version

Summary of OsREG614 (All List)

OrganismOryza sativa  
IDOsREG614  
SequenceGCCCGGCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count2390  

Entry Sequences (2390 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0147200016-005-F02GGGCCCGGCCCATCANONE 
AK106463GGGCCCGGCCCATCANONE 
AK121921GGGCCCGGCCCATCAIWS1, C-terminal family protein. 
J033098O16GGGCCCGGCCCATCANONE 
J033106E16GGGCCCGGCCCATCANONE 
J043026D12GGGCCCGGCCCATCANONE 
J065070B04GGGCCCGGCCCATCANONE 
J065162L03GGGCCCGGCCCATCANONE 
J065166F01GGGCCCGGCCCATCANONE 
J075030A13GGGCCCGGCCCATCANONE 
J075093O12GGGCCCGGCCCATCANONE 
J075106K15GGGCCCGGCCCATCANONE 
J075107F20GGGCCCGGCCCATCANONE 
J090031F21GGGCCCGGCCCATCANONE 
J090079E17GGGCCCGGCCCATCANONE 
Os01g0174700003-111-B04GCCCGGCCNONE 
011-043-F04GCCCGGCCNONE 
AK073313GCCCGGCCNONE 
J033057J01GCCCGGCCNONE 
J065041K14GCCCGGCCNONE 
J065122G22GCCCGGCCNONE 
Os01g0188200015-013-B12GGTTGGGCTGGCCGGGCCGNONE 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
Os01g0238500006-086-E04GCCCGGCCGGGCCGGCNONE 
AK067076GCCCGGCCGGGCCGGCSimilar to Branched-chain-amino-acid aminotransferase-like protein 3, chloroplast precursor. 
AK104302GCCCGGCCGGGCCGGCNONE 
J013093D15GCCCGGCCGGGCCGGCNONE 
J065038O05GCCCGGCCGGGCCGGCNONE 
J075089I20GCCCGGCCGGGCCGGCNONE 
J075122B01GCCCGGCCGGGCCGGCNONE 
J090086G20GCCCGGCCGGGCCGGCNONE 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0286000AK109824AGATGGGCCGGGCCCSnf7 family protein. 
Os01g0388000AK069778GCCCGGCCSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment). 
AK069778GCCCGGCCCSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment). 
Os01g0503400AK066889GCCCGGCCNONE 
AK068118GCCCGGCCSimilar to OsNramp1 (Integral membrane protein). 
AK068641GCCCGGCCNONE 
AK072201GCCCGGCCNONE 
J013089K10GCCCGGCCNONE 
Os01g0514300AK121086GGGCCGGGCLissencephaly type-1-like homology motif domain containing protein. 
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE 
012-094-B11AACGGGCCCGGCCCATGNONE 
015-096-C04AACGGGCCCGGCCCATGNONE 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
AK099005AACGGGCCCGGCCCATGNONE 
J013109B04AACGGGCCCGGCCCATGNONE 
J033057L14AACGGGCCCGGCCCATGNONE 
J090072H04AACGGGCCCGGCCCATGNONE 
J100030A14AACGGGCCCGGCCCATGNONE 
Os01g0551000006-104-A04CCCAGCCCGGCCCAACCNONE 
009-183-B08CCCAGCCCGGCCCAACCNONE 
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein. 
AK106034CCCAGCCCGGCCCAACCNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0587000AK067605CCCGGCCCGGCCSimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0612600004-008-D07TGCGGGCCGGGCCGNONE 
009-057-C09TGCGGGCCGGGCCGNONE 
009-130-C01TGCGGGCCGGGCCGNONE 
AK062906TGCGGGCCGGGCCGNONE 
AK066561TGCGGGCCGGGCCGProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCGGGCCGNONE 
J013073D14TGCGGGCCGGGCCGNONE 
J023014A21TGCGGGCCGGGCCGNONE 
J023073M13TGCGGGCCGGGCCGNONE 
J023079F02TGCGGGCCGGGCCGNONE 
J023083B16TGCGGGCCGGGCCGNONE 
J023090G19TGCGGGCCGGGCCGNONE 
J023095F15TGCGGGCCGGGCCGNONE 
J023119H11TGCGGGCCGGGCCGNONE 
J033040B01TGCGGGCCGGGCCGNONE 
J033044F13TGCGGGCCGGGCCGNONE 
J033081E23TGCGGGCCGGGCCGNONE 
J033121K07TGCGGGCCGGGCCGNONE 
J033124D11TGCGGGCCGGGCCGNONE 
J033131N22TGCGGGCCGGGCCGNONE 
J065179E10TGCGGGCCGGGCCGNONE 
J090020A13TGCGGGCCGGGCCGNONE 
J090045K17TGCGGGCCGGGCCGNONE 
J090047M24TGCGGGCCGGGCCGNONE 
J090064G23TGCGGGCCGGGCCGNONE 
J090084G08TGCGGGCCGGGCCGNONE 
J090086F18TGCGGGCCGGGCCGNONE 
J100032D09TGCGGGCCGGGCCGNONE 
J100037O18TGCGGGCCGGGCCGNONE 
J100042B03TGCGGGCCGGGCCGNONE 
J100061D06TGCGGGCCGGGCCGNONE 
J100061I03TGCGGGCCGGGCCGNONE 
J100063B17TGCGGGCCGGGCCGNONE 
Os01g0624700AK111416CGGCCCGGCCSimilar to WRKY transcription factor 12. 
AY676924CGGCCCGGCCNONE 
AY870601CGGCCCGGCCNONE 
Os01g0635400AK102655GGCCCGGCCSimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
AK111923GGCCCGGCCNONE 
Os01g0666500AK102689GGCCGGGCCCACTConserved hypothetical protein. 
Os01g0675500AK069674GGCCGGGCSimilar to Glycoprotein-specific UDP-glucuronyltransferase-like protein. 
J013059I20GGCCGGGCNONE 
J013123M22GGCCGGGCNONE 
J023027J07GGCCGGGCNONE 
J023028I07GGCCGGGCNONE 
J023057A15GGCCGGGCNONE 
J023111L24GGCCGGGCNONE 
J033114P05GGCCGGGCNONE 
J033127H17GGCCGGGCNONE 
Os01g0733600011-078-A01GCCCGGCCNONE 
AK066744GCCCGGCCFlavodoxin/nitric oxide synthase domain containing protein. 
J013088B01GCCCGGCCNONE 
J033075A12GCCCGGCCNONE 
J033092N03GCCCGGCCNONE 
J065077J07GCCCGGCCNONE 
J065088E23GCCCGGCCNONE 
J065207L12GCCCGGCCNONE 
J100033O20GCCCGGCCNONE 
J100037N08GCCCGGCCNONE 
J100041L09GCCCGGCCNONE 
J100061J09GCCCGGCCNONE 
J100069N11GCCCGGCCNONE 
Os01g0743400AK059177GGGCCGGGCCGGCSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114GGGCCGGGCCGGCNONE 
J065070E07GGGCCGGGCCGGCNONE 
J065152G11GGGCCGGGCCGGCNONE 
Os01g0755500AB071807GGCCGGGCSimilar to Transcription factor PCF7 (Fragment). 
AK058570GGCCGGGCNONE 
J065184I03GGCCGGGCNONE 
J065191I07GGCCGGGCNONE 
Os01g0761100AK122112GGCCCGGCCTesmin/TSO1-like, CXC domain containing protein. 
Os01g0800300006-097-C12TCCGGCCCGGCCNONE 
014-070-C12TCCGGCCCGGCCNONE 
AK072549TCCGGCCCGGCCNONE 
AK100942TCCGGCCCGGCCNONE 
AK100951TCCGGCCCGGCCConserved hypothetical protein. 
AK106023TCCGGCCCGGCCNONE 
J023138D05TCCGGCCCGGCCNONE 
J075097P16TCCGGCCCGGCCNONE 
J075099F23TCCGGCCCGGCCNONE 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK064082CACGGCCCGGCCNONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
AK101426CACGGCCCGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0846300AK065949CCACGTGTTGCGGGCCGGGCCGGGSimilar to Protein phosphatase 2C. 
Os01g0849600AK108159GCCCGGCCSimilar to ENOD18 protein (Fragment). 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0863166J065007F23CACGGCCCGGCCNONE 
J065007F23GCCGGGCCGGGCCGNONE 
J065124H21CACGGCCCGGCCConserved hypothetical protein. 
J065124H21GCCGGGCCGGGCCGConserved hypothetical protein. 
Os01g0866300006-029-F08GGCCGGGCCCACTNONE 
006-074-E10GGCCGGGCCCACTNONE 
006-079-E11GGCCGGGCCCACTNONE 
009-048-A05GGCCGGGCCCACTNONE 
AK059875GGCCGGGCCCACTNONE 
J043005O17GGCCGGGCCCACTNONE 
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0942300AK063126GGCCGGGCTGGGSimilar to Beta glucanase precursor (EC 3.2.1.73) (Fragment). 
Os01g0949700AK069037GCCCGGCCCAATNONE 
J023004F17GCCCGGCCCAATNONE 
J065063D04GCCCGGCCCAATNONE 
J065196H02GCCCGGCCCAATNONE 
J075198A05GCCCGGCCCAATNONE 
Os01g0973100J065216G12CCCGGCCCGGCCCProtein of unknown function DUF239, plant domain containing protein. 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0193500009-092-G09CTCGGCCCGGCCCNONE 
AK101237CTCGGCCCGGCCCHypothetical protein. 
J033031K13CTCGGCCCGGCCCNONE 
J033034P12CTCGGCCCGGCCCNONE 
J080304L19CTCGGCCCGGCCCNONE 
J100059N21CTCGGCCCGGCCCNONE 
Os02g0227000J023084F07GGCCCGGCCCNONE 
J033051H22GGCCCGGCCCProtein of unknown function UPF0054 family protein. 
Os02g0245000AK119770GGCCGGGCGGCCCGTTNONE 
AK119874GGCCGGGCGGCCCGTTSWAP/Surp domain containing protein. 
J065038L11GGCCGGGCGGCCCGTTNONE 
J100059I06GGCCGGGCGGCCCGTTNONE 
J100076C23GGCCGGGCGGCCCGTTNONE 
J100081P08GGCCGGGCGGCCCGTTNONE 
J100084C13GGCCGGGCGGCCCGTTNONE 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0289700009-196-H06GCCCGGCCCNONE 
014-005-D09GCCCGGCCCNONE 
AK063231GCCCGGCCCSimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
Os02g0299200AK105486GCCCGGCCACGTCIQ calmodulin-binding region domain containing protein. 
Os02g0304800Os02g0304800GGCCCGGCCCAAATProtein prenyltransferase domain containing protein. 
Os02g0326700AK064977GGCCGGGCCCCACGRhomboid-like protein family protein. 
Os02g0327000006-110-H11GGCCGGGCNONE 
AK073631GGCCGGGCC2 domain containing protein. 
AK104165GGCCGGGCNONE 
J023004L22GGCCGGGCNONE 
J023091P07GGCCGGGCNONE 
J023115A09GGCCGGGCNONE 
J023139A19GGCCGGGCNONE 
J033043I10GGCCGGGCNONE 
J033052D22GGCCGGGCNONE 
J033066B05GGCCGGGCNONE 
J043003P17GGCCGGGCNONE 
J043030K22GGCCGGGCNONE 
J065109P18GGCCGGGCNONE 
J065130G19GGCCGGGCNONE 
J065150K12GGCCGGGCNONE 
J065202B18GGCCGGGCNONE 
J065203K23GGCCGGGCNONE 
J090012O12GGCCGGGCNONE 
J090076M23GGCCGGGCNONE 
J100019I12GGCCGGGCNONE 
J100028N06GGCCGGGCNONE 
J100030G13GGCCGGGCNONE 
J100031O22GGCCGGGCNONE 
J100042F17GGCCGGGCNONE 
J100059C04GGCCGGGCNONE 
J100067G16GGCCGGGCNONE 
J100075K20GGCCGGGCNONE 
J100078D05GGCCGGGCNONE 
Os02g0332700009-144-D04GGCCGGGCNONE 
AK062975GGCCGGGCConserved hypothetical protein. 
Os02g0445700011-046-C10GGCCCGGCCCGTTNONE 
Os02g0461200012-026-A12GCCCGGCCNONE 
AK063459GCCCGGCCConserved hypothetical protein. 
J065183F11GCCCGGCCNONE 
J075190G18GCCCGGCCNONE 
Os02g0462800AK110587GGCCGGGCCGGCWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923GGCCGGGCCGGCNONE 
Os02g0533800009-149-F12GGCCGGGCCGGGNONE 
013-058-H02GGCCGGGCCGGGNONE 
014-017-G07GGCCGGGCCGGGNONE 
014-028-F04GGCCGGGCCGGGNONE 
014-050-G04GGCCGGGCCGGGNONE 
014-095-F04GGCCGGGCCGGGNONE 
014-099-C08GGCCGGGCCGGGNONE 
016-046-F05GGCCGGGCCGGGNONE 
AK121139GGCCGGGCCGGGConserved hypothetical protein. 
J013104A14GGCCGGGCCGGGNONE 
J023077F13GGCCGGGCCGGGNONE 
J023145I11GGCCGGGCCGGGNONE 
J065033D14GGCCGGGCCGGGNONE 
J065079I15GGCCGGGCCGGGNONE 
J065104E21GGCCGGGCCGGGNONE 
J065128E06GGCCGGGCCGGGNONE 
J065174F07GGCCGGGCCGGGNONE 
J065195B12GGCCGGGCCGGGNONE 
J065207B12GGCCGGGCCGGGNONE 
J080304M24GGCCGGGCCGGGNONE 
J090040A13GGCCGGGCCGGGNONE 
J090054B18GGCCGGGCCGGGNONE 
J100037A06GGCCGGGCCGGGNONE 
J100042F24GGCCGGGCCGGGNONE 
J100043N23GGCCGGGCCGGGNONE 
J100044H14GGCCGGGCCGGGNONE 
J100056K24GGCCGGGCCGGGNONE 
J100063O22GGCCGGGCCGGGNONE 
J100071G05GGCCGGGCCGGGNONE 
J100078G15GGCCGGGCCGGGNONE 
Os02g0533900AB062681CCCGGCCCGGCCNONE 
AK061722CCCGGCCCGGCCNONE 
AK106147CCCGGCCCGGCCNONE 
AK121892CCCGGCCCGGCCSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
Os02g0602300AK065609GCCCGGCCGGCCCACCTGNONE 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCCGGCCGGCCCACCTGNONE 
J090040I23GCCCGGCCGGCCCACCTGNONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0642200009-109-H02GCCCGGCCNONE 
AK105194GCCCGGCCSimilar to Remorin. 
Os02g0643200AK106784GCCCGGCCYABBY protein family protein. 
J075048L13GCCCGGCCNONE 
Os02g0672600AK070286GGCCGGGCCGTGSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174GGCCGGGCCGTGNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0736500AK065166GTTTGGGCCGGGCNicastrin family protein. 
J013099D16GTTTGGGCCGGGCNONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0768600006-034-F01TCTGGCCCGGCCCAAACNONE 
006-046-G07TCTGGCCCGGCCCAAACNONE 
006-054-C07TCTGGCCCGGCCCAAACNONE 
006-056-F07TCTGGCCCGGCCCAAACNONE 
006-100-C02TCTGGCCCGGCCCAAACNONE 
AK059725TCTGGCCCGGCCCAAACNONE 
AK098996TCTGGCCCGGCCCAAACNONE 
AK099120TCTGGCCCGGCCCAAACNONE 
AK104659TCTGGCCCGGCCCAAACNONE 
J065043H04TCTGGCCCGGCCCAAACNONE 
J075034N21TCTGGCCCGGCCCAAACNONE 
J075145C18TCTGGCCCGGCCCAAACNONE 
J080016H01TCTGGCCCGGCCCAAACNONE 
J080040F01TCTGGCCCGGCCCAAACNONE 
J080047L23TCTGGCCCGGCCCAAACNONE 
J080049B22TCTGGCCCGGCCCAAACNONE 
J080062J16TCTGGCCCGGCCCAAACNONE 
J080064C23TCTGGCCCGGCCCAAACNONE 
J080064L22TCTGGCCCGGCCCAAACNONE 
J080077N01TCTGGCCCGGCCCAAACNONE 
J080097G17TCTGGCCCGGCCCAAACNONE 
J100065L15TCTGGCCCGGCCCAAACNONE 
J100066K23TCTGGCCCGGCCCAAACNONE 
J100088C07TCTGGCCCGGCCCAAACNONE 
J100090H09TCTGGCCCGGCCCAAACNONE 
Os02g0780500AK072784GGCCGGGCCGGCNONE 
AK121143GGCCGGGCCGGCConserved hypothetical protein. 
J023075M13GGCCGGGCCGGCNONE 
J023077P14GGCCGGGCCGGCNONE 
J023123C16GGCCGGGCCGGCNONE 
J023142P06GGCCGGGCCGGCNONE 
Os02g0801900006-113-E02CACGGCCCGGCCNONE 
006-113-E02GCCGGGCCGGGCCGNONE 
AK109488CACGGCCCGGCCNONE 
AK109488GCCGGGCCGGGCCGNONE 
AK109498CACGGCCCGGCCConserved hypothetical protein. 
AK109498GCCGGGCCGGGCCGConserved hypothetical protein. 
J065007D19CACGGCCCGGCCNONE 
J065007D19GCCGGGCCGGGCCGNONE 
J065035G11CACGGCCCGGCCNONE 
J065035G11GCCGGGCCGGGCCGNONE 
J065044E05CACGGCCCGGCCNONE 
J065044E05GCCGGGCCGGGCCGNONE 
J065112N01CACGGCCCGGCCNONE 
J065112N01GCCGGGCCGGGCCGNONE 
J065143B03CACGGCCCGGCCNONE 
J065143B03GCCGGGCCGGGCCGNONE 
J065159A16CACGGCCCGGCCNONE 
J065159A16GCCGGGCCGGGCCGNONE 
J090007K23CACGGCCCGGCCNONE 
J090007K23GCCGGGCCGGGCCGNONE 
J090045N09CACGGCCCGGCCNONE 
J090045N09GCCGGGCCGGGCCGNONE 
J090049L20CACGGCCCGGCCNONE 
J090049L20GCCGGGCCGGGCCGNONE 
Os02g0824700009-023-E06GGCCGGGCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18GGCCGGGCNONE 
J065017H21GGCCGGGCNONE 
J065052N02GGCCGGGCNONE 
J065053M01GGCCGGGCNONE 
J065064B14GGCCGGGCNONE 
J065146K22GGCCGGGCNONE 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os02g0827600AK068455GGCCGGGCCConserved hypothetical protein. 
Os03g0102200AK120183TCGGCCCGGCCCGGTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TCGGCCCGGCCCGGTNONE 
J065116C05TCGGCCCGGCCCGGTNONE 
J065120N21TCGGCCCGGCCCGGTNONE 
J090049D24TCGGCCCGGCCCGGTNONE 
Os03g0109300AK099538GCCCGGCCCCAGSimilar to Lysine decarboxylase-like protein. 
J013032C19GCCCGGCCCCAGNONE 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0142900011-054-A05CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK067103CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK120438CCAGGCCCAGGCCCAGGCCCGGCCCProtein of unknown function DUF946, plant family protein. 
J013097D18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013098E18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013099I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013108C09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J023045J15CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033095F07CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033102N22CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065016C14CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065065F21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065159M09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075012C13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075017P18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075018M03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075021H19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075070K23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075077B18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075085E20CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075090N23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075137M16CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075151E03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090042L02CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090060C21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090089I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100024L19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100025A06CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100033C24CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100052J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100063H10CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100073P04CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100075D01CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100077J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
Os03g0146400AK111974GGCCCGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554GGCCCGGCCCGTTNONE 
J075060J10GGCCCGGCCCGTTNONE 
Os03g0180800AK070649GCCCGGCCZIM domain containing protein. 
J065121B15GCCCGGCCNONE 
J075067G15GCCCGGCCNONE 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0192100AK064747ATTTGGGCCGGGCNONE 
AK105523ATTTGGGCCGGGCPeptidase S10, serine carboxypeptidase family protein. 
Os03g0192400009-081-A03AGTGGGCCCGGCCCNONE 
009-159-B02AGTGGGCCCGGCCCNONE 
AK070573AGTGGGCCCGGCCCGRIM-19 family protein. 
J023056B01AGTGGGCCCGGCCCNONE 
J023075G06AGTGGGCCCGGCCCNONE 
J033048K16AGTGGGCCCGGCCCNONE 
J033048L16AGTGGGCCCGGCCCNONE 
J053031H23AGTGGGCCCGGCCCNONE 
J065002H14AGTGGGCCCGGCCCNONE 
J065006G22AGTGGGCCCGGCCCNONE 
J065032G13AGTGGGCCCGGCCCNONE 
J065056A09AGTGGGCCCGGCCCNONE 
J065078I01AGTGGGCCCGGCCCNONE 
J065095G01AGTGGGCCCGGCCCNONE 
J065095I18AGTGGGCCCGGCCCNONE 
J065134M18AGTGGGCCCGGCCCNONE 
J065158P07AGTGGGCCCGGCCCNONE 
J065165K17AGTGGGCCCGGCCCNONE 
J065181J12AGTGGGCCCGGCCCNONE 
J065189N09AGTGGGCCCGGCCCNONE 
J065200D13AGTGGGCCCGGCCCNONE 
J065202H20AGTGGGCCCGGCCCNONE 
J065215K20AGTGGGCCCGGCCCNONE 
J075049N19AGTGGGCCCGGCCCNONE 
J075147J16AGTGGGCCCGGCCCNONE 
J090081E19AGTGGGCCCGGCCCNONE 
J100017C16AGTGGGCCCGGCCCNONE 
J100039M16AGTGGGCCCGGCCCNONE 
J100043E23AGTGGGCCCGGCCCNONE 
J100063L12AGTGGGCCCGGCCCNONE 
J100079F22AGTGGGCCCGGCCCNONE 
Os03g0192700012-005-H03GCCCGGCCNONE 
012-006-B05GCCCGGCCNONE 
012-006-E07GCCCGGCCNONE 
012-051-D10GCCCGGCCNONE 
014-089-H06GCCCGGCCNONE 
015-034-C05GCCCGGCCNONE 
015-042-C06GCCCGGCCNONE 
015-059-E09GCCCGGCCNONE 
015-096-A08GCCCGGCCNONE 
016-030-D06GCCCGGCCNONE 
016-053-H07GCCCGGCCNONE 
016-064-D02GCCCGGCCNONE 
AB012107GCCCGGCCNONE 
AK058750GCCCGGCCSimilar to Myo-inositol-1-phosphate synthase. 
AK103501GCCCGGCCNONE 
J023102F09GCCCGGCCNONE 
J023103H09GCCCGGCCNONE 
J023107F22GCCCGGCCNONE 
J033031E17GCCCGGCCNONE 
J033090C03GCCCGGCCNONE 
J033090C17GCCCGGCCNONE 
J033091K19GCCCGGCCNONE 
J033131B11GCCCGGCCNONE 
J033133D04GCCCGGCCNONE 
J053050C09GCCCGGCCNONE 
J053078O12GCCCGGCCNONE 
J075037B10GCCCGGCCNONE 
J090021M23GCCCGGCCNONE 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0206600AK058618GCCCGGCCProtein of unknown function DUF588 family protein. 
Os03g0214100AB111916CGGCCCGGCCCATCTNONE 
AF009179CGGCCCGGCCCATCTReplication protein A1. 
AK060582CGGCCCGGCCCATCTNONE 
Os03g0240700009-086-G10GGCCCGGCCCAACANONE 
009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799GGCCCGGCCCAACAConserved hypothetical protein. 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13GGCCCGGCCCAACANONE 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01GGCCCGGCCCAACANONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01GGCCCGGCCCAACANONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22GGCCCGGCCCAACANONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21GGCCCGGCCCAACANONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02GGCCCGGCCCAACANONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
006-092-D05TGTTGGGCCGGGCCNONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK059292TGTTGGGCCGGGCCNONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
AK121552TGTTGGGCCGGGCCNONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J023131D06TGTTGGGCCGGGCCNONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033033E14TGTTGGGCCGGGCCNONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033105B01TGTTGGGCCGGGCCNONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033114L18TGTTGGGCCGGGCCNONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J033132N24TGTTGGGCCGGGCCNONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065032H03TGTTGGGCCGGGCCNONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065115J20TGTTGGGCCGGGCCNONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J065150C05TGTTGGGCCGGGCCNONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302A11TGTTGGGCCGGGCCNONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080302H16TGTTGGGCCGGGCCNONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080305M12TGTTGGGCCGGGCCNONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080306F13TGTTGGGCCGGGCCNONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J080312A06TGTTGGGCCGGGCCNONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
J090088P09TGTTGGGCCGGGCCNONE 
Os03g0261500AK061995GCCCGGCCCGGCNONE 
J013044K20GCCCGGCCCGGCNONE 
J033113A11GCCCGGCCCGGCNONE 
J100032O18GCCCGGCCCGGCNONE 
J100037K21GCCCGGCCCGGCNONE 
Os03g0271500AK068546GGCCGGGCNONE 
AK109239GGCCGGGCConserved hypothetical protein. 
J013157P04GGCCGGGCNONE 
J075041K23GGCCGGGCNONE 
Os03g0284000Os03g0284000CACGGCCCGGCCConserved hypothetical protein. 
Os03g0287900009-074-B07GGCCCGGCCCAAGNONE 
014-027-E07GGCCCGGCCCAAGNONE 
AK063663GGCCCGGCCCAAGSimilar to Protein disulfide isomerase. 
J065009N21GGCCCGGCCCAAGNONE 
Os03g0288900AK100329GGCCCGGCCCACCConserved hypothetical protein. 
J023080H15GGCCCGGCCCACCNONE 
J033136I21GGCCCGGCCCACCNONE 
J065036A16GGCCCGGCCCACCNONE 
J065186A16GGCCCGGCCCACCNONE 
J065187B08GGCCCGGCCCACCNONE 
J065202E24GGCCCGGCCCACCNONE 
Os03g0293100AK060680GGCCCGGCCCAAAConserved hypothetical protein. 
J065193F02GGCCCGGCCCAAANONE 
J075003N10GGCCCGGCCCAAANONE 
Os03g0374400016-027-B12GGCCGGGCCCCACCCGNONE 
AK069719GGCCGGGCCCCACCCGConserved hypothetical protein. 
J023020L05GGCCGGGCCCCACCCGNONE 
J023026H16GGCCGGGCCCCACCCGNONE 
J033025P22GGCCGGGCCCCACCCGNONE 
J075016I21GGCCGGGCCCCACCCGNONE 
J090015G21GGCCGGGCCCCACCCGNONE 
Os03g0374500Os03g0374500GGCCGGGCCCCACCCGHypothetical protein. 
Os03g0437600006-051-A10GCCCGGCCNONE 
006-059-D02GCCCGGCCNONE 
006-074-A04GCCCGGCCNONE 
006-089-G11GCCCGGCCNONE 
006-095-H02GCCCGGCCNONE 
006-118-B09GCCCGGCCNONE 
009-156-G04GCCCGGCCNONE 
015-015-G01GCCCGGCCNONE 
016-089-D06GCCCGGCCNONE 
AK061303GCCCGGCCNONE 
AK070773GCCCGGCCNONE 
AK073355GCCCGGCCSimilar to Hydrolase. 
AK104138GCCCGGCCNONE 
AK104400GCCCGGCCNONE 
J033030A08GCCCGGCCNONE 
J065056E01GCCCGGCCNONE 
J065061F16GCCCGGCCNONE 
J065075L21GCCCGGCCNONE 
J065102E09GCCCGGCCNONE 
J065175K12GCCCGGCCNONE 
J065197D14GCCCGGCCNONE 
J065199D08GCCCGGCCNONE 
J075029F13GCCCGGCCNONE 
J075042F07GCCCGGCCNONE 
J075056E23GCCCGGCCNONE 
J075077L02GCCCGGCCNONE 
J075086N01GCCCGGCCNONE 
J075095I08GCCCGGCCNONE 
J075099N21GCCCGGCCNONE 
J075099O09GCCCGGCCNONE 
J075109L06GCCCGGCCNONE 
J075114H11GCCCGGCCNONE 
J075120E09GCCCGGCCNONE 
J075137F08GCCCGGCCNONE 
J075154D10GCCCGGCCNONE 
J075158A18GCCCGGCCNONE 
J075197N10GCCCGGCCNONE 
Os03g0607200013-002-F05GGCCGGGCNONE 
013-021-H08GGCCGGGCNONE 
013-038-E10GGCCGGGCNONE 
014-009-E05GGCCGGGCNONE 
014-034-H01GGCCGGGCNONE 
014-038-A08GGCCGGGCNONE 
014-072-G08GGCCGGGCNONE 
014-083-B06GGCCGGGCNONE 
014-088-G10GGCCGGGCNONE 
AK070268GGCCGGGCGibberellin regulated protein family protein. 
J023044E14GGCCGGGCNONE 
J065199F02GGCCGGGCNONE 
J075001C09GGCCGGGCNONE 
J075019F02GGCCGGGCNONE 
J075061J21GGCCGGGCNONE 
J075068G03GGCCGGGCNONE 
J075126F10GGCCGGGCNONE 
J075153F19GGCCGGGCNONE 
J080305I04GGCCGGGCNONE 
J080307F24GGCCGGGCNONE 
J080312E23GGCCGGGCNONE 
J080315M20GGCCGGGCNONE 
J080317E18GGCCGGGCNONE 
J090043I11GGCCGGGCNONE 
Os03g0634400AK111510GCCCGGCCProtein kinase-like domain containing protein. 
J013001I04GCCCGGCCNONE 
J013095I16GCCCGGCCNONE 
J075033B12GCCCGGCCNONE 
J100037D03GCCCGGCCNONE 
J100038H07GCCCGGCCNONE 
J100043B08GCCCGGCCNONE 
J100043B17GCCCGGCCNONE 
J100062L16GCCCGGCCNONE 
J100072L12GCCCGGCCNONE 
J100075N21GCCCGGCCNONE 
J100078P05GCCCGGCCNONE 
J100088J07GCCCGGCCNONE 
J100089A22GCCCGGCCNONE 
Os03g0701900AK068404GGCCCGGCCConserved hypothetical protein. 
Os03g0723400AK107276GCCCGGCCConserved hypothetical protein. 
J065104F19GCCCGGCCNONE 
J075026E22GCCCGGCCNONE 
J075047K21GCCCGGCCNONE 
J075071K20GCCCGGCCNONE 
J075071K21GCCCGGCCNONE 
J075140F21GCCCGGCCNONE 
J075177C18GCCCGGCCNONE 
Os03g0736300AK104929GGCCGGGCCGGGCNONE 
Os03g0737600014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0740700011-093-H12GGCCCGGCCCATCCNONE 
AK102723GGCCCGGCCCATCCProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19GGCCCGGCCCATCCNONE 
J013126N16GGCCCGGCCCATCCNONE 
J033105J16GGCCCGGCCCATCCNONE 
J090059D19GGCCCGGCCCATCCNONE 
Os03g0746800AK101718TCATGGGCCGGGCWD-40 repeat containing protein. 
Os03g0751400AK069033GGCCCGGCCSimilar to 50S ribosomal protein l6. 
J023004G24GGCCCGGCCNONE 
J065176D08GGCCCGGCCNONE 
Os03g0773600AK103310GGCCGGGCKinesin, motor region domain containing protein. 
Os03g0785500AK067718AGATGGGCCGGGCProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0793500AK103407GCCCGGCCCCACCACNONE 
AK121620GCCCGGCCCCACCACSimilar to Casein kinase-like protein. 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0799000013-010-A07GGCCGGGCNONE 
013-081-H02GGCCGGGCNONE 
AK067840GGCCGGGCSimilar to Histone H1. 
AK099211GGCCGGGCNONE 
J065066F23GGCCGGGCNONE 
J065138O20GGCCGGGCNONE 
J065163G22GGCCGGGCNONE 
J065211J01GGCCGGGCNONE 
J080027D02GGCCGGGCNONE 
J080029E20GGCCGGGCNONE 
J080045D03GGCCGGGCNONE 
J080060G13GGCCGGGCNONE 
J080067E14GGCCGGGCNONE 
J080067J04GGCCGGGCNONE 
J080067J21GGCCGGGCNONE 
J080068L09GGCCGGGCNONE 
J080077E15GGCCGGGCNONE 
J080078B03GGCCGGGCNONE 
J080086H09GGCCGGGCNONE 
J090095G02GGCCGGGCNONE 
J100058H04GGCCGGGCNONE 
Os03g0807200011-031-F07GGGCCGGGCCGGCNONE 
011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932GGGCCGGGCCGGCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496GGGCCGGGCCGGCProtein of unknown function DUF1639 family protein. 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04GGGCCGGGCCGGCNONE 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03GGGCCGGGCCGGCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11GGGCCGGGCCGGCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18GGGCCGGGCCGGCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08GGGCCGGGCCGGCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05GGGCCGGGCCGGCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17GGGCCGGGCCGGCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19GGGCCGGGCCGGCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07GGGCCGGGCCGGCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06GGGCCGGGCCGGCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08GGGCCGGGCCGGCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06GGGCCGGGCCGGCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17GGGCCGGGCCGGCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17GGGCCGGGCCGGCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05GGGCCGGGCCGGCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15GGGCCGGGCCGGCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18GGGCCGGGCCGGCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21GGGCCGGGCCGGCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22GGGCCGGGCCGGCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22GGGCCGGGCCGGCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09GGGCCGGGCCGGCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07GGGCCGGGCCGGCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17GGGCCGGGCCGGCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23GGGCCGGGCCGGCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16GGGCCGGGCCGGCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19GGGCCGGGCCGGCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12GGGCCGGGCCGGCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21GGGCCGGGCCGGCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05GGGCCGGGCCGGCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20GGGCCGGGCCGGCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20GGGCCGGGCCGGCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22GGGCCGGGCCGGCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03GGGCCGGGCCGGCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16GGGCCGGGCCGGCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01GGGCCGGGCCGGCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20GGGCCGGGCCGGCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04GGGCCGGGCCGGCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19GGGCCGGGCCGGCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21GGGCCGGGCCGGCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06GGGCCGGGCCGGCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15GGGCCGGGCCGGCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18GGGCCGGGCCGGCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20GGGCCGGGCCGGCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11GGGCCGGGCCGGCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14GGGCCGGGCCGGCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10GGGCCGGGCCGGCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02GGGCCGGGCCGGCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19GGGCCGGGCCGGCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11GGGCCGGGCCGGCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03GGGCCGGGCCGGCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07GGGCCGGGCCGGCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14GGGCCGGGCCGGCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21GGGCCGGGCCGGCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06GGGCCGGGCCGGCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16GGGCCGGGCCGGCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16GGGCCGGGCCGGCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23GGGCCGGGCCGGCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18GGGCCGGGCCGGCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20GGGCCGGGCCGGCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23GGGCCGGGCCGGCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03GGGCCGGGCCGGCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13GGGCCGGGCCGGCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12GGGCCGGGCCGGCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03GGGCCGGGCCGGCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07GGGCCGGGCCGGCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04GGGCCGGGCCGGCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19GGGCCGGGCCGGCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21GGGCCGGGCCGGCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18GGGCCGGGCCGGCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18GGGCCGGGCCGGCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14GGGCCGGGCCGGCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15GGGCCGGGCCGGCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24GGGCCGGGCCGGCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18GGGCCGGGCCGGCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19GGGCCGGGCCGGCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19GGGCCGGGCCGGCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18GGGCCGGGCCGGCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21GGGCCGGGCCGGCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06GGGCCGGGCCGGCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07GGGCCGGGCCGGCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16GGGCCGGGCCGGCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20GGGCCGGGCCGGCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16GGGCCGGGCCGGCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07GGGCCGGGCCGGCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04GGGCCGGGCCGGCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07GGGCCGGGCCGGCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02GGGCCGGGCCGGCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15GGGCCGGGCCGGCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19GGGCCGGGCCGGCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20GGGCCGGGCCGGCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15GGGCCGGGCCGGCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10GGGCCGGGCCGGCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09GGGCCGGGCCGGCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18GGGCCGGGCCGGCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03GGGCCGGGCCGGCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07GGGCCGGGCCGGCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12GGGCCGGGCCGGCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09GGGCCGGGCCGGCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0822700005-010-E01GACGGCCCGGCCCNONE 
006-088-H12GACGGCCCGGCCCNONE 
AK061682GACGGCCCGGCCCNONE 
AK101448GACGGCCCGGCCCArmadillo-like helical domain containing protein. 
J023091N05GACGGCCCGGCCCNONE 
Os03g0831100AK103115AACGGCCCGGCCArmadillo-like helical domain containing protein. 
J033119F15AACGGCCCGGCCNONE 
J065011M19AACGGCCCGGCCNONE 
J075019I08AACGGCCCGGCCNONE 
J075047A01AACGGCCCGGCCNONE 
J075096P21AACGGCCCGGCCNONE 
J075121I05AACGGCCCGGCCNONE 
J075121I07AACGGCCCGGCCNONE 
J090063F13AACGGCCCGGCCNONE 
J090068F16AACGGCCCGGCCNONE 
J090094E14AACGGCCCGGCCNONE 
Os03g0846400AK067706CGGGCCGTGCCCGGCCCNONE 
AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549CGGGCCGTGCCCGGCCCPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os03g0861300AK109024GGCCGGGCSimilar to Aquaporin. 
Os04g0208400AK069629GCTGGGCCGGGCCGCyclin-like F-box domain containing protein. 
Os04g0293600AK063003GGCCGGGCHypothetical protein. 
Os04g0337500AK061807GCCCGGCCNONE 
Os04g0378200AK103076GGGCCGGGCCGGGSterile alpha motif SAM domain containing protein. 
J033118E02GGGCCGGGCCGGGNONE 
J065065F15GGGCCGGGCCGGGNONE 
J090080I24GGGCCGGGCCGGGNONE 
Os04g0388900AK063224CAAGGCCCGGCCCATCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CAAGGCCCGGCCCATCANONE 
J065148P22CAAGGCCCGGCCCATCANONE 
J075040G12CAAGGCCCGGCCCATCANONE 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0483500009-132-G09GCCCGGCCCNONE 
AK060512GCCCGGCCCSimilar to B-keto acyl reductase. 
J065021G03GCCCGGCCCNONE 
J080304E09GCCCGGCCCNONE 
J080311F01GCCCGGCCCNONE 
J080317H02GCCCGGCCCNONE 
J080317L09GCCCGGCCCNONE 
J100047G13GCCCGGCCCNONE 
J100066L09GCCCGGCCCNONE 
Os04g0486400AJ535489GGGCCGGGCCGGGCCGAANONE 
AK103296GGGCCGGGCCGGGCCGAARML1 protein. 
J013045L03GGGCCGGGCCGGGCCGAANONE 
J013045M03GGGCCGGGCCGGGCCGAANONE 
J033034L24GGGCCGGGCCGGGCCGAANONE 
J033125B02GGGCCGGGCCGGGCCGAANONE 
J075001G08GGGCCGGGCCGGGCCGAANONE 
J075011I16GGGCCGGGCCGGGCCGAANONE 
J075033M08GGGCCGGGCCGGGCCGAANONE 
J075044G01GGGCCGGGCCGGGCCGAANONE 
J075047D04GGGCCGGGCCGGGCCGAANONE 
J075061J09GGGCCGGGCCGGGCCGAANONE 
J075085L07GGGCCGGGCCGGGCCGAANONE 
J075087D20GGGCCGGGCCGGGCCGAANONE 
J075117A04GGGCCGGGCCGGGCCGAANONE 
J075134H06GGGCCGGGCCGGGCCGAANONE 
J075184J12GGGCCGGGCCGGGCCGAANONE 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0529400J013039I24GGCCGGGCNONE 
J013055M04GGCCGGGCNONE 
J023050E21GGCCGGGCNONE 
J033060K22GGCCGGGCNONE 
J075026D13GGCCGGGCNONE 
J075033M03GGCCGGGCNONE 
J075138F11GGCCGGGCNONE 
J090022B15GGCCGGGCNONE 
Os04g0531300016-006-E10GCCCGGCCCATATNONE 
AK072647GCCCGGCCCATATDihydrouridine synthase, DuS family protein. 
AK103911GCCCGGCCCATATNONE 
J013038P22GCCCGGCCCATATNONE 
J023130D01GCCCGGCCCATATNONE 
J033150P13GCCCGGCCCATATNONE 
J043026L14GCCCGGCCCATATNONE 
J065049A08GCCCGGCCCATATNONE 
J065215C17GCCCGGCCCATATNONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0611300009-006-G08GCCCGGCCCAAGNONE 
009-011-C01GCCCGGCCCAAGNONE 
009-036-B09GCCCGGCCCAAGNONE 
009-116-G09GCCCGGCCCAAGNONE 
009-126-E09GCCCGGCCCAAGNONE 
009-132-F09GCCCGGCCCAAGNONE 
009-151-G07GCCCGGCCCAAGNONE 
009-155-C07GCCCGGCCCAAGNONE 
009-163-G01GCCCGGCCCAAGNONE 
009-169-G08GCCCGGCCCAAGNONE 
009-191-B02GCCCGGCCCAAGNONE 
009-196-A08GCCCGGCCCAAGNONE 
009-198-E07GCCCGGCCCAAGNONE 
014-015-F04GCCCGGCCCAAGNONE 
015-087-H04GCCCGGCCCAAGNONE 
AK062605GCCCGGCCCAAGNONE 
AK063022GCCCGGCCCAAGConserved hypothetical protein. 
AK066749GCCCGGCCCAAGNONE 
AK104924GCCCGGCCCAAGNONE 
J065002M20GCCCGGCCCAAGNONE 
J065045L23GCCCGGCCCAAGNONE 
J065101E05GCCCGGCCCAAGNONE 
J065140J23GCCCGGCCCAAGNONE 
J065179G11GCCCGGCCCAAGNONE 
J065191B18GCCCGGCCCAAGNONE 
J065192E03GCCCGGCCCAAGNONE 
J065199H21GCCCGGCCCAAGNONE 
J075067F01GCCCGGCCCAAGNONE 
J075089L01GCCCGGCCCAAGNONE 
J075147K22GCCCGGCCCAAGNONE 
J080069G23GCCCGGCCCAAGNONE 
J100053D10GCCCGGCCCAAGNONE 
J100078C10GCCCGGCCCAAGNONE 
Os04g0635700009-079-G03GGCCCGGCCNONE 
AK062025GGCCCGGCCRibbon-helix-helix domain containing protein. 
AK098916GGCCCGGCCNONE 
J013002J07GGCCCGGCCNONE 
J013109L20GGCCCGGCCNONE 
J023055C07GGCCCGGCCNONE 
J065036K04GGCCCGGCCNONE 
J065164G12GGCCCGGCCNONE 
Os04g0652900AK071125GGCCGGGCPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03GGCCGGGCNONE 
J075142E01GGCCGGGCNONE 
Os04g0663800013-021-G09GCCCGGCCGTCCNONE 
AK105321GCCCGGCCGTCCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0670600AK064255AAAAGCCCGGCCCAGTTNONE 
Os04g0673400Os04g0673400ACCGGGCCGGGCSimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0683800011-050-B05CTCGGCCCGGCCCNONE 
AK073897CTCGGCCCGGCCCSimilar to Phosphoribosyltransferase (Fragment). 
AK102910CTCGGCCCGGCCCNONE 
J033075A06CTCGGCCCGGCCCNONE 
J033079F23CTCGGCCCGGCCCNONE 
J033093D20CTCGGCCCGGCCCNONE 
J033099B18CTCGGCCCGGCCCNONE 
J033129G13CTCGGCCCGGCCCNONE 
J065075F21CTCGGCCCGGCCCNONE 
J065093M19CTCGGCCCGGCCCNONE 
J075023K10CTCGGCCCGGCCCNONE 
J075046J08CTCGGCCCGGCCCNONE 
J090003I20CTCGGCCCGGCCCNONE 
J090017L12CTCGGCCCGGCCCNONE 
J090024B04CTCGGCCCGGCCCNONE 
J090033A20CTCGGCCCGGCCCNONE 
J090083F02CTCGGCCCGGCCCNONE 
Os04g0684300009-130-G10GCCCGGCCNONE 
AK105205GCCCGGCCProtein of unknown function DUF588 family protein. 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0150300AK100732GCCCGGCCCSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0173700012-035-H08GCCCGGCCNONE 
AK063470GCCCGGCCSimilar to DNA replication licensing factor MCM3 homolog (Replication origin activator) (ROA protein) (Fragment). 
Os05g0189900AK061489GGCCGGGCVirulence factor, pectin lyase fold family protein. 
Os05g0223300AK069616CCCGGCCCGGCCCGGCCCGCASimilar to RNA-binding protein. 
J080093O15CCCGGCCCGGCCCGGCCCGCANONE 
J090061N02CCCGGCCCGGCCCGGCCCGCANONE 
Os05g0227700AK067567GGCCGGGCCConserved hypothetical protein. 
AK068760GGCCGGGCCNONE 
J013108C14GGCCGGGCCNONE 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0397700AK067298GGCCGGGCCGGGCCGGTSecY protein family protein. 
Os05g0409400AK102597GGCCGGGCMAP65/ASE1 family protein. 
Os05g0412800AF402803GCCCGGCCGGCCCAAATSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0414200015-033-G02TCCGACGGCGGCCCGGCCNONE 
AK106297TCCGACGGCGGCCCGGCCDisease resistance protein family protein. 
Os05g0430300AK121670GGGCCCGGCCCProtein of unknown function DUF668 family protein. 
Os05g0437800015-045-B10CCAGGCCCGGCCCACANONE 
AK106328CCAGGCCCGGCCCACAConserved hypothetical protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0476400AK106783GGCCGGGCConserved hypothetical protein. 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE 
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A. 
Os05g0548100AK060333GGCCGGGCCConserved hypothetical protein. 
AK100682GGCCGGGCCNONE 
J013151E01GGCCGGGCCNONE 
J023113L22GGCCGGGCCNONE 
J043027A19GGCCGGGCCNONE 
J075093E06GGCCGGGCCNONE 
J090060D15GGCCGGGCCNONE 
J090082J03GGCCGGGCCNONE 
J100050E01GGCCGGGCCNONE 
Os05g0552900AK102095GCCCGGCCCAGTAMAP65/ASE1 family protein. 
Os05g0563500AK121924GGCCGGGCCCConserved hypothetical protein. 
J033106F17GGCCGGGCCCNONE 
Os05g0566500AK073468TGTGGGCCGGGCNONE 
AK099052TGTGGGCCGGGCSimilar to Initiation factor 3d (Fragment). 
AK104093TGTGGGCCGGGCNONE 
J090025I18TGTGGGCCGGGCNONE 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0577200AK069756GCCCGGCCCACTCarboxylesterase, type B family protein. 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os05g0596600AK107823GCCCGGCCNONE 
AK121149GCCCGGCCSimilar to SMC5 protein. 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0114600015-077-E06CCTGGGCCGGGCCNONE 
AK067972CCTGGGCCGGGCCConserved hypothetical protein. 
Os06g0140100011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0150600011-051-F03GGCCGGGCCGTANONE 
AK063346GGCCGGGCCGTATransferase family protein. 
Os06g0157800AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0168000AK059250CTTGGGCCGGGCCNONE 
AK099356CTTGGGCCGGGCCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19CTTGGGCCGGGCCNONE 
J033097H04CTTGGGCCGGGCCNONE 
J075087M11CTTGGGCCGGGCCNONE 
J075146H06CTTGGGCCGGGCCNONE 
J075188H11CTTGGGCCGGGCCNONE 
J090071D03CTTGGGCCGGGCCNONE 
J090097L20CTTGGGCCGGGCCNONE 
J100051M05CTTGGGCCGGGCCNONE 
J100082H13CTTGGGCCGGGCCNONE 
Os06g0212900AK071518GGCCGGGCCCCACTCCHeat shock protein Hsp70 family protein. 
AK104048GGCCGGGCCCCACTCCNONE 
J023019O18GGCCGGGCCCCACTCCNONE 
J023090N13GGCCGGGCCCCACTCCNONE 
J023101M15GGCCGGGCCCCACTCCNONE 
J023122F06GGCCGGGCCCCACTCCNONE 
J075023H16GGCCGGGCCCCACTCCNONE 
J090006J22GGCCGGGCCCCACTCCNONE 
J090075F24GGCCGGGCCCCACTCCNONE 
J090095A17GGCCGGGCCCCACTCCNONE 
Os06g0226500009-030-E06TGTGGGCCCGGCCCNONE 
AK071601TGTGGGCCCGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J023102C01TGTGGGCCCGGCCCNONE 
Os06g0247800AK102187GGCCCGGCCCAACCSimilar to Dynamin-like protein (Fragment). 
AY224491GGCCCGGCCCAACCNONE 
Os06g0258000AK107483GCCCGGCCSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
AK120884GGCCCGGCCCGGTSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCAACGCCCAGCCCNONE 
J013089A14GGCCCGGCCCGGTNONE 
J023028N24GGCCCGGCCCAACGCCCAGCCCNONE 
J023028N24GGCCCGGCCCGGTNONE 
J033098H21GGCCCGGCCCAACGCCCAGCCCNONE 
J033098H21GGCCCGGCCCGGTNONE 
J033118G04GGCCCGGCCCAACGCCCAGCCCNONE 
J033118G04GGCCCGGCCCGGTNONE 
J090056P15GGCCCGGCCCAACGCCCAGCCCNONE 
J090056P15GGCCCGGCCCGGTNONE 
J090062B02GGCCCGGCCCAACGCCCAGCCCNONE 
J090062B02GGCCCGGCCCGGTNONE 
J100024B09GGCCCGGCCCAACGCCCAGCCCNONE 
J100024B09GGCCCGGCCCGGTNONE 
J100060I04GGCCCGGCCCAACGCCCAGCCCNONE 
J100060I04GGCCCGGCCCGGTNONE 
J100078H11GGCCCGGCCCAACGCCCAGCCCNONE 
J100078H11GGCCCGGCCCGGTNONE 
J100080A14GGCCCGGCCCAACGCCCAGCCCNONE 
J100080A14GGCCCGGCCCGGTNONE 
J100086F18GGCCCGGCCCAACGCCCAGCCCNONE 
J100086F18GGCCCGGCCCGGTNONE 
Os06g0338900016-067-B02GGGCCGGGCGGCCCANONE 
AK100837GGGCCGGGCGGCCCANucleotidyl transferase domain containing protein. 
J013058L01GGGCCGGGCGGCCCANONE 
J013135N01GGGCCGGGCGGCCCANONE 
J023123E15GGGCCGGGCGGCCCANONE 
J033051J01GGGCCGGGCGGCCCANONE 
J090002O21GGGCCGGGCGGCCCANONE 
J090013F06GGGCCGGGCGGCCCANONE 
J090056F16GGGCCGGGCGGCCCANONE 
J090081G13GGGCCGGGCGGCCCANONE 
J090090P21GGGCCGGGCGGCCCANONE 
J100039F05GGGCCGGGCGGCCCANONE 
J100059J03GGGCCGGGCGGCCCANONE 
Os06g0357800AK070985GCCCGGCCConserved hypothetical protein. 
Os06g0500000J065064K10GCCCGGCCCConserved hypothetical protein. 
J065148C10GCCCGGCCCNONE 
J065183N06GCCCGGCCCNONE 
J065203F05GCCCGGCCCNONE 
Os06g0530200009-042-B02GCCCGGCCCNONE 
009-042-B02TGTTGGGCCGGGCCNONE 
009-050-E10GCCCGGCCCNONE 
009-050-E10TGTTGGGCCGGGCCNONE 
009-060-F07GCCCGGCCCNONE 
009-060-F07TGTTGGGCCGGGCCNONE 
009-117-H08GCCCGGCCCNONE 
009-117-H08TGTTGGGCCGGGCCNONE 
009-129-C10GCCCGGCCCNONE 
009-129-C10TGTTGGGCCGGGCCNONE 
AK073116GCCCGGCCCConserved hypothetical protein. 
AK073116TGTTGGGCCGGGCCConserved hypothetical protein. 
AK104077GCCCGGCCCNONE 
AK104077TGTTGGGCCGGGCCNONE 
J065032N16GCCCGGCCCNONE 
J065032N16TGTTGGGCCGGGCCNONE 
J065153K07GCCCGGCCCNONE 
J065153K07TGTTGGGCCGGGCCNONE 
J065169N18GCCCGGCCCNONE 
J065169N18TGTTGGGCCGGGCCNONE 
J065190H18GCCCGGCCCNONE 
J065190H18TGTTGGGCCGGGCCNONE 
J075127E14GCCCGGCCCNONE 
J075127E14TGTTGGGCCGGGCCNONE 
J090008F20GCCCGGCCCNONE 
J090008F20TGTTGGGCCGGGCCNONE 
Os06g0542100AK111086GGCCGGGCHypothetical protein. 
J090051D03GGCCGGGCNONE 
Os06g0548800AK072611CCAAGCCCGGCCSimilar to Nectarin 5 (Fragment). 
J023009K16CCAAGCCCGGCCNONE 
J023037M18CCAAGCCCGGCCNONE 
J023044H17CCAAGCCCGGCCNONE 
J023052K12CCAAGCCCGGCCNONE 
J023087N10CCAAGCCCGGCCNONE 
J023093E22CCAAGCCCGGCCNONE 
J023095A04CCAAGCCCGGCCNONE 
J023108G05CCAAGCCCGGCCNONE 
J023133A01CCAAGCCCGGCCNONE 
Os06g0551400009-003-D11CCCACCCGGCCCGGCCCACANONE 
011-025-C09CCCACCCGGCCCGGCCCACANONE 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
D13758CCCACCCGGCCCGGCCCACANONE 
J013069H14CCCACCCGGCCCGGCCCACANONE 
J053037J07CCCACCCGGCCCGGCCCACANONE 
J065011J03CCCACCCGGCCCGGCCCACANONE 
J065078L15CCCACCCGGCCCGGCCCACANONE 
J065103H24CCCACCCGGCCCGGCCCACANONE 
J065157A07CCCACCCGGCCCGGCCCACANONE 
J065213P12CCCACCCGGCCCGGCCCACANONE 
J090007P04CCCACCCGGCCCGGCCCACANONE 
J090052N23CCCACCCGGCCCGGCCCACANONE 
Os06g0564700AK070508GCCGGCCCGGCCSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23GCCGGCCCGGCCNONE 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0585200016-065-C02CACGGCCCGGCCNONE 
016-065-C02GCCGGGCCGGGCCGTGNONE 
AK068592CACGGCCCGGCCNONE 
AK068592GCCGGGCCGGGCCGTGNONE 
AK073844CACGGCCCGGCCNONE 
AK073844GCCGGGCCGGGCCGTGNONE 
AK106549CACGGCCCGGCCConserved hypothetical protein. 
AK106549GCCGGGCCGGGCCGTGConserved hypothetical protein. 
J013154A14CACGGCCCGGCCNONE 
J013154A14GCCGGGCCGGGCCGTGNONE 
J100049K24CACGGCCCGGCCNONE 
J100049K24GCCGGGCCGGGCCGTGNONE 
J100059C18CACGGCCCGGCCNONE 
J100059C18GCCGGGCCGGGCCGTGNONE 
J100082N13CACGGCCCGGCCNONE 
J100082N13GCCGGGCCGGGCCGTGNONE 
Os06g0602400AK106474GGCCGGGCSimilar to DEAD-box protein 3, X-chromosomal (DEAD-box RNA helicase DEAD3) (mDEAD3) (Embryonic RNA helicase) (D1PAS1 related sequence 2). 
Os06g0622700AK107021GCCCGGCCEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05GCCCGGCCNONE 
J065100L18GCCCGGCCNONE 
J065129N15GCCCGGCCNONE 
J065152M08GCCCGGCCNONE 
J065198M12GCCCGGCCNONE 
J090077J22GCCCGGCCNONE 
J100024G23GCCCGGCCNONE 
J100027L01GCCCGGCCNONE 
J100047C06GCCCGGCCNONE 
J100055D01GCCCGGCCNONE 
J100067M05GCCCGGCCNONE 
J100077M16GCCCGGCCNONE 
J100078M22GCCCGGCCNONE 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os06g0704300AK107008ATCTGGGCCGGGCCCZinc finger, CCCH-type domain containing protein. 
J065038I12ATCTGGGCCGGGCCCNONE 
J065079E03ATCTGGGCCGGGCCCNONE 
J075035B15ATCTGGGCCGGGCCCNONE 
J090072D21ATCTGGGCCGGGCCCNONE 
Os06g0717400AK072887GCCGGCCCGGCCCATTTPseudouridine synthase, Rlu family protein. 
Os06g0725400J065086O07AATGGGCCGGGCCGGTSimilar to BLE1 protein. 
J065114J19AATGGGCCGGGCCGGTNONE 
Os07g0110800009-107-B11GGCCCGGCCCATCANONE 
AK062792GGCCCGGCCCATCAConserved hypothetical protein. 
J053026P09GGCCCGGCCCATCANONE 
J053074L17GGCCCGGCCCATCANONE 
J065057E24GGCCCGGCCCATCANONE 
J065149B18GGCCCGGCCCATCANONE 
J075002O20GGCCCGGCCCATCANONE 
J090002C13GGCCCGGCCCATCANONE 
Os07g0110900AK058987TGATGGGCCGGGCCConserved hypothetical protein. 
J065032L02TGATGGGCCGGGCCNONE 
J065074H06TGATGGGCCGGGCCNONE 
J065168M23TGATGGGCCGGGCCNONE 
Os07g0113200AK108787GGCCCGGCCCATCAConserved hypothetical protein. 
J065090J04GGCCCGGCCCATCANONE 
J065116K24GGCCCGGCCCATCANONE 
J065161F14GGCCCGGCCCATCANONE 
J065203E23GGCCCGGCCCATCANONE 
Os07g0144200Os07g0144200GGCCCGGCCCGGCCCHypothetical protein. 
Os07g0158900AK064980GGCCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os07g0185700012-040-A11GCCCGGCCCATATNONE 
AK070572GCCCGGCCCATATConserved hypothetical protein. 
J065116D10GCCCGGCCCATATNONE 
J065122F20GCCCGGCCCATATNONE 
Os07g0202100AK101736GGCCGGGCSimilar to ATP-dependent RNA helicase ded1. 
Os07g0206900AK107761GGCCGGGCCGGCProtein of unknown function DUF642 family protein. 
Os07g0213600AK107696GCCCGGCCCPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09GCCCGGCCCNONE 
J100082J05GCCCGGCCCNONE 
Os07g0224000009-060-E01GCCCGGCCCATTANONE 
J065042D20GCCCGGCCCATTANONE 
J065127D14GCCCGGCCCATTANONE 
J065176C24GCCCGGCCCATTANONE 
J065188M12GCCCGGCCCATTANONE 
J065194L14GCCCGGCCCATTANONE 
J075060P09GCCCGGCCCATTANONE 
J075134C14GCCCGGCCCATTARibosomal protein L24E family protein. 
J075192M12GCCCGGCCCATTANONE 
J100032N01GCCCGGCCCATTANONE 
Os07g0256200AK072904GCCCGGCCCACAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCCCGGCCCACAANONE 
Os07g0258400AK121534CTCGGCCCGGCCCACCTNONE 
L41217CTCGGCCCGGCCCACCTNONE 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0301200AB110202GCTGGGCCGGGCCGNONE 
AK073463GCTGGGCCGGGCCGSimilar to RNA helicase (Fragment). 
Os07g0422100013-054-G11GCCCGGCCNONE 
AK063592GCCCGGCCNONE 
J065165K10GCCCGGCCNONE 
J075021B01GCCCGGCCNONE 
J075087H22GCCCGGCCNONE 
J075118C10GCCCGGCCNONE 
J075134N03GCCCGGCCNONE 
J075151F23GCCCGGCCNONE 
U57639GCCCGGCCAWPM-19-like family protein. 
Os07g0442800AK103470GGCCGGGCConserved hypothetical protein. 
J033130A10GGCCGGGCNONE 
J053045P07GGCCGGGCNONE 
J053076I17GGCCGGGCNONE 
J053088O13GGCCGGGCNONE 
J065036F09GGCCGGGCNONE 
J065048N13GGCCGGGCNONE 
J065067D16GGCCGGGCNONE 
J065087J06GGCCGGGCNONE 
J065111L23GGCCGGGCNONE 
J065117O16GGCCGGGCNONE 
J065120D22GGCCGGGCNONE 
J065164G14GGCCGGGCNONE 
J065181K11GGCCGGGCNONE 
J065214H01GGCCGGGCNONE 
Os07g0462700009-033-D05GCCCGGCCCNONE 
AK073834GCCCGGCCCNONE 
AK104968GCCCGGCCCThioesterase superfamily domain containing protein. 
J065104G16GCCCGGCCCNONE 
J065197C14GCCCGGCCCNONE 
J065213E17GCCCGGCCCNONE 
J065215D11GCCCGGCCCNONE 
J075001J15GCCCGGCCCNONE 
J075026M11GCCCGGCCCNONE 
J075142G03GCCCGGCCCNONE 
J075178H04GCCCGGCCCNONE 
J100069P18GCCCGGCCCNONE 
Os07g0496200AK064866CACGGCCCGGCCNONE 
AK065801CACGGCCCGGCCSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0516200AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
Os07g0539900AK071889GCCCGGCCCAGTTSimilar to Beta-1,3-glucanase-like protein. 
AK098943GCCCGGCCCAGTTNONE 
J013047P11GCCCGGCCCAGTTNONE 
Os07g0546000AF188065GGCCCGGCCCGGCCGGCCCACCNONE 
AK061800GGCCCGGCCCGGCCGGCCCACCNONE 
AK065871GGCCCGGCCCGGCCGGCCCACCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02GGCCCGGCCCGGCCGGCCCACCNONE 
J013035F03GGCCCGGCCCGGCCGGCCCACCNONE 
J013044J20GGCCCGGCCCGGCCGGCCCACCNONE 
Os07g0552800AF435651GCCCGGCCNONE 
AK066835GCCCGGCCNONE 
J023009K24GCCCGGCCNONE 
J023050L14GCCCGGCCNONE 
J023092I02GCCCGGCCNONE 
J023100P04GCCCGGCCNONE 
J023112O13GCCCGGCCNONE 
J023121J20GCCCGGCCNONE 
Os07g0555400AK070977GCTGGGCCGGGCCGCCCATTTConserved hypothetical protein. 
Os07g0562700003-111-G08GCCCGGCCCAAAANONE 
004-013-E07GCCCGGCCCAAAANONE 
006-021-D03GCCCGGCCCAAAANONE 
006-021-D07GCCCGGCCCAAAANONE 
006-021-F09GCCCGGCCCAAAANONE 
006-023-D01GCCCGGCCCAAAANONE 
006-024-F04GCCCGGCCCAAAANONE 
006-024-G09GCCCGGCCCAAAANONE 
006-024-G11GCCCGGCCCAAAANONE 
006-025-A10GCCCGGCCCAAAANONE 
006-025-B08GCCCGGCCCAAAANONE 
006-025-E10GCCCGGCCCAAAANONE 
006-025-F10GCCCGGCCCAAAANONE 
006-026-B04GCCCGGCCCAAAANONE 
006-026-C08GCCCGGCCCAAAANONE 
006-026-D03GCCCGGCCCAAAANONE 
006-026-F03GCCCGGCCCAAAANONE 
006-026-F08GCCCGGCCCAAAANONE 
006-026-F12GCCCGGCCCAAAANONE 
006-027-A10GCCCGGCCCAAAANONE 
006-027-C03GCCCGGCCCAAAANONE 
006-028-C03GCCCGGCCCAAAANONE 
006-029-E02GCCCGGCCCAAAANONE 
006-029-G05GCCCGGCCCAAAANONE 
006-030-A10GCCCGGCCCAAAANONE 
006-030-C06GCCCGGCCCAAAANONE 
006-030-D03GCCCGGCCCAAAANONE 
006-030-D06GCCCGGCCCAAAANONE 
006-030-G05GCCCGGCCCAAAANONE 
006-031-B10GCCCGGCCCAAAANONE 
006-031-D04GCCCGGCCCAAAANONE 
006-031-D11GCCCGGCCCAAAANONE 
006-031-H09GCCCGGCCCAAAANONE 
006-032-C09GCCCGGCCCAAAANONE 
006-032-H09GCCCGGCCCAAAANONE 
006-033-B02GCCCGGCCCAAAANONE 
006-033-B09GCCCGGCCCAAAANONE 
006-033-E01GCCCGGCCCAAAANONE 
006-033-F06GCCCGGCCCAAAANONE 
006-033-G03GCCCGGCCCAAAANONE 
006-034-A08GCCCGGCCCAAAANONE 
006-034-C09GCCCGGCCCAAAANONE 
006-034-F06GCCCGGCCCAAAANONE 
006-035-B12GCCCGGCCCAAAANONE 
006-035-C12GCCCGGCCCAAAANONE 
006-035-H04GCCCGGCCCAAAANONE 
006-035-H12GCCCGGCCCAAAANONE 
006-036-A05GCCCGGCCCAAAANONE 
006-036-A09GCCCGGCCCAAAANONE 
006-036-B10GCCCGGCCCAAAANONE 
006-036-C03GCCCGGCCCAAAANONE 
006-036-E06GCCCGGCCCAAAANONE 
006-037-H11GCCCGGCCCAAAANONE 
006-038-G01GCCCGGCCCAAAANONE 
006-039-B01GCCCGGCCCAAAANONE 
006-039-B12GCCCGGCCCAAAANONE 
006-039-C02GCCCGGCCCAAAANONE 
006-039-E06GCCCGGCCCAAAANONE 
006-039-G12GCCCGGCCCAAAANONE 
006-040-G07GCCCGGCCCAAAANONE 
006-041-H04GCCCGGCCCAAAANONE 
006-042-A11GCCCGGCCCAAAANONE 
006-042-E07GCCCGGCCCAAAANONE 
006-042-F12GCCCGGCCCAAAANONE 
006-043-C01GCCCGGCCCAAAANONE 
006-045-H12GCCCGGCCCAAAANONE 
006-046-A12GCCCGGCCCAAAANONE 
006-046-F03GCCCGGCCCAAAANONE 
006-047-A07GCCCGGCCCAAAANONE 
006-047-A09GCCCGGCCCAAAANONE 
006-047-E10GCCCGGCCCAAAANONE 
006-047-G12GCCCGGCCCAAAANONE 
006-048-B04GCCCGGCCCAAAANONE 
006-049-D01GCCCGGCCCAAAANONE 
006-049-G02GCCCGGCCCAAAANONE 
006-049-G10GCCCGGCCCAAAANONE 
006-049-H04GCCCGGCCCAAAANONE 
006-050-D05GCCCGGCCCAAAANONE 
006-050-F05GCCCGGCCCAAAANONE 
006-051-B05GCCCGGCCCAAAANONE 
006-051-G12GCCCGGCCCAAAANONE 
006-052-D12GCCCGGCCCAAAANONE 
006-053-D06GCCCGGCCCAAAANONE 
006-054-H02GCCCGGCCCAAAANONE 
006-055-A03GCCCGGCCCAAAANONE 
006-055-C01GCCCGGCCCAAAANONE 
006-055-E07GCCCGGCCCAAAANONE 
006-055-H06GCCCGGCCCAAAANONE 
006-056-F06GCCCGGCCCAAAANONE 
006-057-D03GCCCGGCCCAAAANONE 
006-057-D05GCCCGGCCCAAAANONE 
006-057-G01GCCCGGCCCAAAANONE 
006-058-A03GCCCGGCCCAAAANONE 
006-058-B06GCCCGGCCCAAAANONE 
006-059-A09GCCCGGCCCAAAANONE 
006-059-H11GCCCGGCCCAAAANONE 
006-060-A04GCCCGGCCCAAAANONE 
006-060-A09GCCCGGCCCAAAANONE 
006-060-C11GCCCGGCCCAAAANONE 
006-060-D08GCCCGGCCCAAAANONE 
006-061-A04GCCCGGCCCAAAANONE 
006-061-E01GCCCGGCCCAAAANONE 
006-061-G10GCCCGGCCCAAAANONE 
006-061-H12GCCCGGCCCAAAANONE 
006-062-B07GCCCGGCCCAAAANONE 
006-062-G03GCCCGGCCCAAAANONE 
006-062-H12GCCCGGCCCAAAANONE 
006-063-D05GCCCGGCCCAAAANONE 
006-063-E04GCCCGGCCCAAAANONE 
006-063-F05GCCCGGCCCAAAANONE 
006-063-G05GCCCGGCCCAAAANONE 
006-064-B07GCCCGGCCCAAAANONE 
006-065-C11GCCCGGCCCAAAANONE 
006-065-H02GCCCGGCCCAAAANONE 
006-067-C12GCCCGGCCCAAAANONE 
006-067-F10GCCCGGCCCAAAANONE 
006-068-E02GCCCGGCCCAAAANONE 
006-068-G04GCCCGGCCCAAAANONE 
006-069-A02GCCCGGCCCAAAANONE 
006-071-A07GCCCGGCCCAAAANONE 
006-072-F11GCCCGGCCCAAAANONE 
006-072-F12GCCCGGCCCAAAANONE 
006-073-E12GCCCGGCCCAAAANONE 
006-073-F08GCCCGGCCCAAAANONE 
006-073-H07GCCCGGCCCAAAANONE 
006-074-A07GCCCGGCCCAAAANONE 
006-075-A12GCCCGGCCCAAAANONE 
006-075-B01GCCCGGCCCAAAANONE 
006-075-H10GCCCGGCCCAAAANONE 
006-075-H12GCCCGGCCCAAAANONE 
006-076-B06GCCCGGCCCAAAANONE 
006-077-A09GCCCGGCCCAAAANONE 
006-077-D05GCCCGGCCCAAAANONE 
006-078-C11GCCCGGCCCAAAANONE 
006-078-D12GCCCGGCCCAAAANONE 
006-078-E02GCCCGGCCCAAAANONE 
006-079-A01GCCCGGCCCAAAANONE 
006-079-E02GCCCGGCCCAAAANONE 
006-079-F03GCCCGGCCCAAAANONE 
006-080-G11GCCCGGCCCAAAANONE 
006-081-C02GCCCGGCCCAAAANONE 
006-081-C08GCCCGGCCCAAAANONE 
006-082-B06GCCCGGCCCAAAANONE 
006-082-C11GCCCGGCCCAAAANONE 
006-082-H04GCCCGGCCCAAAANONE 
006-083-E04GCCCGGCCCAAAANONE 
006-083-H12GCCCGGCCCAAAANONE 
006-084-C08GCCCGGCCCAAAANONE 
006-084-E07GCCCGGCCCAAAANONE 
006-084-E10GCCCGGCCCAAAANONE 
006-085-E06GCCCGGCCCAAAANONE 
006-085-E10GCCCGGCCCAAAANONE 
006-086-F06GCCCGGCCCAAAANONE 
006-087-D08GCCCGGCCCAAAANONE 
006-087-F03GCCCGGCCCAAAANONE 
006-087-F10GCCCGGCCCAAAANONE 
006-087-G07GCCCGGCCCAAAANONE 
006-088-A02GCCCGGCCCAAAANONE 
006-089-A04GCCCGGCCCAAAANONE 
006-089-B12GCCCGGCCCAAAANONE 
006-089-D06GCCCGGCCCAAAANONE 
006-089-D10GCCCGGCCCAAAANONE 
006-089-H05GCCCGGCCCAAAANONE 
006-090-C06GCCCGGCCCAAAANONE 
006-091-A03GCCCGGCCCAAAANONE 
006-091-E04GCCCGGCCCAAAANONE 
006-091-H12GCCCGGCCCAAAANONE 
006-092-A08GCCCGGCCCAAAANONE 
006-092-F01GCCCGGCCCAAAANONE 
006-092-G08GCCCGGCCCAAAANONE 
006-093-B12GCCCGGCCCAAAANONE 
006-093-D04GCCCGGCCCAAAANONE 
006-093-F01GCCCGGCCCAAAANONE 
006-094-A08GCCCGGCCCAAAANONE 
006-094-F01GCCCGGCCCAAAANONE 
006-094-F03GCCCGGCCCAAAANONE 
006-095-C12GCCCGGCCCAAAANONE 
006-095-E10GCCCGGCCCAAAANONE 
006-095-E12GCCCGGCCCAAAANONE 
006-095-G06GCCCGGCCCAAAANONE 
006-096-B12GCCCGGCCCAAAANONE 
006-096-C12GCCCGGCCCAAAANONE 
006-096-G02GCCCGGCCCAAAANONE 
006-097-D01GCCCGGCCCAAAANONE 
006-097-D07GCCCGGCCCAAAANONE 
006-097-F04GCCCGGCCCAAAANONE 
006-098-C07GCCCGGCCCAAAANONE 
006-098-D04GCCCGGCCCAAAANONE 
006-099-E06GCCCGGCCCAAAANONE 
006-099-F02GCCCGGCCCAAAANONE 
006-099-F10GCCCGGCCCAAAANONE 
006-100-A07GCCCGGCCCAAAANONE 
006-100-B10GCCCGGCCCAAAANONE 
006-100-G01GCCCGGCCCAAAANONE 
006-100-H06GCCCGGCCCAAAANONE 
006-101-D01GCCCGGCCCAAAANONE 
006-101-F03GCCCGGCCCAAAANONE 
006-102-A12GCCCGGCCCAAAANONE 
006-102-B11GCCCGGCCCAAAANONE 
006-102-C03GCCCGGCCCAAAANONE 
006-102-F11GCCCGGCCCAAAANONE 
006-103-A08GCCCGGCCCAAAANONE 
006-103-B06GCCCGGCCCAAAANONE 
006-103-D01GCCCGGCCCAAAANONE 
006-103-F02GCCCGGCCCAAAANONE 
006-104-B02GCCCGGCCCAAAANONE 
006-104-C01GCCCGGCCCAAAANONE 
006-104-F09GCCCGGCCCAAAANONE 
006-104-H11GCCCGGCCCAAAANONE 
006-105-A03GCCCGGCCCAAAANONE 
006-105-D09GCCCGGCCCAAAANONE 
006-106-B10GCCCGGCCCAAAANONE 
006-107-A06GCCCGGCCCAAAANONE 
006-107-C04GCCCGGCCCAAAANONE 
006-107-E03GCCCGGCCCAAAANONE 
006-107-F05GCCCGGCCCAAAANONE 
006-108-C09GCCCGGCCCAAAANONE 
006-109-C09GCCCGGCCCAAAANONE 
006-109-D10GCCCGGCCCAAAANONE 
006-109-E06GCCCGGCCCAAAANONE 
006-109-E10GCCCGGCCCAAAANONE 
006-110-A06GCCCGGCCCAAAANONE 
006-110-C11GCCCGGCCCAAAANONE 
006-111-A02GCCCGGCCCAAAANONE 
006-111-F02GCCCGGCCCAAAANONE 
006-112-A08GCCCGGCCCAAAANONE 
006-112-H06GCCCGGCCCAAAANONE 
006-113-A08GCCCGGCCCAAAANONE 
006-113-B01GCCCGGCCCAAAANONE 
006-113-C05GCCCGGCCCAAAANONE 
006-113-D01GCCCGGCCCAAAANONE 
006-113-D04GCCCGGCCCAAAANONE 
006-113-D06GCCCGGCCCAAAANONE 
006-113-E09GCCCGGCCCAAAANONE 
006-114-F06GCCCGGCCCAAAANONE 
006-116-B02GCCCGGCCCAAAANONE 
006-117-B07GCCCGGCCCAAAANONE 
006-117-G04GCCCGGCCCAAAANONE 
006-118-D01GCCCGGCCCAAAANONE 
006-118-D12GCCCGGCCCAAAANONE 
006-118-F12GCCCGGCCCAAAANONE 
006-118-G12GCCCGGCCCAAAANONE 
006-119-B08GCCCGGCCCAAAANONE 
006-120-E09GCCCGGCCCAAAANONE 
006-120-G05GCCCGGCCCAAAANONE 
006-120-G10GCCCGGCCCAAAANONE 
009-022-D12GCCCGGCCCAAAANONE 
009-051-H08GCCCGGCCCAAAANONE 
009-065-F05GCCCGGCCCAAAANONE 
009-070-A06GCCCGGCCCAAAANONE 
009-073-B07GCCCGGCCCAAAANONE 
009-092-C10GCCCGGCCCAAAANONE 
009-093-D03GCCCGGCCCAAAANONE 
009-103-B04GCCCGGCCCAAAANONE 
009-106-H08GCCCGGCCCAAAANONE 
009-120-B05GCCCGGCCCAAAANONE 
009-121-F05GCCCGGCCCAAAANONE 
009-122-B04GCCCGGCCCAAAANONE 
009-122-D08GCCCGGCCCAAAANONE 
009-123-F07GCCCGGCCCAAAANONE 
009-125-G02GCCCGGCCCAAAANONE 
009-128-F02GCCCGGCCCAAAANONE 
009-128-H07GCCCGGCCCAAAANONE 
009-131-C06GCCCGGCCCAAAANONE 
009-132-F08GCCCGGCCCAAAANONE 
009-133-G08GCCCGGCCCAAAANONE 
009-134-D09GCCCGGCCCAAAANONE 
009-135-F01GCCCGGCCCAAAANONE 
009-149-E11GCCCGGCCCAAAANONE 
009-153-H04GCCCGGCCCAAAANONE 
009-161-E04GCCCGGCCCAAAANONE 
009-163-A09GCCCGGCCCAAAANONE 
009-163-C05GCCCGGCCCAAAANONE 
009-163-E10GCCCGGCCCAAAANONE 
009-165-F04GCCCGGCCCAAAANONE 
009-166-A07GCCCGGCCCAAAANONE 
009-169-G12GCCCGGCCCAAAANONE 
009-172-G08GCCCGGCCCAAAANONE 
009-179-E06GCCCGGCCCAAAANONE 
009-181-F09GCCCGGCCCAAAANONE 
009-190-G07GCCCGGCCCAAAANONE 
009-191-D01GCCCGGCCCAAAANONE 
009-195-G02GCCCGGCCCAAAANONE 
AF022738GCCCGGCCCAAAANONE 
AK061512GCCCGGCCCAAAANONE 
AK068972GCCCGGCCCAAAANONE 
AK103926GCCCGGCCCAAAANONE 
AK103999GCCCGGCCCAAAANONE 
AK104224GCCCGGCCCAAAANONE 
AK104465GCCCGGCCCAAAANONE 
AK104495GCCCGGCCCAAAANONE 
AK109399GCCCGGCCCAAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCCCGGCCCAAAANONE 
AK119545GCCCGGCCCAAAANONE 
J013043L10GCCCGGCCCAAAANONE 
J013050A09GCCCGGCCCAAAANONE 
J023001G03GCCCGGCCCAAAANONE 
J023024D14GCCCGGCCCAAAANONE 
J023072E11GCCCGGCCCAAAANONE 
J023149E18GCCCGGCCCAAAANONE 
J033029B16GCCCGGCCCAAAANONE 
J065001O21GCCCGGCCCAAAANONE 
J065035B04GCCCGGCCCAAAANONE 
J065044D18GCCCGGCCCAAAANONE 
J065057F12GCCCGGCCCAAAANONE 
J065060A11GCCCGGCCCAAAANONE 
J065062G15GCCCGGCCCAAAANONE 
J065080F13GCCCGGCCCAAAANONE 
J065084N12GCCCGGCCCAAAANONE 
J065101D02GCCCGGCCCAAAANONE 
J065107C07GCCCGGCCCAAAANONE 
J065112N24GCCCGGCCCAAAANONE 
J065141I16GCCCGGCCCAAAANONE 
J065147D05GCCCGGCCCAAAANONE 
J065167H02GCCCGGCCCAAAANONE 
J065207K23GCCCGGCCCAAAANONE 
J075008E16GCCCGGCCCAAAANONE 
J075014F03GCCCGGCCCAAAANONE 
J075015O17GCCCGGCCCAAAANONE 
J075020H20GCCCGGCCCAAAANONE 
J075021E22GCCCGGCCCAAAANONE 
J075023N13GCCCGGCCCAAAANONE 
J075028H10GCCCGGCCCAAAANONE 
J075040F20GCCCGGCCCAAAANONE 
J075051L23GCCCGGCCCAAAANONE 
J075069G16GCCCGGCCCAAAANONE 
J075084F24GCCCGGCCCAAAANONE 
J075090H09GCCCGGCCCAAAANONE 
J075092M21GCCCGGCCCAAAANONE 
J075110C10GCCCGGCCCAAAANONE 
J075111J12GCCCGGCCCAAAANONE 
J075114L04GCCCGGCCCAAAANONE 
J075139E02GCCCGGCCCAAAANONE 
J075160M10GCCCGGCCCAAAANONE 
J075176J03GCCCGGCCCAAAANONE 
J075183I17GCCCGGCCCAAAANONE 
J075191N10GCCCGGCCCAAAANONE 
J075193D07GCCCGGCCCAAAANONE 
J075194M16GCCCGGCCCAAAANONE 
J075197K04GCCCGGCCCAAAANONE 
J080032I11GCCCGGCCCAAAANONE 
J080076M11GCCCGGCCCAAAANONE 
J080311J08GCCCGGCCCAAAANONE 
J080317E05GCCCGGCCCAAAANONE 
J090034L08GCCCGGCCCAAAANONE 
J100040D19GCCCGGCCCAAAANONE 
J100074C11GCCCGGCCCAAAANONE 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0585800006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305F09TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080311G07TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080315B14TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
J080317C02TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
Os07g0691200AK068807GCCCGGCCNONE 
AK072158GCCCGGCCNONE 
J013001D13GCCCGGCCNONE 
J013022D09GCCCGGCCNONE 
J013028C24GCCCGGCCNONE 
J013032M14GCCCGGCCNONE 
J023097E13GCCCGGCCNONE 
J065095A22GCCCGGCCNONE 
Os08g0105100AK069415GGCCGGGCCyclin-like F-box domain containing protein. 
AK099227GGCCGGGCNONE 
J023019E02GGCCGGGCNONE 
J100024M08GGCCGGGCNONE 
J100090G12GGCCGGGCNONE 
Os08g0139100006-027-E12GGCCCGGCCCGGCCCGGCCCACTNONE 
006-089-E06GGCCCGGCCCGGCCCGGCCCACTNONE 
006-113-G02GGCCCGGCCCGGCCCGGCCCACTNONE 
AK061429GGCCCGGCCCGGCCCGGCCCACTNONE 
AK099590GGCCCGGCCCGGCCCGGCCCACTSimilar to DAG protein, chloroplast precursor. 
AK104727GGCCCGGCCCGGCCCGGCCCACTNONE 
J013043H11GGCCCGGCCCGGCCCGGCCCACTNONE 
J013049N13GGCCCGGCCCGGCCCGGCCCACTNONE 
J065079F01GGCCCGGCCCGGCCCGGCCCACTNONE 
J065122N24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065142J24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065193N03GGCCCGGCCCGGCCCGGCCCACTNONE 
J075041I21GGCCCGGCCCGGCCCGGCCCACTNONE 
J075145E04GGCCCGGCCCGGCCCGGCCCACTNONE 
Os08g0161700009-088-D09AAATGGGCCTTATTGGGCCGGGCCNONE 
009-131-H02AAATGGGCCTTATTGGGCCGGGCCNONE 
009-182-D04AAATGGGCCTTATTGGGCCGGGCCNONE 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
J075002M21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075090H12AAATGGGCCTTATTGGGCCGGGCCNONE 
J075129C21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075146N03AAATGGGCCTTATTGGGCCGGGCCNONE 
J075178P18AAATGGGCCTTATTGGGCCGGGCCNONE 
J075190M03AAATGGGCCTTATTGGGCCGGGCCNONE 
J090030G01AAATGGGCCTTATTGGGCCGGGCCNONE 
J100088M23AAATGGGCCTTATTGGGCCGGGCCNONE 
Os08g0167500006-063-D04TCATGGGCCGGGCCGGGNONE 
006-066-G09TCATGGGCCGGGCCGGGNONE 
AK061061TCATGGGCCGGGCCGGGConserved hypothetical protein. 
AK071197TCATGGGCCGGGCCGGGNONE 
J023082N10TCATGGGCCGGGCCGGGNONE 
Os08g0203800J065195H23GGCCCGGCCCNONE 
J075146H03GGCCCGGCCCNONE 
Os08g0224200AK101331GGCCGGGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
014-096-F01GGCCGGGCCGGCNONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
AK067127GGCCGGGCCGGCConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J013096C05GGCCGGGCCGGCNONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12GGCCGGGCCGGCNONE 
Os08g0328300AK102227GGCCCGGCCCATTTNONE 
AK105392GGCCCGGCCCATTTENT domain containing protein. 
Os08g0406500016-001-C06GCCCGGCCCNONE 
AK064160GCCCGGCCCTRAF-like domain containing protein. 
Os08g0416000AF145729GGCCGGGCCGGCHomeodomain leucine zipper protein. 
AK100634GGCCGGGCCGGCNONE 
AK101569GGCCGGGCCGGCNONE 
AK110561GGCCGGGCCGGCNONE 
J013074A01GGCCGGGCCGGCNONE 
J013159K22GGCCGGGCCGGCNONE 
J023028M01GGCCGGGCCGGCNONE 
J023033C15GGCCGGGCCGGCNONE 
J023107N23GGCCGGGCCGGCNONE 
J023110A12GGCCGGGCCGGCNONE 
J023122D02GGCCGGGCCGGCNONE 
J033050G15GGCCGGGCCGGCNONE 
J033107D17GGCCGGGCCGGCNONE 
J065082J21GGCCGGGCCGGCNONE 
J065165L21GGCCGGGCCGGCNONE 
J065171J17GGCCGGGCCGGCNONE 
J100026K13GGCCGGGCCGGCNONE 
J100039E16GGCCGGGCCGGCNONE 
J100056J11GGCCGGGCCGGCNONE 
J100070I19GGCCGGGCCGGCNONE 
J100073B16GGCCGGGCCGGCNONE 
J100081M19GGCCGGGCCGGCNONE 
J100088E09GGCCGGGCCGGCNONE 
Os08g0431500009-186-D05ATTTGGGCCGGGCNONE 
009-186-D05GGCCCGGCCCATTTNONE 
AK058993ATTTGGGCCGGGCNONE 
AK058993GGCCCGGCCCATTTNONE 
AK100797ATTTGGGCCGGGCConserved hypothetical protein. 
AK100797GGCCCGGCCCATTTConserved hypothetical protein. 
J023121F15ATTTGGGCCGGGCNONE 
J023121F15GGCCCGGCCCATTTNONE 
Os08g0433200013-023-E07TACGGCCCGGCCCAAANONE 
AK099471TACGGCCCGGCCCAAAConserved hypothetical protein. 
J013024A05TACGGCCCGGCCCAAANONE 
J013065N03TACGGCCCGGCCCAAANONE 
J023111A21TACGGCCCGGCCCAAANONE 
J065035F10TACGGCCCGGCCCAAANONE 
J065083H01TACGGCCCGGCCCAAANONE 
J065159E03TACGGCCCGGCCCAAANONE 
J065186A03TACGGCCCGGCCCAAANONE 
J075032B02TACGGCCCGGCCCAAANONE 
J075038L14TACGGCCCGGCCCAAANONE 
J075047N21TACGGCCCGGCCCAAANONE 
J075076H05TACGGCCCGGCCCAAANONE 
J075110C08TACGGCCCGGCCCAAANONE 
J090096K17TACGGCCCGGCCCAAANONE 
Os08g0439900AK110628GCCCGGCCMitochondrial glycoprotein family protein. 
J065118D13GCCCGGCCNONE 
Os08g0442300006-067-F05GCTGGGCCAGGCCGGGCCGGANONE 
AK059843GCTGGGCCAGGCCGGGCCGGANONE 
AK071719GCTGGGCCAGGCCGGGCCGGASimilar to Calcineurin-like protein. 
AK102411GCTGGGCCAGGCCGGGCCGGANONE 
J023108H11GCTGGGCCAGGCCGGGCCGGANONE 
J033092P05GCTGGGCCAGGCCGGGCCGGANONE 
J075109C09GCTGGGCCAGGCCGGGCCGGANONE 
J090070B02GCTGGGCCAGGCCGGGCCGGANONE 
J090076M14GCTGGGCCAGGCCGGGCCGGANONE 
J100064B16GCTGGGCCAGGCCGGGCCGGANONE 
Os08g0447200AK067377GCCCGGCCCATCTGGCCCSGT1 family protein. 
J013106M17GCCCGGCCCATCTGGCCCNONE 
J033133D18GCCCGGCCCATCTGGCCCNONE 
J033140B09GCCCGGCCCATCTGGCCCNONE 
J100028I17GCCCGGCCCATCTGGCCCNONE 
J100086C22GCCCGGCCCATCTGGCCCNONE 
Os08g0474700AK064878GCCCGGCCCSimilar to COPII subunit Sec23 (Fragment). 
Os08g0527100AK119411TACTGGGCCGGGCCTTGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TACTGGGCCGGGCCTTGNONE 
J090029K18TACTGGGCCGGGCCTTGNONE 
Os08g0535600AK121683CCCGGCCCGGCCCGTTZinc finger, Tim10/DDP-type family protein. 
J065077E05CCCGGCCCGGCCCGTTNONE 
J075088M24CCCGGCCCGGCCCGTTNONE 
J075140B03CCCGGCCCGGCCCGTTNONE 
J090014B14CCCGGCCCGGCCCGTTNONE 
Os08g0542100AK058490GCCCGGCCCAGTARibosomal protein L7, eukaryotic form family protein. 
AK101416GCCCGGCCCAGTANONE 
J033037N08GCCCGGCCCAGTANONE 
J033086B16GCCCGGCCCAGTANONE 
J043036J02GCCCGGCCCAGTANONE 
J065137E02GCCCGGCCCAGTANONE 
J090015L07GCCCGGCCCAGTANONE 
J100036D02GCCCGGCCCAGTANONE 
Os08g0554000AK111661AGATGGGCCGGGCCGTAWD-40 repeat containing protein. 
AK112044AGATGGGCCGGGCCGTANONE 
J013039N12AGATGGGCCGGGCCGTANONE 
J013134D02AGATGGGCCGGGCCGTANONE 
J013153B06AGATGGGCCGGGCCGTANONE 
J033044L16AGATGGGCCGGGCCGTANONE 
J033073P14AGATGGGCCGGGCCGTANONE 
Os08g0562500AK109443GCCCGGCCTransferase family protein. 
Os08g0563200AK110263GGCCGGGCProtein of unknown function DUF296 domain containing protein. 
Os09g0115900009-055-E06AGTTGGGCCGGGCCNONE 
AK068597AGTTGGGCCGGGCCConserved hypothetical protein. 
J065136F11AGTTGGGCCGGGCCNONE 
J080023D14AGTTGGGCCGGGCCNONE 
Os09g0296400J090084M08CCCGGCCCGGCCCConserved hypothetical protein. 
J090084M08GCCCGGCCCAGCCConserved hypothetical protein. 
Os09g0329800AK069775GGGCCGGGCConserved hypothetical protein. 
Os09g0329900Os09g0329900GGGCCGGGCNONE 
Os09g0347900AK071224GGCCGGGCCCACCTGConserved hypothetical protein. 
J023087B12GGCCGGGCCCACCTGNONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0403000AK111051GGCCGGGCConserved hypothetical protein. 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0416400J075067A16GGCCCGGCCCATCAConserved hypothetical protein. 
J075104N21GGCCCGGCCCATCANONE 
J075106F04GGCCCGGCCCATCANONE 
J075131F08GGCCCGGCCCATCANONE 
Os09g0471900AK073815GCCCGGCCCAACTBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0480600AK107853GGCCGGGCHypothetical protein. 
Os09g0482660AK106911GGCCGGGCSimilar to Subtilisin-type protease. 
Os09g0486700011-018-H05GCCCGGCCCNONE 
012-065-H02GCCCGGCCCNONE 
015-043-C08GCCCGGCCCNONE 
AK105294GCCCGGCCCSimilar to P90 ribosomal S6 kinase. 
Os09g0487500AK108131GCCCGGCCCAATConserved hypothetical protein. 
J080062L16GCCCGGCCCAATNONE 
Os09g0511700AK101420ATTGGGCCGGGCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19ATTGGGCCGGGCNONE 
J013036D23ATTGGGCCGGGCNONE 
J013037F22ATTGGGCCGGGCNONE 
J013111M23ATTGGGCCGGGCNONE 
J023109F14ATTGGGCCGGGCNONE 
J023119H17ATTGGGCCGGGCNONE 
J023133H23ATTGGGCCGGGCNONE 
J033032G17ATTGGGCCGGGCNONE 
J033038B10ATTGGGCCGGGCNONE 
J033071M16ATTGGGCCGGGCNONE 
J033096G04ATTGGGCCGGGCNONE 
J033109D06ATTGGGCCGGGCNONE 
J043016E22ATTGGGCCGGGCNONE 
J043022O09ATTGGGCCGGGCNONE 
J100023N11ATTGGGCCGGGCNONE 
J100046I21ATTGGGCCGGGCNONE 
Os09g0516300AK065222GCCCGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0532900AJ311052GGCCGGGCNONE 
AJ311053GGCCGGGCNONE 
AK106039GGCCGGGCNONE 
AK111740GGCCGGGCMyb, DNA-binding domain containing protein. 
AK121023GGCCGGGCNONE 
Os09g0569400AK063384GCCCGGCCCATGTBeta-lactamase-like domain containing protein. 
AK070608GCCCGGCCCATGTNONE 
Os11g0106700006-055-F11GGCCGGGCCGGGCNONE 
006-099-D08GGCCGGGCCGGGCNONE 
009-155-A12GGCCGGGCCGGGCNONE 
AF519570GGCCGGGCCGGGCNONE 
AK059354GGCCGGGCCGGGCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0140400016-060-H04GGCCGGGCNONE 
Os11g0171700AK099115GGCCCGGCCCAACGGAACGSMAD/FHA domain containing protein. 
Os11g0181500006-025-C02GGCCCGGCCNONE 
AK060074GGCCCGGCCNONE 
AK067601GGCCCGGCCSimilar to Nitrogen fixation like protein. 
Os11g0219400AK069850GGCCGGGCTTGGGCCGTGAnkyrin repeat containing protein. 
AK099123GGCCGGGCTTGGGCCGTGNONE 
J023143G18GGCCGGGCTTGGGCCGTGNONE 
Os11g0276000AK108684CTTGGGCCGGGCNONE 
Os11g0482000006-056-D12CCCGGCCCGGCCCAACANONE 
006-102-C10CCCGGCCCGGCCCAACANONE 
009-005-E07CCCGGCCCGGCCCAACANONE 
014-088-D03CCCGGCCCGGCCCAACANONE 
AK059558CCCGGCCCGGCCCAACASimilar to 40S ribosomal protein S5-1. 
AK103918CCCGGCCCGGCCCAACANONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0544600AK064128CTCGGCCCGGCCCGGCCCGGCCConserved hypothetical protein. 
J075118L07CTCGGCCCGGCCCGGCCCGGCCNONE 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0557900009-196-H11AGTTGGGCCGGGCNONE 
AK063232AGTTGGGCCGGGCARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os11g0566800006-084-E06GCCCGGCCNONE 
AK061132GCCCGGCCSimilar to Bibenzyl synthase (EC 2.3.1.-). 
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein. 
Os11g0660000AK066709GGCCCGGCCCGTTSodium/calcium exchanger membrane region domain containing protein. 
J013074O18GGCCCGGCCCGTTNONE 
J023081H12GGCCCGGCCCGTTNONE 
J065072E24GGCCCGGCCCGTTNONE 
J065186K08GGCCCGGCCCGTTNONE 
J075079E19GGCCCGGCCCGTTNONE 
J075093J05GGCCCGGCCCGTTNONE 
J075124I21GGCCCGGCCCGTTNONE 
J075187F09GGCCCGGCCCGTTNONE 
J090037O16GGCCCGGCCCGTTNONE 
Os12g0106000AF370029GGCCGGGCCGGGCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571GGCCGGGCCGGGCNONE 
AK102242GGCCGGGCCGGGCNONE 
AY324879GGCCGGGCCGGGCNONE 
J053063M21GGCCGGGCCGGGCNONE 
J090080A16GGCCGGGCCGGGCNONE 
Os12g0188900012-030-C08GCCCGGCCCNONE 
J013027N23GCCCGGCCCConserved hypothetical protein. 
J013156K23GCCCGGCCCNONE 
J023134K02GCCCGGCCCNONE 
J033051M18GCCCGGCCCNONE 
J033143K05GCCCGGCCCNONE 
J080003C24GCCCGGCCCNONE 
J080004K05GCCCGGCCCNONE 
J080009D14GCCCGGCCCNONE 
J080014L12GCCCGGCCCNONE 
J080020E23GCCCGGCCCNONE 
J080021K20GCCCGGCCCNONE 
J080024B19GCCCGGCCCNONE 
J080024C12GCCCGGCCCNONE 
J080031K10GCCCGGCCCNONE 
J080034G09GCCCGGCCCNONE 
J080036C10GCCCGGCCCNONE 
J080037K18GCCCGGCCCNONE 
J080039J17GCCCGGCCCNONE 
J080040A20GCCCGGCCCNONE 
J080042B06GCCCGGCCCNONE 
J080046P07GCCCGGCCCNONE 
J080047G02GCCCGGCCCNONE 
J080049E12GCCCGGCCCNONE 
J080056N14GCCCGGCCCNONE 
J080059K10GCCCGGCCCNONE 
J080064F05GCCCGGCCCNONE 
J080064I04GCCCGGCCCNONE 
J080064K17GCCCGGCCCNONE 
J080069A15GCCCGGCCCNONE 
J080071E22GCCCGGCCCNONE 
J080071M24GCCCGGCCCNONE 
J080074C17GCCCGGCCCNONE 
J080075J07GCCCGGCCCNONE 
J080079F11GCCCGGCCCNONE 
J080083F15GCCCGGCCCNONE 
J080084N21GCCCGGCCCNONE 
J080086O03GCCCGGCCCNONE 
J080089K02GCCCGGCCCNONE 
J080092K22GCCCGGCCCNONE 
J080093P09GCCCGGCCCNONE 
J090001N04GCCCGGCCCNONE 
J090041M02GCCCGGCCCNONE 
Os12g0223300006-037-D03GGGCCCGGCCCATTNONE 
AJ429043GGGCCCGGCCCATTNONE 
AK060133GGGCCCGGCCCATTSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GGGCCCGGCCCATTNONE 
J065085K05GGGCCCGGCCCATTNONE 
J075053C01GGGCCCGGCCCATTNONE 
J075055O06GGGCCCGGCCCATTNONE 
J075073B01GGGCCCGGCCCATTNONE 
J075089M07GGGCCCGGCCCATTNONE 
J075095E16GGGCCCGGCCCATTNONE 
J075112O19GGGCCCGGCCCATTNONE 
J075143A11GGGCCCGGCCCATTNONE 
J075173D24GGGCCCGGCCCATTNONE 
J075199G18GGGCCCGGCCCATTNONE 
J090030N06GGGCCCGGCCCATTNONE 
J100052H12GGGCCCGGCCCATTNONE 
J100079F09GGGCCCGGCCCATTNONE 
Os12g0238900AK109804GGCCGGGCSimilar to HGA6. 
Os12g0488800015-085-F11GGCCCGGCCCGTGGGCCGTGGNONE 
AK064347GGCCCGGCCCGTGGGCCGTGGRNA polymerase II, RPB4 domain containing protein. 
J033065H11GGCCCGGCCCGTGGGCCGTGGNONE 
J033145P10GGCCCGGCCCGTGGGCCGTGGNONE 
J065137L04GGCCCGGCCCGTGGGCCGTGGNONE 
J065171P08GGCCCGGCCCGTGGGCCGTGGNONE 
Os12g0509300AK108497GCCCGGCCCAACConserved hypothetical protein. 
Os12g0533500AK068646TCGGCCCGGCCCGGCCCAGAConserved hypothetical protein. 
J013158L10TCGGCCCGGCCCGGCCCAGANONE 
J065083J02TCGGCCCGGCCCGGCCCAGANONE 
J075079D02TCGGCCCGGCCCGGCCCAGANONE 
J100037H16TCGGCCCGGCCCGGCCCAGANONE 
J100075P13TCGGCCCGGCCCGGCCCAGANONE 
Os12g0534700AK122037GCCCGGCCCAAGProtein kinase-like domain containing protein. 
J033112P03GCCCGGCCCAAGNONE 
J090022G02GCCCGGCCCAAGNONE 
J090066N06GCCCGGCCCAAGNONE 
J100064H18GCCCGGCCCAAGNONE 
J100074N21GCCCGGCCCAAGNONE 
J100081P16GCCCGGCCCAAGNONE 
Os12g0592200Os12g0592200GCCCGGCCCACGGCCCACTConserved hypothetical protein. 
Os12g0596000AK073530ATATGGGCCGGGCSimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B). 
AK101541ATATGGGCCGGGCNONE 
Os12g0599900AK101252TCTCGGCCCGGCCTetratricopeptide region domain containing protein. 
J033032F05TCTCGGCCCGGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.