version

Summary of OsREG615 (All List)

OrganismOryza sativa  
IDOsREG615  
SequenceGCCGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1651  

Entry Sequences (1651 entries)

LocusGene modelSequenceDescription
Os01g0134200AK102394AATTGGGCCGGCConserved hypothetical protein. 
Os01g0151600AK063435GCCGGCCCGCCACGTGTConserved hypothetical protein. 
J065010E12GCCGGCCCGCCACGTGTNONE 
J065067D06GCCGGCCCGCCACGTGTNONE 
J090043F21GCCGGCCCGCCACGTGTNONE 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0169800006-062-A02GGTGGGCCGGCNONE 
AK061054GGTGGGCCGGCAllinase, C-terminal domain containing protein. 
Os01g0173900AK121690GGGCCGGCSimilar to MRP-like ABC transporter. 
J033071F24GGGCCGGCNONE 
J043016E04GGGCCGGCNONE 
J043026D02GGGCCGGCNONE 
J065169H14GGGCCGGCNONE 
J100032P06GGGCCGGCNONE 
Os01g0231700012-002-F11GCCGGCCCAAGTAGGCCCAGCNONE 
013-082-F05GCCGGCCCAAGTAGGCCCAGCNONE 
AK107453GCCGGCCCAAGTAGGCCCAGCSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22GCCGGCCCAAGTAGGCCCAGCNONE 
J065023E21GCCGGCCCAAGTAGGCCCAGCNONE 
J065036H21GCCGGCCCAAGTAGGCCCAGCNONE 
J065037M24GCCGGCCCAAGTAGGCCCAGCNONE 
J065049L04GCCGGCCCAAGTAGGCCCAGCNONE 
J065072F17GCCGGCCCAAGTAGGCCCAGCNONE 
J065085H10GCCGGCCCAAGTAGGCCCAGCNONE 
J065109N19GCCGGCCCAAGTAGGCCCAGCNONE 
J065117M19GCCGGCCCAAGTAGGCCCAGCNONE 
J065144C15GCCGGCCCAAGTAGGCCCAGCNONE 
J065159G24GCCGGCCCAAGTAGGCCCAGCNONE 
J065164N14GCCGGCCCAAGTAGGCCCAGCNONE 
J075025K16GCCGGCCCAAGTAGGCCCAGCNONE 
J075057L05GCCGGCCCAAGTAGGCCCAGCNONE 
J075070I16GCCGGCCCAAGTAGGCCCAGCNONE 
J075089D10GCCGGCCCAAGTAGGCCCAGCNONE 
J075138F10GCCGGCCCAAGTAGGCCCAGCNONE 
J090018C11GCCGGCCCAAGTAGGCCCAGCNONE 
J100018L19GCCGGCCCAAGTAGGCCCAGCNONE 
J100024B14GCCGGCCCAAGTAGGCCCAGCNONE 
J100048L02GCCGGCCCAAGTAGGCCCAGCNONE 
J100055A22GCCGGCCCAAGTAGGCCCAGCNONE 
J100069K01GCCGGCCCAAGTAGGCCCAGCNONE 
Os01g0238500006-086-E04GCCCGGCCGGGCCGGCNONE 
AK067076GCCCGGCCGGGCCGGCSimilar to Branched-chain-amino-acid aminotransferase-like protein 3, chloroplast precursor. 
AK104302GCCCGGCCGGGCCGGCNONE 
J013093D15GCCCGGCCGGGCCGGCNONE 
J065038O05GCCCGGCCGGGCCGGCNONE 
J075089I20GCCCGGCCGGGCCGGCNONE 
J075122B01GCCCGGCCGGGCCGGCNONE 
J090086G20GCCCGGCCGGGCCGGCNONE 
Os01g0246100AK120732CAAGTGGGCCGGCProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0250900AK065179GGTCCACGGGCCGGCCCCACHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
J013002D15GGTCCACGGGCCGGCCCCACNONE 
J013037K03GGTCCACGGGCCGGCCCCACNONE 
J013091F03GGTCCACGGGCCGGCCCCACNONE 
J013127B14GGTCCACGGGCCGGCCCCACNONE 
Os01g0514300AK121086ATATGGGCCGGCLissencephaly type-1-like homology motif domain containing protein. 
Os01g0525000015-038-B04GCCGGCCCNONE 
AK064104GCCGGCCCConserved hypothetical protein. 
Os01g0530366J075001P06GCCGGCCCATATAACGGGCCNONE 
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein. 
J075030G13GCCGGCCCATATAACGGGCCNONE 
Os01g0592500AK111253GCCGGCCCAGCProtein of unknown function DUF1070 family protein. 
Os01g0743400AK059177CCGAGCCGGCCCSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK059177GGGCCGGGCCGGCSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114CCGAGCCGGCCCNONE 
AK069114GGGCCGGGCCGGCNONE 
J065070E07CCGAGCCGGCCCNONE 
J065070E07GGGCCGGGCCGGCNONE 
J065152G11CCGAGCCGGCCCNONE 
J065152G11GGGCCGGGCCGGCNONE 
Os01g0757400AB110177GCCGGCCCCACCAACNONE 
AK058626GCCGGCCCCACCAACNONE 
AK102585GCCGGCCCCACCAACNONE 
AK105474GCCGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
J033098E22GCCGGCCCCACCAACNONE 
J033105O19GCCGGCCCCACCAACNONE 
J065019C21GCCGGCCCCACCAACNONE 
J090082H11GCCGGCCCCACCAACNONE 
J100050B19GCCGGCCCCACCAACNONE 
J100078H19GCCGGCCCCACCAACNONE 
Os01g0766600AK061986GCCGGCCCNONE 
AK103570GCCGGCCCBSD domain containing protein. 
Os01g0767100AK109493TGATGGGCCGGCSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0784600AK067527GCCGGCCCConserved hypothetical protein. 
Os01g0801100AK102132CTGGGGCCGGCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
J013149O18CTGGGGCCGGCNONE 
J033031K07CTGGGGCCGGCNONE 
J033044A19CTGGGGCCGGCNONE 
J043040M23CTGGGGCCGGCNONE 
J065082D02CTGGGGCCGGCNONE 
Os01g0805800006-057-H04GCCGGCCCAAGNONE 
006-106-H01GCCGGCCCAAGNONE 
AK059963GCCGGCCCAAGNONE 
AK103408GCCGGCCCAAGRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0816700AK100654GCCGGCCCAGASimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0863166J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
Os01g0870100AK067564GCCGGCCCGCAProtein of unknown function DUF1012 family protein. 
AK072312GCCGGCCCGCANONE 
AK103428GCCGGCCCGCANONE 
Os01g0878400AK073884GCCGGCCCAmino acid/polyamine transporter II family protein. 
J065163K23GCCGGCCCNONE 
J065207H17GCCGGCCCNONE 
Os01g0888700AK073376ACTGGGCCGGCCCAATProtein of unknown function RIO1 family protein. 
J033030B16ACTGGGCCGGCCCAATNONE 
J033098D06ACTGGGCCGGCCCAATNONE 
J033112A12ACTGGGCCGGCCCAATNONE 
J043003L24ACTGGGCCGGCCCAATNONE 
Os01g0924000004-020-C09CCCACGTGCTGGGCCGGCNONE 
004-020-C09GTATGGGCCGGCCCNONE 
005-014-A06CCCACGTGCTGGGCCGGCNONE 
005-014-A06GTATGGGCCGGCCCNONE 
009-085-G12CCCACGTGCTGGGCCGGCNONE 
009-085-G12GTATGGGCCGGCCCNONE 
009-123-A08CCCACGTGCTGGGCCGGCNONE 
009-123-A08GTATGGGCCGGCCCNONE 
009-134-A05CCCACGTGCTGGGCCGGCNONE 
009-134-A05GTATGGGCCGGCCCNONE 
009-137-F06CCCACGTGCTGGGCCGGCNONE 
009-137-F06GTATGGGCCGGCCCNONE 
016-016-B08CCCACGTGCTGGGCCGGCNONE 
016-016-B08GTATGGGCCGGCCCNONE 
AF050674CCCACGTGCTGGGCCGGCNONE 
AF050674GTATGGGCCGGCCCNONE 
AK061690CCCACGTGCTGGGCCGGCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK061690GTATGGGCCGGCCCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797CCCACGTGCTGGGCCGGCNONE 
AK120797GTATGGGCCGGCCCNONE 
J013040A15CCCACGTGCTGGGCCGGCNONE 
J013040A15GTATGGGCCGGCCCNONE 
J013104L20CCCACGTGCTGGGCCGGCNONE 
J013104L20GTATGGGCCGGCCCNONE 
J013127E12CCCACGTGCTGGGCCGGCNONE 
J013127E12GTATGGGCCGGCCCNONE 
J013158O05CCCACGTGCTGGGCCGGCNONE 
J013158O05GTATGGGCCGGCCCNONE 
J023012E09CCCACGTGCTGGGCCGGCNONE 
J023012E09GTATGGGCCGGCCCNONE 
J023126L23CCCACGTGCTGGGCCGGCNONE 
J023126L23GTATGGGCCGGCCCNONE 
J023143B03CCCACGTGCTGGGCCGGCNONE 
J023143B03GTATGGGCCGGCCCNONE 
J065005B16CCCACGTGCTGGGCCGGCNONE 
J065005B16GTATGGGCCGGCCCNONE 
J065101J15CCCACGTGCTGGGCCGGCNONE 
J065101J15GTATGGGCCGGCCCNONE 
J065105K16CCCACGTGCTGGGCCGGCNONE 
J065105K16GTATGGGCCGGCCCNONE 
J065155K16CCCACGTGCTGGGCCGGCNONE 
J065155K16GTATGGGCCGGCCCNONE 
J065171M17CCCACGTGCTGGGCCGGCNONE 
J065171M17GTATGGGCCGGCCCNONE 
J065182F07CCCACGTGCTGGGCCGGCNONE 
J065182F07GTATGGGCCGGCCCNONE 
J065187D10CCCACGTGCTGGGCCGGCNONE 
J065187D10GTATGGGCCGGCCCNONE 
J065194I24CCCACGTGCTGGGCCGGCNONE 
J065194I24GTATGGGCCGGCCCNONE 
J065207E24CCCACGTGCTGGGCCGGCNONE 
J065207E24GTATGGGCCGGCCCNONE 
J075001C24CCCACGTGCTGGGCCGGCNONE 
J075001C24GTATGGGCCGGCCCNONE 
J075090O10CCCACGTGCTGGGCCGGCNONE 
J075090O10GTATGGGCCGGCCCNONE 
J075095H17CCCACGTGCTGGGCCGGCNONE 
J075095H17GTATGGGCCGGCCCNONE 
J075109M24CCCACGTGCTGGGCCGGCNONE 
J075109M24GTATGGGCCGGCCCNONE 
J075123C18CCCACGTGCTGGGCCGGCNONE 
J075123C18GTATGGGCCGGCCCNONE 
J075148G22CCCACGTGCTGGGCCGGCNONE 
J075148G22GTATGGGCCGGCCCNONE 
J090009B09CCCACGTGCTGGGCCGGCNONE 
J090009B09GTATGGGCCGGCCCNONE 
J090075K17CCCACGTGCTGGGCCGGCNONE 
J090075K17GTATGGGCCGGCCCNONE 
J090081H23CCCACGTGCTGGGCCGGCNONE 
J090081H23GTATGGGCCGGCCCNONE 
J090097H21CCCACGTGCTGGGCCGGCNONE 
J090097H21GTATGGGCCGGCCCNONE 
J100063P14CCCACGTGCTGGGCCGGCNONE 
J100063P14GTATGGGCCGGCCCNONE 
Os01g0959100009-163-G12ATCTGGGCCGGCNONE 
AK063053ATCTGGGCCGGCSimilar to Abscisic stress ripening protein 1. 
Os01g0976200006-044-A09ATCTGGGCCGGCNONE 
AK061022ATCTGGGCCGGC11-S plant seed storage protein family protein. 
J023012H20ATCTGGGCCGGCNONE 
J023025O07ATCTGGGCCGGCNONE 
J023082A14ATCTGGGCCGGCNONE 
J023115H15ATCTGGGCCGGCNONE 
J023133H14ATCTGGGCCGGCNONE 
J023133L21ATCTGGGCCGGCNONE 
J023136B16ATCTGGGCCGGCNONE 
J023145P17ATCTGGGCCGGCNONE 
J023146N03ATCTGGGCCGGCNONE 
Os02g0116900009-017-C02GCCGGCCCAATNONE 
AK121401GCCGGCCCAATSimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09GCCGGCCCAATNONE 
J023131N03GCCGGCCCAATNONE 
J033145N08GCCGGCCCAATNONE 
J065105G09GCCGGCCCAATNONE 
J075086L06GCCGGCCCAATNONE 
Os02g0135600AK069843GCCGGCCCAGTTAGGCCCACAConserved hypothetical protein. 
J023034H09GCCGGCCCAGTTAGGCCCACANONE 
J033090D08GCCGGCCCAGTTAGGCCCACANONE 
J100025N07GCCGGCCCAGTTAGGCCCACANONE 
J100075G18GCCGGCCCAGTTAGGCCCACANONE 
Os02g0135700AK100570TGTGGGCCTAACTGGGCCGGCDNA polymerase V family protein. 
Os02g0138600AK071778GGGCCGGCGGCCCAGAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023113L07GGGCCGGCGGCCCAGANONE 
Os02g0175100AB053473ACTGGGCCGGCSimilar to Transcriptional activator protein. 
AK069575ACTGGGCCGGCNONE 
J023025A18ACTGGGCCGGCNONE 
J065001E07ACTGGGCCGGCNONE 
J065171A13ACTGGGCCGGCNONE 
J065208N04ACTGGGCCGGCNONE 
J075098H14ACTGGGCCGGCNONE 
J090026G03ACTGGGCCGGCNONE 
J100031K15ACTGGGCCGGCNONE 
J100032K19ACTGGGCCGGCNONE 
J100041D18ACTGGGCCGGCNONE 
J100061K06ACTGGGCCGGCNONE 
Os02g0192700004-020-H12CCCGTGGGCCGGCNONE 
006-024-H06CCCGTGGGCCGGCNONE 
006-042-F06CCCGTGGGCCGGCNONE 
006-050-D04CCCGTGGGCCGGCNONE 
006-059-E10CCCGTGGGCCGGCNONE 
006-070-B02CCCGTGGGCCGGCNONE 
006-084-A09CCCGTGGGCCGGCNONE 
006-114-E11CCCGTGGGCCGGCNONE 
006-117-E05CCCGTGGGCCGGCNONE 
009-126-D11CCCGTGGGCCGGCNONE 
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase. 
AK065909CCCGTGGGCCGGCNONE 
J013043E11CCCGTGGGCCGGCNONE 
J065038I09CCCGTGGGCCGGCNONE 
J065078C12CCCGTGGGCCGGCNONE 
J065122O14CCCGTGGGCCGGCNONE 
J065198H04CCCGTGGGCCGGCNONE 
Os02g0205300006-050-H03ACATGGGCCGGCNONE 
011-057-B04ACATGGGCCGGCNONE 
AB033537ACATGGGCCGGCNONE 
AB052887ACATGGGCCGGCNONE 
AK061762ACATGGGCCGGCNONE 
AK102286ACATGGGCCGGCSimilar to TAT-binding protein homolog (Fragment). 
AK106217ACATGGGCCGGCNONE 
J013000E18ACATGGGCCGGCNONE 
J023030F11ACATGGGCCGGCNONE 
J033030E16ACATGGGCCGGCNONE 
J033061B21ACATGGGCCGGCNONE 
J033086D09ACATGGGCCGGCNONE 
J033089I16ACATGGGCCGGCNONE 
J033132G01ACATGGGCCGGCNONE 
J090003O15ACATGGGCCGGCNONE 
J090004A19ACATGGGCCGGCNONE 
J090054P05ACATGGGCCGGCNONE 
J090083M17ACATGGGCCGGCNONE 
J100039E08ACATGGGCCGGCNONE 
J100058D24ACATGGGCCGGCNONE 
J100066P09ACATGGGCCGGCNONE 
J100086K12ACATGGGCCGGCNONE 
J100088J15ACATGGGCCGGCNONE 
Os02g0326000006-099-D01GCCGGCCCAGCCNONE 
AK059937GCCGGCCCAGCCNONE 
AK102973GCCGGCCCAGCCConserved hypothetical protein. 
J033115K18GCCGGCCCAGCCNONE 
J075069J04GCCGGCCCAGCCNONE 
Os02g0445700011-046-C10GCCGGCCCNONE 
Os02g0462800AK110587GGCCGGGCCGGCWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923GGCCGGGCCGGCNONE 
Os02g0559300AK100088CAACGGCCGGCCCNONE 
AK121206CAACGGCCGGCCCProtein kinase-like domain containing protein. 
J023003H24CAACGGCCGGCCCNONE 
J023088A16CAACGGCCGGCCCNONE 
J023100K01CAACGGCCGGCCCNONE 
J023127H24CAACGGCCGGCCCNONE 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0593400016-051-C08CTTGGGCCGGCCCNONE 
AK064226CTTGGGCCGGCCCNONE 
AK072362CTTGGGCCGGCCCConserved hypothetical protein. 
AK109015CTTGGGCCGGCCCNONE 
J023063B12CTTGGGCCGGCCCNONE 
J065192M02CTTGGGCCGGCCCNONE 
J075182N05CTTGGGCCGGCCCNONE 
Os02g0602000AK103400GCCGGCCCRemorin, C-terminal region domain containing protein. 
Os02g0602300AK065609GCCCGGCCGGCCCACCTGNONE 
AK065609GCCGGCCCNONE 
AK065609GCCGGCCCACGTGNONE 
AK065609GCCGGCCCGGCNONE 
AK065609GGGCCGGCNONE 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCGGCCCSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCGGCCCGGCSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GGGCCGGCSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCCGGCCGGCCCACCTGNONE 
J013092L08GCCGGCCCNONE 
J013092L08GCCGGCCCACGTGNONE 
J013092L08GCCGGCCCGGCNONE 
J013092L08GGGCCGGCNONE 
J090040I23GCCCGGCCGGCCCACCTGNONE 
J090040I23GCCGGCCCNONE 
J090040I23GCCGGCCCACGTGNONE 
J090040I23GCCGGCCCGGCNONE 
J090040I23GGGCCGGCNONE 
Os02g0610700014-008-A03TTCGTGGGCCGGCNONE 
AK059205TTCGTGGGCCGGCConserved hypothetical protein. 
AK100281TTCGTGGGCCGGCNONE 
J023074H03TTCGTGGGCCGGCNONE 
J065002J16TTCGTGGGCCGGCNONE 
J065032I20TTCGTGGGCCGGCNONE 
J065076A07TTCGTGGGCCGGCNONE 
J065142O21TTCGTGGGCCGGCNONE 
J065203A03TTCGTGGGCCGGCNONE 
J075017F24TTCGTGGGCCGGCNONE 
J075017G24TTCGTGGGCCGGCNONE 
Os02g0612900AK071108GCCGGCCCSimilar to Temperature stress-induced lipocalin. 
J013045F10GCCGGCCCNONE 
J023078B21GCCGGCCCNONE 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
AK106681CTTGGGCTGCCGGCCCAGCConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
J065062G16CTTGGGCTGCCGGCCCAGCNONE 
Os02g0622400005-010-C04TAATGGGCCGGCCCATTTNONE 
AK061679TAATGGGCCGGCCCATTTConserved hypothetical protein. 
J013058H01TAATGGGCCGGCCCATTTNONE 
J013095D07TAATGGGCCGGCCCATTTNONE 
J023054G05TAATGGGCCGGCCCATTTNONE 
J023093A17TAATGGGCCGGCCCATTTNONE 
J023146P16TAATGGGCCGGCCCATTTNONE 
J033089D16TAATGGGCCGGCCCATTTNONE 
J033099G12TAATGGGCCGGCCCATTTNONE 
J033131N10TAATGGGCCGGCCCATTTNONE 
J053073J04TAATGGGCCGGCCCATTTNONE 
J053074P03TAATGGGCCGGCCCATTTNONE 
J053075M06TAATGGGCCGGCCCATTTNONE 
J053088K13TAATGGGCCGGCCCATTTNONE 
J090039F18TAATGGGCCGGCCCATTTNONE 
J090045M03TAATGGGCCGGCCCATTTNONE 
Os02g0630300AK108598GTCGCGCGCGCCGGCCCGGGCCNONE 
Os02g0632500AK101701GCCGGCCCAGCCArf GTPase activating protein family protein. 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0652800AK063448CCCGGGCCGGCMajor facilitator superfamily MFS_1 protein. 
Os02g0677300006-102-D12GCCGGCCCNONE 
AK060550GCCGGCCCNONE 
AK106041GCCGGCCCSimilar to CRT/DRE binding factor 1. 
Os02g0705100012-046-E01GCCGGCCCAGCCNONE 
AK063491GCCGGCCCAGCCEpoxide hydrolase family protein. 
J065184H07GCCGGCCCAGCCNONE 
Os02g0725300AK120054GCCGGCCCAGTNONE 
J013000L05GCCGGCCCAGTNONE 
J065194M19GCCGGCCCAGTNONE 
Os02g0771200011-006-B07GCCGGCCCATAANONE 
AK066823GCCGGCCCATAAConserved hypothetical protein. 
AK071059GCCGGCCCATAANONE 
J013075K03GCCGGCCCATAANONE 
Os02g0776800AB042415AGATGGGCCGGCCCACCCGNONE 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK101212AGATGGGCCGGCCCACCCGNONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
Os02g0780500AK072784GCTGGGCCGGCCCAACNONE 
AK072784GGCCGGGCCGGCNONE 
AK121143GCTGGGCCGGCCCAACConserved hypothetical protein. 
AK121143GGCCGGGCCGGCConserved hypothetical protein. 
J023075M13GCTGGGCCGGCCCAACNONE 
J023075M13GGCCGGGCCGGCNONE 
J023077P14GCTGGGCCGGCCCAACNONE 
J023077P14GGCCGGGCCGGCNONE 
J023123C16GCTGGGCCGGCCCAACNONE 
J023123C16GGCCGGGCCGGCNONE 
J023142P06GCTGGGCCGGCCCAACNONE 
J023142P06GGCCGGGCCGGCNONE 
Os02g0801900006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
Os02g0803200AK063404GCTGGGCCGGCCCACCSimilar to 30S ribosomal protein S15. 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os03g0100400AK068556TCTGGGCCGGCNONE 
AK121880TCTGGGCCGGCSimilar to DNA repair endonuclease UVH1 (EC 3.1.-.-) (Ultraviolet hypersensitive 1) (AtRAD1) (DNA excision repair protein XP-F homolog). 
Os03g0101800006-069-F11ACCGGGCCGGCNONE 
006-089-G08ACCGGGCCGGCNONE 
006-120-D03ACCGGGCCGGCNONE 
AK061092ACCGGGCCGGCNONE 
AK061186ACCGGGCCGGCProtein of unknown function Cys-rich family protein. 
AK103196ACCGGGCCGGCNONE 
AK104399ACCGGGCCGGCNONE 
J033090H19ACCGGGCCGGCNONE 
J033121P22ACCGGGCCGGCNONE 
J065096C01ACCGGGCCGGCNONE 
J065097C05ACCGGGCCGGCNONE 
J065134I12ACCGGGCCGGCNONE 
J075061L02ACCGGGCCGGCNONE 
J075076K08ACCGGGCCGGCNONE 
J075091K01ACCGGGCCGGCNONE 
J080302F08ACCGGGCCGGCNONE 
J080304F11ACCGGGCCGGCNONE 
J080306I01ACCGGGCCGGCNONE 
J080307F02ACCGGGCCGGCNONE 
J080309G06ACCGGGCCGGCNONE 
J080313P12ACCGGGCCGGCNONE 
J080317C19ACCGGGCCGGCNONE 
J090036F13ACCGGGCCGGCNONE 
J090097P16ACCGGGCCGGCNONE 
J100025K18ACCGGGCCGGCNONE 
J100060J21ACCGGGCCGGCNONE 
Os03g0113700AK103835CCTGGGCCGGCCCAAAASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925TTTTGGGCCGGCCCAGGProtein prenyltransferase domain containing protein. 
J013047E20TTTTGGGCCGGCCCAGGNONE 
J065026F21TTTTGGGCCGGCCCAGGNONE 
J065047B03TTTTGGGCCGGCCCAGGNONE 
J065054J12TTTTGGGCCGGCCCAGGNONE 
J065079M24TTTTGGGCCGGCCCAGGNONE 
J065093M07TTTTGGGCCGGCCCAGGNONE 
J065153F02TTTTGGGCCGGCCCAGGNONE 
J065155E21TTTTGGGCCGGCCCAGGNONE 
J065179H15TTTTGGGCCGGCCCAGGNONE 
J075019N02TTTTGGGCCGGCCCAGGNONE 
J075089E01TTTTGGGCCGGCCCAGGNONE 
J090066I18TTTTGGGCCGGCCCAGGNONE 
J090087K20TTTTGGGCCGGCCCAGGNONE 
J100079F05TTTTGGGCCGGCCCAGGNONE 
Os03g0116500AF106844GCCGGCCCAATANONE 
AK101870GCCGGCCCAATAConstitutive photomorphogenic 11. 
J023055L16GCCGGCCCAATANONE 
J023088I16GCCGGCCCAATANONE 
J033070E21GCCGGCCCAATANONE 
J065124N22GCCGGCCCAATANONE 
J075152A19GCCGGCCCAATANONE 
J075181J21GCCGGCCCAATANONE 
J090011F23GCCGGCCCAATANONE 
Os03g0146400AK111974GCCGGCCCSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554GCCGGCCCNONE 
J075060J10GCCGGCCCNONE 
Os03g0172200AK069130AATTGGGCCGGCArmadillo-like helical domain containing protein. 
Os03g0172700AK111307GCCGGCCCACTHypothetical protein. 
Os03g0182600006-028-E05CTTGGGCCGGCCCATGNONE 
006-047-F10CTTGGGCCGGCCCATGNONE 
009-123-C08CTTGGGCCGGCCCATGNONE 
016-033-G05CTTGGGCCGGCCCATGNONE 
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein. 
AK066899CTTGGGCCGGCCCATGNONE 
J013065H05CTTGGGCCGGCCCATGNONE 
J023012F15CTTGGGCCGGCCCATGNONE 
J023065M10CTTGGGCCGGCCCATGNONE 
J033079N15CTTGGGCCGGCCCATGNONE 
J033109E21CTTGGGCCGGCCCATGNONE 
J033148M14CTTGGGCCGGCCCATGNONE 
J043015G23CTTGGGCCGGCCCATGNONE 
J043022M01CTTGGGCCGGCCCATGNONE 
J053060D01CTTGGGCCGGCCCATGNONE 
J053062E24CTTGGGCCGGCCCATGNONE 
J053096N12CTTGGGCCGGCCCATGNONE 
J053098N02CTTGGGCCGGCCCATGNONE 
J090024N09CTTGGGCCGGCCCATGNONE 
J090027G22CTTGGGCCGGCCCATGNONE 
J090043C10CTTGGGCCGGCCCATGNONE 
J090063F05CTTGGGCCGGCCCATGNONE 
J090066J05CTTGGGCCGGCCCATGNONE 
J090073I17CTTGGGCCGGCCCATGNONE 
J090087L04CTTGGGCCGGCCCATGNONE 
J100075O12CTTGGGCCGGCCCATGNONE 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0204900009-041-G04GCCGGCCCAATANONE 
AK062601GCCGGCCCAATASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0232800AK060669GCCGGCCCNONE 
AK072207GCCGGCCCLecithin:cholesterol acyltransferase family protein. 
AK121004GCCGGCCCNONE 
Os03g0255000AK101625GCCGGCCCFAR1 domain containing protein. 
J033052M07GCCGGCCCNONE 
Os03g0271500AK068546TATGGGCCGGCNONE 
AK109239TATGGGCCGGCConserved hypothetical protein. 
J013157P04TATGGGCCGGCNONE 
J075041K23TATGGGCCGGCNONE 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0278200AK103544CGCGGGGGCCGGCNAD-dependent epimerase/dehydratase family protein. 
Os03g0312600AK073391CTTGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
AK073391TGATGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0321900AK073317GGGACCCGGCCGGCCCCMP/dCMP deaminase, zinc-binding domain containing protein. 
Os03g0326600AK107632AGTGGGCCGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0333300015-069-B02TGTGGGCCGGCNONE 
AK063858TGTGGGCCGGCNONE 
AK073228TGTGGGCCGGCSimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
Os03g0353400006-092-E01GCCGGCCCGGCNONE 
006-120-A08GCCGGCCCGGCNONE 
009-098-A01GCCGGCCCGGCNONE 
009-139-G01GCCGGCCCGGCNONE 
013-041-E01GCCGGCCCGGCNONE 
013-068-C06GCCGGCCCGGCNONE 
014-014-G01GCCGGCCCGGCNONE 
014-088-E11GCCGGCCCGGCNONE 
AB110172GCCGGCCCGGCNONE 
AK062176GCCGGCCCGGCSimilar to Poly(A)-binding protein C-terminal interacting protein 6. 
AK068753GCCGGCCCGGCNONE 
AY656247GCCGGCCCGGCNONE 
J013049N20GCCGGCCCGGCNONE 
J013072F18GCCGGCCCGGCNONE 
J013089L05GCCGGCCCGGCNONE 
J013099L20GCCGGCCCGGCNONE 
J013131G13GCCGGCCCGGCNONE 
J013157B15GCCGGCCCGGCNONE 
J013158E09GCCGGCCCGGCNONE 
J023013I18GCCGGCCCGGCNONE 
J023019G19GCCGGCCCGGCNONE 
J023027C18GCCGGCCCGGCNONE 
J023052J24GCCGGCCCGGCNONE 
J023080N08GCCGGCCCGGCNONE 
J033043F21GCCGGCCCGGCNONE 
J033044C08GCCGGCCCGGCNONE 
J033086N04GCCGGCCCGGCNONE 
J065041E07GCCGGCCCGGCNONE 
J065067N17GCCGGCCCGGCNONE 
J065082H19GCCGGCCCGGCNONE 
J065104D20GCCGGCCCGGCNONE 
J065105P09GCCGGCCCGGCNONE 
J065114D01GCCGGCCCGGCNONE 
J065119D15GCCGGCCCGGCNONE 
J065134G02GCCGGCCCGGCNONE 
J065143D06GCCGGCCCGGCNONE 
J065170G14GCCGGCCCGGCNONE 
J065178K06GCCGGCCCGGCNONE 
J065208P11GCCGGCCCGGCNONE 
J075004A10GCCGGCCCGGCNONE 
J075034E12GCCGGCCCGGCNONE 
J075035P22GCCGGCCCGGCNONE 
J075065O16GCCGGCCCGGCNONE 
J075070M03GCCGGCCCGGCNONE 
J075115B03GCCGGCCCGGCNONE 
J075190B04GCCGGCCCGGCNONE 
J080002C13GCCGGCCCGGCNONE 
J080010I08GCCGGCCCGGCNONE 
J080017L24GCCGGCCCGGCNONE 
J080023D11GCCGGCCCGGCNONE 
J080025A02GCCGGCCCGGCNONE 
J080025N09GCCGGCCCGGCNONE 
J080035D22GCCGGCCCGGCNONE 
J080038L13GCCGGCCCGGCNONE 
J080042F06GCCGGCCCGGCNONE 
J080043H05GCCGGCCCGGCNONE 
J080048K17GCCGGCCCGGCNONE 
J080053M20GCCGGCCCGGCNONE 
J080056I23GCCGGCCCGGCNONE 
J080057J06GCCGGCCCGGCNONE 
J080058C18GCCGGCCCGGCNONE 
J080062I15GCCGGCCCGGCNONE 
J080080E19GCCGGCCCGGCNONE 
J080096K12GCCGGCCCGGCNONE 
J090004M12GCCGGCCCGGCNONE 
J090055H05GCCGGCCCGGCNONE 
J090062J17GCCGGCCCGGCNONE 
J100044K10GCCGGCCCGGCNONE 
J100047I15GCCGGCCCGGCNONE 
J100047K03GCCGGCCCGGCNONE 
J100058I20GCCGGCCCGGCNONE 
J100067P14GCCGGCCCGGCNONE 
J100074F02GCCGGCCCGGCNONE 
Os03g0381200006-111-A09GGGCCGGCNONE 
AK061302GGGCCGGCSimilar to Capping protein beta 3 subunit (Fragment). 
AK104161GGGCCGGCNONE 
J043003O05GGGCCGGCNONE 
J043016M13GGGCCGGCNONE 
Os03g0428800AK060233GGGCCGGCTetratricopeptide-like helical domain containing protein. 
Os03g0570300AK069396GGGCCGGCCCTranslation protein SH3-like domain containing protein. 
J013036G06GGGCCGGCCCNONE 
J023014K13GGGCCGGCCCNONE 
Os03g0572900AK102204CTGGGGCCGGCMulti antimicrobial extrusion protein MatE family protein. 
Os03g0681900006-042-F08GGGCCGGCCCACGANONE 
009-043-F12GGGCCGGCCCACGANONE 
AK061750GGGCCGGCCCACGANONE 
AK062094GGGCCGGCCCACGASimilar to RGP-3 (Fragment). 
J033034F01GGGCCGGCCCACGANONE 
J033131F11GGGCCGGCCCACGANONE 
J033143N03GGGCCGGCCCACGANONE 
Os03g0734700AK072060GCTGGGCCGGCMitochondrial substrate carrier family protein. 
AK120533GCTGGGCCGGCNONE 
J043026E20GCTGGGCCGGCNONE 
Os03g0744700AK071178CGATGGGCCGGCConserved hypothetical protein. 
J075006D24CGATGGGCCGGCNONE 
J075165F21CGATGGGCCGGCNONE 
Os03g0752800AB041020GGGGCCCGGGCCGGCNONE 
AF058697GGGGCCCGGGCCGGCMADS14 protein. 
AF139664GGGGCCCGGGCCGGCNONE 
AK121171GGGGCCCGGGCCGGCNONE 
AY332478GGGGCCCGGGCCGGCNONE 
AY551916GGGGCCCGGGCCGGCNONE 
J023081C04GGGGCCCGGGCCGGCNONE 
Os03g0758800AJ252135CGGGCCGAGCCGAATGGGCCGGCNONE 
AJ312906CGGGCCGAGCCGAATGGGCCGGCNONE 
AK060387CGGGCCGAGCCGAATGGGCCGGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592CGGGCCGAGCCGAATGGGCCGGCNONE 
J023109G09CGGGCCGAGCCGAATGGGCCGGCNONE 
J033038B14CGGGCCGAGCCGAATGGGCCGGCNONE 
J043013C09CGGGCCGAGCCGAATGGGCCGGCNONE 
J053096E21CGGGCCGAGCCGAATGGGCCGGCNONE 
J065026B08CGGGCCGAGCCGAATGGGCCGGCNONE 
J065062B16CGGGCCGAGCCGAATGGGCCGGCNONE 
J065066E03CGGGCCGAGCCGAATGGGCCGGCNONE 
J065091J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J065164A06CGGGCCGAGCCGAATGGGCCGGCNONE 
J075014I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J075117N07CGGGCCGAGCCGAATGGGCCGGCNONE 
J075142M03CGGGCCGAGCCGAATGGGCCGGCNONE 
J075175D04CGGGCCGAGCCGAATGGGCCGGCNONE 
J075188M01CGGGCCGAGCCGAATGGGCCGGCNONE 
J075199I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J090010J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J090025O16CGGGCCGAGCCGAATGGGCCGGCNONE 
J090041H05CGGGCCGAGCCGAATGGGCCGGCNONE 
J090078P07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100031K10CGGGCCGAGCCGAATGGGCCGGCNONE 
J100055F23CGGGCCGAGCCGAATGGGCCGGCNONE 
J100064G05CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080C24CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080O07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100090F01CGGGCCGAGCCGAATGGGCCGGCNONE 
Os03g0776400015-009-D03GCCGGGCCGGCNONE 
AK106237GCCGGGCCGGCConserved hypothetical protein. 
J100024C12GCCGGGCCGGCNONE 
J100083J23GCCGGGCCGGCNONE 
Os03g0807200011-031-F07GGGCCGGGCCGGCNONE 
AK063932GGGCCGGGCCGGCNONE 
AK103496GGGCCGGGCCGGCProtein of unknown function DUF1639 family protein. 
J033131A04GGGCCGGGCCGGCNONE 
J065109O03GGGCCGGGCCGGCNONE 
J080001M11GGGCCGGGCCGGCNONE 
J080002H18GGGCCGGGCCGGCNONE 
J080005I08GGGCCGGGCCGGCNONE 
J080006B05GGGCCGGGCCGGCNONE 
J080006D17GGGCCGGGCCGGCNONE 
J080007M19GGGCCGGGCCGGCNONE 
J080011E07GGGCCGGGCCGGCNONE 
J080012H06GGGCCGGGCCGGCNONE 
J080014D08GGGCCGGGCCGGCNONE 
J080017D06GGGCCGGGCCGGCNONE 
J080017K17GGGCCGGGCCGGCNONE 
J080020B17GGGCCGGGCCGGCNONE 
J080021O05GGGCCGGGCCGGCNONE 
J080021O15GGGCCGGGCCGGCNONE 
J080023I18GGGCCGGGCCGGCNONE 
J080025A21GGGCCGGGCCGGCNONE 
J080027P22GGGCCGGGCCGGCNONE 
J080028M22GGGCCGGGCCGGCNONE 
J080029B09GGGCCGGGCCGGCNONE 
J080029M07GGGCCGGGCCGGCNONE 
J080029M17GGGCCGGGCCGGCNONE 
J080030H23GGGCCGGGCCGGCNONE 
J080030K16GGGCCGGGCCGGCNONE 
J080030L19GGGCCGGGCCGGCNONE 
J080031A12GGGCCGGGCCGGCNONE 
J080031N21GGGCCGGGCCGGCNONE 
J080032G05GGGCCGGGCCGGCNONE 
J080032P20GGGCCGGGCCGGCNONE 
J080033H20GGGCCGGGCCGGCNONE 
J080034H22GGGCCGGGCCGGCNONE 
J080034J03GGGCCGGGCCGGCNONE 
J080034J16GGGCCGGGCCGGCNONE 
J080034N01GGGCCGGGCCGGCNONE 
J080035K20GGGCCGGGCCGGCNONE 
J080036I04GGGCCGGGCCGGCNONE 
J080036I19GGGCCGGGCCGGCNONE 
J080036O21GGGCCGGGCCGGCNONE 
J080038D06GGGCCGGGCCGGCNONE 
J080039J15GGGCCGGGCCGGCNONE 
J080039P18GGGCCGGGCCGGCNONE 
J080041H20GGGCCGGGCCGGCNONE 
J080041M11GGGCCGGGCCGGCNONE 
J080042F14GGGCCGGGCCGGCNONE 
J080043G10GGGCCGGGCCGGCNONE 
J080043J02GGGCCGGGCCGGCNONE 
J080044C19GGGCCGGGCCGGCNONE 
J080044G11GGGCCGGGCCGGCNONE 
J080045M03GGGCCGGGCCGGCNONE 
J080045N07GGGCCGGGCCGGCNONE 
J080047K14GGGCCGGGCCGGCNONE 
J080049I21GGGCCGGGCCGGCNONE 
J080050A06GGGCCGGGCCGGCNONE 
J080050I16GGGCCGGGCCGGCNONE 
J080050N16GGGCCGGGCCGGCNONE 
J080052C23GGGCCGGGCCGGCNONE 
J080052D18GGGCCGGGCCGGCNONE 
J080052F20GGGCCGGGCCGGCNONE 
J080052F23GGGCCGGGCCGGCNONE 
J080053M03GGGCCGGGCCGGCNONE 
J080054G13GGGCCGGGCCGGCNONE 
J080054H12GGGCCGGGCCGGCNONE 
J080055N03GGGCCGGGCCGGCNONE 
J080056E07GGGCCGGGCCGGCNONE 
J080057L04GGGCCGGGCCGGCNONE 
J080063O19GGGCCGGGCCGGCNONE 
J080064E21GGGCCGGGCCGGCNONE 
J080065D18GGGCCGGGCCGGCNONE 
J080065F18GGGCCGGGCCGGCNONE 
J080065H14GGGCCGGGCCGGCNONE 
J080065K15GGGCCGGGCCGGCNONE 
J080065M24GGGCCGGGCCGGCNONE 
J080066B18GGGCCGGGCCGGCNONE 
J080066B19GGGCCGGGCCGGCNONE 
J080071H19GGGCCGGGCCGGCNONE 
J080072E18GGGCCGGGCCGGCNONE 
J080074K21GGGCCGGGCCGGCNONE 
J080075B06GGGCCGGGCCGGCNONE 
J080076H07GGGCCGGGCCGGCNONE 
J080079D16GGGCCGGGCCGGCNONE 
J080082B20GGGCCGGGCCGGCNONE 
J080084N16GGGCCGGGCCGGCNONE 
J080085L07GGGCCGGGCCGGCNONE 
J080086L04GGGCCGGGCCGGCNONE 
J080086M07GGGCCGGGCCGGCNONE 
J080087D02GGGCCGGGCCGGCNONE 
J080087D15GGGCCGGGCCGGCNONE 
J080087J19GGGCCGGGCCGGCNONE 
J080088G20GGGCCGGGCCGGCNONE 
J080092M15GGGCCGGGCCGGCNONE 
J080093O10GGGCCGGGCCGGCNONE 
J080095L09GGGCCGGGCCGGCNONE 
J080096A18GGGCCGGGCCGGCNONE 
J080097C03GGGCCGGGCCGGCNONE 
J090019J07GGGCCGGGCCGGCNONE 
J090024N12GGGCCGGGCCGGCNONE 
J090049I09GGGCCGGGCCGGCNONE 
Os03g0820400009-042-F06GCCGGCCCAAGNONE 
009-046-E08GCCGGCCCAAGNONE 
009-079-B08GCCGGCCCAAGNONE 
009-111-H09GCCGGCCCAAGNONE 
009-150-D10GCCGGCCCAAGNONE 
015-073-H11GCCGGCCCAAGNONE 
AK119690GCCGGCCCAAGSimilar to ZPT2-13. 
AY286473GCCGGCCCAAGNONE 
AY305864GCCGGCCCAAGNONE 
J100051O21GCCGGCCCAAGNONE 
Os03g0822100AK101094GGGCCGGCCCATATSimilar to Transposase (Fragment). 
J033024N05GGGCCGGCCCATATNONE 
Os03g0848300AK059137TCTGGGCCGGCNONE 
J065110J17TCTGGGCCGGCNONE 
Os03g0851000006-098-C01TTTGGGCCGGCNONE 
AK060496TTTGGGCCGGCSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTTGGGCCGGCNONE 
AK104157TTTGGGCCGGCNONE 
J033087F19TTTGGGCCGGCNONE 
J065087I16TTTGGGCCGGCNONE 
J065113G04TTTGGGCCGGCNONE 
J090026M02TTTGGGCCGGCNONE 
J090027I04TTTGGGCCGGCNONE 
J100073E19TTTGGGCCGGCNONE 
Os03g0854800J090007D13GCCGGCCCACGGGNONE 
J090085N22GCCGGCCCACGGGNONE 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
J013051M12CAAGTGGGCCGGCCCACCTNONE 
J013104N13CAAGTGGGCCGGCCCACCTNONE 
J065052E12CAAGTGGGCCGGCCCACCTNONE 
Os03g0861800AF358762AGGTGGGCCGGCCCACTTGNONE 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK109388AGGTGGGCCGGCCCACTTGNONE 
J013154L15AGGTGGGCCGGCCCACTTGNONE 
J013170I23AGGTGGGCCGGCCCACTTGNONE 
J023031D05AGGTGGGCCGGCCCACTTGNONE 
J023082E07AGGTGGGCCGGCCCACTTGNONE 
J023095M10AGGTGGGCCGGCCCACTTGNONE 
J023127D14AGGTGGGCCGGCCCACTTGNONE 
J023138M15AGGTGGGCCGGCCCACTTGNONE 
J023138M16AGGTGGGCCGGCCCACTTGNONE 
J033060B18AGGTGGGCCGGCCCACTTGNONE 
J033060F13AGGTGGGCCGGCCCACTTGNONE 
J033096J11AGGTGGGCCGGCCCACTTGNONE 
J033122C07AGGTGGGCCGGCCCACTTGNONE 
J053029A10AGGTGGGCCGGCCCACTTGNONE 
J053062O16AGGTGGGCCGGCCCACTTGNONE 
J053064J08AGGTGGGCCGGCCCACTTGNONE 
J053086F22AGGTGGGCCGGCCCACTTGNONE 
J065036C04AGGTGGGCCGGCCCACTTGNONE 
J065072J23AGGTGGGCCGGCCCACTTGNONE 
J065120D04AGGTGGGCCGGCCCACTTGNONE 
J065161D04AGGTGGGCCGGCCCACTTGNONE 
J065172H02AGGTGGGCCGGCCCACTTGNONE 
J065207B01AGGTGGGCCGGCCCACTTGNONE 
J075019H18AGGTGGGCCGGCCCACTTGNONE 
J075082E16AGGTGGGCCGGCCCACTTGNONE 
J075089A10AGGTGGGCCGGCCCACTTGNONE 
J075099G02AGGTGGGCCGGCCCACTTGNONE 
J075134M04AGGTGGGCCGGCCCACTTGNONE 
J075144K19AGGTGGGCCGGCCCACTTGNONE 
J075147F17AGGTGGGCCGGCCCACTTGNONE 
J090004O14AGGTGGGCCGGCCCACTTGNONE 
J090013A07AGGTGGGCCGGCCCACTTGNONE 
J090047K14AGGTGGGCCGGCCCACTTGNONE 
Os04g0105700004-005-E05AATGGGCCGGCNONE 
006-037-C11AATGGGCCGGCNONE 
006-039-E07AATGGGCCGGCNONE 
006-049-A02AATGGGCCGGCNONE 
006-076-D05AATGGGCCGGCNONE 
006-089-E04AATGGGCCGGCNONE 
006-097-F12AATGGGCCGGCNONE 
AK060872AATGGGCCGGCNONE 
AK065082AATGGGCCGGCNONE 
AK104254AATGGGCCGGCConserved hypothetical protein. 
AK104546AATGGGCCGGCNONE 
AK104634AATGGGCCGGCNONE 
AY224557AATGGGCCGGCNONE 
J013001L09AATGGGCCGGCNONE 
J013151B18AATGGGCCGGCNONE 
J023054G18AATGGGCCGGCNONE 
Os04g0195100AK107201GGGCCGGCCyclin-like F-box domain containing protein. 
Os04g0208400AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein. 
AK069629GCCGGCCCGGCACGGCCCAGCCyclin-like F-box domain containing protein. 
AK069629TGGGCCGGCCyclin-like F-box domain containing protein. 
Os04g0372700009-110-D07GCCGGCCCNONE 
AK062814GCCGGCCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065021E21GCCGGCCCNONE 
J065099E23GCCGGCCCNONE 
J065120F10GCCGGCCCNONE 
J065165P14GCCGGCCCNONE 
J065208L18GCCGGCCCNONE 
Os04g0440100AK101324ATTGGGCCGGCNONE 
AK105415ATTGGGCCGGCNonsense-mediated decay UPF3 domain containing protein. 
Os04g0459600006-039-H09GCCGGCCCNONE 
AK061516GCCGGCCCRan-interacting Mog1 protein family protein. 
J065112J03GCCGGCCCNONE 
Os04g0491500AK068089TCCGGGCCGGCNONE 
AK101116TCCGGGCCGGCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0503100AK105505GCCGGCCCSimilar to Calcium-dependent protein kinase, isoform 11 (EC 2.7.1.-) (CDPK 11). 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
Os04g0526800006-051-F03GCCGGCCCGGTNONE 
AK061581GCCGGCCCGGTGRAM domain containing protein. 
J065188M01GCCGGCCCGGTNONE 
J100043J05GCCGGCCCGGTNONE 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0528300AK058387GGGCCGGCCCNONE 
Os04g0567200AK110383GCCGGCCCProtein of unknown function UPF0005 family protein. 
Os04g0570600AK106747GCCGGCCCATCCCytochrome P450 family protein. 
J080319G08GCCGGCCCATCCNONE 
Os04g0581000AK061337GGGCCGGCSimilar to Flavanone 3-hydroxylase-like protein. 
AK061337TGATGGGCCGGCSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142GGGCCGGCNONE 
AK104142TGATGGGCCGGCNONE 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0650200AK072573GCCGGCCCNONE 
AK109786GCCGGCCCLipolytic enzyme, G-D-S-L family protein. 
Os04g0658600AK064729TGTGGGCCGGCNONE 
AK119253TGTGGGCCGGCNucleolar, Nop52 family protein. 
J075132J07TGTGGGCCGGCNONE 
J075157N21TGTGGGCCGGCNONE 
Os04g0659400AK070174GGCTGGGCCGGCENT domain containing protein. 
Os04g0682800AK121846GCCGGCCCATTSodium/hydrogen exchanger family protein. 
Os04g0690600011-007-D04GCCGGCCCGGTNONE 
AK109449GCCGGCCCGGTConserved hypothetical protein. 
J065019H13GCCGGCCCGGTNONE 
J065021N08GCCGGCCCGGTNONE 
J065085C08GCCGGCCCGGTNONE 
J065214O07GCCGGCCCGGTNONE 
Os05g0128100009-051-B07CTTGGGCCGCCGGCCCATCTNONE 
009-127-B08CTTGGGCCGCCGGCCCATCTNONE 
009-144-H03CTTGGGCCGCCGGCCCATCTNONE 
009-176-B05CTTGGGCCGCCGGCCCATCTNONE 
AK108556CTTGGGCCGCCGGCCCATCTNONE 
AK119308CTTGGGCCGCCGGCCCATCTNONE 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
J023036J15CTTGGGCCGCCGGCCCATCTNONE 
J065122L01CTTGGGCCGCCGGCCCATCTNONE 
J075104P10CTTGGGCCGCCGGCCCATCTNONE 
Os05g0156200AK071622GCCGGCCCAATTConserved hypothetical protein. 
J023099E19GCCGGCCCAATTNONE 
J090025C09GCCGGCCCAATTNONE 
J090071K23GCCGGCCCAATTNONE 
Os05g0161200AB042936CTGGCCCAGGGCCGGCCCNONE 
AK121808CTGGCCCAGGGCCGGCCCDNA polymerase III clamp loader subunit, C-terminal domain containing protein. 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0350600AK066244CCCGGGCCGGCSimilar to Atranbp1b protein. 
J075100E12CCCGGGCCGGCNONE 
J090024D03CCCGGGCCGGCNONE 
J100027C02CCCGGGCCGGCNONE 
J100053P05CCCGGGCCGGCNONE 
J100055P22CCCGGGCCGGCNONE 
Os05g0381700AK068838GCCGGCCCCalmodulin-binding, plant family protein. 
J013160I23GCCGGCCCNONE 
Os05g0383100AK121835CCATGGGCCGGCCCATTClathrin adaptor complex, medium chain family protein. 
Os05g0393800AK069074GCCGGCCCProtein of unknown function DUF221 domain containing protein. 
Os05g0412800AF402803GCCCGGCCGGCCCAAATSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0424700AK107848GCCGGCCCAGCSimilar to Copper transporter 1. 
Os05g0456000AK058420GCCGGCCCMitochondrial glycoprotein family protein. 
AK102036GCCGGCCCNONE 
J065066F02GCCGGCCCNONE 
Os05g0480700AK100850AGTGGGCCGGCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AGTGGGCCGGCNONE 
Os05g0503000AK068335GCCGGCCCACACSimilar to Secretory carrier membrane protein. 
AK104049GCCGGCCCACACNONE 
J013149D04GCCGGCCCACACNONE 
J075085A06GCCGGCCCACACNONE 
Os05g0540800AK060731AGTTGGGCCGGCCCAATANONE 
AK071090AGTTGGGCCGGCCCAATAHomeodomain-like containing protein. 
J013095F03AGTTGGGCCGGCCCAATANONE 
J023079C11AGTTGGGCCGGCCCAATANONE 
J033080E08AGTTGGGCCGGCCCAATANONE 
Os05g0542300009-050-C12ATTTGGGCCGGCNONE 
009-185-D06ATTTGGGCCGGCNONE 
AK062488ATTTGGGCCGGCConserved hypothetical protein. 
Os05g0548100AK060333CGGGCCGTGCCGGCCCConserved hypothetical protein. 
AK060333GCCGGCCCConserved hypothetical protein. 
AK100682CGGGCCGTGCCGGCCCNONE 
AK100682GCCGGCCCNONE 
J013151E01CGGGCCGTGCCGGCCCNONE 
J013151E01GCCGGCCCNONE 
J023113L22CGGGCCGTGCCGGCCCNONE 
J023113L22GCCGGCCCNONE 
J043027A19CGGGCCGTGCCGGCCCNONE 
J043027A19GCCGGCCCNONE 
J075093E06CGGGCCGTGCCGGCCCNONE 
J075093E06GCCGGCCCNONE 
J090060D15CGGGCCGTGCCGGCCCNONE 
J090060D15GCCGGCCCNONE 
J090082J03CGGGCCGTGCCGGCCCNONE 
J090082J03GCCGGCCCNONE 
J100050E01CGGGCCGTGCCGGCCCNONE 
J100050E01GCCGGCCCNONE 
Os05g0567300013-039-F11TATTGGGCCGGCCCAAGNONE 
AK112068TATTGGGCCGGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0594800AK058332CCCGGGCCGGCAdhesion regulating molecule family protein. 
AK068013CCCGGGCCGGCNONE 
J013129L24CCCGGGCCGGCNONE 
Os06g0106100009-197-E09TGTGGGCCGGCNONE 
AK111784TGTGGGCCGGCCwf15/Cwc15 cell cycle control protein family protein. 
AK112060TGTGGGCCGGCNONE 
Os06g0111800AK102134GCCGGCCCAGTNONE 
AK105393GCCGGCCCAGTSimilar to CSLD2 (Fragment). 
Os06g0139700006-052-C07GCCGGCCCNONE 
009-009-A08GCCGGCCCNONE 
015-020-D09GCCGGCCCNONE 
015-087-H06GCCGGCCCNONE 
016-078-A03GCCGGCCCNONE 
AK067884GCCGGCCCNONE 
AK103245GCCGGCCCConserved hypothetical protein. 
AK106116GCCGGCCCNONE 
AK106220GCCGGCCCNONE 
Os06g0152800003-125-D04ATTTGGGCCGGCCCAGGNONE 
AK099578ATTTGGGCCGGCCCAGGConserved hypothetical protein. 
Os06g0156700AK107226GCCGGCCCAGCCCLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCGGCCCAGCCCNONE 
J075023M12GCCGGCCCAGCCCNONE 
J075041C14GCCGGCCCAGCCCNONE 
J075041C19GCCGGCCCAGCCCNONE 
J075064F08GCCGGCCCAGCCCNONE 
J075116I03GCCGGCCCAGCCCNONE 
J075123I02GCCGGCCCAGCCCNONE 
Os06g0157800AK121504TATTGGGCCGGCCCSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGGCCCNONE 
J075033D09TATTGGGCCGGCCCNONE 
Os06g0218800011-007-B09GCCGGCCCNONE 
AK073565GCCGGCCCNONE 
AK104975GCCGGCCCConserved hypothetical protein. 
J033041B13GCCGGCCCNONE 
Os06g0251000J033111L12GCCGGCCCATCANONE 
J043001C08GCCGGCCCATCAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
Os06g0332600AK121615GCCGGCCCACCAConserved hypothetical protein. 
J033044B19GCCGGCCCACCANONE 
Os06g0338900016-067-B02GGGCCGGCNONE 
AK100837GGGCCGGCNucleotidyl transferase domain containing protein. 
J013058L01GGGCCGGCNONE 
J013135N01GGGCCGGCNONE 
J023123E15GGGCCGGCNONE 
J033051J01GGGCCGGCNONE 
J090002O21GGGCCGGCNONE 
J090013F06GGGCCGGCNONE 
J090056F16GGGCCGGCNONE 
J090081G13GGGCCGGCNONE 
J090090P21GGGCCGGCNONE 
J100039F05GGGCCGGCNONE 
J100059J03GGGCCGGCNONE 
Os06g0499900J065053E01CGATGGGCCGGCCGATGGGCTNONE 
J065078C19CGATGGGCCGGCCGATGGGCTNONE 
J065122P11CGATGGGCCGGCCGATGGGCTNONE 
J065209B15CGATGGGCCGGCCGATGGGCTNONE 
J065218E19CGATGGGCCGGCCGATGGGCTNONE 
Os06g0560400AK103575GCCGGCCCATCGNONE 
AK108074GCCGGCCCATCGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0564700AK070508GCCGGCCCGGCCSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23GCCGGCCCGGCCNONE 
Os06g0567000009-166-G12GGGCCGGCCCNONE 
AK121337GGGCCGGCCCProtein of unknown function UPF0197 family protein. 
J013122F01GGGCCGGCCCNONE 
J023080N12GGGCCGGCCCNONE 
J023120F03GGGCCGGCCCNONE 
J065013B18GGGCCGGCCCNONE 
J065039P21GGGCCGGCCCNONE 
J065089E06GGGCCGGCCCNONE 
J065095N19GGGCCGGCCCNONE 
J065119H03GGGCCGGCCCNONE 
J065121D18GGGCCGGCCCNONE 
J065149G04GGGCCGGCCCNONE 
J075012J04GGGCCGGCCCNONE 
J075021G13GGGCCGGCCCNONE 
J075106I23GGGCCGGCCCNONE 
J075107F19GGGCCGGCCCNONE 
J075152J22GGGCCGGCCCNONE 
J075186J20GGGCCGGCCCNONE 
J075188F16GGGCCGGCCCNONE 
J080001G06GGGCCGGCCCNONE 
J080002O09GGGCCGGCCCNONE 
J080006E10GGGCCGGCCCNONE 
J080006F24GGGCCGGCCCNONE 
J080012L07GGGCCGGCCCNONE 
J080016A10GGGCCGGCCCNONE 
J080017D11GGGCCGGCCCNONE 
J080017I04GGGCCGGCCCNONE 
J080017I10GGGCCGGCCCNONE 
J080020P06GGGCCGGCCCNONE 
J080024A20GGGCCGGCCCNONE 
J080027B10GGGCCGGCCCNONE 
J080027E03GGGCCGGCCCNONE 
J080027I01GGGCCGGCCCNONE 
J080027K20GGGCCGGCCCNONE 
J080041L12GGGCCGGCCCNONE 
J080043D21GGGCCGGCCCNONE 
J080044K11GGGCCGGCCCNONE 
J080048I08GGGCCGGCCCNONE 
J080049M12GGGCCGGCCCNONE 
J080050C14GGGCCGGCCCNONE 
J080050N21GGGCCGGCCCNONE 
J080053F04GGGCCGGCCCNONE 
J080054O16GGGCCGGCCCNONE 
J080058O21GGGCCGGCCCNONE 
J080059M11GGGCCGGCCCNONE 
J080061A11GGGCCGGCCCNONE 
J080063B15GGGCCGGCCCNONE 
J080063F22GGGCCGGCCCNONE 
J080066M18GGGCCGGCCCNONE 
J080068D12GGGCCGGCCCNONE 
J080070D22GGGCCGGCCCNONE 
J080071B06GGGCCGGCCCNONE 
J080072B17GGGCCGGCCCNONE 
J080081O04GGGCCGGCCCNONE 
J080089H05GGGCCGGCCCNONE 
J080093K13GGGCCGGCCCNONE 
J080095I05GGGCCGGCCCNONE 
J080097F19GGGCCGGCCCNONE 
J080304C03GGGCCGGCCCNONE 
J080304H11GGGCCGGCCCNONE 
J080308M21GGGCCGGCCCNONE 
J080313O15GGGCCGGCCCNONE 
J090020N23GGGCCGGCCCNONE 
J100023C12GGGCCGGCCCNONE 
Os06g0585200016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0643000AK067701GCCGGCCCACCACCAACPhox-like domain containing protein. 
J013032G04GCCGGCCCACCACCAACNONE 
J013044B17GCCGGCCCACCACCAACNONE 
J013114M13GCCGGCCCACCACCAACNONE 
J023133A02GCCGGCCCACCACCAACNONE 
J043022A07GCCGGCCCACCACCAACNONE 
J075046O21GCCGGCCCACCACCAACNONE 
J075142L01GCCGGCCCACCACCAACNONE 
J090076I16GCCGGCCCACCACCAACNONE 
J100056O17GCCGGCCCACCACCAACNONE 
Os06g0678200AK059456CCCCCACGCCGGCCCCACGTGTCNONE 
AK071299CCCCCACGCCGGCCCCACGTGTCSimilar to Geranyl diphosphate synthase. 
Os06g0687900003-115-E01GGGCCGGCTCCGACGGNONE 
AB054003GGGCCGGCTCCGACGGGlycosyl transferase, family 43 protein. 
J065212N07GGGCCGGCTCCGACGGNONE 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0715000AK107114GGGCTGGGCCGGCConserved hypothetical protein. 
Os06g0717400AK072887GCCGGCCCGGCCCATTTPseudouridine synthase, Rlu family protein. 
Os07g0101500AK059667GCCGGCCCACGANONE 
AK071749GCCGGCCCACGASimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07GCCGGCCCACGANONE 
J065050F03GCCGGCCCACGANONE 
J090015C05GCCGGCCCACGANONE 
J090045C11GCCGGCCCACGANONE 
Os07g0105300AK107419GCCGGCCCACGGGConserved hypothetical protein. 
AK107419GCCGGGCCTGGGCCGGCConserved hypothetical protein. 
AK107419GGGCCGGCCCGGCConserved hypothetical protein. 
AK109521GCCGGCCCACGGGNONE 
AK109521GCCGGGCCTGGGCCGGCNONE 
AK109521GGGCCGGCCCGGCNONE 
Os07g0150200009-152-C07AGATGGGCCGGCCCATGTNONE 
AK058680AGATGGGCCGGCCCATGTNONE 
AK121635AGATGGGCCGGCCCATGTSimilar to 40S ribosomal protein S12-1. 
J033051C16AGATGGGCCGGCCCATGTNONE 
J033123H15AGATGGGCCGGCCCATGTNONE 
J065093I01AGATGGGCCGGCCCATGTNONE 
J065197C05AGATGGGCCGGCCCATGTNONE 
J075037B11AGATGGGCCGGCCCATGTNONE 
J075114B08AGATGGGCCGGCCCATGTNONE 
J075123N01AGATGGGCCGGCCCATGTNONE 
J075129O04AGATGGGCCGGCCCATGTNONE 
J075160H17AGATGGGCCGGCCCATGTNONE 
J075166H17AGATGGGCCGGCCCATGTNONE 
J080310F11AGATGGGCCGGCCCATGTNONE 
J080315P11AGATGGGCCGGCCCATGTNONE 
J090025A22AGATGGGCCGGCCCATGTNONE 
Os07g0158900AK064980GCCGGCCCCyclin-like F-box domain containing protein. 
AK064980GCCGGCCCCyclin-like F-box domain containing protein. 
Os07g0164500J013094M18CCCGGGCCGGCCCATTNONE 
J013094M18CCTGGGCCGGCNONE 
J013094M18GCCGGCCCNONE 
J013153L05CCCGGGCCGGCCCATTNONE 
J013153L05CCTGGGCCGGCNONE 
J013153L05GCCGGCCCNONE 
J023011J18CCCGGGCCGGCCCATTNONE 
J023011J18CCTGGGCCGGCNONE 
J023011J18GCCGGCCCNONE 
J023106H21CCCGGGCCGGCCCATTNONE 
J023106H21CCTGGGCCGGCNONE 
J023106H21GCCGGCCCNONE 
J033105F10CCCGGGCCGGCCCATTNONE 
J033105F10CCTGGGCCGGCNONE 
J033105F10GCCGGCCCNONE 
J065210M20CCCGGGCCGGCCCATTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J065210M20CCTGGGCCGGCSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J065210M20GCCGGCCCSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CCCGGGCCGGCCCATTNONE 
J090060F05CCTGGGCCGGCNONE 
J090060F05GCCGGCCCNONE 
J090061C13CCCGGGCCGGCCCATTNONE 
J090061C13CCTGGGCCGGCNONE 
J090061C13GCCGGCCCNONE 
J090074K15CCCGGGCCGGCCCATTNONE 
J090074K15CCTGGGCCGGCNONE 
J090074K15GCCGGCCCNONE 
Os07g0205000009-018-A12AGATGGGCCGGCCCATCGGCCCATCANONE 
AK103963AGATGGGCCGGCCCATCGGCCCATCANONE 
AK121368AGATGGGCCGGCCCATCGGCCCATCANONE 
J023001M20AGATGGGCCGGCCCATCGGCCCATCANONE 
J023125I03AGATGGGCCGGCCCATCGGCCCATCANONE 
J053034L22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065078A21AGATGGGCCGGCCCATCGGCCCATCANONE 
J065089G24AGATGGGCCGGCCCATCGGCCCATCANONE 
J065096G23AGATGGGCCGGCCCATCGGCCCATCANONE 
J065103N06AGATGGGCCGGCCCATCGGCCCATCANONE 
J065146J22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065159K18AGATGGGCCGGCCCATCGGCCCATCANONE 
J065204L04AGATGGGCCGGCCCATCGGCCCATCANONE 
J065207N07AGATGGGCCGGCCCATCGGCCCATCANONE 
J065208E24AGATGGGCCGGCCCATCGGCCCATCANONE 
J075057F19AGATGGGCCGGCCCATCGGCCCATCANONE 
J075058K01AGATGGGCCGGCCCATCGGCCCATCANONE 
J075072H13AGATGGGCCGGCCCATCGGCCCATCANONE 
J080003D08AGATGGGCCGGCCCATCGGCCCATCANONE 
J080025F02AGATGGGCCGGCCCATCGGCCCATCANONE 
Os07g0205700AK120553CCCGGGCCGGCCCSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24CCCGGGCCGGCCCNONE 
Os07g0206900AK107761GGCCGGGCCGGCProtein of unknown function DUF642 family protein. 
Os07g0301200AB110202CACGTGGGCCGGCNONE 
AB110202GCCGGCCCGGCACGGCCCAGCNONE 
AK073463CACGTGGGCCGGCSimilar to RNA helicase (Fragment). 
AK073463GCCGGCCCGGCACGGCCCAGCSimilar to RNA helicase (Fragment). 
Os07g0408100AK108466GCCGGCCCATGGNONE 
AK111780GCCGGCCCATGGWD40-like domain containing protein. 
Os07g0423000AK109714GCCGGCCCATATMitochodrial transcription termination factor-related family protein. 
J065007I23GCCGGCCCATATNONE 
Os07g0438800AK060412GCCGGCCCGGGCCCACCCNONE 
AK100065GCCGGCCCGGGCCCACCCSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195GCCGGCCCGGGCCCACCCNONE 
AY224478GCCGGCCCGGGCCCACCCNONE 
J013160O05GCCGGCCCGGGCCCACCCNONE 
J023030C05GCCGGCCCGGGCCCACCCNONE 
J033025O04GCCGGCCCGGGCCCACCCNONE 
J033121P15GCCGGCCCGGGCCCACCCNONE 
J043034I23GCCGGCCCGGGCCCACCCNONE 
J065022N01GCCGGCCCGGGCCCACCCNONE 
J065022N02GCCGGCCCGGGCCCACCCNONE 
J065023M01GCCGGCCCGGGCCCACCCNONE 
J065101G13GCCGGCCCGGGCCCACCCNONE 
J075058P13GCCGGCCCGGGCCCACCCNONE 
J075186K10GCCGGCCCGGGCCCACCCNONE 
J075199F17GCCGGCCCGGGCCCACCCNONE 
Os07g0450000009-033-A08GCCGGCCCNONE 
AK063789GCCGGCCCNONE 
AK121702GCCGGCCCSimilar to 60S ribosomal protein L44. 
J033073H17GCCGGCCCNONE 
J065006A02GCCGGCCCNONE 
J065009C05GCCGGCCCNONE 
J065028M04GCCGGCCCNONE 
J065070D07GCCGGCCCNONE 
J065072H17GCCGGCCCNONE 
J065114J23GCCGGCCCNONE 
J065127A02GCCGGCCCNONE 
J065146L07GCCGGCCCNONE 
J065213H17GCCGGCCCNONE 
J065214B07GCCGGCCCNONE 
J100045B16GCCGGCCCNONE 
Os07g0459200AK066819ATGGCCCATGGGCCGGCNONE 
AK102099ATGGCCCATGGGCCGGCSimilar to Possible kinase. 
Os07g0490300AK068288GCCGGCCCAAGSimilar to Preproacrosin. 
J013149P03GCCGGCCCAAGNONE 
J065039L14GCCGGCCCAAGNONE 
J100024A06GCCGGCCCAAGNONE 
Os07g0490400AK067941CTTGGGCCGGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CTTGGGCCGGCNONE 
Os07g0502200006-027-C06GCCGGCCCAGGNONE 
012-007-C05GCCGGCCCAGGNONE 
AK120682GCCGGCCCAGGMulti antimicrobial extrusion protein MatE family protein. 
J053045G13GCCGGCCCAGGNONE 
J053064I18GCCGGCCCAGGNONE 
J053091G24GCCGGCCCAGGNONE 
J065016E10GCCGGCCCAGGNONE 
J065021B18GCCGGCCCAGGNONE 
J065022A17GCCGGCCCAGGNONE 
J065059D18GCCGGCCCAGGNONE 
J065063N19GCCGGCCCAGGNONE 
J065065O10GCCGGCCCAGGNONE 
J065196F12GCCGGCCCAGGNONE 
J065208I01GCCGGCCCAGGNONE 
J065218G15GCCGGCCCAGGNONE 
J100040G01GCCGGCCCAGGNONE 
J100060M03GCCGGCCCAGGNONE 
J100061P09GCCGGCCCAGGNONE 
J100065P05GCCGGCCCAGGNONE 
Os07g0531600015-098-E11CCGAGCCGGCCCATGTNONE 
AK067845CCGAGCCGGCCCATGTPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01CCGAGCCGGCCCATGTNONE 
J065008E15CCGAGCCGGCCCATGTNONE 
J065052K14CCGAGCCGGCCCATGTNONE 
J065052L13CCGAGCCGGCCCATGTNONE 
J065058M02CCGAGCCGGCCCATGTNONE 
J065069M10CCGAGCCGGCCCATGTNONE 
J065135A14CCGAGCCGGCCCATGTNONE 
J065168O18CCGAGCCGGCCCATGTNONE 
J075070D14CCGAGCCGGCCCATGTNONE 
J075169B16CCGAGCCGGCCCATGTNONE 
Os07g0546000AF188065GGCCCGGCCCGGCCGGCCCACCNONE 
AK061800GGCCCGGCCCGGCCGGCCCACCNONE 
AK065871GGCCCGGCCCGGCCGGCCCACCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02GGCCCGGCCCGGCCGGCCCACCNONE 
J013035F03GGCCCGGCCCGGCCGGCCCACCNONE 
J013044J20GGCCCGGCCCGGCCGGCCCACCNONE 
Os07g0546700009-110-H10TCATGGGCCGGCNONE 
AK058262TCATGGGCCGGCNONE 
J065154I05TCATGGGCCGGCNONE 
J065175P09TCATGGGCCGGCNONE 
J065187F11TCATGGGCCGGCNONE 
J075114K16TCATGGGCCGGCNONE 
J090031L21TCATGGGCCGGCNONE 
U86017TCATGGGCCGGCSimilar to 60S ribosomal protein L38. 
Os07g0555400AK070977GGGCCGGCCCGGCConserved hypothetical protein. 
Os07g0585800006-106-A05GCCGGCCCAGATNONE 
AK066419GCCGGCCCAGATNONE 
AK105064GCCGGCCCAGATSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01GCCGGCCCAGATNONE 
J065085B08GCCGGCCCAGATNONE 
J065099I23GCCGGCCCAGATNONE 
J065169A01GCCGGCCCAGATNONE 
J065187N13GCCGGCCCAGATNONE 
J065191L18GCCGGCCCAGATNONE 
J065194D04GCCGGCCCAGATNONE 
J065211M09GCCGGCCCAGATNONE 
J065212I02GCCGGCCCAGATNONE 
J090003C10GCCGGCCCAGATNONE 
J090025O11GCCGGCCCAGATNONE 
J090092F10GCCGGCCCAGATNONE 
J100055A04GCCGGCCCAGATNONE 
J100064A01GCCGGCCCAGATNONE 
J100080L02GCCGGCCCAGATNONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0667400AK073297ACTGGGCCGGCSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22ACTGGGCCGGCNONE 
J033122B17ACTGGGCCGGCNONE 
J065017H12ACTGGGCCGGCNONE 
J065106D19ACTGGGCCGGCNONE 
J065196J16ACTGGGCCGGCNONE 
J090084F01ACTGGGCCGGCNONE 
Os07g0685800AK064532GCTGGGCCGGCGlucose/ribitol dehydrogenase family protein. 
Os07g0686500AK119424GCCGGCCCProtein of unknown function DUF630 domain containing protein. 
J065064P13GCCGGCCCNONE 
J065070L21GCCGGCCCNONE 
J065196A06GCCGGCCCNONE 
J065216M14GCCGGCCCNONE 
Os07g0693800AK061531GGGCCGGCSimilar to Fatty acid desaturase (Fragment). 
AK098930GGGCCGGCNONE 
AY848920GGGCCGGCNONE 
Os08g0101600AB074260TGTTGGGCCGGCGTGGGCTTGSingle-strand DNA endonuclease-1. 
AK102542TGTTGGGCCGGCGTGGGCTTGNONE 
Os08g0112800009-113-D03GCCGGCCCATATNONE 
AK121176GCCGGCCCATATRickettsia 17 kDa surface antigen family protein. 
J023083C18GCCGGCCCATATNONE 
J033074M10GCCGGCCCATATNONE 
J033097G10GCCGGCCCATATNONE 
J065090F05GCCGGCCCATATNONE 
J090001J03GCCGGCCCATATNONE 
J090044F23GCCGGCCCATATNONE 
J090078H09GCCGGCCCATATNONE 
J100088G23GCCGGCCCATATNONE 
Os08g0118900AK109749GCCGGCCCAdenylate kinase family protein. 
Os08g0135900AK072535AGTGGGCCGGCCCATGSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0195400006-057-E04GGGCCGGCCCGGCACGGCCCGNONE 
006-060-B10GGGCCGGCCCGGCACGGCCCGNONE 
AK070464GGGCCGGCCCGGCACGGCCCGConserved hypothetical protein. 
AK104389GGGCCGGCCCGGCACGGCCCGNONE 
AK106140GGGCCGGCCCGGCACGGCCCGNONE 
J023013G08GGGCCGGCCCGGCACGGCCCGNONE 
J023054K19GGGCCGGCCCGGCACGGCCCGNONE 
J023089D18GGGCCGGCCCGGCACGGCCCGNONE 
J023092K05GGGCCGGCCCGGCACGGCCCGNONE 
J033025A08GGGCCGGCCCGGCACGGCCCGNONE 
J033067P12GGGCCGGCCCGGCACGGCCCGNONE 
J033098A10GGGCCGGCCCGGCACGGCCCGNONE 
J065219L04GGGCCGGCCCGGCACGGCCCGNONE 
J090021P06GGGCCGGCCCGGCACGGCCCGNONE 
J090062M05GGGCCGGCCCGGCACGGCCCGNONE 
J090079F15GGGCCGGCCCGGCACGGCCCGNONE 
J100041H19GGGCCGGCCCGGCACGGCCCGNONE 
Os08g0224200AK101331CGGGCCGTGCCGGCCCSimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01GGCCGGGCCGGCNONE 
AK067127GGCCGGGCCGGCConserved hypothetical protein. 
J013096C05GGCCGGGCCGGCNONE 
J100032D12GGCCGGGCCGGCNONE 
Os08g0328300AK102227GCCGGCCCNONE 
AK105392GCCGGCCCENT domain containing protein. 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0389733J065044M19GTGTGGGCCGGCCGTCGGATNONE 
J065104D10GTGTGGGCCGGCCGTCGGATNONE 
J065110F18GTGTGGGCCGGCCGTCGGATNONE 
Os08g0416000AF145729GGCCGGGCCGGCHomeodomain leucine zipper protein. 
AK100634GGCCGGGCCGGCNONE 
AK101569GGCCGGGCCGGCNONE 
AK110561GGCCGGGCCGGCNONE 
J013074A01GGCCGGGCCGGCNONE 
J013159K22GGCCGGGCCGGCNONE 
J023028M01GGCCGGGCCGGCNONE 
J023033C15GGCCGGGCCGGCNONE 
J023107N23GGCCGGGCCGGCNONE 
J023110A12GGCCGGGCCGGCNONE 
J023122D02GGCCGGGCCGGCNONE 
J033050G15GGCCGGGCCGGCNONE 
J033107D17GGCCGGGCCGGCNONE 
J065082J21GGCCGGGCCGGCNONE 
J065165L21GGCCGGGCCGGCNONE 
J065171J17GGCCGGGCCGGCNONE 
J100026K13GGCCGGGCCGGCNONE 
J100039E16GGCCGGGCCGGCNONE 
J100056J11GGCCGGGCCGGCNONE 
J100070I19GGCCGGGCCGGCNONE 
J100073B16GGCCGGGCCGGCNONE 
J100081M19GGCCGGGCCGGCNONE 
J100088E09GGCCGGGCCGGCNONE 
Os08g0480000006-053-A10GCCGGCCCAGCCNONE 
AK067748GCCGGCCCAGCCMulti antimicrobial extrusion protein MatE family protein. 
J013118K06GCCGGCCCAGCCNONE 
Os08g0490300011-064-F08AGATGGGCCGGCCCACGAANONE 
015-050-C06AGATGGGCCGGCCCACGAANONE 
AK066895AGATGGGCCGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22AGATGGGCCGGCCCACGAANONE 
J090060F02AGATGGGCCGGCCCACGAANONE 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os08g0563300009-007-B01GGGCCGGCCCATAANONE 
AK062315GGGCCGGCCCATAASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04GGGCCGGCCCATAANONE 
Os08g0564100AK063258GCCGGCCCATAASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0112400AK109186TGTTGGGCCGGCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0325300011-005-H08TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
AK068435TCGGCCCAAACTTGGGCCGGCCCGTTConserved hypothetical protein. 
AK073998TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J033071H21TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J065214H05TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
Os09g0329800AK069775GGGCCGGCConserved hypothetical protein. 
Os09g0329900Os09g0329900GGGCCGGCNONE 
Os09g0363700AK103667TGTTGGGCCGGCCCAAGConserved hypothetical protein. 
J075001L14TGTTGGGCCGGCCCAAGNONE 
J075049M23TGTTGGGCCGGCCCAAGNONE 
J075051I04TGTTGGGCCGGCCCAAGNONE 
J075073L04TGTTGGGCCGGCCCAAGNONE 
J075077E03TGTTGGGCCGGCCCAAGNONE 
J075083J11TGTTGGGCCGGCCCAAGNONE 
J075094J22TGTTGGGCCGGCCCAAGNONE 
J075112E08TGTTGGGCCGGCCCAAGNONE 
J075137J23TGTTGGGCCGGCCCAAGNONE 
J075192E02TGTTGGGCCGGCCCAAGNONE 
J100039K04TGTTGGGCCGGCCCAAGNONE 
Os09g0375700AK068295CGCGTGGGCCGGCCCAGCHypothetical protein. 
Os09g0382500009-117-E11GGGCCGGCNONE 
009-117-E11GGGCCGGCNONE 
AK105199GGGCCGGCConserved hypothetical protein. 
AK105199GGGCCGGCConserved hypothetical protein. 
Os09g0388400AK069644GCCGGCCCCof protein family protein. 
J023147A17GCCGGCCCNONE 
Os09g0406900012-044-F05GCCGGCCCNONE 
AK063485GCCGGCCCNONE 
AK067460GCCGGCCCConserved hypothetical protein. 
Os09g0465800009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0509200AK069525GGGCCGGCCCAATTSimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0525500AK107918GCCGGCCCAACCYY1 protein precursor. 
D50575GCCGGCCCAACCNONE 
Os09g0535000AK058712GGGCCGGCCCAGGSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488GGGCCGGCCCAGGNONE 
AK069832GGGCCGGCCCAGGNONE 
J100065D20GGGCCGGCCCAGGNONE 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os11g0127700AK103742CTGGGCTTGGGCCGGCCCACTHypothetical protein. 
J090083M11CTGGGCTTGGGCCGGCCCACTNONE 
Os11g0219400AK069850GCCGGCCCAnkyrin repeat containing protein. 
AK069850GGGCCGGCCCGGCAnkyrin repeat containing protein. 
AK099123GCCGGCCCNONE 
AK099123GGGCCGGCCCGGCNONE 
J023143G18GCCGGCCCNONE 
J023143G18GGGCCGGCCCGGCNONE 
Os11g0249300AK060391ATATGGGCCGGCConserved hypothetical protein. 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
J075053H03GCCGGCCCAAACGGCCCACGAANONE 
J075062F23GCCGGCCCAAACGGCCCACGAANONE 
J090029D08GCCGGCCCAAACGGCCCACGAANONE 
Os11g0544000AK066017GCCGGCCCAACTCGGCCCAAGConserved hypothetical protein. 
AK071393GCCGGCCCAACTCGGCCCAAGNONE 
J013050C10GCCGGCCCAACTCGGCCCAAGNONE 
J013118O12GCCGGCCCAACTCGGCCCAAGNONE 
Os11g0606300J075039E08ATTGGGCCGGCCCGGTNONE 
J075044E18ATTGGGCCGGCCCGGTNONE 
J075053G16ATTGGGCCGGCCCGGTConserved hypothetical protein. 
Os11g0630900AK107482GCCGGCCCAACAMATH domain containing protein. 
Os11g0660000AK066709GCCGGCCCSodium/calcium exchanger membrane region domain containing protein. 
J013074O18GCCGGCCCNONE 
J023081H12GCCGGCCCNONE 
J065072E24GCCGGCCCNONE 
J065186K08GCCGGCCCNONE 
J075079E19GCCGGCCCNONE 
J075093J05GCCGGCCCNONE 
J075124I21GCCGGCCCNONE 
J075187F09GCCGGCCCNONE 
J090037O16GCCGGCCCNONE 
Os12g0112250J013069O10AGTGGGCCGGCSaposin B domain containing protein. 
J065206G04AGTGGGCCGGCNONE 
J080302C06AGTGGGCCGGCNONE 
J080306K06AGTGGGCCGGCNONE 
J080307O09AGTGGGCCGGCNONE 
J080310J07AGTGGGCCGGCNONE 
J080311G18AGTGGGCCGGCNONE 
J080318C07AGTGGGCCGGCNONE 
Os12g0123900016-031-A06CTTGGGCCGGCCCACTNONE 
AK061862CTTGGGCCGGCCCACTHypothetical protein. 
J013031P10CTTGGGCCGGCCCACTNONE 
J053034P22CTTGGGCCGGCCCACTNONE 
J053046O16CTTGGGCCGGCCCACTNONE 
J053048D20CTTGGGCCGGCCCACTNONE 
J090031I07CTTGGGCCGGCCCACTNONE 
J100025B02CTTGGGCCGGCCCACTNONE 
Os12g0168200015-027-H11AACTGGGCCGGCCCAGGNONE 
AK069543AACTGGGCCGGCCCAGGSsu72-like protein family protein. 
J023025N02AACTGGGCCGGCCCAGGNONE 
Os12g0242500J065129F10AATGGGCCGGCGCGGGTGCGGGCCNONE 
J090032G12AATGGGCCGGCGCGGGTGCGGGCCConserved hypothetical protein. 
Os12g0244500AK102026GCCGGCCCConserved hypothetical protein. 
J023014D06GCCGGCCCNONE 
J023060C12GCCGGCCCNONE 
J033080M18GCCGGCCCNONE 
J090017I22GCCGGCCCNONE 
J090023D21GCCGGCCCNONE 
J090036J05GCCGGCCCNONE 
J090053M19GCCGGCCCNONE 
Os12g0287200009-067-B11GCCGGCCCATTTGGGCCCAATTNONE 
009-130-F06GCCGGCCCATTTGGGCCCAATTNONE 
009-185-H10GCCGGCCCATTTGGGCCCAATTNONE 
AF338343GCCGGCCCATTTGGGCCCAATTNONE 
AK063847GCCGGCCCATTTGGGCCCAATTSimilar to Mago nashi protein. 
AK121477GCCGGCCCATTTGGGCCCAATTNONE 
J023149H05GCCGGCCCATTTGGGCCCAATTNONE 
J065019G18GCCGGCCCATTTGGGCCCAATTNONE 
J065049J18GCCGGCCCATTTGGGCCCAATTNONE 
J065143C22GCCGGCCCATTTGGGCCCAATTNONE 
J075130D23GCCGGCCCATTTGGGCCCAATTNONE 
J090014I22GCCGGCCCATTTGGGCCCAATTNONE 
J090018A06GCCGGCCCATTTGGGCCCAATTNONE 
J090053H11GCCGGCCCATTTGGGCCCAATTNONE 
J090080N13GCCGGCCCATTTGGGCCCAATTNONE 
J100019H19GCCGGCCCATTTGGGCCCAATTNONE 
Os12g0481100AK073151GCCGGCCCAACTSimilar to RNA helicase. 
Os12g0508300009-006-G07GCCGGCCCAGGNONE 
009-133-E05GCCGGCCCAGGNONE 
009-137-F10GCCGGCCCAGGNONE 
014-024-A06GCCGGCCCAGGNONE 
AK059123GCCGGCCCAGGRibosomal protein S14 family protein. 
J100088E22GCCGGCCCAGGNONE 
Os12g0557800AK121691GCCGGGCCTGGGCCGGCProtein prenyltransferase domain containing protein. 
AK121691GGGCCGGCCCProtein prenyltransferase domain containing protein. 
J013095M03GCCGGGCCTGGGCCGGCNONE 
J013095M03GGGCCGGCCCNONE 
J033071H11GCCGGGCCTGGGCCGGCNONE 
J033071H11GGGCCGGCCCNONE 
J065101B02GCCGGGCCTGGGCCGGCNONE 
J065101B02GGGCCGGCCCNONE 
Os12g0611000AK111837GCCGGCCCATTASimilar to Zinc-finger protein Lsd1. 
Os12g0612500Os12g0612500ATTGGGCCGGCCCATTTModification methylase HemK family protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.