version

Summary of OsREG616 (All List)

OrganismOryza sativa  
IDOsREG616  
SequenceGCCGGGCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count2052  

Entry Sequences (2052 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0147200016-005-F02GGGCCCGGCCCATCANONE 
AK106463GGGCCCGGCCCATCANONE 
AK121921GGGCCCGGCCCATCAIWS1, C-terminal family protein. 
J033098O16GGGCCCGGCCCATCANONE 
J033106E16GGGCCCGGCCCATCANONE 
J043026D12GGGCCCGGCCCATCANONE 
J065070B04GGGCCCGGCCCATCANONE 
J065162L03GGGCCCGGCCCATCANONE 
J065166F01GGGCCCGGCCCATCANONE 
J075030A13GGGCCCGGCCCATCANONE 
J075093O12GGGCCCGGCCCATCANONE 
J075106K15GGGCCCGGCCCATCANONE 
J075107F20GGGCCCGGCCCATCANONE 
J090031F21GGGCCCGGCCCATCANONE 
J090079E17GGGCCCGGCCCATCANONE 
Os01g0166800AK073783ATCTCGGCCCGGCConserved hypothetical protein. 
AK099378ATCTCGGCCCGGCNONE 
J033026H10ATCTCGGCCCGGCNONE 
J033067O18ATCTCGGCCCGGCNONE 
J033108A17ATCTCGGCCCGGCNONE 
J065015J11ATCTCGGCCCGGCNONE 
J065204P09ATCTCGGCCCGGCNONE 
Os01g0188200015-013-B12GGTTGGGCTGGCCGGGCCGNONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
Os01g0238500006-086-E04GCCCGGCCGGGCCGGCNONE 
AK067076GCCCGGCCGGGCCGGCSimilar to Branched-chain-amino-acid aminotransferase-like protein 3, chloroplast precursor. 
AK104302GCCCGGCCGGGCCGGCNONE 
J013093D15GCCCGGCCGGGCCGGCNONE 
J065038O05GCCCGGCCGGGCCGGCNONE 
J075089I20GCCCGGCCGGGCCGGCNONE 
J075122B01GCCCGGCCGGGCCGGCNONE 
J090086G20GCCCGGCCGGGCCGGCNONE 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0286000AK109824AGATGGGCCGGGCCCSnf7 family protein. 
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE 
012-094-B11AACGGGCCCGGCCCATGNONE 
015-096-C04AACGGGCCCGGCCCATGNONE 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
AK099005AACGGGCCCGGCCCATGNONE 
J013109B04AACGGGCCCGGCCCATGNONE 
J033057L14AACGGGCCCGGCCCATGNONE 
J090072H04AACGGGCCCGGCCCATGNONE 
J100030A14AACGGGCCCGGCCCATGNONE 
Os01g0557100Os01g0557100CGGCCCGGCAlpha/beta hydrolase family protein. 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0587000AK067605CCCGGCCCGGCCSimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0612600004-008-D07TGCGGGCCGGGCCGNONE 
009-057-C09TGCGGGCCGGGCCGNONE 
009-130-C01TGCGGGCCGGGCCGNONE 
AK062906TGCGGGCCGGGCCGNONE 
AK066561TGCGGGCCGGGCCGProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCGGGCCGNONE 
J013073D14TGCGGGCCGGGCCGNONE 
J023014A21TGCGGGCCGGGCCGNONE 
J023073M13TGCGGGCCGGGCCGNONE 
J023079F02TGCGGGCCGGGCCGNONE 
J023083B16TGCGGGCCGGGCCGNONE 
J023090G19TGCGGGCCGGGCCGNONE 
J023095F15TGCGGGCCGGGCCGNONE 
J023119H11TGCGGGCCGGGCCGNONE 
J033040B01TGCGGGCCGGGCCGNONE 
J033044F13TGCGGGCCGGGCCGNONE 
J033081E23TGCGGGCCGGGCCGNONE 
J033121K07TGCGGGCCGGGCCGNONE 
J033124D11TGCGGGCCGGGCCGNONE 
J033131N22TGCGGGCCGGGCCGNONE 
J065179E10TGCGGGCCGGGCCGNONE 
J090020A13TGCGGGCCGGGCCGNONE 
J090045K17TGCGGGCCGGGCCGNONE 
J090047M24TGCGGGCCGGGCCGNONE 
J090064G23TGCGGGCCGGGCCGNONE 
J090084G08TGCGGGCCGGGCCGNONE 
J090086F18TGCGGGCCGGGCCGNONE 
J100032D09TGCGGGCCGGGCCGNONE 
J100037O18TGCGGGCCGGGCCGNONE 
J100042B03TGCGGGCCGGGCCGNONE 
J100061D06TGCGGGCCGGGCCGNONE 
J100061I03TGCGGGCCGGGCCGNONE 
J100063B17TGCGGGCCGGGCCGNONE 
Os01g0624700AK111416CGGCCCGGCCSimilar to WRKY transcription factor 12. 
AY676924CGGCCCGGCCNONE 
AY870601CGGCCCGGCCNONE 
Os01g0635400AK102655GGCCCGGCCSimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
AK111923GGCCCGGCCNONE 
Os01g0639900004-009-H08GCCCAGCCGGGCCGCANONE 
006-050-F07GCCCAGCCGGGCCGCANONE 
006-120-D04GCCCAGCCGGGCCGCANONE 
AF182806GCCCAGCCGGGCCGCANONE 
AK060890GCCCAGCCGGGCCGCASimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825GCCCAGCCGGGCCGCANONE 
J075022I06GCCCAGCCGGGCCGCANONE 
U08404GCCCAGCCGGGCCGCANONE 
Os01g0666500AK102689GGCCGGGCCCACTConserved hypothetical protein. 
Os01g0743400AK059177GGGCCGGGCCGGCSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114GGGCCGGGCCGGCNONE 
J065070E07GGGCCGGGCCGGCNONE 
J065152G11GGGCCGGGCCGGCNONE 
Os01g0753800AK121555TCGGCCCGGCConserved hypothetical protein. 
J013075H19TCGGCCCGGCNONE 
J013130F24TCGGCCCGGCNONE 
J033033I01TCGGCCCGGCNONE 
Os01g0761100AK122112GGCCCGGCCTesmin/TSO1-like, CXC domain containing protein. 
Os01g0800300006-097-C12TCCGGCCCGGCCNONE 
014-070-C12TCCGGCCCGGCCNONE 
AK072549TCCGGCCCGGCCNONE 
AK100942TCCGGCCCGGCCNONE 
AK100951TCCGGCCCGGCCConserved hypothetical protein. 
AK106023TCCGGCCCGGCCNONE 
J023138D05TCCGGCCCGGCCNONE 
J075097P16TCCGGCCCGGCCNONE 
J075099F23TCCGGCCCGGCCNONE 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK064082CACGGCCCGGCCNONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
AK101426CACGGCCCGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
J065005C19CGGGTGGGCCCGGCNONE 
J065025H20CGGGTGGGCCCGGCNONE 
J065061E22CGGGTGGGCCCGGCNONE 
J065065F14CGGGTGGGCCCGGCNONE 
J065083O21CGGGTGGGCCCGGCNONE 
J065201G05CGGGTGGGCCCGGCNONE 
Os01g0846300AK065949CCACGTGTTGCGGGCCGGGCCGGGSimilar to Protein phosphatase 2C. 
Os01g0853400AK121543GGCCCGGCNONE 
AY168645GGCCCGGCNONE 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0863166J065007F23CACGGCCCGGCCNONE 
J065007F23GCCGGGCCGGGCCGNONE 
J065124H21CACGGCCCGGCCConserved hypothetical protein. 
J065124H21GCCGGGCCGGGCCGConserved hypothetical protein. 
Os01g0866300006-029-F08GGCCGGGCCCACTNONE 
006-074-E10GGCCGGGCCCACTNONE 
006-079-E11GGCCGGGCCCACTNONE 
009-048-A05GGCCGGGCCCACTNONE 
AK059875GGCCGGGCCCACTNONE 
J043005O17GGCCGGGCCCACTNONE 
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0913900AK110828GCCGGGCCCConserved hypothetical protein. 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0973100J065216G12CCCGGCCCGGCCCProtein of unknown function DUF239, plant domain containing protein. 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0193500009-092-G09CTCGGCCCGGCCCNONE 
AK101237CTCGGCCCGGCCCHypothetical protein. 
J033031K13CTCGGCCCGGCCCNONE 
J033034P12CTCGGCCCGGCCCNONE 
J080304L19CTCGGCCCGGCCCNONE 
J100059N21CTCGGCCCGGCCCNONE 
Os02g0227000J023084F07GGCCCGGCCCNONE 
J033051H22GGCCCGGCCCProtein of unknown function UPF0054 family protein. 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0301100006-029-F04GGGTGGGCCCGGCNONE 
012-005-F07GGGTGGGCCCGGCNONE 
013-093-H10GGGTGGGCCCGGCNONE 
015-042-B01GGGTGGGCCCGGCNONE 
016-017-F09GGGTGGGCCCGGCNONE 
016-079-B07GGGTGGGCCCGGCNONE 
016-079-G03GGGTGGGCCCGGCNONE 
016-087-F11GGGTGGGCCCGGCNONE 
AK071676GGGTGGGCCCGGCNONE 
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein. 
AK104411GGGTGGGCCCGGCNONE 
AK104467GGGTGGGCCCGGCNONE 
J023069G02GGGTGGGCCCGGCNONE 
J023108F17GGGTGGGCCCGGCNONE 
J033042B04GGGTGGGCCCGGCNONE 
J033128D06GGGTGGGCCCGGCNONE 
J033138I12GGGTGGGCCCGGCNONE 
J053064K16GGGTGGGCCCGGCNONE 
J065088A12GGGTGGGCCCGGCNONE 
J065102L08GGGTGGGCCCGGCNONE 
J065104L14GGGTGGGCCCGGCNONE 
J065117M20GGGTGGGCCCGGCNONE 
J065117N14GGGTGGGCCCGGCNONE 
J065120H23GGGTGGGCCCGGCNONE 
J065135F06GGGTGGGCCCGGCNONE 
J065138J17GGGTGGGCCCGGCNONE 
J065138P06GGGTGGGCCCGGCNONE 
J065156G16GGGTGGGCCCGGCNONE 
J065163M20GGGTGGGCCCGGCNONE 
J065176A14GGGTGGGCCCGGCNONE 
J065182C02GGGTGGGCCCGGCNONE 
J065200C05GGGTGGGCCCGGCNONE 
J065213J22GGGTGGGCCCGGCNONE 
J065217D24GGGTGGGCCCGGCNONE 
J075009H03GGGTGGGCCCGGCNONE 
J075020D10GGGTGGGCCCGGCNONE 
J075026L24GGGTGGGCCCGGCNONE 
J075028L01GGGTGGGCCCGGCNONE 
J075057O09GGGTGGGCCCGGCNONE 
J075089A20GGGTGGGCCCGGCNONE 
J075094J15GGGTGGGCCCGGCNONE 
J075103B11GGGTGGGCCCGGCNONE 
J075143L13GGGTGGGCCCGGCNONE 
J075153K15GGGTGGGCCCGGCNONE 
J075161P22GGGTGGGCCCGGCNONE 
J075166J06GGGTGGGCCCGGCNONE 
J075177G06GGGTGGGCCCGGCNONE 
J075198N06GGGTGGGCCCGGCNONE 
Os02g0304800Os02g0304800GGCCCGGCCCAAATProtein prenyltransferase domain containing protein. 
Os02g0326700AK064977GGCCGGGCCCCACGRhomboid-like protein family protein. 
Os02g0445700011-046-C10GCCGGGCCGTGNONE 
011-046-C10GGCCCGGCCCGTTNONE 
Os02g0462800AK110587GGCCGGGCCGGCWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923GGCCGGGCCGGCNONE 
Os02g0533800009-149-F12GGCCGGGCCGGGNONE 
013-058-H02GGCCGGGCCGGGNONE 
014-017-G07GGCCGGGCCGGGNONE 
014-028-F04GGCCGGGCCGGGNONE 
014-050-G04GGCCGGGCCGGGNONE 
014-095-F04GGCCGGGCCGGGNONE 
014-099-C08GGCCGGGCCGGGNONE 
016-046-F05GGCCGGGCCGGGNONE 
AK121139GGCCGGGCCGGGConserved hypothetical protein. 
J013104A14GGCCGGGCCGGGNONE 
J023077F13GGCCGGGCCGGGNONE 
J023145I11GGCCGGGCCGGGNONE 
J065033D14GGCCGGGCCGGGNONE 
J065079I15GGCCGGGCCGGGNONE 
J065104E21GGCCGGGCCGGGNONE 
J065128E06GGCCGGGCCGGGNONE 
J065174F07GGCCGGGCCGGGNONE 
J065195B12GGCCGGGCCGGGNONE 
J065207B12GGCCGGGCCGGGNONE 
J080304M24GGCCGGGCCGGGNONE 
J090040A13GGCCGGGCCGGGNONE 
J090054B18GGCCGGGCCGGGNONE 
J100037A06GGCCGGGCCGGGNONE 
J100042F24GGCCGGGCCGGGNONE 
J100043N23GGCCGGGCCGGGNONE 
J100044H14GGCCGGGCCGGGNONE 
J100056K24GGCCGGGCCGGGNONE 
J100063O22GGCCGGGCCGGGNONE 
J100071G05GGCCGGGCCGGGNONE 
J100078G15GGCCGGGCCGGGNONE 
Os02g0533900AB062681CCCGGCCCGGCCNONE 
AK061722CCCGGCCCGGCCNONE 
AK106147CCCGGCCCGGCCNONE 
AK121892CCCGGCCCGGCCSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
Os02g0602300AK065609GCCGGCCCGGCNONE 
AK066929GCCGGCCCGGCSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCGGCCCGGCNONE 
J090040I23GCCGGCCCGGCNONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0672600AK070286GGCCGGGCCGTGSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174GGCCGGGCCGTGNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0768600006-034-F01TCTGGCCCGGCCCAAACNONE 
006-046-G07TCTGGCCCGGCCCAAACNONE 
006-054-C07TCTGGCCCGGCCCAAACNONE 
006-056-F07TCTGGCCCGGCCCAAACNONE 
006-100-C02TCTGGCCCGGCCCAAACNONE 
AK059725TCTGGCCCGGCCCAAACNONE 
AK098996TCTGGCCCGGCCCAAACNONE 
AK099120TCTGGCCCGGCCCAAACNONE 
AK104659TCTGGCCCGGCCCAAACNONE 
J065043H04TCTGGCCCGGCCCAAACNONE 
J075034N21TCTGGCCCGGCCCAAACNONE 
J075145C18TCTGGCCCGGCCCAAACNONE 
J080016H01TCTGGCCCGGCCCAAACNONE 
J080040F01TCTGGCCCGGCCCAAACNONE 
J080047L23TCTGGCCCGGCCCAAACNONE 
J080049B22TCTGGCCCGGCCCAAACNONE 
J080062J16TCTGGCCCGGCCCAAACNONE 
J080064C23TCTGGCCCGGCCCAAACNONE 
J080064L22TCTGGCCCGGCCCAAACNONE 
J080077N01TCTGGCCCGGCCCAAACNONE 
J080097G17TCTGGCCCGGCCCAAACNONE 
J100065L15TCTGGCCCGGCCCAAACNONE 
J100066K23TCTGGCCCGGCCCAAACNONE 
J100088C07TCTGGCCCGGCCCAAACNONE 
J100090H09TCTGGCCCGGCCCAAACNONE 
Os02g0780500AK072784GGCCGGGCCGGCNONE 
AK121143GGCCGGGCCGGCConserved hypothetical protein. 
J023075M13GGCCGGGCCGGCNONE 
J023077P14GGCCGGGCCGGCNONE 
J023123C16GGCCGGGCCGGCNONE 
J023142P06GGCCGGGCCGGCNONE 
Os02g0801900006-113-E02CACGGCCCGGCCNONE 
006-113-E02GCCGGGCCGGGCCGNONE 
AK109488CACGGCCCGGCCNONE 
AK109488GCCGGGCCGGGCCGNONE 
AK109498CACGGCCCGGCCConserved hypothetical protein. 
AK109498GCCGGGCCGGGCCGConserved hypothetical protein. 
J065007D19CACGGCCCGGCCNONE 
J065007D19GCCGGGCCGGGCCGNONE 
J065035G11CACGGCCCGGCCNONE 
J065035G11GCCGGGCCGGGCCGNONE 
J065044E05CACGGCCCGGCCNONE 
J065044E05GCCGGGCCGGGCCGNONE 
J065112N01CACGGCCCGGCCNONE 
J065112N01GCCGGGCCGGGCCGNONE 
J065143B03CACGGCCCGGCCNONE 
J065143B03GCCGGGCCGGGCCGNONE 
J065159A16CACGGCCCGGCCNONE 
J065159A16GCCGGGCCGGGCCGNONE 
J090007K23CACGGCCCGGCCNONE 
J090007K23GCCGGGCCGGGCCGNONE 
J090045N09CACGGCCCGGCCNONE 
J090045N09GCCGGGCCGGGCCGNONE 
J090049L20CACGGCCCGGCCNONE 
J090049L20GCCGGGCCGGGCCGNONE 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os02g0827600AK068455GGCCGGGCCConserved hypothetical protein. 
Os03g0102200AK120183TCGGCCCGGCCCGGTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TCGGCCCGGCCCGGTNONE 
J065116C05TCGGCCCGGCCCGGTNONE 
J065120N21TCGGCCCGGCCCGGTNONE 
J090049D24TCGGCCCGGCCCGGTNONE 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0122200009-052-H10GCCGGGCCGCATGGGCCATNONE 
AB042934GCCGGGCCGCATGGGCCATNONE 
AK065033GCCGGGCCGCATGGGCCATSimilar to 50S ribosomal protein L11. 
J013001H03GCCGGGCCGCATGGGCCATNONE 
J023149C23GCCGGGCCGCATGGGCCATNONE 
J065025J15GCCGGGCCGCATGGGCCATNONE 
J065093D22GCCGGGCCGCATGGGCCATNONE 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0137500006-040-G01GCCGGGCCGTANONE 
015-054-G04GCCGGGCCGTANONE 
AK060148GCCGGGCCGTANONE 
AK073584GCCGGGCCGTANONE 
AK100231GCCGGGCCGTASimilar to VDAC3.1. 
J013146L24GCCGGGCCGTANONE 
J023022O09GCCGGGCCGTANONE 
J023049J19GCCGGGCCGTANONE 
J023133L05GCCGGGCCGTANONE 
J023143P12GCCGGGCCGTANONE 
J033040B12GCCGGGCCGTANONE 
J033050O14GCCGGGCCGTANONE 
J033066G05GCCGGGCCGTANONE 
J065007J18GCCGGGCCGTANONE 
J100067H13GCCGGGCCGTANONE 
Os03g0138600Os03g0138600GCCGGGCCCCACCACProtein of unknown function DUF810 family protein. 
Os03g0142900011-054-A05CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK067103CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK120438CCAGGCCCAGGCCCAGGCCCGGCCCProtein of unknown function DUF946, plant family protein. 
J013097D18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013098E18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013099I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013108C09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J023045J15CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033095F07CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033102N22CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065016C14CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065065F21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065159M09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075012C13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075017P18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075018M03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075021H19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075070K23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075077B18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075085E20CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075090N23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075137M16CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075151E03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090042L02CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090060C21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090089I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100024L19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100025A06CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100033C24CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100052J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100063H10CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100073P04CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100075D01CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100077J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
Os03g0146400AK111974GCCGGGCCGTGSimilar to Lethal leaf-spot 1 (Fragment). 
AK111974GGCCCGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554GCCGGGCCGTGNONE 
AK120554GGCCCGGCCCGTTNONE 
J075060J10GCCGGGCCGTGNONE 
J075060J10GGCCCGGCCCGTTNONE 
Os03g0148000AK110468GCCGGGCCCACAProtein of unknown function DUF677 family protein. 
Os03g0184100AK067400CGGCCCGGCHypothetical protein. 
J013030J24CGGCCCGGCNONE 
J013037M23CGGCCCGGCNONE 
J013106B15CGGCCCGGCNONE 
J013130H10CGGCCCGGCNONE 
J013152B03CGGCCCGGCNONE 
J013157J24CGGCCCGGCNONE 
J013157K04CGGCCCGGCNONE 
J033093A19CGGCCCGGCNONE 
J033106E24CGGCCCGGCNONE 
J090043G12CGGCCCGGCNONE 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0192400009-081-A03AGTGGGCCCGGCCCNONE 
009-159-B02AGTGGGCCCGGCCCNONE 
AK070573AGTGGGCCCGGCCCGRIM-19 family protein. 
J023056B01AGTGGGCCCGGCCCNONE 
J023075G06AGTGGGCCCGGCCCNONE 
J033048K16AGTGGGCCCGGCCCNONE 
J033048L16AGTGGGCCCGGCCCNONE 
J053031H23AGTGGGCCCGGCCCNONE 
J065002H14AGTGGGCCCGGCCCNONE 
J065006G22AGTGGGCCCGGCCCNONE 
J065032G13AGTGGGCCCGGCCCNONE 
J065056A09AGTGGGCCCGGCCCNONE 
J065078I01AGTGGGCCCGGCCCNONE 
J065095G01AGTGGGCCCGGCCCNONE 
J065095I18AGTGGGCCCGGCCCNONE 
J065134M18AGTGGGCCCGGCCCNONE 
J065158P07AGTGGGCCCGGCCCNONE 
J065165K17AGTGGGCCCGGCCCNONE 
J065181J12AGTGGGCCCGGCCCNONE 
J065189N09AGTGGGCCCGGCCCNONE 
J065200D13AGTGGGCCCGGCCCNONE 
J065202H20AGTGGGCCCGGCCCNONE 
J065215K20AGTGGGCCCGGCCCNONE 
J075049N19AGTGGGCCCGGCCCNONE 
J075147J16AGTGGGCCCGGCCCNONE 
J090081E19AGTGGGCCCGGCCCNONE 
J100017C16AGTGGGCCCGGCCCNONE 
J100039M16AGTGGGCCCGGCCCNONE 
J100043E23AGTGGGCCCGGCCCNONE 
J100063L12AGTGGGCCCGGCCCNONE 
J100079F22AGTGGGCCCGGCCCNONE 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0214100AB111916CGGCCCGGCCCATCTNONE 
AF009179CGGCCCGGCCCATCTReplication protein A1. 
AK060582CGGCCCGGCCCATCTNONE 
Os03g0240700009-086-G10GGCCCGGCCCAACANONE 
009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799GGCCCGGCCCAACAConserved hypothetical protein. 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13GGCCCGGCCCAACANONE 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01GGCCCGGCCCAACANONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01GGCCCGGCCCAACANONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22GGCCCGGCCCAACANONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21GGCCCGGCCCAACANONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02GGCCCGGCCCAACANONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
006-092-D05TGTTGGGCCGGGCCNONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK059292TGTTGGGCCGGGCCNONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
AK121552TGTTGGGCCGGGCCNONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J023131D06TGTTGGGCCGGGCCNONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033033E14TGTTGGGCCGGGCCNONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033105B01TGTTGGGCCGGGCCNONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033114L18TGTTGGGCCGGGCCNONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J033132N24TGTTGGGCCGGGCCNONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065032H03TGTTGGGCCGGGCCNONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065115J20TGTTGGGCCGGGCCNONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J065150C05TGTTGGGCCGGGCCNONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302A11TGTTGGGCCGGGCCNONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080302H16TGTTGGGCCGGGCCNONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080305M12TGTTGGGCCGGGCCNONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080306F13TGTTGGGCCGGGCCNONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J080312A06TGTTGGGCCGGGCCNONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
J090088P09TGTTGGGCCGGGCCNONE 
Os03g0248600AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CCAACGGCCCGGCNONE 
AK104877CCAACGGCCCGGCNONE 
J013026L10CCAACGGCCCGGCNONE 
J013055P12CCAACGGCCCGGCNONE 
J023091A14CCAACGGCCCGGCNONE 
J033034G07CCAACGGCCCGGCNONE 
J033048H19CCAACGGCCCGGCNONE 
J033128D07CCAACGGCCCGGCNONE 
J065060L24CCAACGGCCCGGCNONE 
J065176A19CCAACGGCCCGGCNONE 
J090018K08CCAACGGCCCGGCNONE 
J090023C03CCAACGGCCCGGCNONE 
Os03g0261500AK061995GCCCGGCCCGGCNONE 
J013044K20GCCCGGCCCGGCNONE 
J033113A11GCCCGGCCCGGCNONE 
J100032O18GCCCGGCCCGGCNONE 
J100037K21GCCCGGCCCGGCNONE 
Os03g0284000Os03g0284000CACGGCCCGGCCConserved hypothetical protein. 
Os03g0287900009-074-B07GGCCCGGCCCAAGNONE 
014-027-E07GGCCCGGCCCAAGNONE 
AK063663GGCCCGGCCCAAGSimilar to Protein disulfide isomerase. 
J065009N21GGCCCGGCCCAAGNONE 
Os03g0288900AK100329GGCCCGGCCCACCConserved hypothetical protein. 
J023080H15GGCCCGGCCCACCNONE 
J033136I21GGCCCGGCCCACCNONE 
J065036A16GGCCCGGCCCACCNONE 
J065186A16GGCCCGGCCCACCNONE 
J065187B08GGCCCGGCCCACCNONE 
J065202E24GGCCCGGCCCACCNONE 
Os03g0293100AK060680GGCCCGGCCCAAAConserved hypothetical protein. 
J065193F02GGCCCGGCCCAAANONE 
J075003N10GGCCCGGCCCAAANONE 
Os03g0312300AK111364GACGGCCCGGCProtein of unknown function DUF26 domain containing protein. 
Os03g0353400006-092-E01GCCGGCCCGGCNONE 
006-120-A08GCCGGCCCGGCNONE 
009-098-A01GCCGGCCCGGCNONE 
009-139-G01GCCGGCCCGGCNONE 
013-041-E01GCCGGCCCGGCNONE 
013-068-C06GCCGGCCCGGCNONE 
014-014-G01GCCGGCCCGGCNONE 
014-088-E11GCCGGCCCGGCNONE 
AB110172GCCGGCCCGGCNONE 
AK062176GCCGGCCCGGCSimilar to Poly(A)-binding protein C-terminal interacting protein 6. 
AK068753GCCGGCCCGGCNONE 
AY656247GCCGGCCCGGCNONE 
J013049N20GCCGGCCCGGCNONE 
J013072F18GCCGGCCCGGCNONE 
J013089L05GCCGGCCCGGCNONE 
J013099L20GCCGGCCCGGCNONE 
J013131G13GCCGGCCCGGCNONE 
J013157B15GCCGGCCCGGCNONE 
J013158E09GCCGGCCCGGCNONE 
J023013I18GCCGGCCCGGCNONE 
J023019G19GCCGGCCCGGCNONE 
J023027C18GCCGGCCCGGCNONE 
J023052J24GCCGGCCCGGCNONE 
J023080N08GCCGGCCCGGCNONE 
J033043F21GCCGGCCCGGCNONE 
J033044C08GCCGGCCCGGCNONE 
J033086N04GCCGGCCCGGCNONE 
J065041E07GCCGGCCCGGCNONE 
J065067N17GCCGGCCCGGCNONE 
J065082H19GCCGGCCCGGCNONE 
J065104D20GCCGGCCCGGCNONE 
J065105P09GCCGGCCCGGCNONE 
J065114D01GCCGGCCCGGCNONE 
J065119D15GCCGGCCCGGCNONE 
J065134G02GCCGGCCCGGCNONE 
J065143D06GCCGGCCCGGCNONE 
J065170G14GCCGGCCCGGCNONE 
J065178K06GCCGGCCCGGCNONE 
J065208P11GCCGGCCCGGCNONE 
J075004A10GCCGGCCCGGCNONE 
J075034E12GCCGGCCCGGCNONE 
J075035P22GCCGGCCCGGCNONE 
J075065O16GCCGGCCCGGCNONE 
J075070M03GCCGGCCCGGCNONE 
J075115B03GCCGGCCCGGCNONE 
J075190B04GCCGGCCCGGCNONE 
J080002C13GCCGGCCCGGCNONE 
J080010I08GCCGGCCCGGCNONE 
J080017L24GCCGGCCCGGCNONE 
J080023D11GCCGGCCCGGCNONE 
J080025A02GCCGGCCCGGCNONE 
J080025N09GCCGGCCCGGCNONE 
J080035D22GCCGGCCCGGCNONE 
J080038L13GCCGGCCCGGCNONE 
J080042F06GCCGGCCCGGCNONE 
J080043H05GCCGGCCCGGCNONE 
J080048K17GCCGGCCCGGCNONE 
J080053M20GCCGGCCCGGCNONE 
J080056I23GCCGGCCCGGCNONE 
J080057J06GCCGGCCCGGCNONE 
J080058C18GCCGGCCCGGCNONE 
J080062I15GCCGGCCCGGCNONE 
J080080E19GCCGGCCCGGCNONE 
J080096K12GCCGGCCCGGCNONE 
J090004M12GCCGGCCCGGCNONE 
J090055H05GCCGGCCCGGCNONE 
J090062J17GCCGGCCCGGCNONE 
J100044K10GCCGGCCCGGCNONE 
J100047I15GCCGGCCCGGCNONE 
J100047K03GCCGGCCCGGCNONE 
J100058I20GCCGGCCCGGCNONE 
J100067P14GCCGGCCCGGCNONE 
J100074F02GCCGGCCCGGCNONE 
Os03g0374400016-027-B12GGCCGGGCCCCACCCGNONE 
AK069719GGCCGGGCCCCACCCGConserved hypothetical protein. 
J023020L05GGCCGGGCCCCACCCGNONE 
J023026H16GGCCGGGCCCCACCCGNONE 
J033025P22GGCCGGGCCCCACCCGNONE 
J075016I21GGCCGGGCCCCACCCGNONE 
J090015G21GGCCGGGCCCCACCCGNONE 
Os03g0374500Os03g0374500GGCCGGGCCCCACCCGHypothetical protein. 
Os03g0391400AK105821GCCGGGCCSimilar to Phospholipase D nu-2 (Fragment). 
Os03g0633800AK073044GGCCCGGCSimilar to IAA6 (Fragment). 
J065038L22GGCCCGGCNONE 
J065185C13GGCCCGGCNONE 
Os03g0701900AK068404GGCCCGGCCConserved hypothetical protein. 
Os03g0736300AK104929GGCCGGGCCGGGCNONE 
Os03g0737600014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0740700011-093-H12GGCCCGGCCCATCCNONE 
AK102723GGCCCGGCCCATCCProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19GGCCCGGCCCATCCNONE 
J013126N16GGCCCGGCCCATCCNONE 
J033105J16GGCCCGGCCCATCCNONE 
J090059D19GGCCCGGCCCATCCNONE 
Os03g0751400AK069033GGCCCGGCCSimilar to 50S ribosomal protein l6. 
J023004G24GGCCCGGCCNONE 
J065176D08GGCCCGGCCNONE 
Os03g0760500AK100633GCCGGGCCCytochrome P450 family protein. 
Os03g0776400015-009-D03GCCGGGCCGGCNONE 
AK106237GCCGGGCCGGCConserved hypothetical protein. 
J100024C12GCCGGGCCGGCNONE 
J100083J23GCCGGGCCGGCNONE 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0807200011-031-F07GGCCCGGCNONE 
011-031-F07GGGCCGGGCCGGCNONE 
011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932GGCCCGGCNONE 
AK063932GGGCCGGGCCGGCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496GGCCCGGCProtein of unknown function DUF1639 family protein. 
AK103496GGGCCGGGCCGGCProtein of unknown function DUF1639 family protein. 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04GGCCCGGCNONE 
J033131A04GGGCCGGGCCGGCNONE 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03GGCCCGGCNONE 
J065109O03GGGCCGGGCCGGCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11GGCCCGGCNONE 
J080001M11GGGCCGGGCCGGCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18GGCCCGGCNONE 
J080002H18GGGCCGGGCCGGCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08GGCCCGGCNONE 
J080005I08GGGCCGGGCCGGCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05GGCCCGGCNONE 
J080006B05GGGCCGGGCCGGCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17GGCCCGGCNONE 
J080006D17GGGCCGGGCCGGCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19GGCCCGGCNONE 
J080007M19GGGCCGGGCCGGCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07GGCCCGGCNONE 
J080011E07GGGCCGGGCCGGCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06GGCCCGGCNONE 
J080012H06GGGCCGGGCCGGCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08GGCCCGGCNONE 
J080014D08GGGCCGGGCCGGCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06GGCCCGGCNONE 
J080017D06GGGCCGGGCCGGCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17GGCCCGGCNONE 
J080017K17GGGCCGGGCCGGCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17GGCCCGGCNONE 
J080020B17GGGCCGGGCCGGCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05GGCCCGGCNONE 
J080021O05GGGCCGGGCCGGCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15GGCCCGGCNONE 
J080021O15GGGCCGGGCCGGCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18GGCCCGGCNONE 
J080023I18GGGCCGGGCCGGCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21GGCCCGGCNONE 
J080025A21GGGCCGGGCCGGCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22GGCCCGGCNONE 
J080027P22GGGCCGGGCCGGCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22GGCCCGGCNONE 
J080028M22GGGCCGGGCCGGCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09GGCCCGGCNONE 
J080029B09GGGCCGGGCCGGCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07GGCCCGGCNONE 
J080029M07GGGCCGGGCCGGCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17GGCCCGGCNONE 
J080029M17GGGCCGGGCCGGCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23GGCCCGGCNONE 
J080030H23GGGCCGGGCCGGCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16GGCCCGGCNONE 
J080030K16GGGCCGGGCCGGCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19GGCCCGGCNONE 
J080030L19GGGCCGGGCCGGCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12GGCCCGGCNONE 
J080031A12GGGCCGGGCCGGCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21GGCCCGGCNONE 
J080031N21GGGCCGGGCCGGCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05GGCCCGGCNONE 
J080032G05GGGCCGGGCCGGCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20GGCCCGGCNONE 
J080032P20GGGCCGGGCCGGCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20GGCCCGGCNONE 
J080033H20GGGCCGGGCCGGCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22GGCCCGGCNONE 
J080034H22GGGCCGGGCCGGCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03GGCCCGGCNONE 
J080034J03GGGCCGGGCCGGCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16GGCCCGGCNONE 
J080034J16GGGCCGGGCCGGCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01GGCCCGGCNONE 
J080034N01GGGCCGGGCCGGCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20GGCCCGGCNONE 
J080035K20GGGCCGGGCCGGCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04GGCCCGGCNONE 
J080036I04GGGCCGGGCCGGCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19GGCCCGGCNONE 
J080036I19GGGCCGGGCCGGCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21GGCCCGGCNONE 
J080036O21GGGCCGGGCCGGCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06GGCCCGGCNONE 
J080038D06GGGCCGGGCCGGCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15GGCCCGGCNONE 
J080039J15GGGCCGGGCCGGCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18GGCCCGGCNONE 
J080039P18GGGCCGGGCCGGCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20GGCCCGGCNONE 
J080041H20GGGCCGGGCCGGCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11GGCCCGGCNONE 
J080041M11GGGCCGGGCCGGCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14GGCCCGGCNONE 
J080042F14GGGCCGGGCCGGCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10GGCCCGGCNONE 
J080043G10GGGCCGGGCCGGCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02GGCCCGGCNONE 
J080043J02GGGCCGGGCCGGCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19GGCCCGGCNONE 
J080044C19GGGCCGGGCCGGCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11GGCCCGGCNONE 
J080044G11GGGCCGGGCCGGCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03GGCCCGGCNONE 
J080045M03GGGCCGGGCCGGCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07GGCCCGGCNONE 
J080045N07GGGCCGGGCCGGCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14GGCCCGGCNONE 
J080047K14GGGCCGGGCCGGCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21GGCCCGGCNONE 
J080049I21GGGCCGGGCCGGCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06GGCCCGGCNONE 
J080050A06GGGCCGGGCCGGCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16GGCCCGGCNONE 
J080050I16GGGCCGGGCCGGCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16GGCCCGGCNONE 
J080050N16GGGCCGGGCCGGCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23GGCCCGGCNONE 
J080052C23GGGCCGGGCCGGCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18GGCCCGGCNONE 
J080052D18GGGCCGGGCCGGCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20GGCCCGGCNONE 
J080052F20GGGCCGGGCCGGCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23GGCCCGGCNONE 
J080052F23GGGCCGGGCCGGCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03GGCCCGGCNONE 
J080053M03GGGCCGGGCCGGCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13GGCCCGGCNONE 
J080054G13GGGCCGGGCCGGCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12GGCCCGGCNONE 
J080054H12GGGCCGGGCCGGCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03GGCCCGGCNONE 
J080055N03GGGCCGGGCCGGCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07GGCCCGGCNONE 
J080056E07GGGCCGGGCCGGCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04GGCCCGGCNONE 
J080057L04GGGCCGGGCCGGCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19GGCCCGGCNONE 
J080063O19GGGCCGGGCCGGCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21GGCCCGGCNONE 
J080064E21GGGCCGGGCCGGCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18GGCCCGGCNONE 
J080065D18GGGCCGGGCCGGCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18GGCCCGGCNONE 
J080065F18GGGCCGGGCCGGCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14GGCCCGGCNONE 
J080065H14GGGCCGGGCCGGCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15GGCCCGGCNONE 
J080065K15GGGCCGGGCCGGCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24GGCCCGGCNONE 
J080065M24GGGCCGGGCCGGCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18GGCCCGGCNONE 
J080066B18GGGCCGGGCCGGCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19GGCCCGGCNONE 
J080066B19GGGCCGGGCCGGCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19GGCCCGGCNONE 
J080071H19GGGCCGGGCCGGCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18GGCCCGGCNONE 
J080072E18GGGCCGGGCCGGCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21GGCCCGGCNONE 
J080074K21GGGCCGGGCCGGCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06GGCCCGGCNONE 
J080075B06GGGCCGGGCCGGCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07GGCCCGGCNONE 
J080076H07GGGCCGGGCCGGCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16GGCCCGGCNONE 
J080079D16GGGCCGGGCCGGCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20GGCCCGGCNONE 
J080082B20GGGCCGGGCCGGCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16GGCCCGGCNONE 
J080084N16GGGCCGGGCCGGCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07GGCCCGGCNONE 
J080085L07GGGCCGGGCCGGCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04GGCCCGGCNONE 
J080086L04GGGCCGGGCCGGCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07GGCCCGGCNONE 
J080086M07GGGCCGGGCCGGCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02GGCCCGGCNONE 
J080087D02GGGCCGGGCCGGCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15GGCCCGGCNONE 
J080087D15GGGCCGGGCCGGCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19GGCCCGGCNONE 
J080087J19GGGCCGGGCCGGCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20GGCCCGGCNONE 
J080088G20GGGCCGGGCCGGCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15GGCCCGGCNONE 
J080092M15GGGCCGGGCCGGCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10GGCCCGGCNONE 
J080093O10GGGCCGGGCCGGCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09GGCCCGGCNONE 
J080095L09GGGCCGGGCCGGCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18GGCCCGGCNONE 
J080096A18GGGCCGGGCCGGCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03GGCCCGGCNONE 
J080097C03GGGCCGGGCCGGCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07GGCCCGGCNONE 
J090019J07GGGCCGGGCCGGCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12GGCCCGGCNONE 
J090024N12GGGCCGGGCCGGCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09GGCCCGGCNONE 
J090049I09GGGCCGGGCCGGCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE 
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein. 
AK070287GACACGTGGGGCCCGGCNONE 
J023049O16GACACGTGGGGCCCGGCNONE 
J100025I21GACACGTGGGGCCCGGCNONE 
J100035K21GACACGTGGGGCCCGGCNONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0822700005-010-E01GACGGCCCGGCCCNONE 
006-088-H12GACGGCCCGGCCCNONE 
AK061682GACGGCCCGGCCCNONE 
AK101448GACGGCCCGGCCCArmadillo-like helical domain containing protein. 
J023091N05GACGGCCCGGCCCNONE 
Os03g0831100AK103115AACGGCCCGGCCArmadillo-like helical domain containing protein. 
J033119F15AACGGCCCGGCCNONE 
J065011M19AACGGCCCGGCCNONE 
J075019I08AACGGCCCGGCCNONE 
J075047A01AACGGCCCGGCCNONE 
J075096P21AACGGCCCGGCCNONE 
J075121I05AACGGCCCGGCCNONE 
J075121I07AACGGCCCGGCCNONE 
J090063F13AACGGCCCGGCCNONE 
J090068F16AACGGCCCGGCCNONE 
J090094E14AACGGCCCGGCCNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0847500AK073859GCCGGGCCCSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os04g0208400AK069629GCCGGCCCGGCACGGCCCAGCCyclin-like F-box domain containing protein. 
AK069629GCTGGGCCGGGCCGCyclin-like F-box domain containing protein. 
Os04g0283800AK109869CGGCCCGGCOcticosapeptide/Phox/Bem1p domain containing protein. 
Os04g0378200AK103076GGGCCGGGCCGGGSterile alpha motif SAM domain containing protein. 
J033118E02GGGCCGGGCCGGGNONE 
J065065F15GGGCCGGGCCGGGNONE 
J090080I24GGGCCGGGCCGGGNONE 
Os04g0388900AK063224CAAGGCCCGGCCCATCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CAAGGCCCGGCCCATCANONE 
J065148P22CAAGGCCCGGCCCATCANONE 
J075040G12CAAGGCCCGGCCCATCANONE 
Os04g0445100014-052-B04TCCGGCCCGGCNONE 
AK063700TCCGGCCCGGCSimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0486400AJ535489GGGCCGGGCCGGGCCGAANONE 
AK103296GGGCCGGGCCGGGCCGAARML1 protein. 
J013045L03GGGCCGGGCCGGGCCGAANONE 
J013045M03GGGCCGGGCCGGGCCGAANONE 
J033034L24GGGCCGGGCCGGGCCGAANONE 
J033125B02GGGCCGGGCCGGGCCGAANONE 
J075001G08GGGCCGGGCCGGGCCGAANONE 
J075011I16GGGCCGGGCCGGGCCGAANONE 
J075033M08GGGCCGGGCCGGGCCGAANONE 
J075044G01GGGCCGGGCCGGGCCGAANONE 
J075047D04GGGCCGGGCCGGGCCGAANONE 
J075061J09GGGCCGGGCCGGGCCGAANONE 
J075085L07GGGCCGGGCCGGGCCGAANONE 
J075087D20GGGCCGGGCCGGGCCGAANONE 
J075117A04GGGCCGGGCCGGGCCGAANONE 
J075134H06GGGCCGGGCCGGGCCGAANONE 
J075184J12GGGCCGGGCCGGGCCGAANONE 
Os04g0490500AK065576GCCGGGCCCCSimilar to Pto kinase interactor 1. 
J080004D10GCCGGGCCCCNONE 
J080083C02GCCGGGCCCCNONE 
J080083G13GCCGGGCCCCNONE 
J080097F03GCCGGGCCCCNONE 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0555700AK069329CGGCCCGGCSimilar to Actin-depolymerizing factor (ADF). 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0635700009-079-G03GGCCCGGCCNONE 
AK062025GGCCCGGCCRibbon-helix-helix domain containing protein. 
AK098916GGCCCGGCCNONE 
J013002J07GGCCCGGCCNONE 
J013109L20GGCCCGGCCNONE 
J023055C07GGCCCGGCCNONE 
J065036K04GGCCCGGCCNONE 
J065164G12GGCCCGGCCNONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0683800011-050-B05CTCGGCCCGGCCCNONE 
AK073897CTCGGCCCGGCCCSimilar to Phosphoribosyltransferase (Fragment). 
AK102910CTCGGCCCGGCCCNONE 
J033075A06CTCGGCCCGGCCCNONE 
J033079F23CTCGGCCCGGCCCNONE 
J033093D20CTCGGCCCGGCCCNONE 
J033099B18CTCGGCCCGGCCCNONE 
J033129G13CTCGGCCCGGCCCNONE 
J065075F21CTCGGCCCGGCCCNONE 
J065093M19CTCGGCCCGGCCCNONE 
J075023K10CTCGGCCCGGCCCNONE 
J075046J08CTCGGCCCGGCCCNONE 
J090003I20CTCGGCCCGGCCCNONE 
J090017L12CTCGGCCCGGCCCNONE 
J090024B04CTCGGCCCGGCCCNONE 
J090033A20CTCGGCCCGGCCCNONE 
J090083F02CTCGGCCCGGCCCNONE 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0223300AK069616CCCGGCCCGGCCCGGCCCGCASimilar to RNA-binding protein. 
J080093O15CCCGGCCCGGCCCGGCCCGCANONE 
J090061N02CCCGGCCCGGCCCGGCCCGCANONE 
Os05g0227700AK067567GGCCGGGCCConserved hypothetical protein. 
AK068760GGCCGGGCCNONE 
J013108C14GGCCGGGCCNONE 
Os05g0379300AK109293TCTGGCCCGGCConserved hypothetical protein. 
Os05g0397700AK067298GGCCGGGCCGGGCCGGTSecY protein family protein. 
Os05g0414200015-033-G02TCCGACGGCGGCCCGGCCNONE 
AK106297TCCGACGGCGGCCCGGCCDisease resistance protein family protein. 
Os05g0430300AK121670GGGCCCGGCCCProtein of unknown function DUF668 family protein. 
Os05g0437800015-045-B10CCAGGCCCGGCCCACANONE 
AK106328CCAGGCCCGGCCCACAConserved hypothetical protein. 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0475700AK066119GCCGGGCCNodulin-like domain containing protein. 
AK105733GCCGGGCCNONE 
J075031E06GCCGGGCCNONE 
J075124I07GCCGGGCCNONE 
J075161H10GCCGGGCCNONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE 
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A. 
Os05g0548100AK060333GGCCGGGCCConserved hypothetical protein. 
AK100682GGCCGGGCCNONE 
J013151E01GGCCGGGCCNONE 
J023113L22GGCCGGGCCNONE 
J043027A19GGCCGGGCCNONE 
J075093E06GGCCGGGCCNONE 
J090060D15GGCCGGGCCNONE 
J090082J03GGCCGGGCCNONE 
J100050E01GGCCGGGCCNONE 
Os05g0563500AK121924GGCCGGGCCCConserved hypothetical protein. 
J033106F17GGCCGGGCCCNONE 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0114600015-077-E06CCTGGGCCGGGCCNONE 
AK067972CCTGGGCCGGGCCConserved hypothetical protein. 
Os06g0140100011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0150600011-051-F03GGCCGGGCCGTANONE 
AK063346GGCCGGGCCGTATransferase family protein. 
Os06g0157800AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0168000AK059250CTTGGGCCGGGCCNONE 
AK099356CTTGGGCCGGGCCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19CTTGGGCCGGGCCNONE 
J033097H04CTTGGGCCGGGCCNONE 
J075087M11CTTGGGCCGGGCCNONE 
J075146H06CTTGGGCCGGGCCNONE 
J075188H11CTTGGGCCGGGCCNONE 
J090071D03CTTGGGCCGGGCCNONE 
J090097L20CTTGGGCCGGGCCNONE 
J100051M05CTTGGGCCGGGCCNONE 
J100082H13CTTGGGCCGGGCCNONE 
Os06g0212900AK071518GGCCGGGCCCCACTCCHeat shock protein Hsp70 family protein. 
AK104048GGCCGGGCCCCACTCCNONE 
J023019O18GGCCGGGCCCCACTCCNONE 
J023090N13GGCCGGGCCCCACTCCNONE 
J023101M15GGCCGGGCCCCACTCCNONE 
J023122F06GGCCGGGCCCCACTCCNONE 
J075023H16GGCCGGGCCCCACTCCNONE 
J090006J22GGCCGGGCCCCACTCCNONE 
J090075F24GGCCGGGCCCCACTCCNONE 
J090095A17GGCCGGGCCCCACTCCNONE 
Os06g0226500009-030-E06TGTGGGCCCGGCCCNONE 
AK071601TGTGGGCCCGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J023102C01TGTGGGCCCGGCCCNONE 
Os06g0247800AK102187GGCCCGGCCCAACCSimilar to Dynamin-like protein (Fragment). 
AY224491GGCCCGGCCCAACCNONE 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
AK120884GGCCCGGCCCGGTSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCAACGCCCAGCCCNONE 
J013089A14GGCCCGGCCCGGTNONE 
J023028N24GGCCCGGCCCAACGCCCAGCCCNONE 
J023028N24GGCCCGGCCCGGTNONE 
J033098H21GGCCCGGCCCAACGCCCAGCCCNONE 
J033098H21GGCCCGGCCCGGTNONE 
J033118G04GGCCCGGCCCAACGCCCAGCCCNONE 
J033118G04GGCCCGGCCCGGTNONE 
J090056P15GGCCCGGCCCAACGCCCAGCCCNONE 
J090056P15GGCCCGGCCCGGTNONE 
J090062B02GGCCCGGCCCAACGCCCAGCCCNONE 
J090062B02GGCCCGGCCCGGTNONE 
J100024B09GGCCCGGCCCAACGCCCAGCCCNONE 
J100024B09GGCCCGGCCCGGTNONE 
J100060I04GGCCCGGCCCAACGCCCAGCCCNONE 
J100060I04GGCCCGGCCCGGTNONE 
J100078H11GGCCCGGCCCAACGCCCAGCCCNONE 
J100078H11GGCCCGGCCCGGTNONE 
J100080A14GGCCCGGCCCAACGCCCAGCCCNONE 
J100080A14GGCCCGGCCCGGTNONE 
J100086F18GGCCCGGCCCAACGCCCAGCCCNONE 
J100086F18GGCCCGGCCCGGTNONE 
Os06g0324400014-079-C07GGCCCGGCNONE 
AK063726GGCCCGGCLate embryogenesis abundant (LEA) group 1 family protein. 
J065159N12GGCCCGGCNONE 
J075053K06GGCCCGGCNONE 
Os06g0530200009-042-B02TGTTGGGCCGGGCCNONE 
009-050-E10TGTTGGGCCGGGCCNONE 
009-060-F07TGTTGGGCCGGGCCNONE 
009-117-H08TGTTGGGCCGGGCCNONE 
009-129-C10TGTTGGGCCGGGCCNONE 
AK073116TGTTGGGCCGGGCCConserved hypothetical protein. 
AK104077TGTTGGGCCGGGCCNONE 
J065032N16TGTTGGGCCGGGCCNONE 
J065153K07TGTTGGGCCGGGCCNONE 
J065169N18TGTTGGGCCGGGCCNONE 
J065190H18TGTTGGGCCGGGCCNONE 
J075127E14TGTTGGGCCGGGCCNONE 
J090008F20TGTTGGGCCGGGCCNONE 
Os06g0551400009-003-D11CCCACCCGGCCCGGCCCACANONE 
011-025-C09CCCACCCGGCCCGGCCCACANONE 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
D13758CCCACCCGGCCCGGCCCACANONE 
J013069H14CCCACCCGGCCCGGCCCACANONE 
J053037J07CCCACCCGGCCCGGCCCACANONE 
J065011J03CCCACCCGGCCCGGCCCACANONE 
J065078L15CCCACCCGGCCCGGCCCACANONE 
J065103H24CCCACCCGGCCCGGCCCACANONE 
J065157A07CCCACCCGGCCCGGCCCACANONE 
J065213P12CCCACCCGGCCCGGCCCACANONE 
J090007P04CCCACCCGGCCCGGCCCACANONE 
J090052N23CCCACCCGGCCCGGCCCACANONE 
Os06g0564700AK070508GCCGGCCCGGCCSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23GCCGGCCCGGCCNONE 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0585200016-065-C02CACGGCCCGGCCNONE 
016-065-C02GCCGGGCCGGGCCGTGNONE 
AK068592CACGGCCCGGCCNONE 
AK068592GCCGGGCCGGGCCGTGNONE 
AK073844CACGGCCCGGCCNONE 
AK073844GCCGGGCCGGGCCGTGNONE 
AK106549CACGGCCCGGCCConserved hypothetical protein. 
AK106549GCCGGGCCGGGCCGTGConserved hypothetical protein. 
J013154A14CACGGCCCGGCCNONE 
J013154A14GCCGGGCCGGGCCGTGNONE 
J100049K24CACGGCCCGGCCNONE 
J100049K24GCCGGGCCGGGCCGTGNONE 
J100059C18CACGGCCCGGCCNONE 
J100059C18GCCGGGCCGGGCCGTGNONE 
J100082N13CACGGCCCGGCCNONE 
J100082N13GCCGGGCCGGGCCGTGNONE 
Os06g0682800011-092-E01GCCGGGCCACATGGGCCGGANONE 
AK064816GCCGGGCCACATGGGCCGGAZinc finger, CCCH-type domain containing protein. 
J013000E13GCCGGGCCACATGGGCCGGANONE 
J013035J22GCCGGGCCACATGGGCCGGANONE 
J013045M06GCCGGGCCACATGGGCCGGANONE 
J013120A07GCCGGGCCACATGGGCCGGANONE 
J033144H15GCCGGGCCACATGGGCCGGANONE 
J033145H15GCCGGGCCACATGGGCCGGANONE 
J033145N16GCCGGGCCACATGGGCCGGANONE 
J090019J02GCCGGGCCACATGGGCCGGANONE 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os06g0704300AK107008ATCTGGGCCGGGCCCZinc finger, CCCH-type domain containing protein. 
J065038I12ATCTGGGCCGGGCCCNONE 
J065079E03ATCTGGGCCGGGCCCNONE 
J075035B15ATCTGGGCCGGGCCCNONE 
J090072D21ATCTGGGCCGGGCCCNONE 
Os06g0717400AK072887GCCGGCCCGGCCCATTTPseudouridine synthase, Rlu family protein. 
Os06g0725400J065086O07AATGGGCCGGGCCGGTSimilar to BLE1 protein. 
J065114J19AATGGGCCGGGCCGGTNONE 
Os07g0105300AK107419GCCGGGCCTGGGCCGGCConserved hypothetical protein. 
AK107419GGGCCGGCCCGGCConserved hypothetical protein. 
AK109521GCCGGGCCTGGGCCGGCNONE 
AK109521GGGCCGGCCCGGCNONE 
Os07g0110800009-107-B11GGCCCGGCCCATCANONE 
AK062792GGCCCGGCCCATCAConserved hypothetical protein. 
J053026P09GGCCCGGCCCATCANONE 
J053074L17GGCCCGGCCCATCANONE 
J065057E24GGCCCGGCCCATCANONE 
J065149B18GGCCCGGCCCATCANONE 
J075002O20GGCCCGGCCCATCANONE 
J090002C13GGCCCGGCCCATCANONE 
Os07g0110900AK058987TGATGGGCCGGGCCConserved hypothetical protein. 
J065032L02TGATGGGCCGGGCCNONE 
J065074H06TGATGGGCCGGGCCNONE 
J065168M23TGATGGGCCGGGCCNONE 
Os07g0113200AK108787GGCCCGGCCCATCAConserved hypothetical protein. 
J065090J04GGCCCGGCCCATCANONE 
J065116K24GGCCCGGCCCATCANONE 
J065161F14GGCCCGGCCCATCANONE 
J065203E23GGCCCGGCCCATCANONE 
Os07g0144200Os07g0144200GGCCCGGCCCGGCCCHypothetical protein. 
Os07g0158900AK064980GCCGGGCCGTGCyclin-like F-box domain containing protein. 
AK064980GGCCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os07g0181500AK072431GCCGGGCCCACCTGTCProtein of unknown function DUF506, plant family protein. 
Os07g0206900AK107761GGCCGGGCCGGCProtein of unknown function DUF642 family protein. 
Os07g0207400014-085-E12GCCGGGCCNONE 
AK063732GCCGGGCCSimilar to RF12 protein (Fragment). 
Os07g0246200012-046-B07GCCGGGCCCACCCGNONE 
AB021259GCCGGGCCCACCCGNONE 
AK065341GCCGGGCCCACCCGSimilar to Calreticulin (Fragment). 
AK099348GCCGGGCCCACCCGNONE 
AK104328GCCGGGCCCACCCGNONE 
AK104826GCCGGGCCCACCCGNONE 
J013000E04GCCGGGCCCACCCGNONE 
J013093M19GCCGGGCCCACCCGNONE 
J013108J08GCCGGGCCCACCCGNONE 
J013118G03GCCGGGCCCACCCGNONE 
J013121I07GCCGGGCCCACCCGNONE 
J013153K07GCCGGGCCCACCCGNONE 
J023028N07GCCGGGCCCACCCGNONE 
J023034F12GCCGGGCCCACCCGNONE 
J023043J11GCCGGGCCCACCCGNONE 
J023087A03GCCGGGCCCACCCGNONE 
J023099N05GCCGGGCCCACCCGNONE 
J023105B02GCCGGGCCCACCCGNONE 
J023110H02GCCGGGCCCACCCGNONE 
J023112E15GCCGGGCCCACCCGNONE 
J023132C20GCCGGGCCCACCCGNONE 
J023134G12GCCGGGCCCACCCGNONE 
J023138O12GCCGGGCCCACCCGNONE 
J033031E05GCCGGGCCCACCCGNONE 
J033032C03GCCGGGCCCACCCGNONE 
J033039K10GCCGGGCCCACCCGNONE 
J033050P09GCCGGGCCCACCCGNONE 
J033074D03GCCGGGCCCACCCGNONE 
J033075G14GCCGGGCCCACCCGNONE 
J033075I23GCCGGGCCCACCCGNONE 
J033081H23GCCGGGCCCACCCGNONE 
J033087N08GCCGGGCCCACCCGNONE 
J033110B03GCCGGGCCCACCCGNONE 
J033148H22GCCGGGCCCACCCGNONE 
J043027F13GCCGGGCCCACCCGNONE 
J043031H01GCCGGGCCCACCCGNONE 
J080003O10GCCGGGCCCACCCGNONE 
J080022D10GCCGGGCCCACCCGNONE 
J080029I12GCCGGGCCCACCCGNONE 
J080034A09GCCGGGCCCACCCGNONE 
J080035H20GCCGGGCCCACCCGNONE 
J080049C10GCCGGGCCCACCCGNONE 
J080053G14GCCGGGCCCACCCGNONE 
J080055J22GCCGGGCCCACCCGNONE 
J080058J04GCCGGGCCCACCCGNONE 
J080069E14GCCGGGCCCACCCGNONE 
J080069M23GCCGGGCCCACCCGNONE 
J080072E19GCCGGGCCCACCCGNONE 
J080072I03GCCGGGCCCACCCGNONE 
J080075B13GCCGGGCCCACCCGNONE 
J080078I11GCCGGGCCCACCCGNONE 
J080081F16GCCGGGCCCACCCGNONE 
J080088O10GCCGGGCCCACCCGNONE 
J080089G18GCCGGGCCCACCCGNONE 
J090009C10GCCGGGCCCACCCGNONE 
J090022D23GCCGGGCCCACCCGNONE 
J090023A15GCCGGGCCCACCCGNONE 
J090024M10GCCGGGCCCACCCGNONE 
J090038F24GCCGGGCCCACCCGNONE 
J090039O13GCCGGGCCCACCCGNONE 
J090040N12GCCGGGCCCACCCGNONE 
J090054I18GCCGGGCCCACCCGNONE 
J090061C16GCCGGGCCCACCCGNONE 
J090063H23GCCGGGCCCACCCGNONE 
J090067F21GCCGGGCCCACCCGNONE 
J090075A01GCCGGGCCCACCCGNONE 
J090076K11GCCGGGCCCACCCGNONE 
J090078L11GCCGGGCCCACCCGNONE 
J090079P03GCCGGGCCCACCCGNONE 
J090087D23GCCGGGCCCACCCGNONE 
J090087G22GCCGGGCCCACCCGNONE 
J090089F03GCCGGGCCCACCCGNONE 
J090092A04GCCGGGCCCACCCGNONE 
J100024L17GCCGGGCCCACCCGNONE 
J100031P13GCCGGGCCCACCCGNONE 
J100032H05GCCGGGCCCACCCGNONE 
J100036P03GCCGGGCCCACCCGNONE 
J100038L07GCCGGGCCCACCCGNONE 
J100043I20GCCGGGCCCACCCGNONE 
J100069A21GCCGGGCCCACCCGNONE 
J100078G06GCCGGGCCCACCCGNONE 
J100081J24GCCGGGCCCACCCGNONE 
J100081N04GCCGGGCCCACCCGNONE 
J100084K16GCCGGGCCCACCCGNONE 
J100085O06GCCGGGCCCACCCGNONE 
J100088L13GCCGGGCCCACCCGNONE 
J100090O21GCCGGGCCCACCCGNONE 
Os07g0258400AK121534CTCGGCCCGGCCCACCTNONE 
L41217CTCGGCCCGGCCCACCTNONE 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0301200AB110202GCCGGCCCGGCACGGCCCAGCNONE 
AB110202GCTGGGCCGGGCCGNONE 
AK073463GCCGGCCCGGCACGGCCCAGCSimilar to RNA helicase (Fragment). 
AK073463GCTGGGCCGGGCCGSimilar to RNA helicase (Fragment). 
Os07g0408100AK108466GCCGGGCCGTGNONE 
AK111780GCCGGGCCGTGWD40-like domain containing protein. 
Os07g0496200AK064866CACGGCCCGGCCNONE 
AK065801CACGGCCCGGCCSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0516200AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
Os07g0516900009-108-C10GCCGGGCCCNONE 
AK062798GCCGGGCCCNONE 
Os07g0546000AF188065GGCCCGGCCCGGCCGGCCCACCNONE 
AK061800GGCCCGGCCCGGCCGGCCCACCNONE 
AK065871GGCCCGGCCCGGCCGGCCCACCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02GGCCCGGCCCGGCCGGCCCACCNONE 
J013035F03GGCCCGGCCCGGCCGGCCCACCNONE 
J013044J20GGCCCGGCCCGGCCGGCCCACCNONE 
Os07g0555400AK070977GCTGGGCCGGGCCGCCCATTTConserved hypothetical protein. 
AK070977GGGCCGGCCCGGCConserved hypothetical protein. 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0585800006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305F09TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080311G07TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080315B14TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
J080317C02TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
Os07g0659500AK073537GGCCCGGCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0690300012-048-A07GCCGGGCCCACGGGNONE 
AK099674GCCGGGCCCACGGGChromatin SPT2 family protein. 
J013028F12GCCGGGCCCACGGGNONE 
J013069F21GCCGGGCCCACGGGNONE 
J013104E17GCCGGGCCCACGGGNONE 
J013153M16GCCGGGCCCACGGGNONE 
J023012L09GCCGGGCCCACGGGNONE 
J023069A08GCCGGGCCCACGGGNONE 
J023132L23GCCGGGCCCACGGGNONE 
J033120P19GCCGGGCCCACGGGNONE 
J065173J03GCCGGGCCCACGGGNONE 
J075008H06GCCGGGCCCACGGGNONE 
J075043J15GCCGGGCCCACGGGNONE 
J075147I12GCCGGGCCCACGGGNONE 
J090041G07GCCGGGCCCACGGGNONE 
Os08g0127500AK071322GCCGGGCCCACAAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
J023087N16GCCGGGCCCACANONE 
J065146A20GCCGGGCCCACANONE 
J075043F12GCCGGGCCCACANONE 
J090015B21GCCGGGCCCACANONE 
Os08g0139100006-027-E12GGCCCGGCCCGGCCCGGCCCACTNONE 
006-089-E06GGCCCGGCCCGGCCCGGCCCACTNONE 
006-113-G02GGCCCGGCCCGGCCCGGCCCACTNONE 
AK061429GGCCCGGCCCGGCCCGGCCCACTNONE 
AK099590GGCCCGGCCCGGCCCGGCCCACTSimilar to DAG protein, chloroplast precursor. 
AK104727GGCCCGGCCCGGCCCGGCCCACTNONE 
J013043H11GGCCCGGCCCGGCCCGGCCCACTNONE 
J013049N13GGCCCGGCCCGGCCCGGCCCACTNONE 
J065079F01GGCCCGGCCCGGCCCGGCCCACTNONE 
J065122N24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065142J24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065193N03GGCCCGGCCCGGCCCGGCCCACTNONE 
J075041I21GGCCCGGCCCGGCCCGGCCCACTNONE 
J075145E04GGCCCGGCCCGGCCCGGCCCACTNONE 
Os08g0161700009-088-D09AAATGGGCCTTATTGGGCCGGGCCNONE 
009-131-H02AAATGGGCCTTATTGGGCCGGGCCNONE 
009-182-D04AAATGGGCCTTATTGGGCCGGGCCNONE 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
J075002M21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075090H12AAATGGGCCTTATTGGGCCGGGCCNONE 
J075129C21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075146N03AAATGGGCCTTATTGGGCCGGGCCNONE 
J075178P18AAATGGGCCTTATTGGGCCGGGCCNONE 
J075190M03AAATGGGCCTTATTGGGCCGGGCCNONE 
J090030G01AAATGGGCCTTATTGGGCCGGGCCNONE 
J100088M23AAATGGGCCTTATTGGGCCGGGCCNONE 
Os08g0167500006-063-D04TCATGGGCCGGGCCGGGNONE 
006-066-G09TCATGGGCCGGGCCGGGNONE 
AK061061TCATGGGCCGGGCCGGGConserved hypothetical protein. 
AK071197TCATGGGCCGGGCCGGGNONE 
J023082N10TCATGGGCCGGGCCGGGNONE 
Os08g0195400006-057-E04GGGCCGGCCCGGCACGGCCCGNONE 
006-060-B10GGGCCGGCCCGGCACGGCCCGNONE 
AK070464GGGCCGGCCCGGCACGGCCCGConserved hypothetical protein. 
AK104389GGGCCGGCCCGGCACGGCCCGNONE 
AK106140GGGCCGGCCCGGCACGGCCCGNONE 
J023013G08GGGCCGGCCCGGCACGGCCCGNONE 
J023054K19GGGCCGGCCCGGCACGGCCCGNONE 
J023089D18GGGCCGGCCCGGCACGGCCCGNONE 
J023092K05GGGCCGGCCCGGCACGGCCCGNONE 
J033025A08GGGCCGGCCCGGCACGGCCCGNONE 
J033067P12GGGCCGGCCCGGCACGGCCCGNONE 
J033098A10GGGCCGGCCCGGCACGGCCCGNONE 
J065219L04GGGCCGGCCCGGCACGGCCCGNONE 
J090021P06GGGCCGGCCCGGCACGGCCCGNONE 
J090062M05GGGCCGGCCCGGCACGGCCCGNONE 
J090079F15GGGCCGGCCCGGCACGGCCCGNONE 
J100041H19GGGCCGGCCCGGCACGGCCCGNONE 
Os08g0203800J065195H23GGCCCGGCCCNONE 
J075146H03GGCCCGGCCCNONE 
Os08g0224200AK101331GGCCGGGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
014-096-F01GGCCGGGCCGGCNONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
AK067127GGCCGGGCCGGCConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J013096C05GGCCGGGCCGGCNONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12GGCCGGGCCGGCNONE 
Os08g0328300AK102227GCCGGGCCGTGNONE 
AK102227GGCCCGGCCCATTTNONE 
AK105392GCCGGGCCGTGENT domain containing protein. 
AK105392GGCCCGGCCCATTTENT domain containing protein. 
Os08g0416000AF145729GGCCGGGCCGGCHomeodomain leucine zipper protein. 
AK100634GGCCGGGCCGGCNONE 
AK101569GGCCGGGCCGGCNONE 
AK110561GGCCGGGCCGGCNONE 
J013074A01GGCCGGGCCGGCNONE 
J013159K22GGCCGGGCCGGCNONE 
J023028M01GGCCGGGCCGGCNONE 
J023033C15GGCCGGGCCGGCNONE 
J023107N23GGCCGGGCCGGCNONE 
J023110A12GGCCGGGCCGGCNONE 
J023122D02GGCCGGGCCGGCNONE 
J033050G15GGCCGGGCCGGCNONE 
J033107D17GGCCGGGCCGGCNONE 
J065082J21GGCCGGGCCGGCNONE 
J065165L21GGCCGGGCCGGCNONE 
J065171J17GGCCGGGCCGGCNONE 
J100026K13GGCCGGGCCGGCNONE 
J100039E16GGCCGGGCCGGCNONE 
J100056J11GGCCGGGCCGGCNONE 
J100070I19GGCCGGGCCGGCNONE 
J100073B16GGCCGGGCCGGCNONE 
J100081M19GGCCGGGCCGGCNONE 
J100088E09GGCCGGGCCGGCNONE 
Os08g0425000AK105302GCCGGGCCGTCCConserved hypothetical protein. 
Os08g0431500009-186-D05GGCCCGGCCCATTTNONE 
AK058993GGCCCGGCCCATTTNONE 
AK100797GGCCCGGCCCATTTConserved hypothetical protein. 
J023121F15GGCCCGGCCCATTTNONE 
Os08g0433200013-023-E07TACGGCCCGGCCCAAANONE 
AK099471TACGGCCCGGCCCAAAConserved hypothetical protein. 
J013024A05TACGGCCCGGCCCAAANONE 
J013065N03TACGGCCCGGCCCAAANONE 
J023111A21TACGGCCCGGCCCAAANONE 
J065035F10TACGGCCCGGCCCAAANONE 
J065083H01TACGGCCCGGCCCAAANONE 
J065159E03TACGGCCCGGCCCAAANONE 
J065186A03TACGGCCCGGCCCAAANONE 
J075032B02TACGGCCCGGCCCAAANONE 
J075038L14TACGGCCCGGCCCAAANONE 
J075047N21TACGGCCCGGCCCAAANONE 
J075076H05TACGGCCCGGCCCAAANONE 
J075110C08TACGGCCCGGCCCAAANONE 
J090096K17TACGGCCCGGCCCAAANONE 
Os08g0442300006-067-F05GCTGGGCCAGGCCGGGCCGGANONE 
AK059843GCTGGGCCAGGCCGGGCCGGANONE 
AK071719GCTGGGCCAGGCCGGGCCGGASimilar to Calcineurin-like protein. 
AK102411GCTGGGCCAGGCCGGGCCGGANONE 
J023108H11GCTGGGCCAGGCCGGGCCGGANONE 
J033092P05GCTGGGCCAGGCCGGGCCGGANONE 
J075109C09GCTGGGCCAGGCCGGGCCGGANONE 
J090070B02GCTGGGCCAGGCCGGGCCGGANONE 
J090076M14GCTGGGCCAGGCCGGGCCGGANONE 
J100064B16GCTGGGCCAGGCCGGGCCGGANONE 
Os08g0527100AK119411TACTGGGCCGGGCCTTGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TACTGGGCCGGGCCTTGNONE 
J090029K18TACTGGGCCGGGCCTTGNONE 
Os08g0535600AK121683CCCGGCCCGGCCCGTTZinc finger, Tim10/DDP-type family protein. 
J065077E05CCCGGCCCGGCCCGTTNONE 
J075088M24CCCGGCCCGGCCCGTTNONE 
J075140B03CCCGGCCCGGCCCGTTNONE 
J090014B14CCCGGCCCGGCCCGTTNONE 
Os08g0554000AK111661AGATGGGCCGGGCCGTAWD-40 repeat containing protein. 
AK112044AGATGGGCCGGGCCGTANONE 
J013039N12AGATGGGCCGGGCCGTANONE 
J013134D02AGATGGGCCGGGCCGTANONE 
J013153B06AGATGGGCCGGGCCGTANONE 
J033044L16AGATGGGCCGGGCCGTANONE 
J033073P14AGATGGGCCGGGCCGTANONE 
Os09g0115900009-055-E06AGTTGGGCCGGGCCNONE 
AK068597AGTTGGGCCGGGCCConserved hypothetical protein. 
J065136F11AGTTGGGCCGGGCCNONE 
J080023D14AGTTGGGCCGGGCCNONE 
Os09g0296400J090084M08CCCGGCCCGGCCCConserved hypothetical protein. 
Os09g0330200AK111018GCCGGGCCCAGGCCACGTCConserved hypothetical protein. 
Os09g0347900AK071224GGCCGGGCCCACCTGConserved hypothetical protein. 
J023087B12GGCCGGGCCCACCTGNONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0416400J075067A16GGCCCGGCCCATCAConserved hypothetical protein. 
J075104N21GGCCCGGCCCATCANONE 
J075106F04GGCCCGGCCCATCANONE 
J075131F08GGCCCGGCCCATCANONE 
Os09g0439600AK100577GCCGGGCCCACGAExo70 exocyst complex subunit family protein. 
J090071K03GCCGGGCCCACGANONE 
Os09g0559600AK109214CAAGGCCCGGCThioredoxin domain 2 containing protein. 
Os11g0106700006-055-F11GGCCGGGCCGGGCNONE 
006-099-D08GGCCGGGCCGGGCNONE 
009-155-A12GGCCGGGCCGGGCNONE 
AF519570GGCCGGGCCGGGCNONE 
AK059354GGCCGGGCCGGGCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0171700AK099115GGCCCGGCCCAACGGAACGSMAD/FHA domain containing protein. 
Os11g0181500006-025-C02GGCCCGGCCNONE 
AK060074GGCCCGGCCNONE 
AK067601GGCCCGGCCSimilar to Nitrogen fixation like protein. 
Os11g0219400AK069850GGGCCGGCCCGGCAnkyrin repeat containing protein. 
AK099123GGGCCGGCCCGGCNONE 
J023143G18GGGCCGGCCCGGCNONE 
Os11g0231400AK108047GGCCCGGCProtein of unknown function DUF295 family protein. 
Os11g0431700AK111439GCCGGGCCSimilar to Serine carboxypeptidase. 
J065099L22GCCGGGCCNONE 
J065123L05GCCGGGCCNONE 
J065205O08GCCGGGCCNONE 
Os11g0445300AK073557GCCGGGCCCCProtein kinase-like domain containing protein. 
J033046C19GCCGGGCCCCNONE 
J065025H02GCCGGGCCCCNONE 
J065026K20GCCGGGCCCCNONE 
J065161F22GCCGGGCCCCNONE 
J065196D22GCCGGGCCCCNONE 
J075130B15GCCGGGCCCCNONE 
J090004H14GCCGGGCCCCNONE 
J090083D24GCCGGGCCCCNONE 
J100077F15GCCGGGCCCCNONE 
Os11g0482000006-056-D12CCCGGCCCGGCCCAACANONE 
006-102-C10CCCGGCCCGGCCCAACANONE 
009-005-E07CCCGGCCCGGCCCAACANONE 
014-088-D03CCCGGCCCGGCCCAACANONE 
AK059558CCCGGCCCGGCCCAACASimilar to 40S ribosomal protein S5-1. 
AK103918CCCGGCCCGGCCCAACANONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0544600AK064128CTCGGCCCGGCCCGGCCCGGCCConserved hypothetical protein. 
J075118L07CTCGGCCCGGCCCGGCCCGGCCNONE 
Os11g0549655J065008P04AGATGGGCTAATTGGGCCGGTGGCCCGGCNONE 
J065148G18AGATGGGCTAATTGGGCCGGTGGCCCGGCMaf-like protein family protein. 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein. 
Os11g0660000AK066709GCCGGGCCGTGSodium/calcium exchanger membrane region domain containing protein. 
AK066709GGCCCGGCCCGTTSodium/calcium exchanger membrane region domain containing protein. 
J013074O18GCCGGGCCGTGNONE 
J013074O18GGCCCGGCCCGTTNONE 
J023081H12GCCGGGCCGTGNONE 
J023081H12GGCCCGGCCCGTTNONE 
J065072E24GCCGGGCCGTGNONE 
J065072E24GGCCCGGCCCGTTNONE 
J065186K08GCCGGGCCGTGNONE 
J065186K08GGCCCGGCCCGTTNONE 
J075079E19GCCGGGCCGTGNONE 
J075079E19GGCCCGGCCCGTTNONE 
J075093J05GCCGGGCCGTGNONE 
J075093J05GGCCCGGCCCGTTNONE 
J075124I21GCCGGGCCGTGNONE 
J075124I21GGCCCGGCCCGTTNONE 
J075187F09GCCGGGCCGTGNONE 
J075187F09GGCCCGGCCCGTTNONE 
J090037O16GCCGGGCCGTGNONE 
J090037O16GGCCCGGCCCGTTNONE 
Os12g0106000AF370029GGCCGGGCCGGGCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571GGCCGGGCCGGGCNONE 
AK102242GGCCGGGCCGGGCNONE 
AY324879GGCCGGGCCGGGCNONE 
J053063M21GGCCGGGCCGGGCNONE 
J090080A16GGCCGGGCCGGGCNONE 
Os12g0188900012-030-C08GCCGGGCCCGCNONE 
J013027N23GCCGGGCCCGCConserved hypothetical protein. 
J013156K23GCCGGGCCCGCNONE 
J023134K02GCCGGGCCCGCNONE 
J033051M18GCCGGGCCCGCNONE 
J033143K05GCCGGGCCCGCNONE 
J080003C24GCCGGGCCCGCNONE 
J080004K05GCCGGGCCCGCNONE 
J080009D14GCCGGGCCCGCNONE 
J080014L12GCCGGGCCCGCNONE 
J080020E23GCCGGGCCCGCNONE 
J080021K20GCCGGGCCCGCNONE 
J080024B19GCCGGGCCCGCNONE 
J080024C12GCCGGGCCCGCNONE 
J080031K10GCCGGGCCCGCNONE 
J080034G09GCCGGGCCCGCNONE 
J080036C10GCCGGGCCCGCNONE 
J080037K18GCCGGGCCCGCNONE 
J080039J17GCCGGGCCCGCNONE 
J080040A20GCCGGGCCCGCNONE 
J080042B06GCCGGGCCCGCNONE 
J080046P07GCCGGGCCCGCNONE 
J080047G02GCCGGGCCCGCNONE 
J080049E12GCCGGGCCCGCNONE 
J080056N14GCCGGGCCCGCNONE 
J080059K10GCCGGGCCCGCNONE 
J080064F05GCCGGGCCCGCNONE 
J080064I04GCCGGGCCCGCNONE 
J080064K17GCCGGGCCCGCNONE 
J080069A15GCCGGGCCCGCNONE 
J080071E22GCCGGGCCCGCNONE 
J080071M24GCCGGGCCCGCNONE 
J080074C17GCCGGGCCCGCNONE 
J080075J07GCCGGGCCCGCNONE 
J080079F11GCCGGGCCCGCNONE 
J080083F15GCCGGGCCCGCNONE 
J080084N21GCCGGGCCCGCNONE 
J080086O03GCCGGGCCCGCNONE 
J080089K02GCCGGGCCCGCNONE 
J080092K22GCCGGGCCCGCNONE 
J080093P09GCCGGGCCCGCNONE 
J090001N04GCCGGGCCCGCNONE 
J090041M02GCCGGGCCCGCNONE 
Os12g0223300006-037-D03GGGCCCGGCCCATTNONE 
AJ429043GGGCCCGGCCCATTNONE 
AK060133GGGCCCGGCCCATTSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GGGCCCGGCCCATTNONE 
J065085K05GGGCCCGGCCCATTNONE 
J075053C01GGGCCCGGCCCATTNONE 
J075055O06GGGCCCGGCCCATTNONE 
J075073B01GGGCCCGGCCCATTNONE 
J075089M07GGGCCCGGCCCATTNONE 
J075095E16GGGCCCGGCCCATTNONE 
J075112O19GGGCCCGGCCCATTNONE 
J075143A11GGGCCCGGCCCATTNONE 
J075173D24GGGCCCGGCCCATTNONE 
J075199G18GGGCCCGGCCCATTNONE 
J090030N06GGGCCCGGCCCATTNONE 
J100052H12GGGCCCGGCCCATTNONE 
J100079F09GGGCCCGGCCCATTNONE 
Os12g0428000009-014-C02GGCCCGGCNONE 
009-048-G02GGCCCGGCNONE 
012-001-F03GGCCCGGCNONE 
016-089-D02GGCCCGGCNONE 
AK100244GGCCCGGCNONE 
J013130A13GGCCCGGCNONE 
J023034C11GGCCCGGCNONE 
J023056E18GGCCCGGCNONE 
J065045B09GGCCCGGCNONE 
J065049N16GGCCCGGCNONE 
J065053F22GGCCCGGCNONE 
J065053O16GGCCCGGCNONE 
J065068N16GGCCCGGCNONE 
J065075G13GGCCCGGCNONE 
J065086E24GGCCCGGCNONE 
J065089H24GGCCCGGCNONE 
J065093F04GGCCCGGCNONE 
J065093J24GGCCCGGCNONE 
J065095P07GGCCCGGCNONE 
J065106C02GGCCCGGCNONE 
J065107F20GGCCCGGCNONE 
J065114N08GGCCCGGCNONE 
J065121B19GGCCCGGCNONE 
J065122H07GGCCCGGCNONE 
J065160B22GGCCCGGCNONE 
J065164H04GGCCCGGCNONE 
J065166N24GGCCCGGCNONE 
J065173P22GGCCCGGCNONE 
J065181I05GGCCCGGCNONE 
J065186D06GGCCCGGCNONE 
J065187H15GGCCCGGCNONE 
J065189I19GGCCCGGCNONE 
J065194G24GGCCCGGCNONE 
J065208I04GGCCCGGCNONE 
J065217B12GGCCCGGCNONE 
J100018M19GGCCCGGCNONE 
J100032B17GGCCCGGCNONE 
J100035O20GGCCCGGCNONE 
J100039J12GGCCCGGCNONE 
J100072E02GGCCCGGCNONE 
J100088F05GGCCCGGCNONE 
Os12g0443700AK069541GCCGGGCCCATCCSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881GCCGGGCCCATCCNONE 
Os12g0488800015-085-F11GGCCCGGCCCGTGGGCCGTGGNONE 
AK064347GGCCCGGCCCGTGGGCCGTGGRNA polymerase II, RPB4 domain containing protein. 
J033065H11GGCCCGGCCCGTGGGCCGTGGNONE 
J033145P10GGCCCGGCCCGTGGGCCGTGGNONE 
J065137L04GGCCCGGCCCGTGGGCCGTGGNONE 
J065171P08GGCCCGGCCCGTGGGCCGTGGNONE 
Os12g0533500AK068646TCGGCCCGGCCCGGCCCAGAConserved hypothetical protein. 
J013158L10TCGGCCCGGCCCGGCCCAGANONE 
J065083J02TCGGCCCGGCCCGGCCCAGANONE 
J075079D02TCGGCCCGGCCCGGCCCAGANONE 
J100037H16TCGGCCCGGCCCGGCCCAGANONE 
J100075P13TCGGCCCGGCCCGGCCCAGANONE 
Os12g0557800AK121691GCCGGGCCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J013095M03GCCGGGCCTGGGCCGGCNONE 
J033071H11GCCGGGCCTGGGCCGGCNONE 
J065101B02GCCGGGCCTGGGCCGGCNONE 
Os12g0565800AK072828GGCCCGGCZinc finger, TTF-type domain containing protein. 
Os12g0599900AK101252TCTCGGCCCGGCCTetratricopeptide region domain containing protein. 
J033032F05TCTCGGCCCGGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.