version

Summary of OsREG613 (All List)

OrganismOryza sativa  
IDOsREG613  
SequenceGCCCCCAC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1620  

Entry Sequences (1620 entries)

LocusGene modelSequenceDescription
Os01g0103600006-072-A01GTGGTGGGCCCCCACNONE 
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK102848GTGGTGGGCCCCCACNONE 
J033036P20GTGGTGGGCCCCCACNONE 
J065171N21GTGGTGGGCCCCCACNONE 
J065209M02GTGGTGGGCCCCCACNONE 
J075067A03GTGGTGGGCCCCCACNONE 
J075110C09GTGGTGGGCCCCCACNONE 
Os01g0135900003-115-D06GTGGGGGCNONE 
003-115-H03GTGGGGGCNONE 
006-109-B10GTGGGGGCNONE 
006-113-F11GTGGGGGCNONE 
009-010-B01GTGGGGGCNONE 
009-019-F02GTGGGGGCNONE 
009-037-C01GTGGGGGCNONE 
009-053-D01GTGGGGGCNONE 
009-054-G04GTGGGGGCNONE 
009-080-H12GTGGGGGCNONE 
009-104-D05GTGGGGGCNONE 
009-113-A04GTGGGGGCNONE 
009-118-H10GTGGGGGCNONE 
009-119-E10GTGGGGGCNONE 
009-132-E06GTGGGGGCNONE 
009-146-H11GTGGGGGCNONE 
009-154-F07GTGGGGGCNONE 
009-156-D10GTGGGGGCNONE 
009-170-G12GTGGGGGCNONE 
009-178-C05GTGGGGGCNONE 
009-192-G09GTGGGGGCNONE 
009-196-C05GTGGGGGCNONE 
AK062091GTGGGGGCNONE 
AK064849GTGGGGGCSimilar to Cytosolic class I small heat shock protein 3C (Fragment). 
AK065690GTGGGGGCNONE 
AK119599GTGGGGGCNONE 
J013000H01GTGGGGGCNONE 
J013041H01GTGGGGGCNONE 
J013070K08GTGGGGGCNONE 
J013169N20GTGGGGGCNONE 
J023037E16GTGGGGGCNONE 
J023083M03GTGGGGGCNONE 
J023095M09GTGGGGGCNONE 
J033100B18GTGGGGGCNONE 
J043036J21GTGGGGGCNONE 
J100042I20GTGGGGGCNONE 
J100067L09GTGGGGGCNONE 
Os01g0174700003-111-B04GCCCCCACNONE 
011-043-F04GCCCCCACNONE 
AK073313GCCCCCACNONE 
J033057J01GCCCCCACNONE 
J065041K14GCCCCCACNONE 
J065122G22GCCCCCACNONE 
Os01g0276700011-014-A12GCCCCCACNONE 
012-092-G12GCCCCCACNONE 
AK103164GCCCCCACNONE 
AK103465GCCCCCACSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GCCCCCACNONE 
J023084I02GCCCCCACNONE 
J033027F20GCCCCCACNONE 
J033029M06GCCCCCACNONE 
J033039K13GCCCCCACNONE 
J033057C24GCCCCCACNONE 
J033058G20GCCCCCACNONE 
J033060A14GCCCCCACNONE 
J033061M21GCCCCCACNONE 
J033068M10GCCCCCACNONE 
J033074K16GCCCCCACNONE 
J033076C11GCCCCCACNONE 
J033093O13GCCCCCACNONE 
J033119H20GCCCCCACNONE 
J033121D22GCCCCCACNONE 
J033129N11GCCCCCACNONE 
J033131E12GCCCCCACNONE 
J033150L07GCCCCCACNONE 
J053024N17GCCCCCACNONE 
J053034G19GCCCCCACNONE 
J053035E18GCCCCCACNONE 
J053046M01GCCCCCACNONE 
J053047P04GCCCCCACNONE 
J053048B06GCCCCCACNONE 
J053050M22GCCCCCACNONE 
J053053E09GCCCCCACNONE 
J053053I07GCCCCCACNONE 
J053059K03GCCCCCACNONE 
J053059P12GCCCCCACNONE 
J053060C12GCCCCCACNONE 
J053060H24GCCCCCACNONE 
J053064D19GCCCCCACNONE 
J053066L15GCCCCCACNONE 
J053073I02GCCCCCACNONE 
J053083E15GCCCCCACNONE 
J053094D05GCCCCCACNONE 
J053094P18GCCCCCACNONE 
J053095C15GCCCCCACNONE 
J053095C21GCCCCCACNONE 
J053099N16GCCCCCACNONE 
J090025O19GCCCCCACNONE 
J090049N22GCCCCCACNONE 
J090050F17GCCCCCACNONE 
Os01g0303300J053035N19GCCCCCACACACGTGGCNONE 
J075042F02GCCCCCACACACGTGGCNONE 
J075068E10GCCCCCACACACGTGGCNONE 
J075116E19GCCCCCACACACGTGGCNONE 
J075131C10GCCCCCACACACGTGGCNONE 
J075145J11GCCCCCACACACGTGGCNONE 
J075157P20GCCCCCACACACGTGGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12GCCCCCACACACGTGGCNONE 
Os01g0313300AJ575219GCCCCCACGCCACNONE 
AK111775GCCCCCACGCCACSimilar to EREBP-3 protein (Fragment). 
J023075G11GCCCCCACGCCACNONE 
J065086L01GCCCCCACGCCACNONE 
J065161K09GCCCCCACGCCACNONE 
J075019P13GCCCCCACGCCACNONE 
Os01g0314000015-084-B08CCTCGCCCCCACNONE 
AK106418CCTCGCCCCCACNONE 
Os01g0342800J065046B02GCCCCCACACNONE 
J065059I08GCCCCCACACNONE 
J065074A14GCCCCCACACNONE 
J065147C02GCCCCCACACNONE 
J065176F09GCCCCCACACNONE 
J065199J12GCCCCCACACConserved hypothetical protein. 
Os01g0571000AK066090GCCCCCACMitochondrial substrate carrier family protein. 
AK121334GCCCCCACNONE 
Os01g0582600J023150F24TCCACGCCCCCACConserved hypothetical protein. 
J100032A08TCCACGCCCCCACNONE 
Os01g0652800006-085-A10GCCCCCACTTGNONE 
013-030-A12GCCCCCACTTGNONE 
AK061145GCCCCCACTTGProtein of unknown function DUF231, plant domain containing protein. 
AK103547GCCCCCACTTGNONE 
AK104312GCCCCCACTTGNONE 
J023039H04GCCCCCACTTGNONE 
J033132E17GCCCCCACTTGNONE 
J053023N09GCCCCCACTTGNONE 
J065052H05GCCCCCACTTGNONE 
J075058C12GCCCCCACTTGNONE 
J075058I03GCCCCCACTTGNONE 
J075128L08GCCCCCACTTGNONE 
J075170M10GCCCCCACTTGNONE 
J090011D14GCCCCCACTTGNONE 
J090043C02GCCCCCACTTGNONE 
J100040I15GCCCCCACTTGNONE 
Os01g0667900013-097-A02GCGGGCCCCCACGGTGACGTCACCNONE 
014-011-C01GCGGGCCCCCACGGTGACGTCACCNONE 
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein. 
J065156F10GCGGGCCCCCACGGTGACGTCACCNONE 
J065163D22GCGGGCCCCCACGGTGACGTCACCNONE 
J065197J04GCGGGCCCCCACGGTGACGTCACCNONE 
J075122C02GCGGGCCCCCACGGTGACGTCACCNONE 
J100047L16GCGGGCCCCCACGGTGACGTCACCNONE 
Os01g0730300AK101207GCCCCCACHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GCCCCCACNONE 
Os01g0732000009-052-G10GCCCCCACNONE 
AK062498GCCCCCACSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J075040I23GCCCCCACNONE 
J075123E04GCCCCCACNONE 
J080305B10GCCCCCACNONE 
J080315B13GCCCCCACNONE 
J080318H03GCCCCCACNONE 
Os01g0741900014-012-B05GCCCCCACNONE 
014-012-B05GCCCCCACTTGNONE 
AK068600GCCCCCACSimilar to Auxin-responsive protein IAA26 (Indoleacetic acid-induced protein 26) (Phytochrome-associated protein 1). 
AK068600GCCCCCACTTGSimilar to Auxin-responsive protein IAA26 (Indoleacetic acid-induced protein 26) (Phytochrome-associated protein 1). 
J013035G23GCCCCCACNONE 
J013035G23GCCCCCACTTGNONE 
J013154A18GCCCCCACNONE 
J013154A18GCCCCCACTTGNONE 
J033092G10GCCCCCACNONE 
J033092G10GCCCCCACTTGNONE 
J043020A20GCCCCCACNONE 
J043020A20GCCCCCACTTGNONE 
J100041K22GCCCCCACNONE 
J100041K22GCCCCCACTTGNONE 
J100066E16GCCCCCACNONE 
J100066E16GCCCCCACTTGNONE 
J100081J06GCCCCCACNONE 
J100081J06GCCCCCACTTGNONE 
Os01g0750500006-028-G02GTGGGGGCNONE 
006-105-B02GTGGGGGCNONE 
006-117-D04GTGGGGGCNONE 
013-066-D08GTGGGGGCNONE 
015-058-C06GTGGGGGCNONE 
AK067516GTGGGGGCProtein of unknown function DUF814 domain containing protein. 
AK104228GTGGGGGCNONE 
AK104728GTGGGGGCNONE 
J013056K07GTGGGGGCNONE 
J013073A21GTGGGGGCNONE 
J013112J21GTGGGGGCNONE 
J065034L03GTGGGGGCNONE 
J100026F22GTGGGGGCNONE 
J100073H05GTGGGGGCNONE 
J100084P09GTGGGGGCNONE 
Os01g0754200AK099782GCCCCCACGlycosyl transferase, family 48 protein. 
AK120195GCCCCCACNONE 
AK120402GCCCCCACNONE 
J013036H01GCCCCCACNONE 
J013088I17GCCCCCACNONE 
Os01g0767100AK109493GCCCCCACGTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0794100009-027-B12GCCCCCACGTNONE 
AK062404GCCCCCACGTConserved hypothetical protein. 
Os01g0823500016-059-D03GTGGGGGCCCACGCNONE 
AK064237GTGGGGGCCCACGCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0833200AK121629TTCGGCCCCCACGConserved hypothetical protein. 
J023093N07TTCGGCCCCCACGNONE 
J033050C20TTCGGCCCCCACGNONE 
J080302F22TTCGGCCCCCACGNONE 
J080303H06TTCGGCCCCCACGNONE 
J080306J04TTCGGCCCCCACGNONE 
J080309K06TTCGGCCCCCACGNONE 
J080311E18TTCGGCCCCCACGNONE 
J080318A20TTCGGCCCCCACGNONE 
J100031F20TTCGGCCCCCACGNONE 
J100034P21TTCGGCCCCCACGNONE 
J100042K08TTCGGCCCCCACGNONE 
J100047H24TTCGGCCCCCACGNONE 
J100065C14TTCGGCCCCCACGNONE 
J100074E23TTCGGCCCCCACGNONE 
Os01g0866200009-039-E12GCCCCCACGNONE 
J065059P16GCCCCCACGNONE 
J065063E21GCCCCCACGNONE 
J065078B21GCCCCCACGNONE 
J065079A11GCCCCCACGNONE 
J065087H15GCCCCCACGNONE 
J065137M10GCCCCCACGNONE 
J065138K24GCCCCCACGNONE 
J065142E08GCCCCCACGNONE 
J065171G11GCCCCCACGNONE 
J065183K15GCCCCCACGNONE 
J065192J05GCCCCCACGNONE 
J075151P09GCCCCCACGNONE 
J090020B17GCCCCCACGNONE 
J090067F15GCCCCCACGNONE 
J090070K06GCCCCCACGNONE 
J090094G13GCCCCCACGNONE 
J100081M20GCCCCCACGHistone H3. 
J100089D06GCCCCCACGNONE 
Os01g0866300006-087-C06GCCCCCACGNONE 
006-114-E01GCCCCCACGNONE 
J065202L13GCCCCCACGNONE 
Os01g0867300AK067919GCCCCCACACSimilar to OSE2-like protein (Fragment). 
J013123H12GCCCCCACACNONE 
J033046C11GCCCCCACACNONE 
J033051I17GCCCCCACACNONE 
U25283GCCCCCACACNONE 
Os01g0882400AK108538GTGGGGGCProtein of unknown function DUF679 family protein. 
Os01g0885600AK059523GCCCCCACGCGTEsterase/lipase/thioesterase domain containing protein. 
J065013G01GCCCCCACGCGTNONE 
J065063D03GCCCCCACGCGTNONE 
J065143H01GCCCCCACGCGTNONE 
J065146F08GCCCCCACGCGTNONE 
J065153D14GCCCCCACGCGTNONE 
J065170E02GCCCCCACGCGTNONE 
J065175M22GCCCCCACGCGTNONE 
J065186E13GCCCCCACGCGTNONE 
J075023J16GCCCCCACGCGTNONE 
J075176J06GCCCCCACGCGTNONE 
Os01g0891300AK063674GCCCCCACGSimilar to Allyl alcohol dehydrogenase. 
AK099151GCCCCCACGNONE 
Os01g0897600J065120F23CGTGGGGGCNONE 
Os01g0915000AK107951GCCCCCACProtein of unknown function DUF506, plant family protein. 
Os01g0916200AK101112GTGGGGGCNONE 
Os01g0976300AK111354GTGGGGGCHeavy metal transport/detoxification protein domain containing protein. 
Os02g0125300006-047-E06GCCCCCACGCGCGGGTNONE 
006-088-F09GCCCCCACGCGCGGGTNONE 
006-106-F10GCCCCCACGCGCGGGTNONE 
AB025926GCCCCCACGCGCGGGTNONE 
AK061564GCCCCCACGCGCGGGTNONE 
AK061953GCCCCCACGCGCGGGTNONE 
AK101060GCCCCCACGCGCGGGTBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21GCCCCCACGCGCGGGTNONE 
J023097A08GCCCCCACGCGCGGGTNONE 
J023133F03GCCCCCACGCGCGGGTNONE 
J033022C21GCCCCCACGCGCGGGTNONE 
J033073C21GCCCCCACGCGCGGGTNONE 
J033116O09GCCCCCACGCGCGGGTNONE 
J033120E01GCCCCCACGCGCGGGTNONE 
J065088M19GCCCCCACGCGCGGGTNONE 
J065135O04GCCCCCACGCGCGGGTNONE 
J080304J03GCCCCCACGCGCGGGTNONE 
J090001K14GCCCCCACGCGCGGGTNONE 
J090038D04GCCCCCACGCGCGGGTNONE 
J090045G09GCCCCCACGCGCGGGTNONE 
J090076E12GCCCCCACGCGCGGGTNONE 
J090077D21GCCCCCACGCGCGGGTNONE 
J100018J19GCCCCCACGCGCGGGTNONE 
J100029M12GCCCCCACGCGCGGGTNONE 
J100049D07GCCCCCACGCGCGGGTNONE 
J100067G21GCCCCCACGCGCGGGTNONE 
J100090D05GCCCCCACGCGCGGGTNONE 
Os02g0129700AK065610GTGGGGGCCCACCTHypothetical protein. 
J013031M24GTGGGGGCCCACCTNONE 
J075043J08GTGGGGGCCCACCTNONE 
J075142N23GTGGGGGCCCACCTNONE 
Os02g0148400AK070451GGCCGTGGGGGCCCACTNONE 
AK072039GGCCGTGGGGGCCCACTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10GGCCGTGGGGGCCCACTNONE 
Os02g0169300006-023-D12GCCCCCACNONE 
006-062-B01GCCCCCACNONE 
015-049-F11GCCCCCACNONE 
015-057-G02GCCCCCACNONE 
015-092-F04GCCCCCACNONE 
015-095-H02GCCCCCACNONE 
015-097-B07GCCCCCACNONE 
AK070041GCCCCCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07GCCCCCACNONE 
J013134H23GCCCCCACNONE 
J013134J23GCCCCCACNONE 
J023036N24GCCCCCACNONE 
J023049C06GCCCCCACNONE 
J023077E10GCCCCCACNONE 
J023077F10GCCCCCACNONE 
J023105N12GCCCCCACNONE 
J033036O12GCCCCCACNONE 
J033064P11GCCCCCACNONE 
J033079F01GCCCCCACNONE 
J033123M22GCCCCCACNONE 
J033143E10GCCCCCACNONE 
J075013D12GCCCCCACNONE 
Os02g0178800AK066569GTGGGGGCSimilar to Glossy1 protein. 
Os02g0190900AK111037GTGGGGGCCCAAGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CTTGGGCCCCCACConserved hypothetical protein. 
J075117E23CTTGGGCCCCCACNONE 
J075117F23CTTGGGCCCCCACNONE 
J075144M12CTTGGGCCCCCACNONE 
J075145H10CTTGGGCCCCCACNONE 
J075186B15CTTGGGCCCCCACNONE 
Os02g0196800AK070521GTGTGGGGGCSimilar to Fumarylacetoacetase (Fragment). 
AK105018GTGTGGGGGCNONE 
J080301A13GTGTGGGGGCNONE 
J080307M08GTGTGGGGGCNONE 
Os02g0285800AK072177ATCCCCCAAGCCCCCACSimilar to GTP-binding protein typA (Tyrosine phosphorylated protein A). 
AK099035ATCCCCCAAGCCCCCACNONE 
Os02g0288100AK107019CAGGTGGGGTGGGGGCSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0316200AK073932GTGTGGGGGCCCGCACyclin-like F-box domain containing protein. 
AK105757GTGTGGGGGCCCGCANONE 
J023039G03GTGTGGGGGCCCGCANONE 
J033076K03GTGTGGGGGCCCGCANONE 
J075157J22GTGTGGGGGCCCGCANONE 
J090097K02GTGTGGGGGCCCGCANONE 
J100053F10GTGTGGGGGCCCGCANONE 
Os02g0499300AK106994GCCCCCACConserved hypothetical protein. 
Os02g0517531AK121247GCCCCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0548900AK070239TGTGGGCCCCCACHypothetical protein. 
J023045K14TGTGGGCCCCCACNONE 
Os02g0613200AK064869GCCCCCACGTGGCNONE 
AK064869GCCCCCACTGACNONE 
AK065051GCCCCCACGTGGCNONE 
AK065051GCCCCCACTGACNONE 
AK098853GCCCCCACGTGGCConserved hypothetical protein. 
AK098853GCCCCCACTGACConserved hypothetical protein. 
AK098974GCCCCCACGTGGCNONE 
AK098974GCCCCCACTGACNONE 
J013000H15GCCCCCACGTGGCNONE 
J013000H15GCCCCCACTGACNONE 
J013001I18GCCCCCACGTGGCNONE 
J013001I18GCCCCCACTGACNONE 
J013022I18GCCCCCACGTGGCNONE 
J013022I18GCCCCCACTGACNONE 
J013025D06GCCCCCACGTGGCNONE 
J013025D06GCCCCCACTGACNONE 
J013037H17GCCCCCACGTGGCNONE 
J013037H17GCCCCCACTGACNONE 
J013043F22GCCCCCACGTGGCNONE 
J013043F22GCCCCCACTGACNONE 
J013075E01GCCCCCACGTGGCNONE 
J013075E01GCCCCCACTGACNONE 
J013088D09GCCCCCACGTGGCNONE 
J013088D09GCCCCCACTGACNONE 
J013088E19GCCCCCACGTGGCNONE 
J013088E19GCCCCCACTGACNONE 
J013102O18GCCCCCACGTGGCNONE 
J013102O18GCCCCCACTGACNONE 
J013110C08GCCCCCACGTGGCNONE 
J013110C08GCCCCCACTGACNONE 
J013118C06GCCCCCACGTGGCNONE 
J013118C06GCCCCCACTGACNONE 
J013119F22GCCCCCACGTGGCNONE 
J013119F22GCCCCCACTGACNONE 
J013128K14GCCCCCACGTGGCNONE 
J013128K14GCCCCCACTGACNONE 
J013158C17GCCCCCACGTGGCNONE 
J013158C17GCCCCCACTGACNONE 
J023013P15GCCCCCACGTGGCNONE 
J023013P15GCCCCCACTGACNONE 
J023044L21GCCCCCACGTGGCNONE 
J023044L21GCCCCCACTGACNONE 
J033023I04GCCCCCACGTGGCNONE 
J033023I04GCCCCCACTGACNONE 
J033038I22GCCCCCACGTGGCNONE 
J033038I22GCCCCCACTGACNONE 
J033095M02GCCCCCACGTGGCNONE 
J033095M02GCCCCCACTGACNONE 
J043022F05GCCCCCACGTGGCNONE 
J043022F05GCCCCCACTGACNONE 
J080307N20GCCCCCACGTGGCNONE 
J080307N20GCCCCCACTGACNONE 
J080315C02GCCCCCACGTGGCNONE 
J080315C02GCCCCCACTGACNONE 
J080316A15GCCCCCACGTGGCNONE 
J080316A15GCCCCCACTGACNONE 
J080316G03GCCCCCACGTGGCNONE 
J080316G03GCCCCCACTGACNONE 
J090029E24GCCCCCACGTGGCNONE 
J090029E24GCCCCCACTGACNONE 
J090031H15GCCCCCACGTGGCNONE 
J090031H15GCCCCCACTGACNONE 
J090034F13GCCCCCACGTGGCNONE 
J090034F13GCCCCCACTGACNONE 
J090047G02GCCCCCACGTGGCNONE 
J090047G02GCCCCCACTGACNONE 
J090069M24GCCCCCACGTGGCNONE 
J090069M24GCCCCCACTGACNONE 
J100052E15GCCCCCACGTGGCNONE 
J100052E15GCCCCCACTGACNONE 
Os02g0634600AK101737GTGGGGGCGGCCCAConserved hypothetical protein. 
Os02g0649300014-043-A05GTGTGGGGGCNONE 
AK063685GTGTGGGGGCSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0653000AK062922GCCCCCACConserved hypothetical protein. 
AK062922GCCCCCACCACConserved hypothetical protein. 
Os02g0658500012-083-D01GCCCCCACCACNONE 
016-061-E08GCCCCCACCACNONE 
AK099591GCCCCCACCACConserved hypothetical protein. 
AK107591GCCCCCACCACNONE 
J013043M11GCCCCCACCACNONE 
J100025J18GCCCCCACCACNONE 
J100059C10GCCCCCACCACNONE 
Os02g0667600AK073500GCCCCCACHarpin-induced 1 domain containing protein. 
AK109748GCCCCCACNONE 
AK109816GCCCCCACNONE 
Os02g0690700AK102342CGTGGGGGCClathrin adaptor complex, medium chain family protein. 
J033024M23CGTGGGGGCNONE 
J033091B08CGTGGGGGCNONE 
J065021P06CGTGGGGGCNONE 
J075105B22CGTGGGGGCNONE 
J075181D03CGTGGGGGCNONE 
J090049L10CGTGGGGGCNONE 
J090083A11CGTGGGGGCNONE 
J090099I18CGTGGGGGCNONE 
J100081L02CGTGGGGGCNONE 
Os02g0705300006-028-G05GCCCCCACNONE 
006-064-H09GCCCCCACNONE 
AK062089GCCCCCACNONE 
AK064855GCCCCCACNONE 
AK106164GCCCCCACTubby family protein. 
Os02g0719100AK069715GCCCCCACGAASimilar to Fimbrin/plastin-like (Fragment). 
Os02g0751900AK071003GCCCCCACSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase CVP2 (EC 3.1.3.56) (Cotyledon vascular pattern 2 protein). 
Os02g0753300012-010-H04GCCCCCACNONE 
AK065736GCCCCCACLipoxygenase, LH2 domain containing protein. 
AK104930GCCCCCACNONE 
J013038J04GCCCCCACNONE 
J065041B21GCCCCCACNONE 
J065162K13GCCCCCACNONE 
J065187G18GCCCCCACNONE 
J075051J11GCCCCCACNONE 
J100027H02GCCCCCACNONE 
Os02g0788800AK066747GCCCACGCGCCCCCACAmino acid/polyamine transporter II family protein. 
Os02g0797500AK072426GCCCCCACSimilar to Plastidic aspartate aminotransferase. 
AK105059GCCCCCACNONE 
AY157306GCCCCCACNONE 
J090089N21GCCCCCACNONE 
Os02g0805900AK073740GCCCCCACACDcp2, box A domain containing protein. 
J013068E03GCCCCCACACNONE 
J033066K03GCCCCCACACNONE 
J033092C14GCCCCCACACNONE 
J065020G11GCCCCCACACNONE 
J065098E16GCCCCCACACNONE 
J065124L06GCCCCCACACNONE 
J065134M23GCCCCCACACNONE 
J065187M23GCCCCCACACNONE 
J065208G07GCCCCCACACNONE 
J075002G10GCCCCCACACNONE 
J075004L01GCCCCCACACNONE 
J075051K23GCCCCCACACNONE 
J090063C03GCCCCCACACNONE 
J090071J21GCCCCCACACNONE 
J100078K12GCCCCCACACNONE 
Os02g0806000AK072745GTGTGGGGGCGCN5-related N-acetyltransferase domain containing protein. 
J013130C06GTGTGGGGGCNONE 
J013154L12GTGTGGGGGCNONE 
J023135J07GTGTGGGGGCNONE 
J065038E23GTGTGGGGGCNONE 
J065042C10GTGTGGGGGCNONE 
J090075B11GTGTGGGGGCNONE 
J100033J17GTGTGGGGGCNONE 
Os03g0108300006-070-F02GCCCCCACNONE 
006-083-A04GCCCCCACNONE 
AK061126GCCCCCACSimilar to Cellulase (EC 3.2.1.4). 
AK104060GCCCCCACNONE 
AK119538GCCCCCACNONE 
Os03g0130700015-052-H06GCCCCCACNONE 
AK073872GCCCCCACNONE 
AK100822GCCCCCACNONE 
AK119886GCCCCCACNONE 
J090060L05GCCCCCACNONE 
J100059N01GCCCCCACNONE 
Os03g0131300015-095-G06CCGTGGGCCCCCACNONE 
015-095-G06GGTCCACGTGGGGGCCCACCCNONE 
AK100656CCGTGGGCCCCCACUbiquitin domain containing protein. 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
J033140O12CCGTGGGCCCCCACNONE 
J033140O12GGTCCACGTGGGGGCCCACCCNONE 
J065112C14CCGTGGGCCCCCACNONE 
J065112C14GGTCCACGTGGGGGCCCACCCNONE 
J090070D10CCGTGGGCCCCCACNONE 
J090070D10GGTCCACGTGGGGGCCCACCCNONE 
Os03g0143700AK066360GCCCCCACGConserved hypothetical protein. 
J013066M09GCCCCCACGNONE 
J023087N24GCCCCCACGNONE 
Os03g0144800AK103041GCCCCCACSimilar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein). 
J013043M12GCCCCCACNONE 
J013043N11GCCCCCACNONE 
J013093E21GCCCCCACNONE 
J033030E13GCCCCCACNONE 
J033044H20GCCCCCACNONE 
J033084H08GCCCCCACNONE 
J033117F03GCCCCCACNONE 
J043005E24GCCCCCACNONE 
J065218M08GCCCCCACNONE 
Os03g0148700AK065978ACGTGGGGGCCGCASimilar to Calcium/calmodulin-regulated receptor-like kinase. 
Os03g0157800AK067375GCCCCCACAC3'-5' exonuclease domain containing protein. 
AK070248GCCCCCACACNONE 
Os03g0160900J065071D24GTGGGGGCNONE 
J065132L03GTGGGGGCHypothetical protein. 
J075189L19GTGGGGGCNONE 
Os03g0167000AK107307GCCCCCACACCCCCCAConserved hypothetical protein. 
J100070K07GCCCCCACACCCCCCANONE 
Os03g0169100006-030-B01GCCCCCACGNONE 
006-098-E09GCCCCCACGNONE 
AF047444GCCCCCACGNONE 
AK061772GCCCCCACGNONE 
AK066306GCCCCCACGRibulose-phosphate 3-epimerase, chloroplast precursor (EC 5.1.3.1) (Pentose-5-phosphate 3-epimerase) (PPE) (RPE) (R5P3E). 
AK099215GCCCCCACGNONE 
J013025E07GCCCCCACGNONE 
J013040K21GCCCCCACGNONE 
J013045P06GCCCCCACGNONE 
J013058K11GCCCCCACGNONE 
J013063E18GCCCCCACGNONE 
J013072B22GCCCCCACGNONE 
J013096J08GCCCCCACGNONE 
J075189H20GCCCCCACGNONE 
J080039H06GCCCCCACGNONE 
J080040H17GCCCCCACGNONE 
Os03g0171900006-070-A01GCCCCCACGTGTCAGTGNONE 
AK061079GCCCCCACGTGTCAGTGNONE 
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0174500AK066881GCCCCCACSimilar to Adenylosuccinate synthetase, chloroplast precursor (EC 6.3.4.4) (IMP-- aspartate ligase) (AdSS) (AMPSase) (Fragment). 
J013088J03GCCCCCACNONE 
J100059J04GCCCCCACNONE 
Os03g0214400AK067931GCCCCCACSimilar to Digalactosyldiacylglycerol synthase 2. 
Os03g0218300015-078-G09CGTGGGGGCConserved hypothetical protein. 
J090095I10CGTGGGGGCNONE 
Os03g0222600J065048C01GTGTGGGGGCNONE 
J065117L06GTGTGGGGGCNONE 
J065183E14GTGTGGGGGCNONE 
J075074N18GTGTGGGGGCNONE 
J075197B12GTGTGGGGGCNONE 
J090049N05GTGTGGGGGCNONE 
J100029D23GTGTGGGGGCNONE 
J100068E06GTGTGGGGGCNONE 
Os03g0228400AK103703GCCCCCACSimilar to Adapter-related protein complex 3 sigma 2 subunit (Sigma-adaptin 3b) (AP-3 complex sigma-3B subunit) (Sigma-3B-adaptin). 
Os03g0228900J065037A17GCCCCCACGCGNONE 
J065053L23GCCCCCACGCGNONE 
J065061G13GCCCCCACGCGNONE 
J065100L21GCCCCCACGCGNONE 
J065101C08GCCCCCACGCGNONE 
J065112B13GCCCCCACGCGHypothetical protein. 
J065114G11GCCCCCACGCGNONE 
J065122L03GCCCCCACGCGNONE 
J065127B04GCCCCCACGCGNONE 
Os03g0251500AK101151CAGGTGGGGGCCCACANONE 
AK119298CAGGTGGGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0260600AK106649GCCCCCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0274800011-021-B02GCCCCCACCACNONE 
011-076-C11GCCCCCACCACNONE 
AK102905GCCCCCACCACSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
J033113F11GCCCCCACCACNONE 
J043009A15GCCCCCACCACNONE 
J090069A03GCCCCCACCACNONE 
Os03g0292800012-077-B05GCCCCCACNONE 
AK069970GCCCCCACSimilar to Ran binding protein 1 homolog. 
J065138F22GCCCCCACNONE 
Os03g0300300AK099693CGTGGGGGCWD40-like domain containing protein. 
Os03g0327100006-119-C12CGTGGGGGCGAGGNONE 
011-018-C10CGTGGGGGCGAGGNONE 
AK065989CGTGGGGGCGAGGSimilar to CUC1. 
J013046E14CGTGGGGGCGAGGNONE 
J065066N20CGTGGGGGCGAGGNONE 
Os03g0338000AK121399GTGTGGGGGCCGGGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0348900006-103-E01CCAAGCCCCCACCACNONE 
AK059950CCAAGCCCCCACCACZinc finger, CHY-type domain containing protein. 
AK073680CCAAGCCCCCACCACNONE 
J065058L22CCAAGCCCCCACCACNONE 
Os03g0365900AK069388GTGGGGGCLipolytic enzyme, G-D-S-L family protein. 
J023011L04GTGGGGGCNONE 
Os03g0379300006-039-F11GCCCCCACGTGNONE 
AK061515GCCCCCACGTGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GCCCCCACGTGNONE 
J013159M16GCCCCCACGTGNONE 
J090067F01GCCCCCACGTGNONE 
J090083F21GCCCCCACGTGNONE 
J100040M08GCCCCCACGTGNONE 
J100048C03GCCCCCACGTGNONE 
J100056M07GCCCCCACGTGNONE 
J100062N22GCCCCCACGTGNONE 
J100086L07GCCCCCACGTGNONE 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0411800009-042-G11AGATGGGCCCCCACGTNONE 
AK121551AGATGGGCCCCCACGTSimilar to Metal transport protein. 
AY302059AGATGGGCCCCCACGTNONE 
J013095L05AGATGGGCCCCCACGTNONE 
J033033B06AGATGGGCCCCCACGTNONE 
J033118G11AGATGGGCCCCCACGTNONE 
Os03g0439700AK065720GCCCCCACProtein of unknown function DUF1230 family protein. 
J013041G12GCCCCCACNONE 
J065030N09GCCCCCACNONE 
J065084A03GCCCCCACNONE 
J065167B14GCCCCCACNONE 
J100025F06GCCCCCACNONE 
J100032J16GCCCCCACNONE 
J100040L01GCCCCCACNONE 
J100074M13GCCCCCACNONE 
Os03g0666500006-096-G10GTGGGGGCNONE 
AK061203GTGGGGGCSimilar to Ras-related protein RHA1. 
AK067459GTGGGGGCNONE 
AK100036GTGGGGGCNONE 
J065052B08GTGGGGGCNONE 
J065075N17GTGGGGGCNONE 
J065106A10GTGGGGGCNONE 
J100065N16GTGGGGGCNONE 
J100073A22GTGGGGGCNONE 
J100084H04GTGGGGGCNONE 
J100090P16GTGGGGGCNONE 
Os03g0676400AK109228GCCCCCACACVQ domain containing protein. 
Os03g0704100003-129-D05GCCCCCACGTNONE 
AK070474GCCCCCACGTPAP fibrillin family protein. 
Os03g0712200AK073205CAGGTGGGGGCZinc finger, RanBP2-type domain containing protein. 
AK098968CAGGTGGGGGCNONE 
Os03g0736300AK070408GCCCACAAGCCCCCACSimilar to CEL6=CELLULASE 6 (Fragment). 
AK104929GCCCACAAGCCCCCACNONE 
Os03g0745000AK109590GCCCCCACNONE 
AY332465GCCCCCACNONE 
AY344486GCCCCCACNONE 
AY998118GCCCCCACWinged helix repressor DNA-binding domain containing protein. 
Os03g0762400AK071181ACGTGGGGGCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20ACGTGGGGGCNONE 
J033039C18ACGTGGGGGCNONE 
J033108N03ACGTGGGGGCNONE 
J043017N16ACGTGGGGGCNONE 
J065026C13ACGTGGGGGCNONE 
J065045C01ACGTGGGGGCNONE 
J065045D11ACGTGGGGGCNONE 
J065050N09ACGTGGGGGCNONE 
J065058P21ACGTGGGGGCNONE 
J065075I20ACGTGGGGGCNONE 
J065077I17ACGTGGGGGCNONE 
J065081I20ACGTGGGGGCNONE 
J065085B14ACGTGGGGGCNONE 
J065101K21ACGTGGGGGCNONE 
J065112A17ACGTGGGGGCNONE 
J065112N13ACGTGGGGGCNONE 
J065118J02ACGTGGGGGCNONE 
J065123E01ACGTGGGGGCNONE 
J065134N12ACGTGGGGGCNONE 
J065139L04ACGTGGGGGCNONE 
J065141I11ACGTGGGGGCNONE 
J065161J24ACGTGGGGGCNONE 
J065164I10ACGTGGGGGCNONE 
J065171L01ACGTGGGGGCNONE 
J065178P21ACGTGGGGGCNONE 
J065185L24ACGTGGGGGCNONE 
J065219C04ACGTGGGGGCNONE 
J075029B07ACGTGGGGGCNONE 
J075033G20ACGTGGGGGCNONE 
J075054N01ACGTGGGGGCNONE 
J075068B22ACGTGGGGGCNONE 
J075096N11ACGTGGGGGCNONE 
J075098C11ACGTGGGGGCNONE 
J075115J22ACGTGGGGGCNONE 
J075127D11ACGTGGGGGCNONE 
J075156J21ACGTGGGGGCNONE 
J075166G08ACGTGGGGGCNONE 
J075166P17ACGTGGGGGCNONE 
J075170O18ACGTGGGGGCNONE 
J075181A16ACGTGGGGGCNONE 
J075195J11ACGTGGGGGCNONE 
Os03g0776400015-009-D03GCCCCCACNONE 
AK106237GCCCCCACConserved hypothetical protein. 
J100024C12GCCCCCACNONE 
J100083J23GCCCCCACNONE 
Os03g0778100003-129-G04GCCCCCACNONE 
006-083-H10GCCCCCACNONE 
009-010-G08GCCCCCACNONE 
009-051-E05GCCCCCACNONE 
AF093634GCCCCCACNONE 
AK059890GCCCCCACNONE 
AK060493GCCCCCACNONE 
AK069791GCCCCCACSimilar to Photosystem-1 F subunit. 
J023031N02GCCCCCACNONE 
J075170I20GCCCCCACNONE 
Os03g0780400011-100-D09GCCCCCACNONE 
AK061347GCCCCCACNONE 
AK073162GCCCCCACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22GCCCCCACNONE 
J065045I07GCCCCCACNONE 
J090036F17GCCCCCACNONE 
J090077M14GCCCCCACNONE 
J100055G20GCCCCCACNONE 
Os03g0788500AK072204GCCCCCACSimilar to Calcium-dependent protein kinase 2. 
Os03g0788600AK069046GCCCCCACCAACBeta-Ig-H3/fasciclin domain containing protein. 
AK106114GCCCCCACCAACNONE 
J023009K09GCCCCCACCAACNONE 
J033022M06GCCCCCACCAACNONE 
J033033H18GCCCCCACCAACNONE 
J033098E16GCCCCCACCAACNONE 
J065138K19GCCCCCACCAACNONE 
J065163G19GCCCCCACCAACNONE 
J090029F21GCCCCCACCAACNONE 
J100031D24GCCCCCACCAACNONE 
J100047O10GCCCCCACCAACNONE 
J100052E07GCCCCCACCAACNONE 
J100055F20GCCCCCACCAACNONE 
J100055O09GCCCCCACCAACNONE 
J100065I23GCCCCCACCAACNONE 
Os03g0788800AK071670GCCCCCACACZinc finger, RING-type domain containing protein. 
J013090J22GCCCCCACACNONE 
J023050M06GCCCCCACACNONE 
J023073A12GCCCCCACACNONE 
J023075P21GCCCCCACACNONE 
J023106F04GCCCCCACACNONE 
J075181H19GCCCCCACACNONE 
J090009C24GCCCCCACACNONE 
J100027L24GCCCCCACACNONE 
J100055F06GCCCCCACACNONE 
J100081C22GCCCCCACACNONE 
J100084I21GCCCCCACACNONE 
Os03g0801900015-081-G06GCCCCCACNONE 
AK106415GCCCCCACProtein of unknown function DUF569 family protein. 
J090099L17GCCCCCACNONE 
J100024B03GCCCCCACNONE 
J100088I08GCCCCCACNONE 
Os03g0825900AK109694GCCCCCACConserved hypothetical protein. 
Os03g0835600AK101677GCCCCCACAcyl-coA-binding protein, ACBP family protein. 
Os03g0859550J065092L21CGTGGGGGCTCAGCTGGGCCTCConserved hypothetical protein. 
Os04g0194500AK121164CAACGGCCCCCACSimilar to ABC transporter-like protein. 
Os04g0337500AK061807TACGGCCCCCACACNONE 
Os04g0382100AK108218CGTGGGGGCSWIB/MDM2 domain containing protein. 
J065059M07CGTGGGGGCNONE 
J065104M04CGTGGGGGCNONE 
Os04g0387600009-148-E01GTGGGGGCCCACTCTNONE 
009-155-A11GTGGGGGCCCACTCTNONE 
009-175-F04GTGGGGGCCCACTCTNONE 
AK063862GTGGGGGCCCACTCTConserved hypothetical protein. 
J065035F12GTGGGGGCCCACTCTNONE 
J065162C13GTGGGGGCCCACTCTNONE 
J065169L19GTGGGGGCCCACTCTNONE 
Os04g0390000AK067777TGTGGGCCCCCACNONE 
AK068713TGTGGGCCCCCACNONE 
AK098921TGTGGGCCCCCACSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0405500011-007-D12GCCCCCACGNONE 
AK063263GCCCCCACGConserved hypothetical protein. 
J065166G19GCCCCCACGNONE 
J075180M09GCCCCCACGNONE 
Os04g0414700009-068-G12GCCCCCACNONE 
009-070-D05GCCCCCACNONE 
009-141-A08GCCCCCACNONE 
009-144-A07GCCCCCACNONE 
009-164-F03GCCCCCACNONE 
AK058848GCCCCCACConserved hypothetical protein. 
J013131F19GCCCCCACNONE 
J013158N18GCCCCCACNONE 
J023028J24GCCCCCACNONE 
J023039K24GCCCCCACNONE 
J065077F17GCCCCCACNONE 
J065080G08GCCCCCACNONE 
J065182N04GCCCCCACNONE 
J065184G24GCCCCCACNONE 
J065208A07GCCCCCACNONE 
J065215H12GCCCCCACNONE 
J075039D21GCCCCCACNONE 
J075049C05GCCCCCACNONE 
J075055E15GCCCCCACNONE 
J075057O12GCCCCCACNONE 
J075073K23GCCCCCACNONE 
J075073N15GCCCCCACNONE 
J075076A15GCCCCCACNONE 
J075077D02GCCCCCACNONE 
J075096M18GCCCCCACNONE 
J075098M24GCCCCCACNONE 
J075101G13GCCCCCACNONE 
J075101O07GCCCCCACNONE 
J075114F04GCCCCCACNONE 
J075119K17GCCCCCACNONE 
J075132E19GCCCCCACNONE 
J075136P20GCCCCCACNONE 
J075140E11GCCCCCACNONE 
J075145D03GCCCCCACNONE 
J075146B08GCCCCCACNONE 
J075169B13GCCCCCACNONE 
J075181A18GCCCCCACNONE 
J075189H21GCCCCCACNONE 
J075197F20GCCCCCACNONE 
J075199J08GCCCCCACNONE 
J080307B22GCCCCCACNONE 
J090076J18GCCCCCACNONE 
Os04g0445200009-034-A06GTTGGTGGGGGCNONE 
AK062427GTTGGTGGGGGCProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720GTTGGTGGGGGCNONE 
J065022E20GTTGGTGGGGGCNONE 
J065062D16GTTGGTGGGGGCNONE 
J065081I02GTTGGTGGGGGCNONE 
J065087C10GTTGGTGGGGGCNONE 
J065116N16GTTGGTGGGGGCNONE 
J065132F10GTTGGTGGGGGCNONE 
J065140F18GTTGGTGGGGGCNONE 
J065143M22GTTGGTGGGGGCNONE 
J065158K17GTTGGTGGGGGCNONE 
J065162D07GTTGGTGGGGGCNONE 
J065207H19GTTGGTGGGGGCNONE 
J075155B20GTTGGTGGGGGCNONE 
J075167E24GTTGGTGGGGGCNONE 
J075178B19GTTGGTGGGGGCNONE 
J080301D22GTTGGTGGGGGCNONE 
J080301J15GTTGGTGGGGGCNONE 
J080308J02GTTGGTGGGGGCNONE 
Os04g0447400AK070858GCCCCCACCACGTCGCGCGCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09GCCCCCACCACGTCGCGCGCNONE 
J023003G16GCCCCCACCACGTCGCGCGCNONE 
J023006F16GCCCCCACCACGTCGCGCGCNONE 
J023008D10GCCCCCACCACGTCGCGCGCNONE 
J023010A01GCCCCCACCACGTCGCGCGCNONE 
J023012M16GCCCCCACCACGTCGCGCGCNONE 
J023023H17GCCCCCACCACGTCGCGCGCNONE 
J023029B12GCCCCCACCACGTCGCGCGCNONE 
J023030F09GCCCCCACCACGTCGCGCGCNONE 
J023034K03GCCCCCACCACGTCGCGCGCNONE 
J023045A16GCCCCCACCACGTCGCGCGCNONE 
J023048I04GCCCCCACCACGTCGCGCGCNONE 
J023056C09GCCCCCACCACGTCGCGCGCNONE 
J023056F05GCCCCCACCACGTCGCGCGCNONE 
J023058B21GCCCCCACCACGTCGCGCGCNONE 
J023058N06GCCCCCACCACGTCGCGCGCNONE 
J023059F03GCCCCCACCACGTCGCGCGCNONE 
J023059M19GCCCCCACCACGTCGCGCGCNONE 
J023060P05GCCCCCACCACGTCGCGCGCNONE 
J023062D07GCCCCCACCACGTCGCGCGCNONE 
J023063F16GCCCCCACCACGTCGCGCGCNONE 
J023068K15GCCCCCACCACGTCGCGCGCNONE 
J023069L04GCCCCCACCACGTCGCGCGCNONE 
J023075I24GCCCCCACCACGTCGCGCGCNONE 
J023086H01GCCCCCACCACGTCGCGCGCNONE 
J023086I24GCCCCCACCACGTCGCGCGCNONE 
J023091M08GCCCCCACCACGTCGCGCGCNONE 
J023095A07GCCCCCACCACGTCGCGCGCNONE 
J023110K06GCCCCCACCACGTCGCGCGCNONE 
J023113D07GCCCCCACCACGTCGCGCGCNONE 
J023126J05GCCCCCACCACGTCGCGCGCNONE 
J023140F04GCCCCCACCACGTCGCGCGCNONE 
J023141N19GCCCCCACCACGTCGCGCGCNONE 
Os04g0447500AK064090GCGCGCGACGTGGTGGGGGCSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0461400AK066992CGTGGGGGCHypothetical protein. 
J013089P17CGTGGGGGCNONE 
Os04g0477500AK063950GCCCCCACGNONE 
AK067372GCCCCCACGGlycosyl transferase, family 17 protein. 
AK100897GCCCCCACGNONE 
J013106K01GCCCCCACGNONE 
J065025M07GCCCCCACGNONE 
J065025M08GCCCCCACGNONE 
Os04g0492300AK120935GTGTGGGGGCSimilar to DNA-directed RNA polymerase II largest chain. 
Os04g0496600AK065058GCCCCCACConserved hypothetical protein. 
J013001J09GCCCCCACNONE 
J013037C18GCCCCCACNONE 
J013126H05GCCCCCACNONE 
J090062G17GCCCCCACNONE 
Os04g0500700AK072528CCTCGCCCCACGCGGCCCCCACCCGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637CCTCGCCCCACGCGGCCCCCACCCGNONE 
AK119237CCTCGCCCCACGCGGCCCCCACCCGNONE 
Os04g0505700AK071138GCCCCCACCCGLeucine-rich repeat, cysteine-containing subtype containing protein. 
J023081C03GCCCCCACCCGNONE 
J033108O05GCCCCCACCCGNONE 
J100079D03GCCCCCACCCGNONE 
Os04g0561200AK107862CCCGGGCCCCCACCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J065028J03CCCGGGCCCCCACNONE 
J065042H13CCCGGGCCCCCACNONE 
J065079N01CCCGGGCCCCCACNONE 
J065190N16CCCGGGCCCCCACNONE 
J065191H22CCCGGGCCCCCACNONE 
Os04g0623300AK064902GCCCCCACGTSimilar to Flavin-containing monamine oxidase family protein. 
Os04g0623400AK100249GCCCCCACNONE 
AK110887GCCCCCACExonuclease domain containing protein. 
J023060F18GCCCCCACNONE 
J023108E02GCCCCCACNONE 
J065203O14GCCCCCACNONE 
Os04g0658600AK064729GCCCCCACNONE 
AK119253GCCCCCACNucleolar, Nop52 family protein. 
J075132J07GCCCCCACNONE 
J075157N21GCCCCCACNONE 
Os04g0661300AK070723GCCCCCACConserved hypothetical protein. 
AK103942GCCCCCACNONE 
Os04g0673000AK064182GCCCCCACHomeodomain-like containing protein. 
AK066211GCCCCCACNONE 
AK068390GCCCCCACNONE 
Os04g0683900004-009-A11CGTGGGGGCNONE 
014-076-H12CGTGGGGGCNONE 
AK060880CGTGGGGGCNONE 
AK099749CGTGGGGGCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309CGTGGGGGCNONE 
J013050K21CGTGGGGGCNONE 
J013092E09CGTGGGGGCNONE 
J013095N06CGTGGGGGCNONE 
J013095P07CGTGGGGGCNONE 
J013130D22CGTGGGGGCNONE 
J013134O15CGTGGGGGCNONE 
J023022I06CGTGGGGGCNONE 
J023062L11CGTGGGGGCNONE 
J023078J11CGTGGGGGCNONE 
J023086J01CGTGGGGGCNONE 
J033125A20CGTGGGGGCNONE 
J065023K13CGTGGGGGCNONE 
J065045N02CGTGGGGGCNONE 
J065129F01CGTGGGGGCNONE 
J065164H14CGTGGGGGCNONE 
J065192H09CGTGGGGGCNONE 
J075064P15CGTGGGGGCNONE 
J075088G17CGTGGGGGCNONE 
J075199D20CGTGGGGGCNONE 
Os05g0116500AK102231GCCCCCACConserved hypothetical protein. 
J033088A05GCCCCCACNONE 
Os05g0139100Os05g0139100GTGGGGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os05g0171200009-093-B06CGCGACGCCCCCACNONE 
009-157-F06CGCGACGCCCCCACNONE 
009-197-H10CGCGACGCCCCCACNONE 
AK062702CGCGACGCCCCCACEmbryo-specific 3 family protein. 
Os05g0186300AK070360GCGGGCCCCCACSimilar to NADP-malic enzyme. 
AK099249GCGGGCCCCCACNONE 
AY435404GCGGGCCCCCACNONE 
J023006D11GCGGGCCCCCACNONE 
J023059P07GCGGGCCCCCACNONE 
Os05g0195200015-031-H09GCCCCCACGTGTCNONE 
015-031-H09TGTGGGCCCCCACNONE 
015-070-C11GCCCCCACGTGTCNONE 
015-070-C11TGTGGGCCCCCACNONE 
016-063-C11GCCCCCACGTGTCNONE 
016-063-C11TGTGGGCCCCCACNONE 
AK106392GCCCCCACGTGTCZinc finger, CCCH-type domain containing protein. 
AK106392TGTGGGCCCCCACZinc finger, CCCH-type domain containing protein. 
J033051N05GCCCCCACGTGTCNONE 
J033051N05TGTGGGCCCCCACNONE 
J065118P05GCCCCCACGTGTCNONE 
J065118P05TGTGGGCCCCCACNONE 
J100071H15GCCCCCACGTGTCNONE 
J100071H15TGTGGGCCCCCACNONE 
J100078J22GCCCCCACGTGTCNONE 
J100078J22TGTGGGCCCCCACNONE 
Os05g0220600AK073669AGTGGGCCCCCACRhomboid-like protein family protein. 
J033052F18AGTGGGCCCCCACNONE 
J065109N23AGTGGGCCCCCACNONE 
J100037H15AGTGGGCCCCCACNONE 
J100048E14AGTGGGCCCCCACNONE 
Os05g0291700AK073234GCCCCCACNONE 
AK099865GCCCCCACConserved hypothetical protein. 
AK108453GCCCCCACNONE 
Os05g0295100AK100239CCCGTGGGGGCCCGProtein of unknown function DUF1253 family protein. 
AK108559CCCGTGGGGGCCCGNONE 
Os05g0304900AK105545GCCCCCACGlycoside hydrolase, family 10 protein. 
Os05g0357850J065118C17AAAAGCCCCCACHypothetical protein. 
J065159C03AAAAGCCCCCACNONE 
Os05g0384300AK107183ACGTGGGGGCPeptidase A1, pepsin family protein. 
Os05g0407500AK074026GTGGGGGCCCACCTEsterase/lipase/thioesterase domain containing protein. 
Os05g0541200AK068633GCCCCCACConserved hypothetical protein 730 family protein. 
J013157L23GCCCCCACNONE 
Os05g0566900AK066026GCCCCCACNONE 
AK102711GCCCCCACNONE 
AK120605GCCCCCACSimilar to TA9 protein (Fragment). 
J013044F07GCCCCCACNONE 
J023007A19GCCCCCACNONE 
J023044D19GCCCCCACNONE 
J033036E11GCCCCCACNONE 
J033045H19GCCCCCACNONE 
J033071A17GCCCCCACNONE 
J033086M17GCCCCCACNONE 
J033129G03GCCCCCACNONE 
J033136I16GCCCCCACNONE 
J065013A05GCCCCCACNONE 
J100085E08GCCCCCACNONE 
Os05g0567100015-030-G11GCCCCCACGNONE 
AK066453GCCCCCACGNONE 
AK067742GCCCCCACGNONE 
AK098906GCCCCCACGNONE 
AK098911GCCCCCACGNONE 
AK103421GCCCCCACGNONE 
AK104838GCCCCCACGNONE 
D32144GCCCCCACGAspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
J013002D14GCCCCCACGNONE 
J013002H22GCCCCCACGNONE 
J013022G01GCCCCCACGNONE 
J013039N15GCCCCCACGNONE 
J023007F19GCCCCCACGNONE 
J023107B10GCCCCCACGNONE 
J033038D21GCCCCCACGNONE 
J033043E23GCCCCCACGNONE 
J033061A06GCCCCCACGNONE 
Os05g0576600AK107732GCCCCCACTCCConserved hypothetical protein. 
Os06g0109200AK060278GTGGGGGCProtein of unknown function DUF6, transmembrane domain containing protein. 
AK099078GTGGGGGCNONE 
J013118A06GTGGGGGCNONE 
J013170B11GTGGGGGCNONE 
J065013G06GTGGGGGCNONE 
J065160O04GTGGGGGCNONE 
Os06g0133600AK068474GCCCCCACACGNONE 
AK105690GCCCCCACACGPhosphate-induced protein 1 conserved region family protein. 
J013155H19GCCCCCACACGNONE 
J023054J01GCCCCCACACGNONE 
J065013N23GCCCCCACACGNONE 
Os06g0153200AK072625GCCCCCACCGGGTGGGGCCCACCCCCACCACNONE 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0157800AK121504GCCCCCACSimilar to CG7224 (Fragment). 
J033022L20GCCCCCACNONE 
J075033D09GCCCCCACNONE 
Os06g0161800AK064664GCCCCCACProtein of unknown function DUF569 family protein. 
Os06g0232000006-109-B11GCCCCCACGNONE 
011-080-C04GCCCCCACGNONE 
016-019-G01GCCCCCACGNONE 
AB110192GCCCCCACGNONE 
AK068966GCCCCCACGNONE 
AK071776GCCCCCACGConserved hypothetical protein. 
AK106053GCCCCCACGNONE 
J013146K14GCCCCCACGNONE 
J023013A10GCCCCCACGNONE 
J023029O20GCCCCCACGNONE 
J023110G05GCCCCCACGNONE 
J023135H04GCCCCCACGNONE 
J033125H14GCCCCCACGNONE 
J043009N01GCCCCCACGNONE 
J090096E06GCCCCCACGNONE 
J100070G19GCCCCCACGNONE 
Os06g0247800AK102187GCCCCCACCGCGTCGCSimilar to Dynamin-like protein (Fragment). 
AY224491GCCCCCACCGCGTCGCNONE 
Os06g0264300016-089-F02GCCCCCACNONE 
AK062241GCCCCCACNONE 
Os06g0340600006-114-G04GCCCCCACNONE 
AK061872GCCCCCACPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
AK065176GCCCCCACNONE 
AK100224GCCCCCACNONE 
J013002D10GCCCCCACNONE 
Os06g0505700009-010-E06GCCCCCACCCGNONE 
AK121505GCCCCCACCCGHypothetical protein. 
J033022N03GCCCCCACCCGNONE 
Os06g0590301J033139K16CGCGTGGGGGCNONE 
J065011M13CGCGTGGGGGCNONE 
J065027D20CGCGTGGGGGCNONE 
J065039O05CGCGTGGGGGCGlucose/ribitol dehydrogenase family protein. 
J065051O10CGCGTGGGGGCNONE 
J065128I21CGCGTGGGGGCNONE 
J065163P10CGCGTGGGGGCNONE 
J065169H02CGCGTGGGGGCNONE 
Os06g0604600009-064-B08GCCCCCACTCTNONE 
AK069255GCCCCCACTCTConserved hypothetical protein. 
J065168I11GCCCCCACTCTNONE 
J080009E23GCCCCCACTCTNONE 
J080017E13GCCCCCACTCTNONE 
J080026M06GCCCCCACTCTNONE 
J080034J02GCCCCCACTCTNONE 
J080039M21GCCCCCACTCTNONE 
J080042J09GCCCCCACTCTNONE 
J080049A14GCCCCCACTCTNONE 
J080072E05GCCCCCACTCTNONE 
J080097E14GCCCCCACTCTNONE 
J080304H23GCCCCCACTCTNONE 
J100032L07GCCCCCACTCTNONE 
J100037F24GCCCCCACTCTNONE 
Os06g0609800AK065646GTGGGGGCConserved hypothetical protein. 
Os06g0652000AK058530GTGGGGGCNONE 
Os06g0659500AK058431GTGGGGGCSimilar to Glutaredoxin. 
J075110D04GTGGGGGCNONE 
J090010C23GTGGGGGCNONE 
Os06g0696400011-019-C01CCCCCGCGTCTCTGGCCCCCACACNONE 
011-027-D04CCCCCGCGTCTCTGGCCCCCACACNONE 
013-051-H10CCCCCGCGTCTCTGGCCCCCACACNONE 
013-054-A06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-061-D06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-088-F04CCCCCGCGTCTCTGGCCCCCACACNONE 
014-018-C07CCCCCGCGTCTCTGGCCCCCACACNONE 
014-026-E10CCCCCGCGTCTCTGGCCCCCACACNONE 
AK058291CCCCCGCGTCTCTGGCCCCCACACNONE 
AK066125CCCCCGCGTCTCTGGCCCCCACACNONE 
AK104912CCCCCGCGTCTCTGGCCCCCACACNONE 
BT014685CCCCCGCGTCTCTGGCCCCCACACSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CCCCCGCGTCTCTGGCCCCCACACNONE 
J065065L22CCCCCGCGTCTCTGGCCCCCACACNONE 
J065084O06CCCCCGCGTCTCTGGCCCCCACACNONE 
J075006O13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075013J18CCCCCGCGTCTCTGGCCCCCACACNONE 
J075018L23CCCCCGCGTCTCTGGCCCCCACACNONE 
J075036E14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075039K21CCCCCGCGTCTCTGGCCCCCACACNONE 
J075075H13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075091A14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075093I09CCCCCGCGTCTCTGGCCCCCACACNONE 
J075136L17CCCCCGCGTCTCTGGCCCCCACACNONE 
J075156M24CCCCCGCGTCTCTGGCCCCCACACNONE 
J075174J01CCCCCGCGTCTCTGGCCCCCACACNONE 
J075179P15CCCCCGCGTCTCTGGCCCCCACACNONE 
J075181F02CCCCCGCGTCTCTGGCCCCCACACNONE 
J075194L24CCCCCGCGTCTCTGGCCCCCACACNONE 
J080302J02CCCCCGCGTCTCTGGCCCCCACACNONE 
J080304J11CCCCCGCGTCTCTGGCCCCCACACNONE 
J080308A15CCCCCGCGTCTCTGGCCCCCACACNONE 
J100041B09CCCCCGCGTCTCTGGCCCCCACACNONE 
Os07g0141400003-129-D08GCCCCCACNONE 
006-021-E02GCCCCCACNONE 
006-025-C06GCCCCCACNONE 
006-027-H11GCCCCCACNONE 
006-036-C05GCCCCCACNONE 
006-046-D07GCCCCCACNONE 
006-047-A02GCCCCCACNONE 
006-050-F02GCCCCCACNONE 
006-053-D07GCCCCCACNONE 
006-054-E06GCCCCCACNONE 
006-055-E01GCCCCCACNONE 
006-055-F01GCCCCCACNONE 
006-056-H12GCCCCCACNONE 
006-057-D07GCCCCCACNONE 
006-074-G10GCCCCCACNONE 
006-077-C02GCCCCCACNONE 
006-081-E01GCCCCCACNONE 
006-089-B08GCCCCCACNONE 
006-089-C10GCCCCCACNONE 
006-092-E07GCCCCCACNONE 
006-096-C11GCCCCCACNONE 
006-096-H06GCCCCCACNONE 
006-097-E07GCCCCCACNONE 
006-098-D03GCCCCCACNONE 
006-102-C05GCCCCCACNONE 
006-107-E09GCCCCCACNONE 
006-110-C09GCCCCCACNONE 
006-113-C01GCCCCCACNONE 
006-114-D09GCCCCCACNONE 
006-115-H06GCCCCCACNONE 
009-016-G06GCCCCCACNONE 
009-031-C05GCCCCCACNONE 
009-060-B05GCCCCCACNONE 
009-123-H12GCCCCCACNONE 
009-154-B09GCCCCCACNONE 
009-172-F07GCCCCCACNONE 
009-193-A04GCCCCCACNONE 
AF022732GCCCCCACNONE 
AF052203GCCCCCACNONE 
AK065248GCCCCCACSimilar to 23 kDa polypeptide of photosystem II. 
AK104722GCCCCCACNONE 
D49713GCCCCCACNONE 
J013002J02GCCCCCACNONE 
J065051O13GCCCCCACNONE 
J065066J18GCCCCCACNONE 
J065077G23GCCCCCACNONE 
J065162C22GCCCCCACNONE 
J065162G22GCCCCCACNONE 
J075091B13GCCCCCACNONE 
J075099J22GCCCCCACNONE 
J100056O22GCCCCCACNONE 
J100059E01GCCCCCACNONE 
J100079F20GCCCCCACNONE 
Os07g0152800AK065458GCCCCCACConserved hypothetical protein. 
J013022G05GCCCCCACNONE 
J013023D18GCCCCCACNONE 
J013048J16GCCCCCACNONE 
J013055I03GCCCCCACNONE 
J013057F12GCCCCCACNONE 
J023109A22GCCCCCACNONE 
J023148E09GCCCCCACNONE 
J033069G17GCCCCCACNONE 
J033092I18GCCCCCACNONE 
J033093C02GCCCCCACNONE 
J033141M17GCCCCCACNONE 
J043016M18GCCCCCACNONE 
J090016D12GCCCCCACNONE 
J090071B10GCCCCCACNONE 
J090098K07GCCCCCACNONE 
J100035K14GCCCCCACNONE 
Os07g0153400AK069618GTGGGGGCCCACCCCyclin-like F-box domain containing protein. 
J013023C22GTGGGGGCCCACCCNONE 
J013034M12GTGGGGGCCCACCCNONE 
J013048B10GTGGGGGCCCACCCNONE 
J013052P04GTGGGGGCCCACCCNONE 
J013091E22GTGGGGGCCCACCCNONE 
J013096D02GTGGGGGCCCACCCNONE 
J013098A08GTGGGGGCCCACCCNONE 
J013106B13GTGGGGGCCCACCCNONE 
J013109C09GTGGGGGCCCACCCNONE 
J013121H14GTGGGGGCCCACCCNONE 
J023002G10GTGGGGGCCCACCCNONE 
J023019I24GTGGGGGCCCACCCNONE 
J023025H16GTGGGGGCCCACCCNONE 
J023037K24GTGGGGGCCCACCCNONE 
J023041J02GTGGGGGCCCACCCNONE 
J023056G02GTGGGGGCCCACCCNONE 
J023073H18GTGGGGGCCCACCCNONE 
J023082F08GTGGGGGCCCACCCNONE 
J023104J01GTGGGGGCCCACCCNONE 
J023105F21GTGGGGGCCCACCCNONE 
J033038A08GTGGGGGCCCACCCNONE 
J033040I21GTGGGGGCCCACCCNONE 
J033111M19GTGGGGGCCCACCCNONE 
J043010N11GTGGGGGCCCACCCNONE 
J075018B18GTGGGGGCCCACCCNONE 
J075043E08GTGGGGGCCCACCCNONE 
J075045H12GTGGGGGCCCACCCNONE 
J075048P08GTGGGGGCCCACCCNONE 
J075056M23GTGGGGGCCCACCCNONE 
J075061J22GTGGGGGCCCACCCNONE 
J075085K04GTGGGGGCCCACCCNONE 
J075118N16GTGGGGGCCCACCCNONE 
J075120O11GTGGGGGCCCACCCNONE 
J075133J08GTGGGGGCCCACCCNONE 
J075186O13GTGGGGGCCCACCCNONE 
J100047B15GTGGGGGCCCACCCNONE 
Os07g0160100AF098752GCCCCCACYABBY protein (OsYAB1) (Filamentous flower protein 1). 
AK070045GCCCCCACNONE 
AK100222GCCCCCACNONE 
Os07g0181800AK121080AGAGTGGGGGCConserved hypothetical protein. 
J023063D04AGAGTGGGGGCNONE 
J033084A07AGAGTGGGGGCNONE 
J075013C04AGAGTGGGGGCNONE 
J075027H13AGAGTGGGGGCNONE 
J075045P19AGAGTGGGGGCNONE 
J090042L13AGAGTGGGGGCNONE 
J090098E10AGAGTGGGGGCNONE 
Os07g0229200AK058412GAGGCGTGGTGTGGGGGCCyclin-like F-box domain containing protein. 
AK058412GTGGTGGGGGCCyclin-like F-box domain containing protein. 
Os07g0240300AK072205GCCCCCACConserved hypothetical protein. 
AK098977GCCCCCACNONE 
Os07g0257200AK070788GCCCCCACSimilar to OsNramp1 (Integral membrane protein). 
J023064O13GCCCCCACNONE 
J090040J06GCCCCCACNONE 
J090071P07GCCCCCACNONE 
J100036G17GCCCCCACNONE 
J100055E18GCCCCCACNONE 
J100062N13GCCCCCACNONE 
J100087P04GCCCCCACNONE 
Os07g0274700J065002G18CCCGTGGGCCCCCACCCGCGCNONE 
J065092L19CCCGTGGGCCCCCACCCGCGCNONE 
J065099K11CCCGTGGGCCCCCACCCGCGCNONE 
J065103L08CCCGTGGGCCCCCACCCGCGCNONE 
J065185I19CCCGTGGGCCCCCACCCGCGCNONE 
J075004L22CCCGTGGGCCCCCACCCGCGCNONE 
J075007G03CCCGTGGGCCCCCACCCGCGCNONE 
J075020E09CCCGTGGGCCCCCACCCGCGCNONE 
J075046B02CCCGTGGGCCCCCACCCGCGCNONE 
J075070D08CCCGTGGGCCCCCACCCGCGCNONE 
J075118L24CCCGTGGGCCCCCACCCGCGCNONE 
J075140C15CCCGTGGGCCCCCACCCGCGCNONE 
J075157A21CCCGTGGGCCCCCACCCGCGCNONE 
J075165J01CCCGTGGGCCCCCACCCGCGCNONE 
J075172J18CCCGTGGGCCCCCACCCGCGCNONE 
J075177P10CCCGTGGGCCCCCACCCGCGCNONE 
J100042D15CCCGTGGGCCCCCACCCGCGCNONE 
J100053M21CCCGTGGGCCCCCACCCGCGCNONE 
J100067M12CCCGTGGGCCCCCACCCGCGCNONE 
Os07g0481100003-130-F04GTGGGGGCNONE 
AK062302GTGGGGGCProtein of unknown function DUF315 domain containing protein. 
J090048K21GTGGGGGCNONE 
Os07g0509800Os07g0509800GCCACGTGGCCCCCACSimilar to APS reductase (Fragment). 
Os07g0545400009-136-E03CCCAGCCCCCACGNONE 
013-015-G08CCCAGCCCCCACGNONE 
AK059228CCCAGCCCCCACGNONE 
J065040D09CCCAGCCCCCACGNONE 
J065051C19CCCAGCCCCCACGNONE 
J065139B05CCCAGCCCCCACGNONE 
J065160E20CCCAGCCCCCACGNONE 
J065207I17CCCAGCCCCCACGNONE 
J080319M24CCCAGCCCCCACGNONE 
Os07g0556200006-026-F07GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-042-H11GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-048-D01GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-051-E02GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-061-E07GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-075-H06GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-110-E10GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-112-C09GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-116-E10GTGTGGGGGCGTGGGCGTGTGGCNONE 
AF093631GTGTGGGGGCGTGGGCGTGTGGCNONE 
AK071634GTGTGGGGGCGTGGGCGTGTGGCRieske iron-sulfur protein family protein. 
J013022H19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J013057E06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J013151C13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023080E08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023100K03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023105H15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023114I15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065002C09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065037K17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065038K18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065039D16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065040D18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065042O04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046J20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046L02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046L03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065053H02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065063A22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065066C08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065077J23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065081N04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065085O08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065087H09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065093M05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065094C01GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065102I04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065103C05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065104O06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065108H03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065121I10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065123E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065128E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065129G16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065131I07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065135F13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065137K23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065143A11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065143I04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065154N18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065170L23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065179D21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065180C18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065190F03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065205C02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065208A12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065209B05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065211C03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065212L24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065216I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065217O06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065218A02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075007M16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075013H23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075013O14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075015K10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075022G20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075023H23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075037I08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075038C06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075042B14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075063D13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075064O11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075067D07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075071G15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075072F15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075073D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075083M23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075084J12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075088I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075089C10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075093K09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075095P15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075098P08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075103A15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075108G23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075116G03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075118O21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075127H14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075129H07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075138J20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075142F12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075143F18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075143L11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075145N09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075146N05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075147P21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075154C18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075154N24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075155D22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075159C14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075161E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075168K20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075170E13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075170M24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075175E08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075176C15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075176H16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075177M01GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075178F18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075179C03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075179E16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075183D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075188O16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075193J05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080001M22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080013N04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080031E11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080034E09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080034L17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080037F06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080038M04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080040F10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080042P19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080045B11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080048E07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080048I09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080050J17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080051G02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080062E19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080063E12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080079A22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080079C15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080080D08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080096L22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080302E06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080302G12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080303B02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080303M06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080304I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080306N10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080308D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080308J23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080317I16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100038H16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100043C14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100045N09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100073D03GTGTGGGGGCGTGGGCGTGTGGCNONE 
Os07g0564600AK061125GTGGGGGCNONE 
AK102110GTGGGGGCSimilar to Secretory carrier membrane protein. 
Os07g0568900009-083-H02TTATGGGCCCCCACGNONE 
AK062660TTATGGGCCCCCACGConserved hypothetical protein. 
Os07g0569000AK073915CGTGGGGGCCCATAAConserved hypothetical protein. 
Os07g0584500003-129-F05TGGTGGGCCCCCACACNONE 
006-119-H08TGGTGGGCCCCCACACNONE 
011-022-G03TGGTGGGCCCCCACACNONE 
AK067725TGGTGGGCCCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109TGGTGGGCCCCCACACNONE 
J013055C05TGGTGGGCCCCCACACNONE 
J013062F12TGGTGGGCCCCCACACNONE 
J013069J22TGGTGGGCCCCCACACNONE 
J013114I11TGGTGGGCCCCCACACNONE 
J023072P12TGGTGGGCCCCCACACNONE 
Os07g0591400Os07g0591400GGTTGGGCCTACGTGGGCCCCCACNONE 
Os07g0592200AK099740GCCCCCACCTGTCAGPeptidase A1, pepsin family protein. 
AK110717GCCCCCACCTGTCAGNONE 
Os07g0623600AK063642GTGGTGGGTGGGGGCGCGGGTGCGGTGConserved hypothetical protein. 
Os07g0695100AK059514GTGGGGGCNONE 
Os08g0135900AK072535GCCCCCACSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0138500AK102951GCCCCCACACGCCCACCTSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GCCCCCACACGCCCACCTNONE 
J033115D14GCCCCCACACGCCCACCTNONE 
J065013F04GCCCCCACACGCCCACCTNONE 
J065050P11GCCCCCACACGCCCACCTNONE 
J065063K18GCCCCCACACGCCCACCTNONE 
J090054H10GCCCCCACACGCCCACCTNONE 
J100083F11GCCCCCACACGCCCACCTNONE 
Os08g0174700AB188247GCCCCCACNONE 
AK103038GCCCCCACSimilar to SERK1 (Fragment). 
AY463361GCCCCCACNONE 
Os08g0176900AK107028GCCCCCACCACSimilar to Transcription factor HBP-1b(C38) (Fragment). 
AK109294GCCCCCACCACNONE 
Os08g0234700AK106899GCCCCCACConserved hypothetical protein. 
Os08g0280200AK069036GCCCCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os08g0374800012-075-F07GGTGGGCCCCCACGNONE 
AB096863GGTGGGCCCCCACGNONE 
AK066269GGTGGGCCCCCACGSimilar to UDP-galactose 4-epimerase-like protein. 
J013059D16GGTGGGCCCCCACGNONE 
J033132O05GGTGGGCCCCCACGNONE 
J065044E20GGTGGGCCCCCACGNONE 
J065139E23GGTGGGCCCCCACGNONE 
J075065B03GGTGGGCCCCCACGNONE 
J090050M10GGTGGGCCCCCACGNONE 
J090094F08GGTGGGCCCCCACGNONE 
J100031C21GGTGGGCCCCCACGNONE 
J100050I23GGTGGGCCCCCACGNONE 
J100081I16GGTGGGCCCCCACGNONE 
Os08g0459100AK121795CTTGGGCCCGCCCCCACGTLeucine-rich repeat, cysteine-containing containing protein. 
Os08g0465000J065121H01GCCCCCACHomeobox domain containing protein. 
Os08g0475100AK105839GCCCCCACEsterase/lipase/thioesterase domain containing protein. 
Os08g0485700AK068131GCCCCCACNONE 
AK069097GCCCCCACMethyl-CpG binding domain containing protein. 
J013130L03GCCCCCACNONE 
Os08g0537900AK119425GTGTGGGGGCNONE 
AY341827GTGTGGGGGCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0539700AB013451GCCCCCACNONE 
AK065693GCCCCCACDisease resistance protein family protein. 
AK099855GCCCCCACNONE 
J013022K17GCCCCCACNONE 
J013035D04GCCCCCACNONE 
J013037A20GCCCCCACNONE 
J013043I01GCCCCCACNONE 
J013051J07GCCCCCACNONE 
J013056G09GCCCCCACNONE 
J013067C09GCCCCCACNONE 
J013067M22GCCCCCACNONE 
J013089C05GCCCCCACNONE 
J013106J08GCCCCCACNONE 
J013110K12GCCCCCACNONE 
J013114K06GCCCCCACNONE 
J013135N19GCCCCCACNONE 
J013149H06GCCCCCACNONE 
J075111G14GCCCCCACNONE 
Os08g0554900AK072840GCCCCCACCCGNonaspanin (TM9SF) family protein. 
AK099230GCCCCCACCCGNONE 
Os09g0128400016-092-E05GTGGGGGCNONE 
AK059696GTGGGGGCNONE 
AK103118GTGGGGGCConserved hypothetical protein. 
Os09g0286600006-028-B02GCCCCCACNONE 
AK060090GCCCCCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
AK065344GCCCCCACNONE 
AK072749GCCCCCACNONE 
Os09g0296400J090084M08GTGGGGGCConserved hypothetical protein. 
Os09g0360400009-192-H06CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
AK071395CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGConserved hypothetical protein. 
J013045J21CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J023095O09CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J065207K01CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
Os09g0369500013-023-F11GTGGGGGCNONE 
AK105322GTGGGGGCNONE 
AK105479GTGGGGGCConserved hypothetical protein. 
Os09g0436500AK107460CGTGGGGGCNONE 
Os09g0447900AK111436GTGGGGGCConserved hypothetical protein. 
Os09g0486500006-062-H11GCCCCCACCCCCACACNONE 
009-049-A11GCCCCCACCCCCACACNONE 
009-070-D06GCCCCCACCCCCACACNONE 
009-089-A10GCCCCCACCCCCACACNONE 
009-107-D06GCCCCCACCCCCACACNONE 
009-133-F02GCCCCCACCCCCACACNONE 
009-142-A05GCCCCCACCCCCACACNONE 
009-175-G07GCCCCCACCCCCACACNONE 
013-044-C05GCCCCCACCCCCACACNONE 
014-044-D10GCCCCCACCCCCACACNONE 
AF140722GCCCCCACCCCCACACNONE 
AK061067GCCCCCACCCCCACACNONE 
AK070140GCCCCCACCCCCACACNONE 
AK106128GCCCCCACCCCCACACMultiple stress-responsive zinc-finger protein ISAP1 (Stress- associated protein 1) (OsISAP1). 
AK119793GCCCCCACCCCCACACNONE 
J023042G11GCCCCCACCCCCACACNONE 
J053043H07GCCCCCACCCCCACACNONE 
J053046N13GCCCCCACCCCCACACNONE 
J053091K15GCCCCCACCCCCACACNONE 
J053094I21GCCCCCACCCCCACACNONE 
J053094N04GCCCCCACCCCCACACNONE 
J053100D12GCCCCCACCCCCACACNONE 
J053101K11GCCCCCACCCCCACACNONE 
J065079H06GCCCCCACCCCCACACNONE 
J100028D11GCCCCCACCCCCACACNONE 
J100033A20GCCCCCACCCCCACACNONE 
J100033F15GCCCCCACCCCCACACNONE 
Os09g0507200AK072867GCCCCCACMADS box protein. 
J023143P16GCCCCCACNONE 
J090001N09GCCCCCACNONE 
J090031J17GCCCCCACNONE 
U32109GCCCCCACNONE 
U78892GCCCCCACNONE 
Os09g0528800AK070219GTGGTGGGGGCCGGGRabGAP/TBC domain containing protein. 
Os09g0547300AK100643GCCCCCACProtein of unknown function DUF630 domain containing protein. 
Os11g0107700AK073061GTGGGGGCProtein kinase-like domain containing protein. 
AK109643GTGGGGGCNONE 
Os11g0147800005-013-G01TGCGGCCCCCACGTNONE 
006-022-F04TGCGGCCCCCACGTNONE 
006-029-E06TGCGGCCCCCACGTNONE 
006-036-H09TGCGGCCCCCACGTNONE 
006-043-F11TGCGGCCCCCACGTNONE 
006-045-G11TGCGGCCCCCACGTNONE 
006-062-C07TGCGGCCCCCACGTNONE 
006-062-G04TGCGGCCCCCACGTNONE 
006-063-C01TGCGGCCCCCACGTNONE 
006-065-A03TGCGGCCCCCACGTNONE 
006-074-E02TGCGGCCCCCACGTNONE 
006-076-H11TGCGGCCCCCACGTNONE 
006-078-E12TGCGGCCCCCACGTNONE 
006-098-A12TGCGGCCCCCACGTNONE 
006-103-B01TGCGGCCCCCACGTNONE 
006-107-C01TGCGGCCCCCACGTNONE 
006-111-D09TGCGGCCCCCACGTNONE 
006-113-H09TGCGGCCCCCACGTNONE 
006-118-D07TGCGGCCCCCACGTNONE 
006-120-B04TGCGGCCCCCACGTNONE 
009-064-G07TGCGGCCCCCACGTNONE 
009-200-A06TGCGGCCCCCACGTNONE 
AK071762TGCGGCCCCCACGTNONE 
AK102998TGCGGCCCCCACGTNONE 
AK104445TGCGGCCCCCACGTNONE 
AK105169TGCGGCCCCCACGTNONE 
AK119185TGCGGCCCCCACGTSimilar to Wali7 protein (Fragment). 
Os11g0150400006-104-E01GTGTGGGGGCNONE 
009-067-G02GTGTGGGGGCNONE 
AK058243GTGTGGGGGCDimeric alpha-beta barrel domain containing protein. 
AK061232GTGTGGGGGCNONE 
AK099186GTGTGGGGGCNONE 
Os11g0163500AK101154CGCGTGGGGGCHomeodomain-like containing protein. 
Os11g0175500015-087-F02GCCCCCACNONE 
AK064320GCCCCCACZinc finger, RING-type domain containing protein. 
AK101592GCCCCCACNONE 
Os11g0199600AK101774GCCCCCACZinc finger, CCHC-type domain containing protein. 
AK120040GCCCCCACNONE 
J023047I06GCCCCCACNONE 
J033064L23GCCCCCACNONE 
J033117I01GCCCCCACNONE 
J033123I18GCCCCCACNONE 
J053026H17GCCCCCACNONE 
J053078G05GCCCCCACNONE 
J065102A09GCCCCCACNONE 
J065113G11GCCCCCACNONE 
J065207F20GCCCCCACNONE 
J075027K21GCCCCCACNONE 
Os11g0209700012-068-H08CCACGGCCCCCACCACNONE 
012-068-H08GCCCCCACCTGNONE 
015-016-B07CCACGGCCCCCACCACNONE 
015-016-B07GCCCCCACCTGNONE 
AK068331CCACGGCCCCCACCACNONE 
AK068331GCCCCCACCTGNONE 
Os11g0421800015-041-B05CCCGTGGGCCCCCACACNONE 
AK106317CCCGTGGGCCCCCACACConserved hypothetical protein. 
Os11g0705200AK102199GTGGGGGCSimilar to Scarecrow-like 9 (Fragment). 
J033087D22GTGGGGGCNONE 
Os12g0108500AK122171GCCCCCACCyclin-like F-box domain containing protein. 
Os12g0165700AK099823CAAGGCCCCCACTranscription factors TFIIS, elongin A, CRSP70, conserved domain containing protein. 
Os12g0580600AK108584GTGGGGGCCCACACConserved hypothetical protein. 
Os12g0613300AB118014GCCCCCACNONE 
AK100618GCCCCCACSimilar to Single myb histone 6. 
AK105660GCCCCCACNONE 
Os12g0621100AK070737GCCCCCACACGSimilar to Filamentous flower-like yabby protein (Fragment). 
AK104918GCCCCCACACGNONE 
J013057J22GCCCCCACACGNONE 
J023025C05GCCCCCACACGNONE 
J023060E23GCCCCCACACGNONE 
J090041I07GCCCCCACACGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.