version

Summary of OsREG617 (All List)

OrganismOryza sativa  
IDOsREG617  
SequenceGCGCGCGA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1643  

Entry Sequences (1643 entries)

LocusGene modelSequenceDescription
Os01g0101200006-040-D03GTCGCGCGCCCATATNONE 
006-068-A02GTCGCGCGCCCATATNONE 
AK104517GTCGCGCGCCCATATNONE 
AK104625GTCGCGCGCCCATATNONE 
AK104752GTCGCGCGCCCATATNONE 
AK119457GTCGCGCGCCCATAT2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. 
J013089L16GTCGCGCGCCCATATNONE 
J023103K24GTCGCGCGCCCATATNONE 
J075050A15GTCGCGCGCCCATATNONE 
Os01g0176500AK102552GCGCGCGAGConserved hypothetical protein. 
Os01g0191900AK109125GCGCGCGASimilar to Blind. 
J100031P20GCGCGCGANONE 
J100060C15GCGCGCGANONE 
J100073J17GCGCGCGANONE 
J100082O12GCGCGCGANONE 
Os01g0205900006-057-B04CTCGCGCGCGCGCGCGAGNONE 
AK060687CTCGCGCGCGCGCGCGAGNONE 
AK105932CTCGCGCGCGCGCGCGAGSimilar to Class III peroxidase GvPx2b (Fragment). 
J033143I12CTCGCGCGCGCGCGCGAGNONE 
J075013J08CTCGCGCGCGCGCGCGAGNONE 
J075090B11CTCGCGCGCGCGCGCGAGNONE 
J075143C17CTCGCGCGCGCGCGCGAGNONE 
J075147O13CTCGCGCGCGCGCGCGAGNONE 
J075161L02CTCGCGCGCGCGCGCGAGNONE 
Os01g0212700AK108311CTCGCGCGCZinc finger, RING-type domain containing protein. 
Os01g0215700011-079-A08GTCGCGCGCNONE 
013-033-E05GTCGCGCGCNONE 
013-052-D07GTCGCGCGCNONE 
014-010-D04GTCGCGCGCNONE 
014-044-G08GTCGCGCGCNONE 
AK059088GTCGCGCGCLipolytic enzyme, G-D-S-L family protein. 
AK061118GTCGCGCGCNONE 
AK119598GTCGCGCGCNONE 
AK119642GTCGCGCGCNONE 
Os01g0253500J100088F12CTCGCGCGCConserved hypothetical protein. 
Os01g0512200J013067C10GTCGCGCGCNONE 
Os01g0594900AK070921CTCGCGCGCConserved hypothetical protein. 
J023074J04CTCGCGCGCNONE 
J023078B04CTCGCGCGCNONE 
J023078N11CTCGCGCGCNONE 
J075143E19CTCGCGCGCNONE 
J075187L10CTCGCGCGCNONE 
J080010N23CTCGCGCGCNONE 
J080013C01CTCGCGCGCNONE 
J080013G03CTCGCGCGCNONE 
J080016I23CTCGCGCGCNONE 
J080017E01CTCGCGCGCNONE 
J080029E18CTCGCGCGCNONE 
J080034L24CTCGCGCGCNONE 
J080039N12CTCGCGCGCNONE 
J080067L11CTCGCGCGCNONE 
J080068N08CTCGCGCGCNONE 
J080069E19CTCGCGCGCNONE 
J080071E16CTCGCGCGCNONE 
J080077J09CTCGCGCGCNONE 
J080085E03CTCGCGCGCNONE 
J080301J09CTCGCGCGCNONE 
J080303L19CTCGCGCGCNONE 
J080308B12CTCGCGCGCNONE 
Os01g0699600009-111-F06GCGCGCGANONE 
AK105196GCGCGCGAProtein kinase-like domain containing protein. 
J065128A07GCGCGCGANONE 
Os01g0714800AK108555GTCGCGCGCWRKY transcription factor 26. 
AY870609GTCGCGCGCNONE 
Os01g0716200AK062106CTCGCGCGCIQ calmodulin-binding region domain containing protein. 
AK098920CTCGCGCGCNONE 
AK120664CTCGCGCGCNONE 
J013002N06CTCGCGCGCNONE 
J013050O19CTCGCGCGCNONE 
J013074N19CTCGCGCGCNONE 
J013098J01CTCGCGCGCNONE 
J013127F17CTCGCGCGCNONE 
J013155C17CTCGCGCGCNONE 
J013158K07CTCGCGCGCNONE 
J013159J10CTCGCGCGCNONE 
J053086D01CTCGCGCGCNONE 
Os01g0737100AK108262CTCGCGCGCConserved hypothetical protein. 
Os01g0747700AK101311GCGCGCGARNA-binding S4 domain containing protein. 
J090007I15GCGCGCGANONE 
Os01g0757200AB092485GCGCGCGAGNONE 
AK060666GCGCGCGAGNONE 
AK060714GCGCGCGAGNONE 
AK099350GCGCGCGAGNONE 
AK101713GCGCGCGAGSimilar to GA 2-oxidase 4. 
Os01g0764800AK102809GCGCGCGACSimilar to Nt-gh3 deduced protein. 
Os01g0765000AK101905CTCGCGCGCSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0767700AK122168GTCGCGCGCSimilar to DEIH-box RNA/DNA helicase. 
Os01g0778700AK064933CTCGCGCGCConserved hypothetical protein. 
AK064933GCGCGCGAGConserved hypothetical protein. 
Os01g0785900AK071014GCGCGCGAZinc finger, C2H2-type domain containing protein. 
AK104311GCGCGCGANONE 
Os01g0787400006-097-H03GCGCGCGACNONE 
AK061223GCGCGCGACConserved hypothetical protein. 
J065011G11GCGCGCGACNONE 
J065161F18GCGCGCGACNONE 
Os01g0800800AK108093CTCGCGCGCConserved hypothetical protein. 
Os01g0805200009-031-F03GCGCGCGAGNONE 
AK066239GCGCGCGAGConserved hypothetical protein. 
AK104864GCGCGCGAGNONE 
J013058M15GCGCGCGAGNONE 
J023013J10GCGCGCGAGNONE 
J053024C05GCGCGCGAGNONE 
J065078N15GCGCGCGAGNONE 
J065206B14GCGCGCGAGNONE 
J075016E22GCGCGCGAGNONE 
J075044O08GCGCGCGAGNONE 
J075157L16GCGCGCGAGNONE 
J080001D07GCGCGCGAGNONE 
J080001I05GCGCGCGAGNONE 
J080003N24GCGCGCGAGNONE 
J080005G15GCGCGCGAGNONE 
J080013I04GCGCGCGAGNONE 
J080018D01GCGCGCGAGNONE 
J080025E19GCGCGCGAGNONE 
J080027H24GCGCGCGAGNONE 
J080029C05GCGCGCGAGNONE 
J080033J18GCGCGCGAGNONE 
J080034N13GCGCGCGAGNONE 
J080037G21GCGCGCGAGNONE 
J080038K05GCGCGCGAGNONE 
J080039I17GCGCGCGAGNONE 
J080047F14GCGCGCGAGNONE 
J080047J22GCGCGCGAGNONE 
J080059A22GCGCGCGAGNONE 
J080062A12GCGCGCGAGNONE 
J080062K14GCGCGCGAGNONE 
J080068E09GCGCGCGAGNONE 
J080072M10GCGCGCGAGNONE 
J080079G07GCGCGCGAGNONE 
J080080F19GCGCGCGAGNONE 
J080081N09GCGCGCGAGNONE 
J080090M11GCGCGCGAGNONE 
J080096B11GCGCGCGAGNONE 
J080097D06GCGCGCGAGNONE 
J080097K16GCGCGCGAGNONE 
Os01g0823600J075039G17GCGCGCGACGCConserved hypothetical protein. 
J075042I11GCGCGCGACGCNONE 
J075054M24GCGCGCGACGCNONE 
J075074C22GCGCGCGACGCNONE 
J075081G13GCGCGCGACGCNONE 
J075099I03GCGCGCGACGCNONE 
J075108D14GCGCGCGACGCNONE 
J075129O14GCGCGCGACGCNONE 
J075136P07GCGCGCGACGCNONE 
J075149P09GCGCGCGACGCNONE 
J075157K12GCGCGCGACGCNONE 
J075176K20GCGCGCGACGCNONE 
J080302C21GCGCGCGACGCNONE 
Os01g0831300AK109023CTCGCGCGCSimilar to Ammonium transporter. 
Os01g0844900AK066659CTCGCGCGCHomeodomain-like containing protein. 
AK066659GCGCGCGACHomeodomain-like containing protein. 
Os01g0856900AK107570GCGCGCGAGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03GCGCGCGANONE 
J075028J03GCGCGCGANONE 
J075052C05GCGCGCGANONE 
J075199J04GCGCGCGANONE 
J090052L20GCGCGCGANONE 
J090075L24GCGCGCGANONE 
Os01g0860601011-099-B05CTCGCGCGCNONE 
013-093-G06CTCGCGCGCNONE 
AK069860CTCGCGCGCSimilar to Ferredoxin, root R-B1. 
J065017K08CTCGCGCGCNONE 
J065020D23CTCGCGCGCNONE 
J065041N15CTCGCGCGCNONE 
J065119F17CTCGCGCGCNONE 
J065169G20CTCGCGCGCNONE 
J065179F21CTCGCGCGCNONE 
J065182L09CTCGCGCGCNONE 
Os01g0877400AK106754CTCGCGCGCSimilar to Avr9 elicitor response-like protein. 
Os01g0914300009-174-C06GCGCGCGAGNONE 
014-073-B09GCGCGCGAGNONE 
AK103489GCGCGCGAGNONE 
AK105463GCGCGCGAGPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J033076A02GCGCGCGAGNONE 
J033130M24GCGCGCGAGNONE 
Os01g0921600AK071344TCGCGCGCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
AK071344TCGCGCGCGACSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22TCGCGCGCNONE 
J013039J22TCGCGCGCGACNONE 
J013109E03TCGCGCGCNONE 
J013109E03TCGCGCGCGACNONE 
J023081J12TCGCGCGCNONE 
J023081J12TCGCGCGCGACNONE 
J023091E24TCGCGCGCNONE 
J023091E24TCGCGCGCGACNONE 
J033022A01TCGCGCGCNONE 
J033022A01TCGCGCGCGACNONE 
J033074C13TCGCGCGCNONE 
J033074C13TCGCGCGCGACNONE 
J065199E03TCGCGCGCNONE 
J065199E03TCGCGCGCGACNONE 
J075172O04TCGCGCGCNONE 
J075172O04TCGCGCGCGACNONE 
J090007G18TCGCGCGCNONE 
J090007G18TCGCGCGCGACNONE 
J090052B17TCGCGCGCNONE 
J090052B17TCGCGCGCGACNONE 
J090074H01TCGCGCGCNONE 
J090074H01TCGCGCGCGACNONE 
J100043J09TCGCGCGCNONE 
J100043J09TCGCGCGCGACNONE 
J100059J05TCGCGCGCNONE 
J100059J05TCGCGCGCGACNONE 
Os01g0963300AK067544CTCGCGCGCSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os02g0102300009-014-G09GCGCGCGANONE 
009-137-A09GCGCGCGANONE 
AK067143GCGCGCGASimilar to Thiosulfate sulfurtransferase (EC 2.8.1.1) (Rhodanese) (Senescence- associated protein) (Sulfurtransferase protein 16) (AtStr16). 
J065202I01GCGCGCGANONE 
J100039N05GCGCGCGANONE 
Os02g0109200AK108815GCGCGCGAGACGTGNONE 
J100030O18GCGCGCGAGACGTGNONE 
Os02g0129900Os02g0129900GCGCGCGAPGAP1-like family protein. 
Os02g0175700AK069542CTCGCGCGCEpsin, N-terminal domain containing protein. 
J023075D24CTCGCGCGCNONE 
J023105C16CTCGCGCGCNONE 
J023140A10CTCGCGCGCNONE 
J023150G13CTCGCGCGCNONE 
Os02g0189900012-074-E11CTCGCGCGCNONE 
AK063528CTCGCGCGCHepatocellular carcinoma-associated antigen 59 family protein. 
Os02g0209400AK108109GTCGCGCGCCACGCCACGCCACConserved hypothetical protein. 
Os02g0219900004-018-E11TCGCGCGCNONE 
AK060915TCGCGCGCNONE 
AK099194TCGCGCGCNONE 
AK104206TCGCGCGCNONE 
AK104393TCGCGCGCSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07TCGCGCGCNONE 
Os02g0445600009-183-B02CTCGCGCGCGACNONE 
AK063150CTCGCGCGCGACSimilar to Auxin-induced SAUR-like protein (Fragment). 
Os02g0506600AK107967GTCGCGCGCConserved hypothetical protein. 
J065142J01GTCGCGCGCNONE 
J100044B16GTCGCGCGCNONE 
J100079K18GTCGCGCGCNONE 
J100086M04GTCGCGCGCNONE 
Os02g0518000AK068281GCGCGCGAGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J013146J12GCGCGCGAGNONE 
J013155G12GCGCGCGAGNONE 
J065141K03GCGCGCGAGNONE 
J065162I12GCGCGCGAGNONE 
J065166C16GCGCGCGAGNONE 
J065171I12GCGCGCGAGNONE 
Os02g0532900AK073663TCGCGCGCGlycoside hydrolase, family 17 protein. 
J033046A21TCGCGCGCNONE 
Os02g0555000015-020-G02TCGCGCGCNONE 
AK065270TCGCGCGCNONE 
AK121253TCGCGCGCProtein of unknown function, ATP binding family protein. 
J013002L01TCGCGCGCNONE 
J023060A02TCGCGCGCNONE 
J023101O11TCGCGCGCNONE 
J023140A15TCGCGCGCNONE 
J033042H19TCGCGCGCNONE 
J033046C02TCGCGCGCNONE 
J033080N19TCGCGCGCNONE 
J065026I02TCGCGCGCNONE 
J065040C18TCGCGCGCNONE 
J090004I16TCGCGCGCNONE 
Os02g0562300AK073250GCGCGCGACCalmodulin binding protein-like family protein. 
Os02g0578300012-035-D02GCGCGCGANONE 
AK105275GCGCGCGASimilar to Glucosyltransferase (Fragment). 
Os02g0581200009-046-F03TCGCGCGCNONE 
AK062477TCGCGCGCConserved hypothetical protein. 
J100073E13TCGCGCGCNONE 
Os02g0605000AK108680GCGCGCGACyclin-like domain containing protein. 
Os02g0606200006-050-A05TCGCGCGCNONE 
006-054-D12TCGCGCGCNONE 
006-076-H01TCGCGCGCNONE 
006-097-F10TCGCGCGCNONE 
006-117-H06TCGCGCGCNONE 
AB001885TCGCGCGCZinc finger, B-box domain containing protein. 
AK061044TCGCGCGCNONE 
AK104293TCGCGCGCNONE 
J065168M02TCGCGCGCNONE 
J065198B03TCGCGCGCNONE 
J075053D02TCGCGCGCNONE 
J100074J07TCGCGCGCNONE 
Os02g0610500AK058536CTCGCGCGCGCGTCTCSimilar to CONSTANS-like protein CO9 (Fragment). 
AK100097CTCGCGCGCGCGTCTCNONE 
J090016D17CTCGCGCGCGCGTCTCNONE 
J090077O10CTCGCGCGCGCGTCTCNONE 
J090097J09CTCGCGCGCGCGTCTCNONE 
J100054K15CTCGCGCGCGCGTCTCNONE 
J100066N13CTCGCGCGCGCGTCTCNONE 
J100072H14CTCGCGCGCGCGTCTCNONE 
Os02g0630300AK108598GTCGCGCGCGCCGGCCCGGGCCNONE 
Os02g0633400AK073723CGCGTCGCGCGCSimilar to 61 kDa protein homolog. 
J100031K17CGCGTCGCGCGCNONE 
Os02g0640000AK120841GCGCGCGAGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023022G19GCGCGCGAGNONE 
J023081F22GCGCGCGAGNONE 
Os02g0643200AK106784CTCGCGCGCYABBY protein family protein. 
J075048L13CTCGCGCGCNONE 
Os02g0643500AK068423TCGCGCGCGAGPentapeptide repeat containing protein. 
Os02g0653400Os02g0653400GCGCGCGATransferase family protein. 
Os02g0653900006-024-H11GCGCGCGACNONE 
006-069-F05GCGCGCGACNONE 
012-005-H01GCGCGCGACNONE 
AK064950GCGCGCGACSimilar to Avr9/Cf-9 rapidly elicited protein 14 (Fragment). 
AK098925GCGCGCGACNONE 
AK104793GCGCGCGACNONE 
AK106154GCGCGCGACNONE 
J013000P22GCGCGCGACNONE 
J013002P22GCGCGCGACNONE 
J013072L24GCGCGCGACNONE 
J013110J23GCGCGCGACNONE 
J013126I23GCGCGCGACNONE 
J013160D23GCGCGCGACNONE 
J023056H01GCGCGCGACNONE 
J033058I09GCGCGCGACNONE 
J065183H09GCGCGCGACNONE 
J065214P06GCGCGCGACNONE 
J075071L23GCGCGCGACNONE 
J090042C11GCGCGCGACNONE 
J090057H07GCGCGCGACNONE 
J090071O22GCGCGCGACNONE 
J100029M07GCGCGCGACNONE 
J100040O18GCGCGCGACNONE 
J100041P12GCGCGCGACNONE 
J100047J02GCGCGCGACNONE 
J100063L09GCGCGCGACNONE 
J100065B12GCGCGCGACNONE 
J100066N05GCGCGCGACNONE 
J100080O21GCGCGCGACNONE 
J100083F13GCGCGCGACNONE 
J100087G04GCGCGCGACNONE 
J100090J20GCGCGCGACNONE 
J100090N08GCGCGCGACNONE 
Os02g0677300006-102-D12GTCGCGCGCNONE 
AK060550GTCGCGCGCNONE 
AK106041GTCGCGCGCSimilar to CRT/DRE binding factor 1. 
Os02g0679700AK108178GCGCGCGAGProtein of unknown function DUF623, plant domain containing protein. 
J075112F23GCGCGCGAGNONE 
Os02g0699000AK109931GCGCGCGACTGF-beta receptor, type I/II extracellular region family protein. 
AK109931GTCGCGCGCTGF-beta receptor, type I/II extracellular region family protein. 
Os02g0701600AK061746GTCGCGCGCNONE 
AK071763GTCGCGCGCSimilar to Tocopherol O-methyltransferase, chloroplast precursor (EC 2.1.1.95) (Gamma-tocopherol methyltransferase). 
J023089D05GTCGCGCGCNONE 
J023110C23GTCGCGCGCNONE 
Os02g0709200AK058999GCGCGCGAGSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074GCGCGCGAGNONE 
AK099074GTCGCGCGCGTGGGCCCCNONE 
Os02g0711300AK107963CTCGCGCGCHSP20-like chaperone domain containing protein. 
AK107963TCGCGCGCHSP20-like chaperone domain containing protein. 
Os02g0756200AK063454CTCGCGCGCNONE 
AK101655CTCGCGCGCSimilar to Phi-1 protein. 
J065104L21CTCGCGCGCNONE 
J065141A07CTCGCGCGCNONE 
Os02g0758200AK111266GCGCGCGAGCCCAACCConserved hypothetical protein. 
Os02g0770800AK102178TCGCGCGCSimilar to Nitrate reductase [NAD(P)H] (EC 1.7.1.2). 
AK102602TCGCGCGCNONE 
Os02g0771100AB040053GCGCGCGAGNONE 
AK102740GCGCGCGAGSimilar to COP1 (Fragment). 
AK111614GCGCGCGAGNONE 
AK112098GCGCGCGAGNONE 
J033106E23GCGCGCGAGNONE 
Os02g0791300J100026B09GCGCGCGANONE 
J100039D05GCGCGCGAHelix-loop-helix DNA-binding domain containing protein. 
Os02g0804900J065051L05GCGCGCGANONE 
J065069D19GCGCGCGANONE 
J065073L01GCGCGCGANONE 
J065147K04GCGCGCGANONE 
J065166D17GCGCGCGANONE 
Os02g0817900AK068163GTCGCGCGCCytochrome P450 family protein. 
Os03g0125900AK060370TCGCGCGCConserved hypothetical protein. 
AK071921TCGCGCGCNONE 
Os03g0128300AK064718GCGTCGCGCGCConserved hypothetical protein. 
Os03g0133100013-080-E12CTCGCGCGCNONE 
AK063608CTCGCGCGCHypothetical protein. 
AK119680CTCGCGCGCNONE 
J075192B05CTCGCGCGCNONE 
Os03g0141200AK068968GCCCCACCGCGCGCGACGTGGCSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092GCCCCACCGCGCGCGACGTGGCNONE 
J023003L18GCCCCACCGCGCGCGACGTGGCNONE 
J023022K18GCCCCACCGCGCGCGACGTGGCNONE 
J023107H13GCCCCACCGCGCGCGACGTGGCNONE 
J023107K02GCCCCACCGCGCGCGACGTGGCNONE 
Os03g0146300011-078-E08GCGCGCGANONE 
014-009-B07GCGCGCGANONE 
AK121395GCGCGCGASimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319GCGCGCGANONE 
J013104I06GCGCGCGANONE 
J023130M16GCGCGCGANONE 
J053037E13GCGCGCGANONE 
J075104M08GCGCGCGANONE 
J075144I22GCGCGCGANONE 
J100057B09GCGCGCGANONE 
Os03g0159600AK106743TCGCGCGCGACSimilar to Rab28 protein. 
J075041K15TCGCGCGCGACNONE 
J075051E03TCGCGCGCGACNONE 
J075055P19TCGCGCGCGACNONE 
J075096D01TCGCGCGCGACNONE 
Os03g0180800AK070649CTCGCGCGCZIM domain containing protein. 
AK070649CTCGCGCGCZIM domain containing protein. 
J065121B15CTCGCGCGCNONE 
J065121B15CTCGCGCGCNONE 
J075067G15CTCGCGCGCNONE 
J075067G15CTCGCGCGCNONE 
Os03g0184100AK067400GCGCGCGAGHypothetical protein. 
J013030J24GCGCGCGAGNONE 
J013037M23GCGCGCGAGNONE 
J013106B15GCGCGCGAGNONE 
J013130H10GCGCGCGAGNONE 
J013152B03GCGCGCGAGNONE 
J013157J24GCGCGCGAGNONE 
J013157K04GCGCGCGAGNONE 
J033093A19GCGCGCGAGNONE 
J033106E24GCGCGCGAGNONE 
J090043G12GCGCGCGAGNONE 
Os03g0184300AK119613TCGCGCGCNONE 
AK120569TCGCGCGCGlycosyl transferase, family 8 protein. 
Os03g0197300AK102651CACGCCACGCCACCCCCACGTCGCGCGCCupin, RmlC-type domain containing protein. 
Os03g0203700AK100415GCGCGCGASimilar to Calcium-transporting ATPase 2, plasma membrane-type (EC 3.6.3.8) (Ca(2+)-ATPase isoform 2). 
AK121250GCGCGCGANONE 
Os03g0214100AB111916TCGCGCGCNONE 
AF009179TCGCGCGCReplication protein A1. 
AK060582TCGCGCGCNONE 
Os03g0214200AK100623CGACACGTGTCGCGCGCProtein of unknown function DUF1675 family protein. 
AK100623GCGCGCGAGProtein of unknown function DUF1675 family protein. 
J075053B18CGACACGTGTCGCGCGCNONE 
J075053B18GCGCGCGAGNONE 
Os03g0215700AK099772CTCGCGCGCMyosin II heavy chain-like family protein. 
Os03g0241600AK120688TCGCGCGCNONE 
Os03g0249800009-063-F07GCGCGCGAGNONE 
009-135-C05GCGCGCGAGNONE 
AK120462GCGCGCGAGHypothetical protein. 
AK121219GCGCGCGAGNONE 
J023090G01GCGCGCGAGNONE 
J100045O11GCGCGCGAGNONE 
Os03g0277000AK100522CCACGCGTCGCGCGCSimilar to GDP dissociation inhibitor protein OsGDI1. 
AK100522GCGCGCGAGSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0300200AK102070CTCGCGCGCSimilar to Ubiquitin-specific protease 16. 
Os03g0308100AB116073GCGCGCGAGPeptidase S14, ClpP family protein. 
AK060518GCGCGCGAGNONE 
AK099107GCGCGCGAGNONE 
AK105977GCGCGCGAGNONE 
J065005O19GCGCGCGAGNONE 
J065007L02GCGCGCGAGNONE 
J065128G15GCGCGCGAGNONE 
J065128N14GCGCGCGAGNONE 
J075010E21GCGCGCGAGNONE 
J075101J24GCGCGCGAGNONE 
J075124O14GCGCGCGAGNONE 
J075126O07GCGCGCGAGNONE 
Os03g0318400015-094-B06GCGCGCGAGNONE 
AK106440GCGCGCGAGPeptidase A1, pepsin family protein. 
J100029O07GCGCGCGAGNONE 
Os03g0387100AB026559ATCGGACGGCGCGCGACNONE 
AF022735ATCGGACGGCGCGCGACNONE 
AK058567ATCGGACGGCGCGCGACProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCGCGCGACNONE 
J033030J15ATCGGACGGCGCGCGACNONE 
J033102N16ATCGGACGGCGCGCGACNONE 
J065056E08ATCGGACGGCGCGCGACNONE 
J065112M11ATCGGACGGCGCGCGACNONE 
J065170H07ATCGGACGGCGCGCGACNONE 
J075003P17ATCGGACGGCGCGCGACNONE 
J075074D06ATCGGACGGCGCGCGACNONE 
J075127F20ATCGGACGGCGCGCGACNONE 
J075129I01ATCGGACGGCGCGCGACNONE 
J075178A10ATCGGACGGCGCGCGACNONE 
J090071P12ATCGGACGGCGCGCGACNONE 
J100090D18ATCGGACGGCGCGCGACNONE 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0576900AK064861CCCCCGCGCGCGAGNONE 
J013000I01CCCCCGCGCGCGAGNONE 
J013169P21CCCCCGCGCGCGAGNONE 
J023001P03CCCCCGCGCGCGAGNONE 
J023009M10CCCCCGCGCGCGAGNONE 
J023025G11CCCCCGCGCGCGAGNONE 
J033046B19CCCCCGCGCGCGAGNONE 
J033149I10CCCCCGCGCGCGAGNONE 
J090081C04CCCCCGCGCGCGAGNONE 
Os03g0646300AK069229CTCGCGCGCSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0685000009-031-F08CTCGCGCGCNONE 
AK059896CTCGCGCGCSimilar to Ferredoxin. 
AK098989CTCGCGCGCNONE 
AK099303CTCGCGCGCNONE 
J065041E14CTCGCGCGCNONE 
J065085G22CTCGCGCGCNONE 
Os03g0687800AK106820TCGCGCGCConserved hypothetical protein. 
Os03g0703000011-082-B01TCGCGCGCNONE 
014-041-E03TCGCGCGCNONE 
AK100165TCGCGCGCNONE 
AK103027TCGCGCGCNONE 
AK105026TCGCGCGCNONE 
J013146C10TCGCGCGCNONE 
J023050B03TCGCGCGCNONE 
J033117C01TCGCGCGCNONE 
J080039D22TCGCGCGCNONE 
J090013G10TCGCGCGCNONE 
J090025K21TCGCGCGCNONE 
J090052K21TCGCGCGCNONE 
J090074F22TCGCGCGCNONE 
J100063C18TCGCGCGCNONE 
J100083C15TCGCGCGCNONE 
U28047TCGCGCGCSimilar to Beta-glucosidase. 
Os03g0725000AK059294GCGCGCGAGNONE 
J043026H11GCGCGCGAGNONE 
J065187O06GCGCGCGAGNONE 
J090066M23GCGCGCGAGNONE 
Os03g0727800014-002-D07GCGCGCGAGNONE 
AK109453GCGCGCGAGCyclin-like F-box domain containing protein. 
Os03g0738600AK073529GCGCGCGACCCACACGSimilar to Lipoxygenase L-2 (EC 1.13.11.12). 
X64396GCGCGCGACCCACACGNONE 
Os03g0744800AK059983CTCGCGCGCemp24/gp25L/p24 family protein. 
J065067D01CTCGCGCGCNONE 
J065122L19CTCGCGCGCNONE 
J090041I03CTCGCGCGCNONE 
J100039H03CTCGCGCGCNONE 
Os03g0751600006-043-F03GCGCGCGACNONE 
006-050-G05GCGCGCGACNONE 
006-059-F10GCGCGCGACNONE 
AK061520GCGCGCGACHeavy metal transport/detoxification protein domain containing protein. 
AK104665GCGCGCGACNONE 
Os03g0764200Os03g0764200GTCGCGCGCNONE 
Os03g0764600AK105625GCGCGCGAGHomeodomain-like containing protein. 
Os03g0766600009-108-B11TCGCGCGCNONE 
AB054528TCGCGCGCNONE 
AK063832TCGCGCGCConserved hypothetical protein. 
AK121417TCGCGCGCNONE 
J023133G21TCGCGCGCNONE 
Os03g0802200009-047-D08CTCGCGCGCNONE 
013-057-D02CTCGCGCGCNONE 
013-089-F02CTCGCGCGCNONE 
014-079-D02CTCGCGCGCNONE 
016-004-A11CTCGCGCGCNONE 
AK111769CTCGCGCGCConserved hypothetical protein. 
J075006H18CTCGCGCGCNONE 
J075060G07CTCGCGCGCNONE 
Os03g0811100AK072463GCGCGCGASimilar to Magnesium-chelatase subunit chlD, chloroplast precursor (EC 6.6.1.1) (Mg-protoporphyrin IX chelatase) (Mg-chelatase subunit D). 
Os03g0819900006-058-B05CGCACGCGCGCGACNONE 
AK111912CGCACGCGCGCGACNONE 
AK112029CGCACGCGCGCGACSimilar to RAB8C. 
AY576526CGCACGCGCGCGACNONE 
AY579410CGCACGCGCGCGACNONE 
J075041G24CGCACGCGCGCGACNONE 
J100070N08CGCACGCGCGCGACNONE 
Os03g0843700AK070364TCGCGCGCFAR1 domain containing protein. 
J013146A20TCGCGCGCNONE 
J023050I08TCGCGCGCNONE 
J033058E14TCGCGCGCNONE 
J033111G20TCGCGCGCNONE 
J033141H24TCGCGCGCNONE 
J065021K13TCGCGCGCNONE 
J065082M21TCGCGCGCNONE 
J075106L22TCGCGCGCNONE 
J075150L05TCGCGCGCNONE 
J075172H24TCGCGCGCNONE 
J075199F06TCGCGCGCNONE 
Os03g0851100AF303468CTCGCGCGCNONE 
AK102069CTCGCGCGCSimilar to Translational elongation factor EF-TuM. 
J033082G06CTCGCGCGCNONE 
J043036M21CTCGCGCGCNONE 
J065158H05CTCGCGCGCNONE 
J065192A04CTCGCGCGCNONE 
Os04g0103200003-106-F06TCGCGCGCNONE 
015-058-G03TCGCGCGCNONE 
AK060850TCGCGCGCNONE 
AK066032TCGCGCGCProteasome component region PCI domain containing protein. 
J013046D12TCGCGCGCNONE 
J013088L18TCGCGCGCNONE 
J013093J06TCGCGCGCNONE 
J013111I01TCGCGCGCNONE 
J013120B15TCGCGCGCNONE 
J013149K17TCGCGCGCNONE 
J023010J08TCGCGCGCNONE 
J023034J10TCGCGCGCNONE 
J023055D05TCGCGCGCNONE 
J033023L03TCGCGCGCNONE 
J033025N21TCGCGCGCNONE 
J033026A19TCGCGCGCNONE 
J033026M14TCGCGCGCNONE 
J033046J22TCGCGCGCNONE 
J033052H11TCGCGCGCNONE 
J033058P05TCGCGCGCNONE 
J033064A11TCGCGCGCNONE 
J033067K11TCGCGCGCNONE 
J033076H02TCGCGCGCNONE 
J033094E04TCGCGCGCNONE 
J033106A02TCGCGCGCNONE 
J033108N14TCGCGCGCNONE 
J033114I06TCGCGCGCNONE 
J033118H18TCGCGCGCNONE 
J033148C05TCGCGCGCNONE 
J043010I24TCGCGCGCNONE 
J043037C07TCGCGCGCNONE 
J053025M02TCGCGCGCNONE 
J053026N08TCGCGCGCNONE 
J053027O14TCGCGCGCNONE 
J065038N11TCGCGCGCNONE 
J065219C03TCGCGCGCNONE 
J090011F14TCGCGCGCNONE 
J090027C03TCGCGCGCNONE 
J090067M19TCGCGCGCNONE 
J090069C17TCGCGCGCNONE 
J090070P21TCGCGCGCNONE 
J090075N11TCGCGCGCNONE 
J090095C22TCGCGCGCNONE 
J100027O14TCGCGCGCNONE 
J100055E01TCGCGCGCNONE 
Os04g0406600AK103609GCGCGCGAGPrephenate dehydratase domain containing protein. 
J033133I10GCGCGCGAGNONE 
J075092D11GCGCGCGAGNONE 
J100031M09GCGCGCGAGNONE 
Os04g0417000AK063428GCGCGCGAGSimilar to Aluminum-activated malate transporter. 
Os04g0434400014-079-B10CGCACGCGCGCGAGNONE 
014-079-B10GCGCGCGANONE 
AK063725CGCACGCGCGCGAGConserved hypothetical protein. 
AK063725GCGCGCGAConserved hypothetical protein. 
Os04g0435700AK100857GTCGCGCGCSimilar to UVB-resistance protein UVR8. 
Os04g0447400AK070858GCCCCCACCACGTCGCGCGCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09GCCCCCACCACGTCGCGCGCNONE 
J023003G16GCCCCCACCACGTCGCGCGCNONE 
J023006F16GCCCCCACCACGTCGCGCGCNONE 
J023008D10GCCCCCACCACGTCGCGCGCNONE 
J023010A01GCCCCCACCACGTCGCGCGCNONE 
J023012M16GCCCCCACCACGTCGCGCGCNONE 
J023023H17GCCCCCACCACGTCGCGCGCNONE 
J023029B12GCCCCCACCACGTCGCGCGCNONE 
J023030F09GCCCCCACCACGTCGCGCGCNONE 
J023034K03GCCCCCACCACGTCGCGCGCNONE 
J023045A16GCCCCCACCACGTCGCGCGCNONE 
J023048I04GCCCCCACCACGTCGCGCGCNONE 
J023056C09GCCCCCACCACGTCGCGCGCNONE 
J023056F05GCCCCCACCACGTCGCGCGCNONE 
J023058B21GCCCCCACCACGTCGCGCGCNONE 
J023058N06GCCCCCACCACGTCGCGCGCNONE 
J023059F03GCCCCCACCACGTCGCGCGCNONE 
J023059M19GCCCCCACCACGTCGCGCGCNONE 
J023060P05GCCCCCACCACGTCGCGCGCNONE 
J023062D07GCCCCCACCACGTCGCGCGCNONE 
J023063F16GCCCCCACCACGTCGCGCGCNONE 
J023068K15GCCCCCACCACGTCGCGCGCNONE 
J023069L04GCCCCCACCACGTCGCGCGCNONE 
J023075I24GCCCCCACCACGTCGCGCGCNONE 
J023086H01GCCCCCACCACGTCGCGCGCNONE 
J023086I24GCCCCCACCACGTCGCGCGCNONE 
J023091M08GCCCCCACCACGTCGCGCGCNONE 
J023095A07GCCCCCACCACGTCGCGCGCNONE 
J023110K06GCCCCCACCACGTCGCGCGCNONE 
J023113D07GCCCCCACCACGTCGCGCGCNONE 
J023126J05GCCCCCACCACGTCGCGCGCNONE 
J023140F04GCCCCCACCACGTCGCGCGCNONE 
J023141N19GCCCCCACCACGTCGCGCGCNONE 
Os04g0447500AK064090GCGCGCGACGTGGTGGGGGCSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0457700J075145N15TCGCGCGCConserved hypothetical protein. 
J075145N15TTTGGGCCTCGCGCGCConserved hypothetical protein. 
Os04g0489600003-130-E01GTCGCGCGCNONE 
AK062301GTCGCGCGCNONE 
AK068039GTCGCGCGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os04g0505200004-004-B07CTCGCGCGCNONE 
004-004-B07GTCGCGCGCGCGACNONE 
006-025-D10CTCGCGCGCNONE 
006-025-D10GTCGCGCGCGCGACNONE 
006-038-D07CTCGCGCGCNONE 
006-038-D07GTCGCGCGCGCGACNONE 
006-044-H11CTCGCGCGCNONE 
006-044-H11GTCGCGCGCGCGACNONE 
006-061-A09CTCGCGCGCNONE 
006-061-A09GTCGCGCGCGCGACNONE 
006-083-C02CTCGCGCGCNONE 
006-083-C02GTCGCGCGCGCGACNONE 
009-167-F06CTCGCGCGCNONE 
009-167-F06GTCGCGCGCGCGACNONE 
013-093-B02CTCGCGCGCNONE 
013-093-B02GTCGCGCGCGCGACNONE 
AK061301CTCGCGCGCLeucine-rich repeat, plant specific containing protein. 
AK061301GTCGCGCGCGCGACLeucine-rich repeat, plant specific containing protein. 
AK066703CTCGCGCGCNONE 
AK066703GTCGCGCGCGCGACNONE 
AK104903CTCGCGCGCNONE 
AK104903GTCGCGCGCGCGACNONE 
J013027H24CTCGCGCGCNONE 
J013027H24GTCGCGCGCGCGACNONE 
J013075O17CTCGCGCGCNONE 
J013075O17GTCGCGCGCGCGACNONE 
J013130D11CTCGCGCGCNONE 
J013130D11GTCGCGCGCGCGACNONE 
J033069B22CTCGCGCGCNONE 
J033069B22GTCGCGCGCGCGACNONE 
J033102K15CTCGCGCGCNONE 
J033102K15GTCGCGCGCGCGACNONE 
J090004A17CTCGCGCGCNONE 
J090004A17GTCGCGCGCGCGACNONE 
J090008L22CTCGCGCGCNONE 
J090008L22GTCGCGCGCGCGACNONE 
J090063C05CTCGCGCGCNONE 
J090063C05GTCGCGCGCGCGACNONE 
Os04g0586100009-190-F11GCGCGCGANONE 
AK063206GCGCGCGAProtein of unknown function DUF581 family protein. 
Os04g0587300AK119483GCGCGCGACSimilar to Purine permease-like protein. 
Os04g0589600011-100-F04GCGCGCGACNONE 
AK061833GCGCGCGACGlycosyl transferase, group 1 domain containing protein. 
AK098964GCGCGCGACNONE 
AK100053GCGCGCGACNONE 
Os04g0594100014-046-H12CACCTGTCGCGCGCNONE 
014-049-F01CACCTGTCGCGCGCNONE 
AK111960CACCTGTCGCGCGCSimilar to P-type R2R3 Myb protein (Fragment). 
Os04g0602800AK100925GCGCGCGAGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0612500003-117-H11GCGCGCGACNONE 
AK062295GCGCGCGACSimilar to Prolin rich protein. 
Os04g0623800AK059270CGCGTCGCGCGCNONE 
AK099234CGCGTCGCGCGCSimilar to Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT). 
Os04g0635000009-031-A05GCGCGCGAGNONE 
009-074-F05GCGCGCGAGNONE 
009-163-H03GCGCGCGAGNONE 
AK062619GCGCGCGAGConserved hypothetical protein. 
Os04g0661200AK102842GCGCGCGAGProtein of unknown function DUF941 family protein. 
J033075E19GCGCGCGAGNONE 
J033109O19GCGCGCGAGNONE 
J065002J12GCGCGCGAGNONE 
J065026E22GCGCGCGAGNONE 
J065061F05GCGCGCGAGNONE 
J065068D22GCGCGCGAGNONE 
J065072N14GCGCGCGAGNONE 
J065085F02GCGCGCGAGNONE 
J075055G19GCGCGCGAGNONE 
J075105B14GCGCGCGAGNONE 
J075118M17GCGCGCGAGNONE 
J075193H02GCGCGCGAGNONE 
J100040O05GCGCGCGAGNONE 
J100064I04GCGCGCGAGNONE 
Os04g0668900AF085174GCGCGCGANONE 
AK067891GCGCGCGASimilar to Plastid terminal oxidase. 
Os04g0679400004-018-E07GCGCGCGAGNONE 
006-039-G08GCGCGCGAGNONE 
006-045-D06GCGCGCGAGNONE 
006-048-B12GCGCGCGAGNONE 
006-061-C05GCGCGCGAGNONE 
006-062-A03GCGCGCGAGNONE 
006-063-A06GCGCGCGAGNONE 
006-066-B04GCGCGCGAGNONE 
006-068-H12GCGCGCGAGNONE 
006-075-C08GCGCGCGAGNONE 
006-076-A02GCGCGCGAGNONE 
006-083-B04GCGCGCGAGNONE 
006-090-F04GCGCGCGAGNONE 
006-099-H12GCGCGCGAGNONE 
006-105-F10GCGCGCGAGNONE 
006-106-G03GCGCGCGAGNONE 
006-107-B05GCGCGCGAGNONE 
006-108-F06GCGCGCGAGNONE 
006-109-E09GCGCGCGAGNONE 
006-111-B02GCGCGCGAGNONE 
006-113-C10GCGCGCGAGNONE 
009-128-G11GCGCGCGAGNONE 
009-150-B02GCGCGCGAGNONE 
009-156-E08GCGCGCGAGNONE 
012-015-E07GCGCGCGAGNONE 
012-027-B04GCGCGCGAGNONE 
012-030-A03GCGCGCGAGNONE 
012-066-E06GCGCGCGAGNONE 
012-083-A09GCGCGCGAGNONE 
012-088-E07GCGCGCGAGNONE 
012-097-F08GCGCGCGAGNONE 
013-010-D04GCGCGCGAGNONE 
013-012-A01GCGCGCGAGNONE 
013-016-D04GCGCGCGAGNONE 
013-041-B01GCGCGCGAGNONE 
013-043-F10GCGCGCGAGNONE 
013-047-C12GCGCGCGAGNONE 
013-058-E10GCGCGCGAGNONE 
013-063-B07GCGCGCGAGNONE 
013-076-A01GCGCGCGAGNONE 
013-081-D04GCGCGCGAGNONE 
013-090-D05GCGCGCGAGNONE 
013-091-B07GCGCGCGAGNONE 
014-030-A04GCGCGCGAGNONE 
014-055-A04GCGCGCGAGNONE 
014-070-A04GCGCGCGAGNONE 
015-033-C10GCGCGCGAGNONE 
015-040-H10GCGCGCGAGNONE 
016-006-F03GCGCGCGAGNONE 
016-090-B03GCGCGCGAGNONE 
AK065314GCGCGCGAGNONE 
AK068608GCGCGCGAGNONE 
AK099009GCGCGCGAGNONE 
AK099087GCGCGCGAGNONE 
AK099368GCGCGCGAGNONE 
AK099653GCGCGCGAGNONE 
AK099975GCGCGCGAGNONE 
AK104249GCGCGCGAGNONE 
AK104376GCGCGCGAGNONE 
AK106133GCGCGCGAGNONE 
AK119666GCGCGCGAGNONE 
AK120508GCGCGCGAGNONE 
AK121152GCGCGCGAGSimilar to Ripening-associated protein (Fragment). 
J013002O24GCGCGCGAGNONE 
J013023H15GCGCGCGAGNONE 
J013036E15GCGCGCGAGNONE 
J013042D22GCGCGCGAGNONE 
J013045A07GCGCGCGAGNONE 
J013056D24GCGCGCGAGNONE 
J013057D10GCGCGCGAGNONE 
J013059B08GCGCGCGAGNONE 
J013059D01GCGCGCGAGNONE 
J013060C02GCGCGCGAGNONE 
J013070N22GCGCGCGAGNONE 
J013071K02GCGCGCGAGNONE 
J013073G04GCGCGCGAGNONE 
J013096J17GCGCGCGAGNONE 
J013098G08GCGCGCGAGNONE 
J013123H02GCGCGCGAGNONE 
J013135I23GCGCGCGAGNONE 
J013149G08GCGCGCGAGNONE 
J013155N04GCGCGCGAGNONE 
J013156C23GCGCGCGAGNONE 
J013157C07GCGCGCGAGNONE 
J013157D23GCGCGCGAGNONE 
J023001K19GCGCGCGAGNONE 
J023002H21GCGCGCGAGNONE 
J023003H14GCGCGCGAGNONE 
J023006D09GCGCGCGAGNONE 
J023010E07GCGCGCGAGNONE 
J023014E18GCGCGCGAGNONE 
J023024G16GCGCGCGAGNONE 
J023034F13GCGCGCGAGNONE 
J023034F17GCGCGCGAGNONE 
J023045C18GCGCGCGAGNONE 
J023058P17GCGCGCGAGNONE 
J023061H18GCGCGCGAGNONE 
J023064H05GCGCGCGAGNONE 
J023078J16GCGCGCGAGNONE 
J023079L03GCGCGCGAGNONE 
J023085N10GCGCGCGAGNONE 
J023087G10GCGCGCGAGNONE 
J023088I02GCGCGCGAGNONE 
J023093K24GCGCGCGAGNONE 
J023095H05GCGCGCGAGNONE 
J023097C02GCGCGCGAGNONE 
J023101P15GCGCGCGAGNONE 
J023106C22GCGCGCGAGNONE 
J023121B08GCGCGCGAGNONE 
J023121N13GCGCGCGAGNONE 
J023123F01GCGCGCGAGNONE 
J023128E14GCGCGCGAGNONE 
J023128M11GCGCGCGAGNONE 
J023135L14GCGCGCGAGNONE 
J023141H20GCGCGCGAGNONE 
J023150A12GCGCGCGAGNONE 
J033035G16GCGCGCGAGNONE 
J033037N04GCGCGCGAGNONE 
J033041D20GCGCGCGAGNONE 
J033052O07GCGCGCGAGNONE 
J033061D19GCGCGCGAGNONE 
J033068M01GCGCGCGAGNONE 
J033090I15GCGCGCGAGNONE 
J033103G06GCGCGCGAGNONE 
J033117F16GCGCGCGAGNONE 
J033120H02GCGCGCGAGNONE 
J033126N05GCGCGCGAGNONE 
J033136C13GCGCGCGAGNONE 
J033139H08GCGCGCGAGNONE 
J043024N03GCGCGCGAGNONE 
J043027G07GCGCGCGAGNONE 
J065103L02GCGCGCGAGNONE 
J065108G02GCGCGCGAGNONE 
J065175N11GCGCGCGAGNONE 
J080003B03GCGCGCGAGNONE 
J080007J02GCGCGCGAGNONE 
J080008D02GCGCGCGAGNONE 
J080008E04GCGCGCGAGNONE 
J080015H20GCGCGCGAGNONE 
J080017J09GCGCGCGAGNONE 
J080020O09GCGCGCGAGNONE 
J080021F06GCGCGCGAGNONE 
J080027L11GCGCGCGAGNONE 
J080028J11GCGCGCGAGNONE 
J080030G17GCGCGCGAGNONE 
J080035E09GCGCGCGAGNONE 
J080035F20GCGCGCGAGNONE 
J080036H18GCGCGCGAGNONE 
J080039M19GCGCGCGAGNONE 
J080042A21GCGCGCGAGNONE 
J080043A07GCGCGCGAGNONE 
J080052A16GCGCGCGAGNONE 
J080055G22GCGCGCGAGNONE 
J080061O12GCGCGCGAGNONE 
J080062I05GCGCGCGAGNONE 
J080068K18GCGCGCGAGNONE 
J080070G01GCGCGCGAGNONE 
J080077F11GCGCGCGAGNONE 
J080079N14GCGCGCGAGNONE 
J080084G11GCGCGCGAGNONE 
J080093C04GCGCGCGAGNONE 
J090056G10GCGCGCGAGNONE 
J090091H01GCGCGCGAGNONE 
J100025J03GCGCGCGAGNONE 
J100027L16GCGCGCGAGNONE 
J100030B22GCGCGCGAGNONE 
J100048H23GCGCGCGAGNONE 
J100050C24GCGCGCGAGNONE 
J100055F22GCGCGCGAGNONE 
J100057L08GCGCGCGAGNONE 
J100065E17GCGCGCGAGNONE 
J100072C03GCGCGCGAGNONE 
Os05g0170700J075130N13GCGCGCGALeucine rich repeat, N-terminal domain containing protein. 
Os05g0190300004-005-C08GCGCGCGACNONE 
006-025-C01GCGCGCGACNONE 
006-027-F06GCGCGCGACNONE 
006-028-B04GCGCGCGACNONE 
006-035-C02GCGCGCGACNONE 
006-036-C11GCGCGCGACNONE 
006-041-A01GCGCGCGACNONE 
006-045-D03GCGCGCGACNONE 
006-054-D06GCGCGCGACNONE 
006-059-H03GCGCGCGACNONE 
006-064-A07GCGCGCGACNONE 
006-064-D09GCGCGCGACNONE 
006-066-C11GCGCGCGACNONE 
006-074-H09GCGCGCGACNONE 
006-079-D01GCGCGCGACNONE 
006-084-A12GCGCGCGACNONE 
006-089-A10GCGCGCGACNONE 
006-090-A09GCGCGCGACNONE 
006-096-C06GCGCGCGACNONE 
006-102-E03GCGCGCGACNONE 
006-109-B09GCGCGCGACNONE 
006-115-D12GCGCGCGACNONE 
AK061507GCGCGCGACNONE 
AK104180GCGCGCGACNONE 
AK104252GCGCGCGACNONE 
AK104267GCGCGCGACNONE 
AK104355GCGCGCGACNONE 
AK106112GCGCGCGACNONE 
AK119190GCGCGCGACAcid phosphatase (Class B) family protein. 
J013088K07GCGCGCGACNONE 
J013110D12GCGCGCGACNONE 
J013118F19GCGCGCGACNONE 
J013124A02GCGCGCGACNONE 
J013135I19GCGCGCGACNONE 
J023027C12GCGCGCGACNONE 
J023063O08GCGCGCGACNONE 
J023122E16GCGCGCGACNONE 
J023150C11GCGCGCGACNONE 
J065035F03GCGCGCGACNONE 
J065057B06GCGCGCGACNONE 
Os05g0346100012-005-C07GCCACGTGGGCGCGCGCGANONE 
AK066689GCCACGTGGGCGCGCGCGAPhox-like domain containing protein. 
J013073J06GCCACGTGGGCGCGCGCGANONE 
Os05g0392200013-072-B10GTCGCGCGCNONE 
AK063603GTCGCGCGCGeneric methyltransferase domain containing protein. 
J065116F18GTCGCGCGCNONE 
J075112N20GTCGCGCGCNONE 
J075136D16GTCGCGCGCNONE 
J090090O10GTCGCGCGCNONE 
J090091G05GTCGCGCGCNONE 
Os05g0397700AK067298GCGCGCGACACGTGSecY protein family protein. 
Os05g0407100AK063349CGCGTCGCGCGCFour F5 protein family protein. 
Os05g0429900AK066834CTCGCGCGCNONE 
AK099108CTCGCGCGCNONE 
AK104053CTCGCGCGCNONE 
D88617CTCGCGCGCSimilar to MybHv5 (Fragment). 
J090031E22CTCGCGCGCNONE 
Os05g0444200AK102658CTCGCGCGCACGCGSimilar to T6J4.5 protein (WIP6 protein). 
Os05g0460000011-074-F09GCGCGCGANONE 
J023002L01GCGCGCGANONE 
J023060I12GCGCGCGANONE 
J023060O12GCGCGCGANONE 
J023106P08GCGCGCGANONE 
J023141D17GCGCGCGANONE 
J023150E11GCGCGCGASimilar to 70 kDa heat shock cognate protein 1. 
J033030A20GCGCGCGANONE 
J033039H14GCGCGCGANONE 
J033101B11GCGCGCGANONE 
J033101B12GCGCGCGANONE 
J033114A09GCGCGCGANONE 
J090037G06GCGCGCGANONE 
J090048G13GCGCGCGANONE 
J090090F15GCGCGCGANONE 
Os05g0465100AK065821CGCACCGCGCGCGACRabGAP/TBC domain containing protein. 
Os05g0478000AK111029CTCGCGCGCZinc finger, RING-type domain containing protein. 
Os05g0495900AK069244TCGCGCGCSimilar to Beta-1,3-glucanase precursor (Fragment). 
J013157P10TCGCGCGCNONE 
J023031M04TCGCGCGCNONE 
J065063H10TCGCGCGCNONE 
Os05g0499800016-065-G04GTCGCGCGCCACGTCNONE 
AK064392GTCGCGCGCCACGTCNONE 
AK103146GTCGCGCGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J023075J11GTCGCGCGCCACGTCNONE 
J033120I02GTCGCGCGCCACGTCNONE 
Os05g0510700AK070308CTCGCGCGCBSD domain containing protein. 
Os05g0533500Os05g0533500GTCGCGCGCSimilar to Serine acetyltransferase. 
Os05g0555300009-032-C03CGTGTGGCGCGCGAGNONE 
009-125-E08CGTGTGGCGCGCGAGNONE 
009-149-C12CGTGTGGCGCGCGAGNONE 
009-172-C01CGTGTGGCGCGCGAGNONE 
AK062890CGTGTGGCGCGCGAGFerredoxin domain containing protein. 
AK062997CGTGTGGCGCGCGAGNONE 
Os05g0564400006-023-A05GCGCGCGANONE 
006-023-A05GCGCGCGANONE 
AK073075GCGCGCGASimilar to GTP-binding protein. 
AK073075GCGCGCGASimilar to GTP-binding protein. 
AK109344GCGCGCGANONE 
AK109344GCGCGCGANONE 
Os05g0576300015-055-B11GCGCGCGANONE 
AK106354GCGCGCGAZinc finger, CCCH-type domain containing protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os06g0101600AF093636GCGCGCGACNONE 
AK070447GCGCGCGACPlastocyanin, chloroplast precursor. 
J065001A20GCGCGCGACNONE 
J065019M17GCGCGCGACNONE 
J065021H18GCGCGCGACNONE 
J065061A17GCGCGCGACNONE 
J065073L02GCGCGCGACNONE 
J065099F17GCGCGCGACNONE 
J065101C23GCGCGCGACNONE 
J065121E23GCGCGCGACNONE 
J065122N04GCGCGCGACNONE 
J065141N05GCGCGCGACNONE 
J065143N21GCGCGCGACNONE 
J065161H09GCGCGCGACNONE 
J065161J04GCGCGCGACNONE 
J065162P20GCGCGCGACNONE 
J065182K10GCGCGCGACNONE 
J065184M05GCGCGCGACNONE 
J065186H24GCGCGCGACNONE 
J065189G21GCGCGCGACNONE 
J065190N14GCGCGCGACNONE 
J065191H08GCGCGCGACNONE 
J065205H17GCGCGCGACNONE 
J075001E03GCGCGCGACNONE 
J075001H21GCGCGCGACNONE 
J075003J23GCGCGCGACNONE 
J075003K01GCGCGCGACNONE 
J075005I11GCGCGCGACNONE 
J075007F16GCGCGCGACNONE 
J075017I11GCGCGCGACNONE 
J075018O05GCGCGCGACNONE 
J075019G24GCGCGCGACNONE 
J075032D04GCGCGCGACNONE 
J075032N13GCGCGCGACNONE 
J075033C09GCGCGCGACNONE 
J075033D11GCGCGCGACNONE 
J075039A20GCGCGCGACNONE 
J075058P12GCGCGCGACNONE 
J075062E10GCGCGCGACNONE 
J075062P16GCGCGCGACNONE 
J075063C17GCGCGCGACNONE 
J075066E07GCGCGCGACNONE 
J075066I20GCGCGCGACNONE 
J075075K21GCGCGCGACNONE 
J075078F03GCGCGCGACNONE 
J075082F10GCGCGCGACNONE 
J075086G16GCGCGCGACNONE 
J075087E07GCGCGCGACNONE 
J075087K06GCGCGCGACNONE 
J075087L04GCGCGCGACNONE 
J075088B16GCGCGCGACNONE 
J075088D02GCGCGCGACNONE 
J075094H21GCGCGCGACNONE 
J075094I24GCGCGCGACNONE 
J075094K10GCGCGCGACNONE 
J075095C18GCGCGCGACNONE 
J075097B05GCGCGCGACNONE 
J075099C13GCGCGCGACNONE 
J075099H22GCGCGCGACNONE 
J075099L16GCGCGCGACNONE 
J075104K08GCGCGCGACNONE 
J075118O06GCGCGCGACNONE 
J075119E15GCGCGCGACNONE 
J075124N06GCGCGCGACNONE 
J075126G02GCGCGCGACNONE 
J075127L24GCGCGCGACNONE 
J075131E23GCGCGCGACNONE 
J075140H06GCGCGCGACNONE 
J075146I20GCGCGCGACNONE 
J075146N24GCGCGCGACNONE 
J075147I19GCGCGCGACNONE 
J075155K07GCGCGCGACNONE 
J075156C05GCGCGCGACNONE 
J075161G07GCGCGCGACNONE 
J075164G01GCGCGCGACNONE 
J075170J18GCGCGCGACNONE 
J075172G17GCGCGCGACNONE 
J075176G10GCGCGCGACNONE 
J075178C05GCGCGCGACNONE 
J075179G01GCGCGCGACNONE 
J075181E24GCGCGCGACNONE 
J080029D19GCGCGCGACNONE 
J080034L11GCGCGCGACNONE 
J080039G07GCGCGCGACNONE 
J080062M23GCGCGCGACNONE 
J080302A01GCGCGCGACNONE 
J100042I15GCGCGCGACNONE 
J100043G22GCGCGCGACNONE 
J100056L12GCGCGCGACNONE 
J100061A12GCGCGCGACNONE 
J100073O20GCGCGCGACNONE 
J100082I08GCGCGCGACNONE 
Os06g0163200AK068888CTCGCGCGCEsterase/lipase/thioesterase domain containing protein. 
J023001E15CTCGCGCGCNONE 
J075100H16CTCGCGCGCNONE 
J075138N07CTCGCGCGCNONE 
Os06g0166500016-094-H06CTCGCGCGCNONE 
AK102541CTCGCGCGCSimilar to Auxin-responsive protein IAA20 (Indoleacetic acid-induced protein 20). 
Os06g0168800AK111753GCGCGCGAGSimilar to Protein kinase. 
Os06g0211200011-063-B02GCGCGCGACNONE 
AK103188GCGCGCGACSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 1) (AREB1). 
AK105312GCGCGCGACNONE 
J065214N03GCGCGCGACNONE 
J090046C13GCGCGCGACNONE 
J090049L03GCGCGCGACNONE 
J100074P03GCGCGCGACNONE 
Os06g0213900AK106922GCGCGCGAConserved hypothetical protein. 
J090028K09GCGCGCGANONE 
J100078N13GCGCGCGANONE 
Os06g0219900AK058704GTCGCGCGCSimilar to Phi-1 protein. 
Os06g0220500011-038-H05GCGCGCGACNONE 
011-086-F05GCGCGCGACNONE 
AK063324GCGCGCGACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J100040M16GCGCGCGACNONE 
Os06g0268800AK120796GCGCGCGAGProtein of unknown function UPF0005 family protein. 
Os06g0274500AK066417TCGCGCGCGAGSimilar to SERK1 (Fragment). 
Os06g0348800AF318581GCGCGCGACCGGCCCNONE 
AK061946GCGCGCGACCGGCCCNONE 
AK065184GCGCGCGACCGGCCCNONE 
AK098909GCGCGCGACCGGCCCNONE 
AK098915GCGCGCGACCGGCCCHomeodomain-like containing protein. 
AK122161GCGCGCGACCGGCCCNONE 
J013002D22GCGCGCGACCGGCCCNONE 
J013002F22GCGCGCGACCGGCCCNONE 
J013002I19GCGCGCGACCGGCCCNONE 
J013022A07GCGCGCGACCGGCCCNONE 
J013135J08GCGCGCGACCGGCCCNONE 
J033147G01GCGCGCGACCGGCCCNONE 
J075012G19GCGCGCGACCGGCCCNONE 
J075049L03GCGCGCGACCGGCCCNONE 
J075068G02GCGCGCGACCGGCCCNONE 
J075145E15GCGCGCGACCGGCCCNONE 
J075145J09GCGCGCGACCGGCCCNONE 
J075155B11GCGCGCGACCGGCCCNONE 
J075173E22GCGCGCGACCGGCCCNONE 
J075180B11GCGCGCGACCGGCCCNONE 
J075195D12GCGCGCGACCGGCCCNONE 
Os06g0539400011-077-E03TCGCGCGCNONE 
AK063382TCGCGCGCAmino acid/polyamine transporter I family protein. 
J100058P22TCGCGCGCNONE 
J100069L17TCGCGCGCNONE 
Os06g0556600AK072511GTCGCGCGCSimilar to Pollen allergen Phl p 11. 
AK072511TCGCGCGCSimilar to Pollen allergen Phl p 11. 
J023077F02GTCGCGCGCNONE 
J023077F02TCGCGCGCNONE 
J023132A12GTCGCGCGCNONE 
J023132A12TCGCGCGCNONE 
Os06g0574200Os06g0574200CTCGCGCGCGAUspA domain containing protein. 
Os06g0593100AK060274GCGCGCGACSimilar to UDP-galactose/UDP-glucose transporter. 
AK071175GCGCGCGACNONE 
Os06g0597600AK120804GCGCGCGAAromatic-ring hydroxylase family protein. 
Os06g0613500AK070970GTCGCGTCGCGCGCSimilar to Helix-loop-helix protein homolog. 
J023066J03GTCGCGTCGCGCGCNONE 
Os06g0633100AK107791GCGCGCGACGCGConserved hypothetical protein. 
J065001N11GCGCGCGACGCGNONE 
Os06g0656800AK109762GCGCGCGACBeta-Ig-H3/fasciclin domain containing protein. 
Os06g0690600AK107925TCGCGCGCConserved hypothetical protein. 
Os07g0141400003-129-D08GCGCGCGACNONE 
006-021-E02GCGCGCGACNONE 
006-025-C06GCGCGCGACNONE 
006-027-H11GCGCGCGACNONE 
006-036-C05GCGCGCGACNONE 
006-046-D07GCGCGCGACNONE 
006-047-A02GCGCGCGACNONE 
006-050-F02GCGCGCGACNONE 
006-053-D07GCGCGCGACNONE 
006-054-E06GCGCGCGACNONE 
006-055-E01GCGCGCGACNONE 
006-055-F01GCGCGCGACNONE 
006-056-H12GCGCGCGACNONE 
006-057-D07GCGCGCGACNONE 
006-074-G10GCGCGCGACNONE 
006-077-C02GCGCGCGACNONE 
006-081-E01GCGCGCGACNONE 
006-089-B08GCGCGCGACNONE 
006-089-C10GCGCGCGACNONE 
006-092-E07GCGCGCGACNONE 
006-096-C11GCGCGCGACNONE 
006-096-H06GCGCGCGACNONE 
006-097-E07GCGCGCGACNONE 
006-098-D03GCGCGCGACNONE 
006-102-C05GCGCGCGACNONE 
006-107-E09GCGCGCGACNONE 
006-110-C09GCGCGCGACNONE 
006-113-C01GCGCGCGACNONE 
006-114-D09GCGCGCGACNONE 
006-115-H06GCGCGCGACNONE 
009-016-G06GCGCGCGACNONE 
009-031-C05GCGCGCGACNONE 
009-060-B05GCGCGCGACNONE 
009-123-H12GCGCGCGACNONE 
009-154-B09GCGCGCGACNONE 
009-172-F07GCGCGCGACNONE 
009-193-A04GCGCGCGACNONE 
AF022732GCGCGCGACNONE 
AF052203GCGCGCGACNONE 
AK065248GCGCGCGACSimilar to 23 kDa polypeptide of photosystem II. 
AK104722GCGCGCGACNONE 
D49713GCGCGCGACNONE 
J013002J02GCGCGCGACNONE 
J065051O13GCGCGCGACNONE 
J065066J18GCGCGCGACNONE 
J065077G23GCGCGCGACNONE 
J065162C22GCGCGCGACNONE 
J065162G22GCGCGCGACNONE 
J075091B13GCGCGCGACNONE 
J075099J22GCGCGCGACNONE 
J100056O22GCGCGCGACNONE 
J100059E01GCGCGCGACNONE 
J100079F20GCGCGCGACNONE 
Os07g0171100AF272978GCGCGCGANONE 
AK062132GCGCGCGANONE 
AK066475GCGCGCGATetratricopeptide-like helical domain containing protein. 
J013068C23GCGCGCGANONE 
Os07g0181500AK072431GCGCGCGAProtein of unknown function DUF506, plant family protein. 
Os07g0191600AK071418GTCGCGCGCNONE 
AK071418GTCGCGCGCNONE 
AK102563GTCGCGCGCNONE 
AK102563GTCGCGCGCNONE 
Os07g0414800AK108552CTCGCGCGCF-actin capping protein, alpha subunit family protein. 
Os07g0490300AK068288TCGCGCGCGCGGGGGGGTGGGCCCACCSimilar to Preproacrosin. 
J013149P03TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
J065039L14TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
J100024A06TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0502200006-027-C06CCCCCGCGCGCGACNONE 
012-007-C05CCCCCGCGCGCGACNONE 
AK120682CCCCCGCGCGCGACMulti antimicrobial extrusion protein MatE family protein. 
J053045G13CCCCCGCGCGCGACNONE 
J053064I18CCCCCGCGCGCGACNONE 
J053091G24CCCCCGCGCGCGACNONE 
J065016E10CCCCCGCGCGCGACNONE 
J065021B18CCCCCGCGCGCGACNONE 
J065022A17CCCCCGCGCGCGACNONE 
J065059D18CCCCCGCGCGCGACNONE 
J065063N19CCCCCGCGCGCGACNONE 
J065065O10CCCCCGCGCGCGACNONE 
J065196F12CCCCCGCGCGCGACNONE 
J065208I01CCCCCGCGCGCGACNONE 
J065218G15CCCCCGCGCGCGACNONE 
J100040G01CCCCCGCGCGCGACNONE 
J100060M03CCCCCGCGCGCGACNONE 
J100061P09CCCCCGCGCGCGACNONE 
J100065P05CCCCCGCGCGCGACNONE 
Os07g0529000011-012-E06GCGCGCGAGNONE 
011-054-G04GCGCGCGAGNONE 
016-094-D08GCGCGCGAGNONE 
AK063353GCGCGCGAGSimilar to Isocitrate lyase (Fragment). 
AK103744GCGCGCGAGNONE 
J065022H24GCGCGCGAGNONE 
J065040B11GCGCGCGAGNONE 
J065053J07GCGCGCGAGNONE 
J065057K21GCGCGCGAGNONE 
J065063M16GCGCGCGAGNONE 
J065073G06GCGCGCGAGNONE 
J065158H07GCGCGCGAGNONE 
J065159C23GCGCGCGAGNONE 
J065184F18GCGCGCGAGNONE 
J065184K08GCGCGCGAGNONE 
J065192A11GCGCGCGAGNONE 
J065199L23GCGCGCGAGNONE 
J065212K16GCGCGCGAGNONE 
J075002I18GCGCGCGAGNONE 
J075055G16GCGCGCGAGNONE 
J075112H09GCGCGCGAGNONE 
J075199I10GCGCGCGAGNONE 
Os07g0549600J080302I11GCGCGCGAGGGCGAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J080304E08GCGCGCGAGGGCGAGGNONE 
J080306P15GCGCGCGAGGGCGAGGNONE 
J080312F02GCGCGCGAGGGCGAGGNONE 
J080316C13GCGCGCGAGGGCGAGGNONE 
J080316K21GCGCGCGAGGGCGAGGNONE 
J080319K19GCGCGCGAGGGCGAGGNONE 
Os07g0554600AK072955TCGCGCGCConserved hypothetical protein. 
Os07g0558000AK069272GTCGCGCGCNONE 
AK101867GTCGCGCGCABC-1 domain containing protein. 
Os07g0565800009-114-F12GTCGCGCGCNONE 
AK062834GTCGCGCGCConserved hypothetical protein. 
J065026L16GTCGCGCGCNONE 
Os07g0566800AK108970GCGCGCGAToll-Interleukin receptor domain containing protein. 
Os07g0605200AF091458TCGCGCGCNONE 
AF139665TCGCGCGCNONE 
AJ011675TCGCGCGCNONE 
AK064704TCGCGCGCMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15TCGCGCGCNONE 
J090034M06TCGCGCGCNONE 
J090079L24TCGCGCGCNONE 
Os07g0623600AK063642TCGCGCGCConserved hypothetical protein. 
Os07g0637300AF323611GCGCGCGAGNONE 
AK069157GCGCGCGAGNONE 
J023007C01GCGCGCGAGNONE 
Os07g0659300AK069789CCCCCGCGCGCGAConserved hypothetical protein. 
AK069789CTCGCGCGCConserved hypothetical protein. 
AK069789TCGCGCGCConserved hypothetical protein. 
Os08g0101100AK069900GCGCGCGAGHigh mobility group box domain containing protein. 
Os08g0126700AK111805GCGCGCGANONE 
AK111805GTCGCGCGCNONE 
AK111805TCGCGCGCNONE 
AK111902GCGCGCGAZinc finger, CCCH-type domain containing protein. 
AK111902GTCGCGCGCZinc finger, CCCH-type domain containing protein. 
AK111902TCGCGCGCZinc finger, CCCH-type domain containing protein. 
Os08g0144100AK071435TCGCGCGCGCGACGCGSimilar to Avr9/Cf-9 rapidly elicited protein 31. 
Os08g0163400AB005290GCGCGCGAGAGAGTGGGSigma-70 factor family protein. 
AK065997GCGCGCGAGAGAGTGGGNONE 
AK071725GCGCGCGAGAGAGTGGGNONE 
Os08g0243500AK068915CGCGTCGCGCGCCCAATTSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2. 
AK099083CGCGTCGCGCGCCCAATTNONE 
Os08g0327200AK069803GCGCGCGAGVirulence factor, pectin lyase fold family protein. 
Os08g0402500AK108881GCGCGCGACGCGACGCGConserved hypothetical protein. 
Os08g0405700AK108256GCGCGCGAGSimilar to Copper chaperone homolog CCH. 
J100052M11GCGCGCGAGNONE 
Os08g0443800AK110630GTCGCGCGCCD9/CD37/CD63 antigen family protein. 
Os08g0473600011-035-H09CTCGCGCGCNONE 
011-052-E06CTCGCGCGCNONE 
012-004-D02CTCGCGCGCNONE 
012-006-G11CTCGCGCGCNONE 
012-025-G01CTCGCGCGCNONE 
012-026-E10CTCGCGCGCNONE 
012-034-F07CTCGCGCGCNONE 
012-038-A04CTCGCGCGCNONE 
012-043-A07CTCGCGCGCNONE 
012-050-C12CTCGCGCGCNONE 
012-060-A06CTCGCGCGCNONE 
012-062-A07CTCGCGCGCNONE 
012-066-G07CTCGCGCGCNONE 
012-067-G12CTCGCGCGCNONE 
012-075-F02CTCGCGCGCNONE 
012-082-H06CTCGCGCGCNONE 
012-088-C08CTCGCGCGCNONE 
012-088-D06CTCGCGCGCNONE 
012-089-D12CTCGCGCGCNONE 
012-091-H05CTCGCGCGCNONE 
012-092-C06CTCGCGCGCNONE 
012-093-H01CTCGCGCGCNONE 
012-100-C09CTCGCGCGCNONE 
013-033-C02CTCGCGCGCNONE 
014-042-F10CTCGCGCGCNONE 
014-050-E03CTCGCGCGCNONE 
014-075-F10CTCGCGCGCNONE 
015-004-G11CTCGCGCGCNONE 
015-005-E07CTCGCGCGCNONE 
015-005-G08CTCGCGCGCNONE 
015-013-D03CTCGCGCGCNONE 
015-013-F04CTCGCGCGCNONE 
015-017-D03CTCGCGCGCNONE 
015-048-D02CTCGCGCGCNONE 
015-049-D02CTCGCGCGCNONE 
015-092-F03CTCGCGCGCNONE 
016-019-H02CTCGCGCGCNONE 
016-027-F03CTCGCGCGCNONE 
016-096-D06CTCGCGCGCNONE 
AK064071CTCGCGCGCNONE 
AK064300CTCGCGCGCAlpha-amylase isozyme 3E precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK103413CTCGCGCGCNONE 
AK106526CTCGCGCGCNONE 
J033030A15CTCGCGCGCNONE 
J033040E10CTCGCGCGCNONE 
J033057P15CTCGCGCGCNONE 
J033127G12CTCGCGCGCNONE 
J033128G11CTCGCGCGCNONE 
J053054F05CTCGCGCGCNONE 
J065006J19CTCGCGCGCNONE 
J065007M11CTCGCGCGCNONE 
J065013H10CTCGCGCGCNONE 
J065015G17CTCGCGCGCNONE 
J065019C10CTCGCGCGCNONE 
J065020H22CTCGCGCGCNONE 
J065022H12CTCGCGCGCNONE 
J065024C08CTCGCGCGCNONE 
J065029F11CTCGCGCGCNONE 
J065036D04CTCGCGCGCNONE 
J065039F22CTCGCGCGCNONE 
J065042G09CTCGCGCGCNONE 
J065045L16CTCGCGCGCNONE 
J065046M13CTCGCGCGCNONE 
J065049E18CTCGCGCGCNONE 
J065052H21CTCGCGCGCNONE 
J065053G17CTCGCGCGCNONE 
J065066H10CTCGCGCGCNONE 
J065069M24CTCGCGCGCNONE 
J065070P07CTCGCGCGCNONE 
J065073O06CTCGCGCGCNONE 
J065078G19CTCGCGCGCNONE 
J065082P16CTCGCGCGCNONE 
J065086P15CTCGCGCGCNONE 
J065093H11CTCGCGCGCNONE 
J065097A14CTCGCGCGCNONE 
J065103D19CTCGCGCGCNONE 
J065105A18CTCGCGCGCNONE 
J065108N23CTCGCGCGCNONE 
J065109N14CTCGCGCGCNONE 
J065121K22CTCGCGCGCNONE 
J065122C18CTCGCGCGCNONE 
J065129L03CTCGCGCGCNONE 
J065130B11CTCGCGCGCNONE 
J065135P07CTCGCGCGCNONE 
J065139B03CTCGCGCGCNONE 
J065144O11CTCGCGCGCNONE 
J065163I17CTCGCGCGCNONE 
J065163J15CTCGCGCGCNONE 
J065177G16CTCGCGCGCNONE 
J065186D17CTCGCGCGCNONE 
J065187D02CTCGCGCGCNONE 
J065188L03CTCGCGCGCNONE 
J065191L02CTCGCGCGCNONE 
J065193F09CTCGCGCGCNONE 
J065197J03CTCGCGCGCNONE 
J065200F07CTCGCGCGCNONE 
J065208K11CTCGCGCGCNONE 
J065211I22CTCGCGCGCNONE 
J065213O22CTCGCGCGCNONE 
J065213P22CTCGCGCGCNONE 
Os08g0476300014-029-G10GTCGCGCGCNONE 
AK071937GTCGCGCGCNONE 
AK105359GTCGCGCGCGlucose/ribitol dehydrogenase family protein. 
J065099P11GTCGCGCGCNONE 
J075083H04GTCGCGCGCNONE 
J075130H04GTCGCGCGCNONE 
Os08g0485700AK068131GCGCGCGACGCGNONE 
AK069097GCGCGCGACGCGMethyl-CpG binding domain containing protein. 
J013130L03GCGCGCGACGCGNONE 
Os08g0495300Os08g0495300GCGCGCGAGConserved hypothetical protein. 
Os08g0517700AK071151GCGCGCGACOxysterol-binding protein family protein. 
Os08g0535400004-001-H10GAGACGTGGGCCCCACCCTCGCGCGCNONE 
AK071527GAGACGTGGGCCCCACCCTCGCGCGCZinc finger, DHHC-type domain containing protein. 
J023107B02GAGACGTGGGCCCCACCCTCGCGCGCNONE 
Os08g0536300AF358777TCGCGCGCNONE 
AK099722TCGCGCGCSimilar to Hd1. 
J100054G13TCGCGCGCNONE 
Os08g0565200AK108143GTCGCGCGCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0101800AK102345CTCGCGCGCWD40-like domain containing protein. 
J090030C23CTCGCGCGCNONE 
Os09g0363700AK103667GTCGCGCGCConserved hypothetical protein. 
J075001L14GTCGCGCGCNONE 
J075049M23GTCGCGCGCNONE 
J075051I04GTCGCGCGCNONE 
J075073L04GTCGCGCGCNONE 
J075077E03GTCGCGCGCNONE 
J075083J11GTCGCGCGCNONE 
J075094J22GTCGCGCGCNONE 
J075112E08GTCGCGCGCNONE 
J075137J23GTCGCGCGCNONE 
J075192E02GTCGCGCGCNONE 
J100039K04GTCGCGCGCNONE 
Os09g0386200J013002G14GCGCGCGANONE 
J065121C06GCGCGCGAU box domain containing protein. 
J100039D18GCGCGCGANONE 
J100050A19GCGCGCGANONE 
J100075N18GCGCGCGANONE 
J100083E14GCGCGCGANONE 
J100085J24GCGCGCGANONE 
J100088B02GCGCGCGANONE 
J100090J11GCGCGCGANONE 
Os09g0403000AK111051GCGCGCGACConserved hypothetical protein. 
Os09g0417600006-110-A01CTCGCGCGCNONE 
AF467736CTCGCGCGCNONE 
AK059966CTCGCGCGCNONE 
AK068337CTCGCGCGCWRKY transcription factor 76. 
AY323479CTCGCGCGCNONE 
J013151N12CTCGCGCGCNONE 
J065064C11CTCGCGCGCNONE 
J065152D10CTCGCGCGCNONE 
J065162J10CTCGCGCGCNONE 
J075033B01CTCGCGCGCNONE 
Os09g0418000006-022-F01CTCGCGCGCNONE 
006-038-G10CTCGCGCGCNONE 
006-089-G04CTCGCGCGCNONE 
006-098-F07CTCGCGCGCNONE 
AK061220CTCGCGCGCNONE 
AK061493CTCGCGCGCNONE 
AK100881CTCGCGCGCNONE 
AK119760CTCGCGCGCProtein kinase-like domain containing protein. 
J023127H10CTCGCGCGCNONE 
J033122J01CTCGCGCGCNONE 
J065162D08CTCGCGCGCNONE 
J065214P03CTCGCGCGCNONE 
J090009B17CTCGCGCGCNONE 
J090093C21CTCGCGCGCNONE 
J100067C01CTCGCGCGCNONE 
J100067P06CTCGCGCGCNONE 
Os09g0420300AK120582TCGCGCGCDNA glycosylase family protein. 
Os09g0433000009-198-H02CTCGCGCGCNONE 
AK063243CTCGCGCGCNONE 
Os09g0456200015-025-E01CCACGCGTCGCGCGCNONE 
015-025-E01CTCGCGCGCCACGTNONE 
AK065873CCACGCGTCGCGCGCSimilar to BZIP transcription factor ABI5. 
AK065873CTCGCGCGCCACGTSimilar to BZIP transcription factor ABI5. 
J013049N23CCACGCGTCGCGCGCNONE 
J013049N23CTCGCGCGCCACGTNONE 
J033128E10CCACGCGTCGCGCGCNONE 
J033128E10CTCGCGCGCCACGTNONE 
Os09g0459900009-190-G09CTCGCGCGCNONE 
AK063208CTCGCGCGCCyclin-dependent kinase inhibitor family protein. 
AK111010CTCGCGCGCNONE 
Os09g0480600AK107853GTCGCGCGCGCGAGHypothetical protein. 
Os09g0511600015-078-A09CTCGCGCGCNONE 
AK102869CTCGCGCGCNONE 
AK121679CTCGCGCGCNONE 
AK121935CTCGCGCGCGlycoside hydrolase, family 1 protein. 
Os09g0525500AK107918GCGCGCGAYY1 protein precursor. 
D50575GCGCGCGANONE 
Os09g0526700011-075-B12CTCGCGCGCNONE 
AB097460CTCGCGCGCNONE 
AK073610CTCGCGCGCSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase). 
AK104977CTCGCGCGCNONE 
Os09g0551600005-020-H08CGCGTCGCGCGCNONE 
006-043-E02CGCGTCGCGCGCNONE 
013-043-F03CGCGTCGCGCGCNONE 
AK066658CGCGTCGCGCGCSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CGCGTCGCGCGCNONE 
J065177J20CGCGTCGCGCGCNONE 
J075041D06CGCGTCGCGCGCNONE 
J075199H24CGCGTCGCGCGCNONE 
J080001G07CGCGTCGCGCGCNONE 
J080024A12CGCGTCGCGCGCNONE 
J080025B15CGCGTCGCGCGCNONE 
J090017G07CGCGTCGCGCGCNONE 
J090050G23CGCGTCGCGCGCNONE 
J090083G11CGCGTCGCGCGCNONE 
Os11g0216900AK060326CTCGCGCGCGTGGGCCTTGSimilar to IDI2. 
AK060549CTCGCGCGCGTGGGCCTTGNONE 
AK100869CTCGCGCGCGTGGGCCTTGNONE 
Os11g0223000J065060C21AGATGGGCGCGCGAGNONE 
Os11g0234200AK105440GCGCGCGAZinc finger, FYVE/PHD-type domain containing protein. 
AK105440TCGCGCGCZinc finger, FYVE/PHD-type domain containing protein. 
Os11g0276000AK072319GTCGCGCGCSimilar to Roothairless 1. 
Os11g0528500AK058434GCGCGCGASimilar to Rubredoxin 1 (Rd-1). 
AK058434TCCACGCCACGCCACGCCACGCCACGCGCGCGASimilar to Rubredoxin 1 (Rd-1). 
J065110G13GCGCGCGANONE 
J065110G13TCCACGCCACGCCACGCCACGCCACGCGCGCGANONE 
Os11g0582400AF049348CCCCCGCGCGCGACGTGGGCTConserved hypothetical protein. 
AF516927CCCCCGCGCGCGACGTGGGCTNONE 
AK073083CCCCCGCGCGCGACGTGGGCTNONE 
AK108352CCCCCGCGCGCGACGTGGGCTNONE 
J075005O16CCCCCGCGCGCGACGTGGGCTNONE 
J075007D15CCCCCGCGCGCGACGTGGGCTNONE 
J075007L04CCCCCGCGCGCGACGTGGGCTNONE 
J075009C11CCCCCGCGCGCGACGTGGGCTNONE 
J075012L11CCCCCGCGCGCGACGTGGGCTNONE 
J075013A14CCCCCGCGCGCGACGTGGGCTNONE 
J075015K01CCCCCGCGCGCGACGTGGGCTNONE 
J075019O21CCCCCGCGCGCGACGTGGGCTNONE 
J075020G20CCCCCGCGCGCGACGTGGGCTNONE 
J075020H06CCCCCGCGCGCGACGTGGGCTNONE 
J075022D07CCCCCGCGCGCGACGTGGGCTNONE 
J075024M12CCCCCGCGCGCGACGTGGGCTNONE 
J075025G04CCCCCGCGCGCGACGTGGGCTNONE 
J075026F09CCCCCGCGCGCGACGTGGGCTNONE 
J075027D19CCCCCGCGCGCGACGTGGGCTNONE 
J075030A12CCCCCGCGCGCGACGTGGGCTNONE 
J075030C16CCCCCGCGCGCGACGTGGGCTNONE 
J075030D15CCCCCGCGCGCGACGTGGGCTNONE 
J075034M20CCCCCGCGCGCGACGTGGGCTNONE 
J075041H12CCCCCGCGCGCGACGTGGGCTNONE 
J075052D12CCCCCGCGCGCGACGTGGGCTNONE 
J075052G11CCCCCGCGCGCGACGTGGGCTNONE 
J075053L09CCCCCGCGCGCGACGTGGGCTNONE 
J075064G05CCCCCGCGCGCGACGTGGGCTNONE 
J075067J01CCCCCGCGCGCGACGTGGGCTNONE 
J075071O03CCCCCGCGCGCGACGTGGGCTNONE 
J075072G12CCCCCGCGCGCGACGTGGGCTNONE 
J075078H06CCCCCGCGCGCGACGTGGGCTNONE 
J075081D06CCCCCGCGCGCGACGTGGGCTNONE 
J075084G23CCCCCGCGCGCGACGTGGGCTNONE 
J075085M10CCCCCGCGCGCGACGTGGGCTNONE 
J075087N20CCCCCGCGCGCGACGTGGGCTNONE 
J075088E11CCCCCGCGCGCGACGTGGGCTNONE 
J075088O22CCCCCGCGCGCGACGTGGGCTNONE 
J075091E10CCCCCGCGCGCGACGTGGGCTNONE 
J075092B12CCCCCGCGCGCGACGTGGGCTNONE 
J075093E08CCCCCGCGCGCGACGTGGGCTNONE 
J075095D04CCCCCGCGCGCGACGTGGGCTNONE 
J075095J10CCCCCGCGCGCGACGTGGGCTNONE 
J075095O19CCCCCGCGCGCGACGTGGGCTNONE 
J075096H20CCCCCGCGCGCGACGTGGGCTNONE 
J075098F10CCCCCGCGCGCGACGTGGGCTNONE 
J075100H10CCCCCGCGCGCGACGTGGGCTNONE 
J075104C23CCCCCGCGCGCGACGTGGGCTNONE 
J075105B10CCCCCGCGCGCGACGTGGGCTNONE 
J075106I24CCCCCGCGCGCGACGTGGGCTNONE 
J075109H23CCCCCGCGCGCGACGTGGGCTNONE 
J075115A03CCCCCGCGCGCGACGTGGGCTNONE 
J075118M06CCCCCGCGCGCGACGTGGGCTNONE 
J075121G08CCCCCGCGCGCGACGTGGGCTNONE 
J075122C09CCCCCGCGCGCGACGTGGGCTNONE 
J075122J12CCCCCGCGCGCGACGTGGGCTNONE 
J075123E06CCCCCGCGCGCGACGTGGGCTNONE 
J075123E16CCCCCGCGCGCGACGTGGGCTNONE 
J075124N09CCCCCGCGCGCGACGTGGGCTNONE 
J075127F23CCCCCGCGCGCGACGTGGGCTNONE 
J075128H17CCCCCGCGCGCGACGTGGGCTNONE 
J075129C02CCCCCGCGCGCGACGTGGGCTNONE 
J075139P18CCCCCGCGCGCGACGTGGGCTNONE 
J075140H17CCCCCGCGCGCGACGTGGGCTNONE 
J075146E12CCCCCGCGCGCGACGTGGGCTNONE 
J075146I07CCCCCGCGCGCGACGTGGGCTNONE 
J075150A08CCCCCGCGCGCGACGTGGGCTNONE 
J075150I22CCCCCGCGCGCGACGTGGGCTNONE 
J075155D01CCCCCGCGCGCGACGTGGGCTNONE 
J075155N10CCCCCGCGCGCGACGTGGGCTNONE 
J075155O09CCCCCGCGCGCGACGTGGGCTNONE 
J075156K11CCCCCGCGCGCGACGTGGGCTNONE 
J075157N01CCCCCGCGCGCGACGTGGGCTNONE 
J075164L09CCCCCGCGCGCGACGTGGGCTNONE 
J075166F14CCCCCGCGCGCGACGTGGGCTNONE 
J075169E20CCCCCGCGCGCGACGTGGGCTNONE 
J075170B13CCCCCGCGCGCGACGTGGGCTNONE 
J075170F24CCCCCGCGCGCGACGTGGGCTNONE 
J075170N16CCCCCGCGCGCGACGTGGGCTNONE 
J075172H22CCCCCGCGCGCGACGTGGGCTNONE 
J075172I02CCCCCGCGCGCGACGTGGGCTNONE 
J075176E08CCCCCGCGCGCGACGTGGGCTNONE 
J075177H17CCCCCGCGCGCGACGTGGGCTNONE 
J075179C18CCCCCGCGCGCGACGTGGGCTNONE 
J075182H23CCCCCGCGCGCGACGTGGGCTNONE 
J075187B10CCCCCGCGCGCGACGTGGGCTNONE 
J075192L10CCCCCGCGCGCGACGTGGGCTNONE 
J075195C04CCCCCGCGCGCGACGTGGGCTNONE 
U25969CCCCCGCGCGCGACGTGGGCTNONE 
Os11g0586300AK072257CTCGCGCGCConserved hypothetical protein. 
Os11g0619800016-094-C06CTCGCGCGCNONE 
AK107437CTCGCGCGCTRAF-like domain containing protein. 
Os11g0621000AK099685TCGCGCGCNONE 
AK106377TCGCGCGCProtein of unknown function DUF716 family protein. 
Os11g0702400009-051-E08TCGCGCGCNONE 
009-170-H11TCGCGCGCNONE 
AK062491TCGCGCGCNONE 
AK105226TCGCGCGCZinc finger, C2H2-type domain containing protein. 
AY305866TCGCGCGCNONE 
Os12g0149300AK110842CGCGTCGCGCGCSimilar to Xyloglucan 6-xylosyltransferase (EC 2.4.2.39) (AtXT1). 
AK110842CTCGCGCGCSimilar to Xyloglucan 6-xylosyltransferase (EC 2.4.2.39) (AtXT1). 
Os12g0275500009-200-B09GCGCGCGANONE 
AK063250GCGCGCGAHypothetical protein. 
Os12g0407100J075130F11GCGCGCGACACGTGTCNONE 
J075150G14GCGCGCGACACGTGTCConserved hypothetical protein. 
J090089B20GCGCGCGACACGTGTCNONE 
J100042D22GCGCGCGACACGTGTCNONE 
Os12g0550800006-091-A05TCGCGCGCGACNONE 
AK061828TCGCGCGCGACNONE 
AK098944TCGCGCGCGACNONE 
AK102550TCGCGCGCGACHypothetical protein. 
J013045G24TCGCGCGCGACNONE 
J065156K11TCGCGCGCGACNONE 
J065201E21TCGCGCGCGACNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.