 
J065060M18CCCGGCCCCACCACCCCACCCGNONE 
J065060M18GGCCCCACCCCCCANONE 
J065073J18CCCGGCCCCACCACCCCACCCGNONE 
J065073J18GGCCCCACCCCCCANONE 
J065103E20CCCGGCCCCACCACCCCACCCGNONE 
J065103E20GGCCCCACCCCCCANONE 
J065105N19CCCGGCCCCACCACCCCACCCGNONE 
J065105N19GGCCCCACCCCCCANONE 
J065137A08CCCGGCCCCACCACCCCACCCGNONE 
J065137A08GGCCCCACCCCCCANONE 
J065152K09CCCGGCCCCACCACCCCACCCGNONE 
J065152K09GGCCCCACCCCCCANONE 
J065156M12CCCGGCCCCACCACCCCACCCGNONE 
J065156M12GGCCCCACCCCCCANONE 
J065162G23CCCGGCCCCACCACCCCACCCGNONE 
J065162G23GGCCCCACCCCCCANONE 
J065162L13CCCGGCCCCACCACCCCACCCGNONE 
J065162L13GGCCCCACCCCCCANONE 
J065163H16CCCGGCCCCACCACCCCACCCGNONE 
J065163H16GGCCCCACCCCCCANONE 
J065165E06CCCGGCCCCACCACCCCACCCGNONE 
J065165E06GGCCCCACCCCCCANONE 
J065171J04CCCGGCCCCACCACCCCACCCGNONE 
J065171J04GGCCCCACCCCCCANONE 
J065180L23CCCGGCCCCACCACCCCACCCGNONE 
J065180L23GGCCCCACCCCCCANONE 
J065183K23CCCGGCCCCACCACCCCACCCGNONE 
J065183K23GGCCCCACCCCCCANONE 
J065186H13CCCGGCCCCACCACCCCACCCGNONE 
J065186H13GGCCCCACCCCCCANONE 
J065195D10CCCGGCCCCACCACCCCACCCGNONE 
J065195D10GGCCCCACCCCCCANONE 
J065209G11CCCGGCCCCACCACCCCACCCGNONE 
J065209G11GGCCCCACCCCCCANONE 
J075006J08CCCGGCCCCACCACCCCACCCGNONE 
J075006J08GGCCCCACCCCCCANONE 
J075112O07CCCGGCCCCACCACCCCACCCGNONE 
J075112O07GGCCCCACCCCCCANONE 
J080301H14CCCGGCCCCACCACCCCACCCGNONE 
J080301H14GGCCCCACCCCCCANONE 
J100058C17CCCGGCCCCACCACCCCACCCGNONE 
J100058C17GGCCCCACCCCCCANONE 
J100077I23CCCGGCCCCACCACCCCACCCGNONE 
J100077I23GGCCCCACCCCCCANONE 
J100080I24CCCGGCCCCACCACCCCACCCGNONE 
J100080I24GGCCCCACCCCCCANONE 
Os07g0661600006-050-D12CCTGGGCCCCACCNONE 
009-124-B10CCTGGGCCCCACCNONE 
AK061123CCTGGGCCCCACCNONE 
AK066432CCTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK104664CCTGGGCCCCACCNONE 
J013064M13CCTGGGCCCCACCNONE 
J013122O12CCTGGGCCCCACCNONE 
J033044A16CCTGGGCCCCACCNONE 
J033144D14CCTGGGCCCCACCNONE 
J090078P13CCTGGGCCCCACCNONE 
Os07g0673700AK071934GGCCCCACCCyclin-like F-box domain containing protein. 
AK107556GGCCCCACCNONE 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
Os08g0113100003-102-G01CAGGTGGGCCCCACCNONE 
011-041-F02CAGGTGGGCCCCACCNONE 
011-063-A09CAGGTGGGCCCCACCNONE 
AB110164CAGGTGGGCCCCACCNONE 
AF429947CAGGTGGGCCCCACCNONE 
AK070120CAGGTGGGCCCCACCSimilar to Fructokinase (Fragment). 
AK099353CAGGTGGGCCCCACCNONE 
J013072L23CAGGTGGGCCCCACCNONE 
J023031J20CAGGTGGGCCCCACCNONE 
J023041C07CAGGTGGGCCCCACCNONE 
J023068B05CAGGTGGGCCCCACCNONE 
J023111H11CAGGTGGGCCCCACCNONE 
J023114G22CAGGTGGGCCCCACCNONE 
J023121E01CAGGTGGGCCCCACCNONE 
J023121G16CAGGTGGGCCCCACCNONE 
J023128D15CAGGTGGGCCCCACCNONE 
J023142I22CAGGTGGGCCCCACCNONE 
J033058M11CAGGTGGGCCCCACCNONE 
J033092F23CAGGTGGGCCCCACCNONE 
J033108M10CAGGTGGGCCCCACCNONE 
J065085D10CAGGTGGGCCCCACCNONE 
J065086I17CAGGTGGGCCCCACCNONE 
J065137I08CAGGTGGGCCCCACCNONE 
J065154L19CAGGTGGGCCCCACCNONE 
J065179C12CAGGTGGGCCCCACCNONE 
J065184K15CAGGTGGGCCCCACCNONE 
J065195G07CAGGTGGGCCCCACCNONE 
J075052K09CAGGTGGGCCCCACCNONE 
J075093D08CAGGTGGGCCCCACCNONE 
J075093L13CAGGTGGGCCCCACCNONE 
J090005F03CAGGTGGGCCCCACCNONE 
J090013F02CAGGTGGGCCCCACCNONE 
J090026L07CAGGTGGGCCCCACCNONE 
J090041P18CAGGTGGGCCCCACCNONE 
J090081E12CAGGTGGGCCCCACCNONE 
J090087F17CAGGTGGGCCCCACCNONE 
J090091C17CAGGTGGGCCCCACCNONE 
J090099P12CAGGTGGGCCCCACCNONE 
J100030P08CAGGTGGGCCCCACCNONE 
J100055E21CAGGTGGGCCCCACCNONE 
J100056N16CAGGTGGGCCCCACCNONE 
J100061I23CAGGTGGGCCCCACCNONE 
J100063L04CAGGTGGGCCCCACCNONE 
J100065A14CAGGTGGGCCCCACCNONE 
J100072A15CAGGTGGGCCCCACCNONE 
J100080A04CAGGTGGGCCCCACCNONE 
J100082K16CAGGTGGGCCCCACCNONE 
J100088C06CAGGTGGGCCCCACCNONE 
J100088L18CAGGTGGGCCCCACCNONE 
Os08g0138500AK102951GGTGGGCCCCACCTGTCATCCACCSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GGTGGGCCCCACCTGTCATCCACCNONE 
J033115D14GGTGGGCCCCACCTGTCATCCACCNONE 
J065013F04GGTGGGCCCCACCTGTCATCCACCNONE 
J065050P11GGTGGGCCCCACCTGTCATCCACCNONE 
J065063K18GGTGGGCCCCACCTGTCATCCACCNONE 
J090054H10GGTGGGCCCCACCTGTCATCCACCNONE 
J100083F11GGTGGGCCCCACCTGTCATCCACCNONE 
Os08g0141300AK058337GTGGTGGGCCCCACCNONE 
AK067917GTGGTGGGCCCCACCMajor sperm protein domain containing protein. 
J100039I03GTGGTGGGCCCCACCNONE 
Os08g0155100AK069865CGGGTGGGGCCMajor sperm protein domain containing protein. 
AK104886CGGGTGGGGCCNONE 
J013089M01CGGGTGGGGCCNONE 
J023037M15CGGGTGGGGCCNONE 
J033068E03CGGGTGGGGCCNONE 
J090021P19CGGGTGGGGCCNONE 
Os08g0160600AK106763CCCGGGCCCCACCTGTConserved hypothetical protein. 
Os08g0280200AK069036GCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK069036GGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os08g0366100AK061882AGGTGGGCCCCACCTGTCAGNONE 
AK120339AGGTGGGCCCCACCTGTCAGSimilar to Endothelial differentiation-related factor 1 (EDF-1) (Multiprotein bridging factor 1) (MBF1). 
J013060M10AGGTGGGCCCCACCTGTCAGNONE 
J023135H23AGGTGGGCCCCACCTGTCAGNONE 
J033095L23AGGTGGGCCCCACCTGTCAGNONE 
J065010L09AGGTGGGCCCCACCTGTCAGNONE 
J065016A02AGGTGGGCCCCACCTGTCAGNONE 
J065041H14AGGTGGGCCCCACCTGTCAGNONE 
J065043F09AGGTGGGCCCCACCTGTCAGNONE 
J065045E03AGGTGGGCCCCACCTGTCAGNONE 
J065058F23AGGTGGGCCCCACCTGTCAGNONE 
J065075L19AGGTGGGCCCCACCTGTCAGNONE 
J065078N12AGGTGGGCCCCACCTGTCAGNONE 
J065105J19AGGTGGGCCCCACCTGTCAGNONE 
J065162I03AGGTGGGCCCCACCTGTCAGNONE 
J065164D10AGGTGGGCCCCACCTGTCAGNONE 
J065170B05AGGTGGGCCCCACCTGTCAGNONE 
J075039K19AGGTGGGCCCCACCTGTCAGNONE 
J075039M06AGGTGGGCCCCACCTGTCAGNONE 
J075057L17AGGTGGGCCCCACCTGTCAGNONE 
J075059F17AGGTGGGCCCCACCTGTCAGNONE 
J075109J04AGGTGGGCCCCACCTGTCAGNONE 
J075120B14AGGTGGGCCCCACCTGTCAGNONE 
J075153I11AGGTGGGCCCCACCTGTCAGNONE 
J075156C19AGGTGGGCCCCACCTGTCAGNONE 
J075166J20AGGTGGGCCCCACCTGTCAGNONE 
J090052H04AGGTGGGCCCCACCTGTCAGNONE 
J100051E13AGGTGGGCCCCACCTGTCAGNONE 
J100057L03AGGTGGGCCCCACCTGTCAGNONE 
J100059G23AGGTGGGCCCCACCTGTCAGNONE 
Os08g0387500AK105106GTGGTGGGCCCCACCCGSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0431100AK069476GTGGTGGGGCBromo adjacent region domain containing protein. 
J043026K24GTGGTGGGGCNONE 
Os08g0463100009-160-D03GGTGGGGCCAGANONE 
AK063043GGTGGGGCCAGAConserved hypothetical protein. 
Os08g0500200AK059046CCACTGACGTGGTGGGCCCCACCNONE 
AK064018CCACTGACGTGGTGGGCCCCACCConserved hypothetical protein. 
J075091E11CCACTGACGTGGTGGGCCCCACCNONE 
J090039E22CCACTGACGTGGTGGGCCCCACCNONE 
J100072K15CCACTGACGTGGTGGGCCCCACCNONE 
Os08g0512700AK060545GTGGTGGGGCSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
Os08g0525000AK103220AGTGGGCCCCACCTGTCAGRas GTPase family protein. 
AK103220CTCGGCCCCACCRas GTPase family protein. 
J033122O18AGTGGGCCCCACCTGTCAGNONE 
J033122O18CTCGGCCCCACCNONE 
J065026M15AGTGGGCCCCACCTGTCAGNONE 
J065026M15CTCGGCCCCACCNONE 
J075007I01AGTGGGCCCCACCTGTCAGNONE 
J075007I01CTCGGCCCCACCNONE 
J075031E01AGTGGGCCCCACCTGTCAGNONE 
J075031E01CTCGGCCCCACCNONE 
J075043N14AGTGGGCCCCACCTGTCAGNONE 
J075043N14CTCGGCCCCACCNONE 
J075074O16AGTGGGCCCCACCTGTCAGNONE 
J075074O16CTCGGCCCCACCNONE 
J075092O04AGTGGGCCCCACCTGTCAGNONE 
J075092O04CTCGGCCCCACCNONE 
J075141D16AGTGGGCCCCACCTGTCAGNONE 
J075141D16CTCGGCCCCACCNONE 
J075172C22AGTGGGCCCCACCTGTCAGNONE 
J075172C22CTCGGCCCCACCNONE 
J075173A05AGTGGGCCCCACCTGTCAGNONE 
J075173A05CTCGGCCCCACCNONE 
Os08g0531000AK072408AGTGGGCCCCACCTGTCSimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os08g0533700AK073691GGGGCCCACGCCCCACCConserved hypothetical protein. 
J033060E01GGGGCCCACGCCCCACCNONE 
J033111N06GGGGCCCACGCCCCACCNONE 
J053025N12GGGGCCCACGCCCCACCNONE 
J053080P18GGGGCCCACGCCCCACCNONE 
J053098H09GGGGCCCACGCCCCACCNONE 
J090076L19GGGGCCCACGCCCCACCNONE 
J100056A18GGGGCCCACGCCCCACCNONE 
Os08g0535400004-001-H10GAGACGTGGGCCCCACCCTCGCGCGCNONE 
AK071527GAGACGTGGGCCCCACCCTCGCGCGCZinc finger, DHHC-type domain containing protein. 
J023107B02GAGACGTGGGCCCCACCCTCGCGCGCNONE 
Os08g0536300AF358777GCGGGCCCCACCNONE 
AK099722GCGGGCCCCACCSimilar to Hd1. 
J100054G13GCGGGCCCCACCNONE 
Os08g0547200AK101130CCACTGACAGGTGGGGCCCCACCRabGAP/TBC domain containing protein. 
AK119577CCACTGACAGGTGGGGCCCCACCNONE 
Os08g0549300009-008-F01CGCCACGTGGGCCCCACCNONE 
009-033-G10CGCCACGTGGGCCCCACCNONE 
AK120938CGCCACGTGGGCCCCACCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420CGCCACGTGGGCCCCACCNONE 
J023037A21CGCCACGTGGGCCCCACCNONE 
J023066D20CGCCACGTGGGCCCCACCNONE 
J033099K13CGCCACGTGGGCCCCACCNONE 
J065116C14CGCCACGTGGGCCCCACCNONE 
J075009K15CGCCACGTGGGCCCCACCNONE 
J075071P13CGCCACGTGGGCCCCACCNONE 
J075080D18CGCCACGTGGGCCCCACCNONE 
J075124F24CGCCACGTGGGCCCCACCNONE 
J075198F23CGCCACGTGGGCCCCACCNONE 
J080006B15CGCCACGTGGGCCCCACCNONE 
J090078H13CGCCACGTGGGCCCCACCNONE 
J090089J09CGCCACGTGGGCCCCACCNONE 
J100017A03CGCCACGTGGGCCCCACCNONE 
J100023G03CGCCACGTGGGCCCCACCNONE 
Os09g0110400006-024-D01GGCCCCACCCGNONE 
006-054-H12GGCCCCACCCGNONE 
AK061402GGCCCCACCCGNONE 
AK068844GGCCCCACCCGSimilar to DNA-directed RNA polymerase II 36 kDa polypeptide A (EC 2.7.7.6) (RNA polymerase II subunit 3). 
AK103978GGCCCCACCCGNONE 
AK120034GGCCCCACCCGNONE 
AK121793GGCCCCACCCGNONE 
J023122O13GGCCCCACCCGNONE 
J033095G14GGCCCCACCCGNONE 
J043003I15GGCCCCACCCGNONE 
J065078D10GGCCCCACCCGNONE 
J065087J01GGCCCCACCCGNONE 
J065122J01GGCCCCACCCGNONE 
J065123N22GGCCCCACCCGNONE 
J065136F22GGCCCCACCCGNONE 
J065161L10GGCCCCACCCGNONE 
J065201L13GGCCCCACCCGNONE 
J075003B14GGCCCCACCCGNONE 
J075066H15GGCCCCACCCGNONE 
J075138D04GGCCCCACCCGNONE 
J075183B16GGCCCCACCCGNONE 
J090082J22GGCCCCACCCGNONE 
J100055D17GGCCCCACCCGNONE 
Os09g0122500J065067B01GGCCCCACCTGTCNONE 
J065113L16GGCCCCACCTGTCHypothetical protein. 
Os09g0251800006-100-E12CGTGTGGGCCCCACCNONE 
AK061218CGTGTGGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CGTGTGGGCCCCACCNONE 
J065048A02CGTGTGGGCCCCACCNONE 
J065073P10CGTGTGGGCCCCACCNONE 
J065075B09CGTGTGGGCCCCACCNONE 
J065112B05CGTGTGGGCCCCACCNONE 
J090014H10CGTGTGGGCCCCACCNONE 
Os09g0279200009-124-D04GGTGGGGCCCACTNONE 
AK062883GGTGGGGCCCACTConserved hypothetical protein. 
Os09g0306700J023045A19GGCCCCACCTGTCNONE 
Os09g0309500J100027L22TGTGGGCCCCACCCCCCGCGConserved hypothetical protein. 
Os09g0360400009-192-H06CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
AK071395CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGConserved hypothetical protein. 
J013045J21CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J023095O09CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J065207K01CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
Os09g0402100009-119-F11GCCCCACCNONE 
009-166-C09GCCCCACCNONE 
AK068506GCCCCACCPF1 protein. 
J065130I01GCCCCACCNONE 
L24390GCCCCACCNONE 
Os09g0424850J065006K24GGTGGGGCCCAGTConserved hypothetical protein. 
Os09g0439600AK100577TGTGGGCCCCACCExo70 exocyst complex subunit family protein. 
J090071K03TGTGGGCCCCACCNONE 
Os09g0441900009-109-C08GCCCCACCTGNONE 
013-033-G05GCCCCACCTGNONE 
AK062809GCCCCACCTGNONE 
AK064043GCCCCACCTGNONE 
J023131I10GCCCCACCTGNONE 
J033032C18GCCCCACCTGNONE 
J033113E20GCCCCACCTGNONE 
Os09g0444500AK059606GCCCCACCACConserved hypothetical protein. 
Os09g0445600AK107839CAGGTGGGGCCCACCACConserved hypothetical protein. 
Os09g0476100AK099938GCCCCACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0481200005-016-B10CCCGGCCCCACCNONE 
009-011-E05CCCGGCCCCACCNONE 
009-045-E02CCCGGCCCCACCNONE 
009-049-A02CCCGGCCCCACCNONE 
009-055-H07CCCGGCCCCACCNONE 
009-067-E08CCCGGCCCCACCNONE 
009-068-G08CCCGGCCCCACCNONE 
009-076-E11CCCGGCCCCACCNONE 
009-077-E02CCCGGCCCCACCNONE 
009-085-H03CCCGGCCCCACCNONE 
009-088-C06CCCGGCCCCACCNONE 
009-088-D07CCCGGCCCCACCNONE 
009-098-A03CCCGGCCCCACCNONE 
009-100-B03CCCGGCCCCACCNONE 
009-105-H04CCCGGCCCCACCNONE 
009-108-D08CCCGGCCCCACCNONE 
009-110-E02CCCGGCCCCACCNONE 
009-114-F08CCCGGCCCCACCNONE 
009-118-A09CCCGGCCCCACCNONE 
009-118-C10CCCGGCCCCACCNONE 
009-120-F08CCCGGCCCCACCNONE 
009-123-B07CCCGGCCCCACCNONE 
009-126-F11CCCGGCCCCACCNONE 
009-131-D02CCCGGCCCCACCNONE 
009-132-F11CCCGGCCCCACCNONE 
009-133-H07CCCGGCCCCACCNONE 
009-134-B03CCCGGCCCCACCNONE 
009-135-D08CCCGGCCCCACCNONE 
009-138-E07CCCGGCCCCACCNONE 
009-138-G03CCCGGCCCCACCNONE 
009-140-E05CCCGGCCCCACCNONE 
009-143-B06CCCGGCCCCACCNONE 
009-144-D01CCCGGCCCCACCNONE 
009-147-D09CCCGGCCCCACCNONE 
009-149-C09CCCGGCCCCACCNONE 
009-150-F10CCCGGCCCCACCNONE 
009-151-E10CCCGGCCCCACCNONE 
009-151-H10CCCGGCCCCACCNONE 
009-154-A08CCCGGCCCCACCNONE 
009-154-D03CCCGGCCCCACCNONE 
009-155-B09CCCGGCCCCACCNONE 
009-163-E08CCCGGCCCCACCNONE 
009-163-G11CCCGGCCCCACCNONE 
009-165-B06CCCGGCCCCACCNONE 
009-165-C12CCCGGCCCCACCNONE 
009-165-H07CCCGGCCCCACCNONE 
009-167-D02CCCGGCCCCACCNONE 
009-175-F08CCCGGCCCCACCNONE 
009-177-H04CCCGGCCCCACCNONE 
009-177-H08CCCGGCCCCACCNONE 
009-178-B09CCCGGCCCCACCNONE 
009-184-E07CCCGGCCCCACCNONE 
009-186-F09CCCGGCCCCACCNONE 
009-188-H01CCCGGCCCCACCNONE 
009-191-G10CCCGGCCCCACCNONE 
009-192-C08CCCGGCCCCACCNONE 
009-192-D06CCCGGCCCCACCNONE 
009-195-H11CCCGGCCCCACCNONE 
009-197-C06CCCGGCCCCACCNONE 
AK061695CCCGGCCCCACCNONE 
AK098847CCCGGCCCCACCSimilar to Photosystem I reaction center subunit V (PSI-G) (Photosystem I 9 kDa protein) (Fragment). 
J013000C21CCCGGCCCCACCNONE 
J065026J24CCCGGCCCCACCNONE 
J065038L06CCCGGCCCCACCNONE 
J065059E08CCCGGCCCCACCNONE 
J065059N21CCCGGCCCCACCNONE 
J065066H14CCCGGCCCCACCNONE 
J065112H14CCCGGCCCCACCNONE 
J065152I16CCCGGCCCCACCNONE 
J065152L16CCCGGCCCCACCNONE 
J065179N13CCCGGCCCCACCNONE 
J065198E01CCCGGCCCCACCNONE 
J075002I24CCCGGCCCCACCNONE 
J075021G08CCCGGCCCCACCNONE 
J075023N02CCCGGCCCCACCNONE 
J075031C09CCCGGCCCCACCNONE 
J075032G16CCCGGCCCCACCNONE 
J075083F07CCCGGCCCCACCNONE 
J075086P19CCCGGCCCCACCNONE 
J075094D01CCCGGCCCCACCNONE 
J075127I02CCCGGCCCCACCNONE 
J075176I18CCCGGCCCCACCNONE 
J100029F21CCCGGCCCCACCNONE 
J100031P15CCCGGCCCCACCNONE 
J100049C10CCCGGCCCCACCNONE 
J100089B21CCCGGCCCCACCNONE 
Os09g0493800011-053-H02GGTGGGCCCCACCNONE 
015-024-E10GGTGGGCCCCACCNONE 
AK103057GGTGGGCCCCACCSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
AK105408GGTGGGCCCCACCNONE 
J033117K03GGTGGGCCCCACCNONE 
J065135F16GGTGGGCCCCACCNONE 
J065140A21GGTGGGCCCCACCNONE 
J075018O14GGTGGGCCCCACCNONE 
J075033C15GGTGGGCCCCACCNONE 
Os09g0497000AK099705GCCCCACCACMitochondrial substrate carrier family protein. 
Os09g0527900AK122172GCCCCACCACSimilar to Hd1-like protein. 
AK122172GGTGGGGCSimilar to Hd1-like protein. 
AK122172GGTGGGGCCSimilar to Hd1-like protein. 
AK122172TCTGGCCCCACCTGTCAGTGSimilar to Hd1-like protein. 
J033148H23GCCCCACCACNONE 
J033148H23GGTGGGGCNONE 
J033148H23GGTGGGGCCNONE 
J033148H23TCTGGCCCCACCTGTCAGTGNONE 
J080070L07GCCCCACCACNONE 
J080070L07GGTGGGGCNONE 
J080070L07GGTGGGGCCNONE 
J080070L07TCTGGCCCCACCTGTCAGTGNONE 
J090088G19GCCCCACCACNONE 
J090088G19GGTGGGGCNONE 
J090088G19GGTGGGGCCNONE 
J090088G19TCTGGCCCCACCTGTCAGTGNONE 
Os09g0532700AK069946GCCCCACCGGCCCACGGAlpha/beta hydrolase family protein. 
Os09g0533900003-104-E05GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
012-076-C03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK067774GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK100449GTGGCCCACCACGCCTCGGCCCCACCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023026E11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023028B20GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023050P11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023052K08GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023075J03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023078E15GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023090P12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023120E01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023142K01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033027K23GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058A09GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058C12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033125A04GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J043040L01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053061D06GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053096N13GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J065193H10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J090075L17GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J100050D10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
Os09g0542100AK105001GGTGGGCCCCACCGCCCACCACPeptidase A1, pepsin family protein. 
AK105001TGTGGGCCCCACCPeptidase A1, pepsin family protein. 
J023149B01GGTGGGCCCCACCGCCCACCACNONE 
J023149B01TGTGGGCCCCACCNONE 
J100043C13GGTGGGCCCCACCGCCCACCACNONE 
J100043C13TGTGGGCCCCACCNONE 
Os09g0547200016-021-H03GGTGGGGCCCACTCCAACGGNONE 
016-021-H03TCCGGCCCCACCNONE 
AK073078GGTGGGGCCCACTCCAACGGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK073078TCCGGCCCCACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984GGTGGGGCCCACTCCAACGGNONE 
AK104984TCCGGCCCCACCNONE 
J065005L05GGTGGGGCCCACTCCAACGGNONE 
J065005L05TCCGGCCCCACCNONE 
J065039C06GGTGGGGCCCACTCCAACGGNONE 
J065039C06TCCGGCCCCACCNONE 
J065116H17GGTGGGGCCCACTCCAACGGNONE 
J065116H17TCCGGCCCCACCNONE 
J100046A17GGTGGGGCCCACTCCAACGGNONE 
J100046A17TCCGGCCCCACCNONE 
Os11g0156600Os11g0156600ACCGGGCCCCACCTB2/DP1 and HVA22 related protein family protein. 
Os11g0187500012-002-D06CTGACAGGTGGGGCCNONE 
012-035-H04CTGACAGGTGGGGCCNONE 
012-065-F08CTGACAGGTGGGGCCNONE 
AK063977CTGACAGGTGGGGCCSimilar to Heat shock protein 70. 
AK103083CTGACAGGTGGGGCCNONE 
J033118G15CTGACAGGTGGGGCCNONE 
J065115E02CTGACAGGTGGGGCCNONE 
J065178K04CTGACAGGTGGGGCCNONE 
J065178L03CTGACAGGTGGGGCCNONE 
J090064A22CTGACAGGTGGGGCCNONE 
Os11g0216100AK059179GGGCCCCACCSimilar to Chaperone protein dnaJ. 
Os11g0238400009-021-C07AGTGGGCCCCACCNONE 
009-125-D03AGTGGGCCCCACCNONE 
AK105203AGTGGGCCCCACCConserved hypothetical protein. 
Os11g0474566009-139-H05GGTGGGCCCCACCNONE 
014-072-C07GGTGGGCCCCACCNONE 
Os11g0479300AK099761CCACGGCCCCACCRabGAP/TBC domain containing protein. 
Os11g0525200011-005-B12CAGGTGGGGCCCNONE 
012-006-A10CAGGTGGGGCCCNONE 
012-093-G03CAGGTGGGGCCCNONE 
014-088-E05CAGGTGGGGCCCNONE 
015-100-F08CAGGTGGGGCCCNONE 
AB025047CAGGTGGGGCCCNONE 
AK060487CAGGTGGGGCCCNONE 
AK121491CAGGTGGGGCCCSimilar to Cytochrome P450 51 (EC 1.14.13.70) (CYPLI) (P450-LIA1) (Obtusifoliol 14-alpha demethylase) (Fragment). 
J013130H02CAGGTGGGGCCCNONE 
J013158G17CAGGTGGGGCCCNONE 
J023063C20CAGGTGGGGCCCNONE 
J023079N18CAGGTGGGGCCCNONE 
J023082P17CAGGTGGGGCCCNONE 
J023086I09CAGGTGGGGCCCNONE 
J023112D17CAGGTGGGGCCCNONE 
J023121B06CAGGTGGGGCCCNONE 
J023122G16CAGGTGGGGCCCNONE 
J023147J07CAGGTGGGGCCCNONE 
J023150P16CAGGTGGGGCCCNONE 
J033076I22CAGGTGGGGCCCNONE 
J033129I15CAGGTGGGGCCCNONE 
J075155F06CAGGTGGGGCCCNONE 
J075163E02CAGGTGGGGCCCNONE 
J075168H23CAGGTGGGGCCCNONE 
J100022M11CAGGTGGGGCCCNONE 
Os11g0525600AK068415GACAGGTGGGCCCCACCACSimilar to Alpha-mannosidase. 
AK098929GACAGGTGGGCCCCACCACNONE 
J013026M18GACAGGTGGGCCCCACCACNONE 
J013050K16GACAGGTGGGCCCCACCACNONE 
J013156L24GACAGGTGGGCCCCACCACNONE 
J023022H22GACAGGTGGGCCCCACCACNONE 
J023065I09GACAGGTGGGCCCCACCACNONE 
J023084F23GACAGGTGGGCCCCACCACNONE 
J033111G01GACAGGTGGGCCCCACCACNONE 
J053026C09GACAGGTGGGCCCCACCACNONE 
J053027J02GACAGGTGGGCCCCACCACNONE 
J053061N23GACAGGTGGGCCCCACCACNONE 
J053086A13GACAGGTGGGCCCCACCACNONE 
J053094C15GACAGGTGGGCCCCACCACNONE 
J075094C03GACAGGTGGGCCCCACCACNONE 
J075150B17GACAGGTGGGCCCCACCACNONE 
J090097L07GACAGGTGGGCCCCACCACNONE 
J100025O15GACAGGTGGGCCCCACCACNONE 
J100077N15GACAGGTGGGCCCCACCACNONE 
Os11g0527000J065137N17CATGGGCCCCACCTGTCConserved hypothetical protein. 
Os11g0536900J100027G18GCCCCACCConserved hypothetical protein. 
J100073G12GCCCCACCNONE 
Os11g0547000AK100677GCGGGCCCCACCCCCACCACSimilar to FKF1. 
Os11g0549615AK069660CCGTGGGCCCCACCAcid phosphatase, type 5 family protein. 
J023031L04CCGTGGGCCCCACCNONE 
Os11g0623700009-049-D06GCCCCACCACNONE 
AK063799GCCCCACCACConserved hypothetical protein. 
Os12g0118400009-027-G04GGTGGGGCNONE 
009-129-H07GGTGGGGCNONE 
AK062407GGTGGGGCNONE 
AK111804GGTGGGGCSimilar to Inwardly rectifying potassium channel subunit. 
J065081E04GGTGGGGCNONE 
J090095O18GGTGGGGCNONE 
Os12g0151500AK058389CCCGGCCCCTGGGCCCCACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865CCCGGCCCCTGGGCCCCACCNONE 
Os12g0168700AK065708GGTGGGGCCAMP-dependent synthetase and ligase domain containing protein. 
AK065708GGTGGGGCCCAMP-dependent synthetase and ligase domain containing protein. 
AK065718GGTGGGGCCNONE 
AK065718GGTGGGGCCCNONE 
Os12g0230600AK072568TGTGGGCCCCACCCACACGProtein of unknown function DUF1685 family protein. 
Os12g0244000AK106408GGCCCCACCTGTCAGHypothetical protein. 
Os12g0516300AK062061GCCCCACCNONE 
Os12g0541400AK101210GGCCCCACCPrefoldin domain containing protein. 
J033031A17GGCCCCACCNONE 
J090051F01GGCCCCACCNONE 
Os12g0566900AK109171TGTGGGCCCCACCNONE 
Os12g0580300AK102871GCTGGGCCCCACCSimilar to TATA-binding protein TBP2. 
Os12g0597500AK101904GCGGGCCCCACCNONE 
AK103799GCGGGCCCCACCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02GCGGGCCCCACCNONE 
J100078O15GCGGGCCCCACCNONE 
Os12g0605900AK109696GCCCCACCACSimilar to Kinase like protein. 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
Os12g0616900AK063753TGTGGGCCCCACCSimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464TGTGGGCCCCACCNONE 
J033126J16TGTGGGCCCCACCNONE 
J065140B05TGTGGGCCCCACCNONE 
Os12g0625000006-117-H03TGCGGGCCCCACCTGNONE 
AF073695TGCGGGCCCCACCTGNONE 
AK061993TGCGGGCCCCACCTGNONE 
AK099598TGCGGGCCCCACCTGCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.