version

Summary of OsREG618 (All List)

OrganismOryza sativa  
IDOsREG618  
SequenceGCGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3176  

Entry Sequences (3176 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein. 
Os01g0141100012-043-A12GCGGCCCAAGNONE 
AK062139GCGGCCCAAGNONE 
J013110M14GCGGCCCAAGNONE 
J013114F09GCGGCCCAAGNONE 
J033036J01GCGGCCCAAGNONE 
Os01g0164500AK068747GCGGCCCACCASimilar to ATP-dependent RNA helicase-like protein. 
AK103737GCGGCCCACCANONE 
Os01g0179901J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0193400AK069948TGCGGCCCAGANONE 
AK099271TGCGGCCCAGANONE 
AK107005TGCGGCCCAGAConserved hypothetical protein. 
Os01g0226700014-020-B10TGCGGCCCAGCCNONE 
AK063653TGCGGCCCAGCCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0270100006-096-H09TGTGGGCCGCANONE 
009-009-C10TGTGGGCCGCANONE 
009-054-E06TGTGGGCCGCANONE 
014-085-F09TGTGGGCCGCANONE 
AK073275TGTGGGCCGCANONE 
AK104155TGTGGGCCGCANONE 
AK119511TGTGGGCCGCASimilar to Cysteine protease inhibitor. 
J033025K21TGTGGGCCGCANONE 
J075065H10TGTGGGCCGCANONE 
J075143G10TGTGGGCCGCANONE 
J100059J02TGTGGGCCGCANONE 
Os01g0283000AK073165CTGGCCCATTTGCGGCCCAGTConserved hypothetical protein. 
J033023G08CTGGCCCATTTGCGGCCCAGTNONE 
Os01g0283100004-018-B01ACTGGGCCGCAAATGGGCCAGNONE 
AK060908ACTGGGCCGCAAATGGGCCAGNONE 
AK071713ACTGGGCCGCAAATGGGCCAGSimilar to Ferripyochelin-binding protein-like. 
AK104205ACTGGGCCGCAAATGGGCCAGNONE 
AK122051ACTGGGCCGCAAATGGGCCAGNONE 
J023109L19ACTGGGCCGCAAATGGGCCAGNONE 
Os01g0299400AK107814TGCGGCCCAAAASterile alpha motif homology domain containing protein. 
J065112H10TGCGGCCCAAAANONE 
Os01g0303800006-024-G06TGCGGCCCAAANONE 
006-025-F12TGCGGCCCAAANONE 
006-085-E12TGCGGCCCAAANONE 
006-092-F12TGCGGCCCAAANONE 
AK060078TGCGGCCCAAAUniversal stress protein (Usp) family protein. 
AK121626TGCGGCCCAAANONE 
J023044K21TGCGGCCCAAANONE 
J023069K09TGCGGCCCAAANONE 
J023091A17TGCGGCCCAAANONE 
J033048C05TGCGGCCCAAANONE 
J033126M13TGCGGCCCAAANONE 
J065040E06TGCGGCCCAAANONE 
J065060D14TGCGGCCCAAANONE 
Os01g0328400006-092-H09GCGGCCCAATANONE 
006-092-H09GCGGCCCATCTNONE 
009-085-A02GCGGCCCAATANONE 
009-085-A02GCGGCCCATCTNONE 
012-078-B03GCGGCCCAATANONE 
012-078-B03GCGGCCCATCTNONE 
AK061988GCGGCCCAATAUbiquitin. 
AK061988GCGGCCCATCTUbiquitin. 
J013073B13GCGGCCCAATANONE 
J013073B13GCGGCCCATCTNONE 
J023135L09GCGGCCCAATANONE 
J023135L09GCGGCCCATCTNONE 
J023135O07GCGGCCCAATANONE 
J023135O07GCGGCCCATCTNONE 
J033027B12GCGGCCCAATANONE 
J033027B12GCGGCCCATCTNONE 
J033084P17GCGGCCCAATANONE 
J033084P17GCGGCCCATCTNONE 
J065010M05GCGGCCCAATANONE 
J065010M05GCGGCCCATCTNONE 
J065021N11GCGGCCCAATANONE 
J065021N11GCGGCCCATCTNONE 
J065021N12GCGGCCCAATANONE 
J065021N12GCGGCCCATCTNONE 
J065031K11GCGGCCCAATANONE 
J065031K11GCGGCCCATCTNONE 
J065072P04GCGGCCCAATANONE 
J065072P04GCGGCCCATCTNONE 
J065098D05GCGGCCCAATANONE 
J065098D05GCGGCCCATCTNONE 
J065122N23GCGGCCCAATANONE 
J065122N23GCGGCCCATCTNONE 
J065129L13GCGGCCCAATANONE 
J065129L13GCGGCCCATCTNONE 
J065135N13GCGGCCCAATANONE 
J065135N13GCGGCCCATCTNONE 
J065215N10GCGGCCCAATANONE 
J065215N10GCGGCCCATCTNONE 
J075120N22GCGGCCCAATANONE 
J075120N22GCGGCCCATCTNONE 
J090011G23GCGGCCCAATANONE 
J090011G23GCGGCCCATCTNONE 
J090014F06GCGGCCCAATANONE 
J090014F06GCGGCCCATCTNONE 
J090040G23GCGGCCCAATANONE 
J090040G23GCGGCCCATCTNONE 
J090075I20GCGGCCCAATANONE 
J090075I20GCGGCCCATCTNONE 
J090075N01GCGGCCCAATANONE 
J090075N01GCGGCCCATCTNONE 
J090089B04GCGGCCCAATANONE 
J090089B04GCGGCCCATCTNONE 
J090090F08GCGGCCCAATANONE 
J090090F08GCGGCCCATCTNONE 
J090091M17GCGGCCCAATANONE 
J090091M17GCGGCCCATCTNONE 
J090094L03GCGGCCCAATANONE 
J090094L03GCGGCCCATCTNONE 
J090099L06GCGGCCCAATANONE 
J090099L06GCGGCCCATCTNONE 
J100018A18GCGGCCCAATANONE 
J100018A18GCGGCCCATCTNONE 
J100027H13GCGGCCCAATANONE 
J100027H13GCGGCCCATCTNONE 
J100069C05GCGGCCCAATANONE 
J100069C05GCGGCCCATCTNONE 
J100086L10GCGGCCCAATANONE 
J100086L10GCGGCCCATCTNONE 
Os01g0342900011-017-G10GCGGCCCAATNONE 
AK063921GCGGCCCAATSimilar to Adenosine monophosphate binding protein 1 AMPBP1. 
J033050H23GCGGCCCAATNONE 
J065097A19GCGGCCCAATNONE 
Os01g0508300AK101435GCGGCCCATGANONE 
AK111287GCGGCCCATGAConserved hypothetical protein. 
J065096N08GCGGCCCATGANONE 
J075003F13GCGGCCCATGANONE 
J075014I16GCGGCCCATGANONE 
J075022D23GCGGCCCATGANONE 
J075040N19GCGGCCCATGANONE 
J075121O06GCGGCCCATGANONE 
J075131E17GCGGCCCATGANONE 
J075136N22GCGGCCCATGANONE 
J075147D01GCGGCCCATGANONE 
J075173C07GCGGCCCATGANONE 
J075196L22GCGGCCCATGANONE 
Os01g0513700AK058445ACATGGGCCGCNONE 
AK068877ACATGGGCCGCSybindin-like protein family protein. 
J023001F01ACATGGGCCGCNONE 
J065065I18ACATGGGCCGCNONE 
J065165A09ACATGGGCCGCNONE 
J065184N12ACATGGGCCGCNONE 
J065205M05ACATGGGCCGCNONE 
J075172I17ACATGGGCCGCNONE 
J090025O09ACATGGGCCGCNONE 
J100087H03ACATGGGCCGCNONE 
Os01g0558500AK099982GCGGCCCAATPWWP domain containing protein. 
J065096J12GCGGCCCAATNONE 
Os01g0593700Os01g0593700GCGGCCCACCSulphate anion transporter family protein. 
Os01g0613900014-018-D04GCGGCCCATGANONE 
AK119181GCGGCCCATGAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14GCGGCCCATGANONE 
J065019A15GCGGCCCATGANONE 
J075090J10GCGGCCCATGANONE 
J075195H12GCGGCCCATGANONE 
Os01g0616600009-171-H09ATTTGGGCCGCANONE 
011-005-G09ATTTGGGCCGCANONE 
012-089-C03ATTTGGGCCGCANONE 
AK063911ATTTGGGCCGCAProtein prenyltransferase domain containing protein. 
AK101490ATTTGGGCCGCANONE 
Os01g0640800AK065688CTTGGGCCGCAConserved hypothetical protein 48 family protein. 
J013042L10CTTGGGCCGCANONE 
J013121H08CTTGGGCCGCANONE 
Os01g0666500AK102689CTTGGGCCGCAConserved hypothetical protein. 
Os01g0733200AK066316GCGGCCCAAGCCCSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493GCGGCCCAAGCCCNONE 
J013066G03GCGGCCCAAGCCCNONE 
J090034J08GCGGCCCAAGCCCNONE 
Os01g0738600AK073479GCGGCCCAAGENTH/VHS domain containing protein. 
AK120616GCGGCCCAAGNONE 
J013046M12GCGGCCCAAGNONE 
J013152B11GCGGCCCAAGNONE 
J023007A09GCGGCCCAAGNONE 
J023007N03GCGGCCCAAGNONE 
J023042A01GCGGCCCAAGNONE 
J023059P06GCGGCCCAAGNONE 
J023113A05GCGGCCCAAGNONE 
J033044K11GCGGCCCAAGNONE 
J033082E04GCGGCCCAAGNONE 
J090033B13GCGGCCCAAGNONE 
J090062H08GCGGCCCAAGNONE 
J100086G23GCGGCCCAAGNONE 
Os01g0749900AK103588GCTGGGCCGCProtein of unknown function DUF250 domain containing protein. 
J033090O22GCTGGGCCGCNONE 
J033133C05GCTGGGCCGCNONE 
J065122N01GCTGGGCCGCNONE 
J065188K04GCTGGGCCGCNONE 
J090012D18GCTGGGCCGCNONE 
J100074N02GCTGGGCCGCNONE 
Os01g0754000014-081-F07AAATGGGCCGCNONE 
AK063730AAATGGGCCGCConserved hypothetical protein. 
J065219A11AAATGGGCCGCNONE 
J075136N13AAATGGGCCGCNONE 
J100051G01AAATGGGCCGCNONE 
J100053M22AAATGGGCCGCNONE 
Os01g0761100AK122112GCGGCCCAACATesmin/TSO1-like, CXC domain containing protein. 
Os01g0772200AK060471GCGGCCCAAGTranscription initiation factor IIF, beta subunit family protein. 
AK103491GCGGCCCAAGNONE 
J023093E05GCGGCCCAAGNONE 
J023101M03GCGGCCCAAGNONE 
J033130N17GCGGCCCAAGNONE 
J043021L02GCGGCCCAAGNONE 
J065001E22GCGGCCCAAGNONE 
J065070G06GCGGCCCAAGNONE 
J065081D15GCGGCCCAAGNONE 
J065123G09GCGGCCCAAGNONE 
J065170K04GCGGCCCAAGNONE 
J065187A01GCGGCCCAAGNONE 
J065210E10GCGGCCCAAGNONE 
J075172K06GCGGCCCAAGNONE 
Os01g0782200AK072068TCTGGGCCGCANONE 
AK107062TCTGGGCCGCADiacylglycerol kinase, catalytic region domain containing protein. 
Os01g0788900AK073287GCGGCCCAAACNONE 
Os01g0811100006-061-F11TGGTGGGCCGCNONE 
AB026562TGGTGGGCCGCNONE 
AK061784TGGTGGGCCGCNONE 
AK103541TGGTGGGCCGCProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
J013020B12TGGTGGGCCGCNONE 
J013022J21TGGTGGGCCGCNONE 
J013056G19TGGTGGGCCGCNONE 
J013060O07TGGTGGGCCGCNONE 
J013110I07TGGTGGGCCGCNONE 
J013160D19TGGTGGGCCGCNONE 
J090035A13TGGTGGGCCGCNONE 
Os01g0833000AK067226GCGGCCCAGCProtein prenyltransferase domain containing protein. 
J013098M23GCGGCCCAGCNONE 
Os01g0851100AK071217GCGGCCCAAGNONE 
Os01g0869800006-029-F03CACGCCACGCGGCCCATGNONE 
006-067-H02CACGCCACGCGGCCCATGNONE 
006-084-A06CACGCCACGCGGCCCATGNONE 
AK058284CACGCCACGCGGCCCATGSimilar to Photosystem II subunit PsbS. 
AK071827CACGCCACGCGGCCCATGNONE 
AK104275CACGCCACGCGGCCCATGNONE 
J013049J07CACGCCACGCGGCCCATGNONE 
J033089F12CACGCCACGCGGCCCATGNONE 
J090094I11CACGCCACGCGGCCCATGNONE 
Os01g0881100AK109822GCGGCCCAAACGGCCEpsin, N-terminal domain containing protein. 
Os01g0886600AK070098GCGGCCCACASimilar to CLP protease regulatory subunit CLPX precursor. 
Os01g0894700009-177-F04GCGGCCCAAACNONE 
AK067623GCGGCCCAAACConserved hypothetical protein. 
AK104876GCGGCCCAAACNONE 
J013095G01GCGGCCCAAACNONE 
J013108L20GCGGCCCAAACNONE 
J013120P13GCGGCCCAAACNONE 
Os01g0904400AJ535210GCGGCCCATGGNONE 
AK103514GCGGCCCATGGSimilar to Chromosome assembly protein homolog. 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0918200009-034-H02GCGGCCCACANONE 
009-034-H02GCGGCCCAGGNONE 
AK062434GCGGCCCACASimilar to Ubiquitin-like protein SMT3. 
AK062434GCGGCCCAGGSimilar to Ubiquitin-like protein SMT3. 
AK103092GCGGCCCACANONE 
AK103092GCGGCCCAGGNONE 
J065093P18GCGGCCCACANONE 
J065093P18GCGGCCCAGGNONE 
J065137C15GCGGCCCACANONE 
J065137C15GCGGCCCAGGNONE 
J065156G01GCGGCCCACANONE 
J065156G01GCGGCCCAGGNONE 
J065206H16GCGGCCCACANONE 
J065206H16GCGGCCCAGGNONE 
J065209D03GCGGCCCACANONE 
J065209D03GCGGCCCAGGNONE 
J075073K05GCGGCCCACANONE 
J075073K05GCGGCCCAGGNONE 
J075099B17GCGGCCCACANONE 
J075099B17GCGGCCCAGGNONE 
J075166N04GCGGCCCACANONE 
J075166N04GCGGCCCAGGNONE 
Os01g0918300009-036-G04GCGGCCCACANONE 
009-128-H04GCGGCCCACANONE 
009-189-D06GCGGCCCACANONE 
AB016030GCGGCCCACANONE 
AK058869GCGGCCCACAUbiquitin-like protein SMT3. 
AK069668GCGGCCCACANONE 
J023026B05GCGGCCCACANONE 
J053042E12GCGGCCCACANONE 
J053045P19GCGGCCCACANONE 
J053078C24GCGGCCCACANONE 
J065038J05GCGGCCCACANONE 
J065170B12GCGGCCCACANONE 
J065174C07GCGGCCCACANONE 
J075002G06GCGGCCCACANONE 
J075024O07GCGGCCCACANONE 
J075068H04GCGGCCCACANONE 
J075071H14GCGGCCCACANONE 
J075095G03GCGGCCCACANONE 
J075117O08GCGGCCCACANONE 
J075118J23GCGGCCCACANONE 
J075124P18GCGGCCCACANONE 
J100057D06GCGGCCCACANONE 
J100063L03GCGGCCCACANONE 
X99608GCGGCCCACANONE 
Os01g0939700AK059803GCGGCCCAAGNONE 
AK070588GCGGCCCAAGSimilar to Esterase D (EC 3.1.1.1). 
AK111469GCGGCCCAAGNONE 
J090021L11GCGGCCCAAGNONE 
Os01g0946200AK071060AAATGGGCCGCNo apical meristem (NAM) protein domain containing protein. 
J023080K20AAATGGGCCGCNONE 
Os01g0958100AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os01g0960300AK100099TGCGGCCCAAGSimilar to Glucose inhibited division protein A. 
Os01g0965500J075073G20CCATGGGCCGCNuclear protein SET domain containing protein. 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0138600AK071778GGGCCGGCGGCCCAGAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023113L07GGGCCGGCGGCCCAGANONE 
Os02g0178400009-151-B08AACTGGGCCGCNONE 
AK063815AACTGGGCCGCProtein transport protein SEC61 gamma subunit. 
AK121516AACTGGGCCGCNONE 
J033026A17AACTGGGCCGCNONE 
J065011K14AACTGGGCCGCNONE 
J065056D01AACTGGGCCGCNONE 
J065061L22AACTGGGCCGCNONE 
J065076M01AACTGGGCCGCNONE 
J075092E14AACTGGGCCGCNONE 
Os02g0187600AK069783CGATGGGCCGCANONE 
AK109387CGATGGGCCGCAConserved hypothetical protein. 
J090029C18CGATGGGCCGCANONE 
Os02g0193500009-092-G09TGCGGCCCACGCGNONE 
AK101237TGCGGCCCACGCGHypothetical protein. 
J033031K13TGCGGCCCACGCGNONE 
J033034P12TGCGGCCCACGCGNONE 
J080304L19TGCGGCCCACGCGNONE 
J100059N21TGCGGCCCACGCGNONE 
Os02g0194000015-020-A08TGGTGGGCCGCNONE 
AK064096TGGTGGGCCGCMyb, DNA-binding domain containing protein. 
J090092L06TGGTGGGCCGCNONE 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0219200016-016-C03AATTGGGCCGCANONE 
AK059059AATTGGGCCGCASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0230200AK105482TTATGGGCCGCConserved hypothetical protein. 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
Os02g0301400AK121646GCGGCCCAAGThioredoxin-like fold domain containing protein. 
J033028E10GCGGCCCAAGNONE 
J033058J23GCGGCCCAAGNONE 
Os02g0445700011-046-C10GCGGCCCAAGNONE 
Os02g0485000016-062-B12CCTGGGCCGCNONE 
AK064246CCTGGGCCGCTransferase family protein. 
Os02g0517531AK121247GGGTGGGCCGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0537500AK068689TCCGGCCCATTGGGCCGCSimilar to E2F homolog. 
Os02g0591800AK060611TGTGGGCCGCABrix domain containing protein. 
AK102534TGTGGGCCGCANONE 
J075057H08TGTGGGCCGCANONE 
J075179P18TGTGGGCCGCANONE 
J080011H01TGTGGGCCGCANONE 
J080018E14TGTGGGCCGCANONE 
J080026N17TGTGGGCCGCANONE 
J080047A13TGTGGGCCGCANONE 
J080049C17TGTGGGCCGCANONE 
J080050G07TGTGGGCCGCANONE 
J080064D10TGTGGGCCGCANONE 
J080080A03TGTGGGCCGCANONE 
J080080G20TGTGGGCCGCANONE 
J080080I03TGTGGGCCGCANONE 
J080081H12TGTGGGCCGCANONE 
J080090K07TGTGGGCCGCANONE 
J080092O06TGTGGGCCGCANONE 
J080096B07TGTGGGCCGCANONE 
J080097M08TGTGGGCCGCANONE 
Os02g0602300AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0605600016-017-B02TCATGGGCCGCNONE 
AK066104TCATGGGCCGCLUC7 related family protein. 
J013052G16TCATGGGCCGCNONE 
J043022E03TCATGGGCCGCNONE 
J065105P10TCATGGGCCGCNONE 
Os02g0634600AK101737GTGGGGGCGGCCCAConserved hypothetical protein. 
Os02g0643200AK106784TGCGGCCCACGCYABBY protein family protein. 
J075048L13TGCGGCCCACGCNONE 
Os02g0677300006-102-D12GAGGCCCAGAGCGGCCCACTNONE 
006-102-D12GCGGCCCACGTNONE 
AK060550GAGGCCCAGAGCGGCCCACTNONE 
AK060550GCGGCCCACGTNONE 
AK106041GAGGCCCAGAGCGGCCCACTSimilar to CRT/DRE binding factor 1. 
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1. 
Os02g0697600011-021-B01CTTGGGCCGCANONE 
AK121757CTTGGGCCGCAAAA ATPase domain containing protein. 
Os02g0705300006-028-G05TGTTGGGCCGCNONE 
006-064-H09TGTTGGGCCGCNONE 
AK062089TGTTGGGCCGCNONE 
AK064855TGTTGGGCCGCNONE 
AK106164TGTTGGGCCGCTubby family protein. 
Os02g0723200AK108140GCGGCCCAACCSimilar to Alpha galactosyltransferase (Fragment). 
J090087D22GCGGCCCAACCNONE 
Os02g0750500AK101960GCGGCCCATTTSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GCGGCCCATTTNONE 
J065054F02GCGGCCCATTTNONE 
J065124N03GCGGCCCATTTNONE 
J090001H12GCGGCCCATTTNONE 
J100057J01GCGGCCCATTTNONE 
J100062F12GCGGCCCATTTNONE 
Os02g0752300AK072544GCGGCCCAAATConserved hypothetical protein. 
J023132N16GCGGCCCAAATNONE 
J033069F17GCGGCCCAAATNONE 
Os02g0767900009-154-G01TGCGGCCCAGCCCNONE 
009-172-H09TGCGGCCCAGCCCNONE 
AK099885TGCGGCCCAGCCCGlutaredoxin 2 family protein. 
Os02g0787100Os02g0787100GCGGCCCACGCProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0795900012-075-B04TGCGGCCCACGANONE 
AK105305TGCGGCCCACGASimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21TGCGGCCCACGANONE 
Os02g0823600AK070498TAATGGGCCGCConserved hypothetical protein. 
J065055C02TAATGGGCCGCNONE 
J065098A17TAATGGGCCGCNONE 
J065119B13TAATGGGCCGCNONE 
J065146F10TAATGGGCCGCNONE 
J065209G06TAATGGGCCGCNONE 
J080001K12TAATGGGCCGCNONE 
J080004O17TAATGGGCCGCNONE 
J080005P21TAATGGGCCGCNONE 
J080009M18TAATGGGCCGCNONE 
J080013O18TAATGGGCCGCNONE 
J080014B04TAATGGGCCGCNONE 
J080014O21TAATGGGCCGCNONE 
J080015B04TAATGGGCCGCNONE 
J080016B17TAATGGGCCGCNONE 
J080017G09TAATGGGCCGCNONE 
J080022A17TAATGGGCCGCNONE 
J080024M10TAATGGGCCGCNONE 
J080025F17TAATGGGCCGCNONE 
J080025O16TAATGGGCCGCNONE 
J080029H09TAATGGGCCGCNONE 
J080030G24TAATGGGCCGCNONE 
J080031E02TAATGGGCCGCNONE 
J080032A18TAATGGGCCGCNONE 
J080032G24TAATGGGCCGCNONE 
J080033C05TAATGGGCCGCNONE 
J080033N19TAATGGGCCGCNONE 
J080035H10TAATGGGCCGCNONE 
J080035L05TAATGGGCCGCNONE 
J080042N09TAATGGGCCGCNONE 
J080044C14TAATGGGCCGCNONE 
J080048K16TAATGGGCCGCNONE 
J080050L07TAATGGGCCGCNONE 
J080051L06TAATGGGCCGCNONE 
J080051P22TAATGGGCCGCNONE 
J080053D09TAATGGGCCGCNONE 
J080053J15TAATGGGCCGCNONE 
J080053O12TAATGGGCCGCNONE 
J080057L01TAATGGGCCGCNONE 
J080062E08TAATGGGCCGCNONE 
J080062I09TAATGGGCCGCNONE 
J080063A21TAATGGGCCGCNONE 
J080063E04TAATGGGCCGCNONE 
J080063E08TAATGGGCCGCNONE 
J080064D15TAATGGGCCGCNONE 
J080064N15TAATGGGCCGCNONE 
J080068F13TAATGGGCCGCNONE 
J080070L16TAATGGGCCGCNONE 
J080072O17TAATGGGCCGCNONE 
J080075A07TAATGGGCCGCNONE 
J080076H10TAATGGGCCGCNONE 
J080077K19TAATGGGCCGCNONE 
J080078E19TAATGGGCCGCNONE 
J080082A02TAATGGGCCGCNONE 
J080083O05TAATGGGCCGCNONE 
J080091I07TAATGGGCCGCNONE 
J080094K10TAATGGGCCGCNONE 
J080094N03TAATGGGCCGCNONE 
J080096F09TAATGGGCCGCNONE 
J080097O04TAATGGGCCGCNONE 
J090037B19TAATGGGCCGCNONE 
J100017A13TAATGGGCCGCNONE 
J100068N22TAATGGGCCGCNONE 
J100072C06TAATGGGCCGCNONE 
Os02g0824700009-023-E06AATTGGGCCGCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18AATTGGGCCGCNONE 
J065017H21AATTGGGCCGCNONE 
J065052N02AATTGGGCCGCNONE 
J065053M01AATTGGGCCGCNONE 
J065064B14AATTGGGCCGCNONE 
J065146K22AATTGGGCCGCNONE 
Os02g0824900AK073217GCGGCCCAGCNONE 
AK103528GCGGCCCAGCConserved hypothetical protein. 
J090069J01GCGGCCCAGCNONE 
J090081B04GCGGCCCAGCNONE 
Os02g0827900AK099911TGATGGGCCAGCGGCCCATACSimilar to Signal peptidase 18 subunit (Fragment). 
Os02g0828200AK071199TGCGGCCCACAGCCCAATANONE 
Os03g0115200009-112-E09GCGGCCCATTANONE 
AK071287GCGGCCCATTASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06GCGGCCCATTANONE 
J065075D17GCGGCCCATTANONE 
J065108G15GCGGCCCATTANONE 
J065165A16GCGGCCCATTANONE 
J075015O12GCGGCCCATTANONE 
J075022O06GCGGCCCATTANONE 
J075031H14GCGGCCCATTANONE 
J075033D10GCGGCCCATTANONE 
J075070A04GCGGCCCATTANONE 
J075127A05GCGGCCCATTANONE 
J100070B16GCGGCCCATTANONE 
Os03g0131200AB020502TGCGGCCCATGTNONE 
AK062174TGCGGCCCATGTNONE 
AK066378TGCGGCCCATGTSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372TGCGGCCCATGTNONE 
J013060B21TGCGGCCCATGTNONE 
J013149P20TGCGGCCCATGTNONE 
J023060E16TGCGGCCCATGTNONE 
J043004A19TGCGGCCCATGTNONE 
J053029N09TGCGGCCCATGTNONE 
J053072I10TGCGGCCCATGTNONE 
J065016G02TGCGGCCCATGTNONE 
J065022E22TGCGGCCCATGTNONE 
J065024K17TGCGGCCCATGTNONE 
J065035E10TGCGGCCCATGTNONE 
J065036D13TGCGGCCCATGTNONE 
J065041E06TGCGGCCCATGTNONE 
J065064H14TGCGGCCCATGTNONE 
J065067I06TGCGGCCCATGTNONE 
J065080C01TGCGGCCCATGTNONE 
J065086K23TGCGGCCCATGTNONE 
J065087L12TGCGGCCCATGTNONE 
J065090I05TGCGGCCCATGTNONE 
J065117E23TGCGGCCCATGTNONE 
J065120A10TGCGGCCCATGTNONE 
J065120L22TGCGGCCCATGTNONE 
J065123F02TGCGGCCCATGTNONE 
J065128G02TGCGGCCCATGTNONE 
J065142B04TGCGGCCCATGTNONE 
J065143K12TGCGGCCCATGTNONE 
J065148B18TGCGGCCCATGTNONE 
J065153C16TGCGGCCCATGTNONE 
J065163J11TGCGGCCCATGTNONE 
J065168L24TGCGGCCCATGTNONE 
J065181J11TGCGGCCCATGTNONE 
J065190F19TGCGGCCCATGTNONE 
J065209E24TGCGGCCCATGTNONE 
J065210G04TGCGGCCCATGTNONE 
J065217H17TGCGGCCCATGTNONE 
J065219I20TGCGGCCCATGTNONE 
J075001M13TGCGGCCCATGTNONE 
J075007B08TGCGGCCCATGTNONE 
J075009I01TGCGGCCCATGTNONE 
J075014C11TGCGGCCCATGTNONE 
J075014L02TGCGGCCCATGTNONE 
J075016E07TGCGGCCCATGTNONE 
J075017J02TGCGGCCCATGTNONE 
J075018F07TGCGGCCCATGTNONE 
J075018N07TGCGGCCCATGTNONE 
J075019B06TGCGGCCCATGTNONE 
J075024F21TGCGGCCCATGTNONE 
J075026B18TGCGGCCCATGTNONE 
J075026M12TGCGGCCCATGTNONE 
J075032B13TGCGGCCCATGTNONE 
J075033O09TGCGGCCCATGTNONE 
J075041A09TGCGGCCCATGTNONE 
J075045L13TGCGGCCCATGTNONE 
J075048N11TGCGGCCCATGTNONE 
J075052A14TGCGGCCCATGTNONE 
J075061B17TGCGGCCCATGTNONE 
J075061I05TGCGGCCCATGTNONE 
J075066I11TGCGGCCCATGTNONE 
J075066P09TGCGGCCCATGTNONE 
J075068F03TGCGGCCCATGTNONE 
J075068P22TGCGGCCCATGTNONE 
J075080I15TGCGGCCCATGTNONE 
J075081I07TGCGGCCCATGTNONE 
J075082K01TGCGGCCCATGTNONE 
J075083A18TGCGGCCCATGTNONE 
J075086O11TGCGGCCCATGTNONE 
J075087E02TGCGGCCCATGTNONE 
J075087M19TGCGGCCCATGTNONE 
J075088G23TGCGGCCCATGTNONE 
J075092K18TGCGGCCCATGTNONE 
J075095H15TGCGGCCCATGTNONE 
J075095K12TGCGGCCCATGTNONE 
J075096L06TGCGGCCCATGTNONE 
J075100H23TGCGGCCCATGTNONE 
J075100K01TGCGGCCCATGTNONE 
J075102K21TGCGGCCCATGTNONE 
J075104F24TGCGGCCCATGTNONE 
J075106C17TGCGGCCCATGTNONE 
J075106E06TGCGGCCCATGTNONE 
J075106M19TGCGGCCCATGTNONE 
J075106O12TGCGGCCCATGTNONE 
J075108I09TGCGGCCCATGTNONE 
J075111M06TGCGGCCCATGTNONE 
J075112E12TGCGGCCCATGTNONE 
J075114C04TGCGGCCCATGTNONE 
J075120A06TGCGGCCCATGTNONE 
J075120D14TGCGGCCCATGTNONE 
J075122P15TGCGGCCCATGTNONE 
J075123A11TGCGGCCCATGTNONE 
J075123L12TGCGGCCCATGTNONE 
J075127G14TGCGGCCCATGTNONE 
J075127H09TGCGGCCCATGTNONE 
J075128M04TGCGGCCCATGTNONE 
J075129J04TGCGGCCCATGTNONE 
J075130J01TGCGGCCCATGTNONE 
J075137N02TGCGGCCCATGTNONE 
J075137O14TGCGGCCCATGTNONE 
J075138H22TGCGGCCCATGTNONE 
J075139P16TGCGGCCCATGTNONE 
J075141G08TGCGGCCCATGTNONE 
J075142C17TGCGGCCCATGTNONE 
J075143B09TGCGGCCCATGTNONE 
J075156I11TGCGGCCCATGTNONE 
J075158M03TGCGGCCCATGTNONE 
J075166I21TGCGGCCCATGTNONE 
J075167C08TGCGGCCCATGTNONE 
J075170C12TGCGGCCCATGTNONE 
J075170F08TGCGGCCCATGTNONE 
J075170G04TGCGGCCCATGTNONE 
J075172N16TGCGGCCCATGTNONE 
J075172P13TGCGGCCCATGTNONE 
J075173G24TGCGGCCCATGTNONE 
J075175D01TGCGGCCCATGTNONE 
J075175K01TGCGGCCCATGTNONE 
J075181O04TGCGGCCCATGTNONE 
J075186A04TGCGGCCCATGTNONE 
J075190B08TGCGGCCCATGTNONE 
J075190M24TGCGGCCCATGTNONE 
J075193D18TGCGGCCCATGTNONE 
J075193H03TGCGGCCCATGTNONE 
J075195N18TGCGGCCCATGTNONE 
J080001N20TGCGGCCCATGTNONE 
J080006K17TGCGGCCCATGTNONE 
J080012I16TGCGGCCCATGTNONE 
J080013K20TGCGGCCCATGTNONE 
J080018N01TGCGGCCCATGTNONE 
J080041G15TGCGGCCCATGTNONE 
J080048L15TGCGGCCCATGTNONE 
J080049A21TGCGGCCCATGTNONE 
J080075G12TGCGGCCCATGTNONE 
J080076O09TGCGGCCCATGTNONE 
J080078P10TGCGGCCCATGTNONE 
J080084D10TGCGGCCCATGTNONE 
J090005N07TGCGGCCCATGTNONE 
Os03g0135700AK060029CTCGCGCGGCCCACCNONE 
AK103779CTCGCGCGGCCCACCSimilar to Transcriptional activator Rb homolog (Fragment). 
J033145C17CTCGCGCGGCCCACCNONE 
J043021B17CTCGCGCGGCCCACCNONE 
Os03g0143400AK073999ACATGGGCCGCASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21ACATGGGCCGCANONE 
J033073C08ACATGGGCCGCANONE 
J033094C19ACATGGGCCGCANONE 
J065017L10ACATGGGCCGCANONE 
J065070H22ACATGGGCCGCANONE 
J065079M09ACATGGGCCGCANONE 
J065091N18ACATGGGCCGCANONE 
J065109N03ACATGGGCCGCANONE 
J065113F05ACATGGGCCGCANONE 
J065135D23ACATGGGCCGCANONE 
J065156L16ACATGGGCCGCANONE 
J065207O04ACATGGGCCGCANONE 
J065208F03ACATGGGCCGCANONE 
J090010M15ACATGGGCCGCANONE 
J090056J18ACATGGGCCGCANONE 
Os03g0143600AB110188AAATGGGCCGCNONE 
AK068424AAATGGGCCGCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464AAATGGGCCGCNONE 
AY224545AAATGGGCCGCNONE 
J013154F02AAATGGGCCGCNONE 
Os03g0146400AK111974GCGGCCCAAGSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554GCGGCCCAAGNONE 
J075060J10GCGGCCCAAGNONE 
Os03g0167600AK121254TTTGGGCCGCSimilar to Male sterility protein 2. 
Os03g0176800AK103848ATCTGGGCCGCConserved hypothetical protein. 
J033148K19ATCTGGGCCGCNONE 
J090079G01ATCTGGGCCGCNONE 
Os03g0181600AK067807AGCCCAAGCGGCCCACCASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197AGCCCAAGCGGCCCACCANONE 
Os03g0182800003-126-E06GCGGCCCACGGNONE 
AJ304840GCGGCCCACGGNONE 
AK073133GCGGCCCACGGNONE 
AY323478GCGGCCCACGGSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13GCGGCCCACGGNONE 
J033028C22GCGGCCCACGGNONE 
J033042J03GCGGCCCACGGNONE 
J065022E13GCGGCCCACGGNONE 
J065208N24GCGGCCCACGGNONE 
J100034B17GCGGCCCACGGNONE 
J100035J21GCGGCCCACGGNONE 
J100039L16GCGGCCCACGGNONE 
J100040A02GCGGCCCACGGNONE 
J100051L11GCGGCCCACGGNONE 
J100064F07GCGGCCCACGGNONE 
J100070J12GCGGCCCACGGNONE 
Os03g0190100AK061907GCGGCCCAGCCNONE 
AK066332GCGGCCCAGCCUbiA prenyltransferase family protein. 
J013051N11GCGGCCCAGCCNONE 
J013060C07GCGGCCCAGCCNONE 
J065117L08GCGGCCCAGCCNONE 
J100067H10GCGGCCCAGCCNONE 
Os03g0210400AK065966ACGTGGGCCGCProtein prenyltransferase domain containing protein. 
AK065966ATTGGGCCGCProtein prenyltransferase domain containing protein. 
AK065966ATTTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter. 
AK099306TCCGGCCCGTGGGCCGCNONE 
AY342321TCCGGCCCGTGGGCCGCNONE 
J023066K08TCCGGCCCGTGGGCCGCNONE 
J100032N19TCCGGCCCGTGGGCCGCNONE 
Os03g0219200011-045-E01GCGGCCCAATTNONE 
AK073785GCGGCCCAATTSimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19GCGGCCCAATTNONE 
J043009H23GCGGCCCAATTNONE 
Os03g0219400AK100702ACATGGGCCGCGlycoside hydrolase, family 20 protein. 
AK121985ACATGGGCCGCNONE 
J023114O06ACATGGGCCGCNONE 
J100043M20ACATGGGCCGCNONE 
Os03g0238700AK073387TCGTGGGCCGCAGGCCCGCASimilar to Acid phosphatase type 5. 
J033043K11TCGTGGGCCGCAGGCCCGCANONE 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0297100AK059192GCGGCCCAAANONE 
AK122143GCGGCCCAAANONE 
J023012D24GCGGCCCAAANONE 
J023041A08GCGGCCCAAANONE 
J033067H08GCGGCCCAAANONE 
J033131K19GCGGCCCAAANONE 
J033136J20GCGGCCCAAANONE 
J053027D07GCGGCCCAAANONE 
J065191B01GCGGCCCAAANONE 
J075112A12GCGGCCCAAANONE 
J075136D05GCGGCCCAAANONE 
J090073P06GCGGCCCAAANONE 
J100026B16GCGGCCCAAANONE 
J100068P21GCGGCCCAAANONE 
J100088C15GCGGCCCAAANONE 
Os03g0309800004-019-H07GGATGGGCCGCANONE 
AK060922GGATGGGCCGCANONE 
AK098942GGATGGGCCGCANONE 
AK106141GGATGGGCCGCANONE 
AK111530GGATGGGCCGCANONE 
AK111624GGATGGGCCGCASimilar to PPR2. 
J013024C10GGATGGGCCGCANONE 
J013043D15GGATGGGCCGCANONE 
J013108I11GGATGGGCCGCANONE 
J100058L07GGATGGGCCGCANONE 
J100071I19GGATGGGCCGCANONE 
Os03g0339100AK111641GCGGCCCACTTGSimilar to PRL1 protein. 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0398900AK107457GCGGCCCACCConserved hypothetical protein. 
Os03g0410700J065102A22GCGGCCCATGANONE 
J065102A22GCGGCCCATGGNONE 
Os03g0410900J065067F10CCATGGGCCGCNONE 
J065067F10TCATGGGCCGCNONE 
J065073D08CCATGGGCCGCNONE 
J065073D08TCATGGGCCGCNONE 
J065176C06CCATGGGCCGCNONE 
J065176C06TCATGGGCCGCNONE 
J065189O13CCATGGGCCGCNONE 
J065189O13TCATGGGCCGCNONE 
J065214E05CCATGGGCCGCNONE 
J065214E05TCATGGGCCGCNONE 
J080007H09CCATGGGCCGCNONE 
J080007H09TCATGGGCCGCNONE 
J080012B19CCATGGGCCGCNONE 
J080012B19TCATGGGCCGCNONE 
J080020J16CCATGGGCCGCNONE 
J080020J16TCATGGGCCGCNONE 
J080038J22CCATGGGCCGCNONE 
J080038J22TCATGGGCCGCNONE 
J080045I09CCATGGGCCGCNONE 
J080045I09TCATGGGCCGCNONE 
J080059M16CCATGGGCCGCNONE 
J080059M16TCATGGGCCGCNONE 
J080060C19CCATGGGCCGCNONE 
J080060C19TCATGGGCCGCNONE 
J080080P22CCATGGGCCGCNONE 
J080080P22TCATGGGCCGCNONE 
J080083C03CCATGGGCCGCNONE 
J080083C03TCATGGGCCGCNONE 
J080093M17CCATGGGCCGCNONE 
J080093M17TCATGGGCCGCNONE 
J100029F12CCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
J100029F12TCATGGGCCGCLike-Sm ribonucleoprotein, core family protein. 
Os03g0415500AK108435GCGGCCCATCCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GCGGCCCATCCANONE 
Os03g0587600Os03g0587600GCGGCCCAGAZinc finger, CCHC-type domain containing protein. 
Os03g0609500Os03g0609500GCGGCCCATGTSimilar to LOB domain protein 39. 
Os03g0646300AK069229TTTTGGGCCGCSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0670700009-028-B03GCGGCCCATAANONE 
009-028-B03GCGGCCCATGTNONE 
009-028-B03GTGGTGGGCCGCNONE 
009-036-H12GCGGCCCATAANONE 
009-036-H12GCGGCCCATGTNONE 
009-036-H12GTGGTGGGCCGCNONE 
009-053-H05GCGGCCCATAANONE 
009-053-H05GCGGCCCATGTNONE 
009-053-H05GTGGTGGGCCGCNONE 
009-126-B02GCGGCCCATAANONE 
009-126-B02GCGGCCCATGTNONE 
009-126-B02GTGGTGGGCCGCNONE 
009-135-D07GCGGCCCATAANONE 
009-135-D07GCGGCCCATGTNONE 
009-135-D07GTGGTGGGCCGCNONE 
009-148-A03GCGGCCCATAANONE 
009-148-A03GCGGCCCATGTNONE 
009-148-A03GTGGTGGGCCGCNONE 
009-148-A12GCGGCCCATAANONE 
009-148-A12GCGGCCCATGTNONE 
009-148-A12GTGGTGGGCCGCNONE 
009-152-B02GCGGCCCATAANONE 
009-152-B02GCGGCCCATGTNONE 
009-152-B02GTGGTGGGCCGCNONE 
009-153-B06GCGGCCCATAANONE 
009-153-B06GCGGCCCATGTNONE 
009-153-B06GTGGTGGGCCGCNONE 
009-166-G05GCGGCCCATAANONE 
009-166-G05GCGGCCCATGTNONE 
009-166-G05GTGGTGGGCCGCNONE 
009-181-A09GCGGCCCATAANONE 
009-181-A09GCGGCCCATGTNONE 
009-181-A09GTGGTGGGCCGCNONE 
011-061-D07GCGGCCCATAANONE 
011-061-D07GCGGCCCATGTNONE 
011-061-D07GTGGTGGGCCGCNONE 
012-043-C04GCGGCCCATAANONE 
012-043-C04GCGGCCCATGTNONE 
012-043-C04GTGGTGGGCCGCNONE 
013-001-A02GCGGCCCATAANONE 
013-001-A02GCGGCCCATGTNONE 
013-001-A02GTGGTGGGCCGCNONE 
013-004-F05GCGGCCCATAANONE 
013-004-F05GCGGCCCATGTNONE 
013-004-F05GTGGTGGGCCGCNONE 
013-008-C08GCGGCCCATAANONE 
013-008-C08GCGGCCCATGTNONE 
013-008-C08GTGGTGGGCCGCNONE 
013-015-B09GCGGCCCATAANONE 
013-015-B09GCGGCCCATGTNONE 
013-015-B09GTGGTGGGCCGCNONE 
013-016-G05GCGGCCCATAANONE 
013-016-G05GCGGCCCATGTNONE 
013-016-G05GTGGTGGGCCGCNONE 
013-023-A06GCGGCCCATAANONE 
013-023-A06GCGGCCCATGTNONE 
013-023-A06GTGGTGGGCCGCNONE 
013-023-B06GCGGCCCATAANONE 
013-023-B06GCGGCCCATGTNONE 
013-023-B06GTGGTGGGCCGCNONE 
013-032-F09GCGGCCCATAANONE 
013-032-F09GCGGCCCATGTNONE 
013-032-F09GTGGTGGGCCGCNONE 
013-059-C07GCGGCCCATAANONE 
013-059-C07GCGGCCCATGTNONE 
013-059-C07GTGGTGGGCCGCNONE 
013-071-E09GCGGCCCATAANONE 
013-071-E09GCGGCCCATGTNONE 
013-071-E09GTGGTGGGCCGCNONE 
013-073-D06GCGGCCCATAANONE 
013-073-D06GCGGCCCATGTNONE 
013-073-D06GTGGTGGGCCGCNONE 
013-077-C02GCGGCCCATAANONE 
013-077-C02GCGGCCCATGTNONE 
013-077-C02GTGGTGGGCCGCNONE 
013-078-B12GCGGCCCATAANONE 
013-078-B12GCGGCCCATGTNONE 
013-078-B12GTGGTGGGCCGCNONE 
013-093-A01GCGGCCCATAANONE 
013-093-A01GCGGCCCATGTNONE 
013-093-A01GTGGTGGGCCGCNONE 
014-002-B12GCGGCCCATAANONE 
014-002-B12GCGGCCCATGTNONE 
014-002-B12GTGGTGGGCCGCNONE 
014-003-E08GCGGCCCATAANONE 
014-003-E08GCGGCCCATGTNONE 
014-003-E08GTGGTGGGCCGCNONE 
014-004-D06GCGGCCCATAANONE 
014-004-D06GCGGCCCATGTNONE 
014-004-D06GTGGTGGGCCGCNONE 
014-007-C11GCGGCCCATAANONE 
014-007-C11GCGGCCCATGTNONE 
014-007-C11GTGGTGGGCCGCNONE 
014-007-G10GCGGCCCATAANONE 
014-007-G10GCGGCCCATGTNONE 
014-007-G10GTGGTGGGCCGCNONE 
014-019-C04GCGGCCCATAANONE 
014-019-C04GCGGCCCATGTNONE 
014-019-C04GTGGTGGGCCGCNONE 
014-021-F05GCGGCCCATAANONE 
014-021-F05GCGGCCCATGTNONE 
014-021-F05GTGGTGGGCCGCNONE 
014-024-G06GCGGCCCATAANONE 
014-024-G06GCGGCCCATGTNONE 
014-024-G06GTGGTGGGCCGCNONE 
014-027-C07GCGGCCCATAANONE 
014-027-C07GCGGCCCATGTNONE 
014-027-C07GTGGTGGGCCGCNONE 
014-027-D03GCGGCCCATAANONE 
014-027-D03GCGGCCCATGTNONE 
014-027-D03GTGGTGGGCCGCNONE 
014-029-E07GCGGCCCATAANONE 
014-029-E07GCGGCCCATGTNONE 
014-029-E07GTGGTGGGCCGCNONE 
014-031-B04GCGGCCCATAANONE 
014-031-B04GCGGCCCATGTNONE 
014-031-B04GTGGTGGGCCGCNONE 
014-033-B05GCGGCCCATAANONE 
014-033-B05GCGGCCCATGTNONE 
014-033-B05GTGGTGGGCCGCNONE 
014-033-C03GCGGCCCATAANONE 
014-033-C03GCGGCCCATGTNONE 
014-033-C03GTGGTGGGCCGCNONE 
014-033-C12GCGGCCCATAANONE 
014-033-C12GCGGCCCATGTNONE 
014-033-C12GTGGTGGGCCGCNONE 
014-036-F01GCGGCCCATAANONE 
014-036-F01GCGGCCCATGTNONE 
014-036-F01GTGGTGGGCCGCNONE 
014-037-C04GCGGCCCATAANONE 
014-037-C04GCGGCCCATGTNONE 
014-037-C04GTGGTGGGCCGCNONE 
014-040-H02GCGGCCCATAANONE 
014-040-H02GCGGCCCATGTNONE 
014-040-H02GTGGTGGGCCGCNONE 
014-045-H04GCGGCCCATAANONE 
014-045-H04GCGGCCCATGTNONE 
014-045-H04GTGGTGGGCCGCNONE 
014-045-H06GCGGCCCATAANONE 
014-045-H06GCGGCCCATGTNONE 
014-045-H06GTGGTGGGCCGCNONE 
014-052-A08GCGGCCCATAANONE 
014-052-A08GCGGCCCATGTNONE 
014-052-A08GTGGTGGGCCGCNONE 
014-076-G01GCGGCCCATAANONE 
014-076-G01GCGGCCCATGTNONE 
014-076-G01GTGGTGGGCCGCNONE 
014-083-F04GCGGCCCATAANONE 
014-083-F04GCGGCCCATGTNONE 
014-083-F04GTGGTGGGCCGCNONE 
014-086-E01GCGGCCCATAANONE 
014-086-E01GCGGCCCATGTNONE 
014-086-E01GTGGTGGGCCGCNONE 
014-091-D02GCGGCCCATAANONE 
014-091-D02GCGGCCCATGTNONE 
014-091-D02GTGGTGGGCCGCNONE 
014-091-F05GCGGCCCATAANONE 
014-091-F05GCGGCCCATGTNONE 
014-091-F05GTGGTGGGCCGCNONE 
014-093-E10GCGGCCCATAANONE 
014-093-E10GCGGCCCATGTNONE 
014-093-E10GTGGTGGGCCGCNONE 
014-100-C10GCGGCCCATAANONE 
014-100-C10GCGGCCCATGTNONE 
014-100-C10GTGGTGGGCCGCNONE 
015-011-H02GCGGCCCATAANONE 
015-011-H02GCGGCCCATGTNONE 
015-011-H02GTGGTGGGCCGCNONE 
015-073-B03GCGGCCCATAANONE 
015-073-B03GCGGCCCATGTNONE 
015-073-B03GTGGTGGGCCGCNONE 
AF010579GCGGCCCATAANONE 
AF010579GCGGCCCATGTNONE 
AF010579GTGGTGGGCCGCNONE 
AK059164GCGGCCCATAASimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK059164GCGGCCCATGTSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK059164GTGGTGGGCCGCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCGGCCCATAANONE 
AK070016GCGGCCCATGTNONE 
AK070016GTGGTGGGCCGCNONE 
AK119238GCGGCCCATAANONE 
AK119238GCGGCCCATGTNONE 
AK119238GTGGTGGGCCGCNONE 
AK119242GCGGCCCATAANONE 
AK119242GCGGCCCATGTNONE 
AK119242GTGGTGGGCCGCNONE 
J023037K17GCGGCCCATAANONE 
J023037K17GCGGCCCATGTNONE 
J023037K17GTGGTGGGCCGCNONE 
J033136F11GCGGCCCATAANONE 
J033136F11GCGGCCCATGTNONE 
J033136F11GTGGTGGGCCGCNONE 
J065008C13GCGGCCCATAANONE 
J065008C13GCGGCCCATGTNONE 
J065008C13GTGGTGGGCCGCNONE 
J065032K18GCGGCCCATAANONE 
J065032K18GCGGCCCATGTNONE 
J065032K18GTGGTGGGCCGCNONE 
J065043N10GCGGCCCATAANONE 
J065043N10GCGGCCCATGTNONE 
J065043N10GTGGTGGGCCGCNONE 
J065045E06GCGGCCCATAANONE 
J065045E06GCGGCCCATGTNONE 
J065045E06GTGGTGGGCCGCNONE 
J065046P21GCGGCCCATAANONE 
J065046P21GCGGCCCATGTNONE 
J065046P21GTGGTGGGCCGCNONE 
J065048J17GCGGCCCATAANONE 
J065048J17GCGGCCCATGTNONE 
J065048J17GTGGTGGGCCGCNONE 
J065053I23GCGGCCCATAANONE 
J065053I23GCGGCCCATGTNONE 
J065053I23GTGGTGGGCCGCNONE 
J065053P03GCGGCCCATAANONE 
J065053P03GCGGCCCATGTNONE 
J065053P03GTGGTGGGCCGCNONE 
J065054C13GCGGCCCATAANONE 
J065054C13GCGGCCCATGTNONE 
J065054C13GTGGTGGGCCGCNONE 
J065058I17GCGGCCCATAANONE 
J065058I17GCGGCCCATGTNONE 
J065058I17GTGGTGGGCCGCNONE 
J065061I12GCGGCCCATAANONE 
J065061I12GCGGCCCATGTNONE 
J065061I12GTGGTGGGCCGCNONE 
J065062E09GCGGCCCATAANONE 
J065062E09GCGGCCCATGTNONE 
J065062E09GTGGTGGGCCGCNONE 
J065063P04GCGGCCCATAANONE 
J065063P04GCGGCCCATGTNONE 
J065063P04GTGGTGGGCCGCNONE 
J065068J07GCGGCCCATAANONE 
J065068J07GCGGCCCATGTNONE 
J065068J07GTGGTGGGCCGCNONE 
J065076D02GCGGCCCATAANONE 
J065076D02GCGGCCCATGTNONE 
J065076D02GTGGTGGGCCGCNONE 
J065083O07GCGGCCCATAANONE 
J065083O07GCGGCCCATGTNONE 
J065083O07GTGGTGGGCCGCNONE 
J065090J02GCGGCCCATAANONE 
J065090J02GCGGCCCATGTNONE 
J065090J02GTGGTGGGCCGCNONE 
J065093N08GCGGCCCATAANONE 
J065093N08GCGGCCCATGTNONE 
J065093N08GTGGTGGGCCGCNONE 
J065097F02GCGGCCCATAANONE 
J065097F02GCGGCCCATGTNONE 
J065097F02GTGGTGGGCCGCNONE 
J065112H17GCGGCCCATAANONE 
J065112H17GCGGCCCATGTNONE 
J065112H17GTGGTGGGCCGCNONE 
J065121B01GCGGCCCATAANONE 
J065121B01GCGGCCCATGTNONE 
J065121B01GTGGTGGGCCGCNONE 
J065124F12GCGGCCCATAANONE 
J065124F12GCGGCCCATGTNONE 
J065124F12GTGGTGGGCCGCNONE 
J065130L03GCGGCCCATAANONE 
J065130L03GCGGCCCATGTNONE 
J065130L03GTGGTGGGCCGCNONE 
J065131K05GCGGCCCATAANONE 
J065131K05GCGGCCCATGTNONE 
J065131K05GTGGTGGGCCGCNONE 
J065132C06GCGGCCCATAANONE 
J065132C06GCGGCCCATGTNONE 
J065132C06GTGGTGGGCCGCNONE 
J065135J18GCGGCCCATAANONE 
J065135J18GCGGCCCATGTNONE 
J065135J18GTGGTGGGCCGCNONE 
J065138J22GCGGCCCATAANONE 
J065138J22GCGGCCCATGTNONE 
J065138J22GTGGTGGGCCGCNONE 
J065140G21GCGGCCCATAANONE 
J065140G21GCGGCCCATGTNONE 
J065140G21GTGGTGGGCCGCNONE 
J065161B19GCGGCCCATAANONE 
J065161B19GCGGCCCATGTNONE 
J065161B19GTGGTGGGCCGCNONE 
J065162F22GCGGCCCATAANONE 
J065162F22GCGGCCCATGTNONE 
J065162F22GTGGTGGGCCGCNONE 
J065162M09GCGGCCCATAANONE 
J065162M09GCGGCCCATGTNONE 
J065162M09GTGGTGGGCCGCNONE 
J065163D03GCGGCCCATAANONE 
J065163D03GCGGCCCATGTNONE 
J065163D03GTGGTGGGCCGCNONE 
J065163O21GCGGCCCATAANONE 
J065163O21GCGGCCCATGTNONE 
J065163O21GTGGTGGGCCGCNONE 
J065165H11GCGGCCCATAANONE 
J065165H11GCGGCCCATGTNONE 
J065165H11GTGGTGGGCCGCNONE 
J065165O16GCGGCCCATAANONE 
J065165O16GCGGCCCATGTNONE 
J065165O16GTGGTGGGCCGCNONE 
J065167N06GCGGCCCATAANONE 
J065167N06GCGGCCCATGTNONE 
J065167N06GTGGTGGGCCGCNONE 
J065168I08GCGGCCCATAANONE 
J065168I08GCGGCCCATGTNONE 
J065168I08GTGGTGGGCCGCNONE 
J065170A14GCGGCCCATAANONE 
J065170A14GCGGCCCATGTNONE 
J065170A14GTGGTGGGCCGCNONE 
J065170L03GCGGCCCATAANONE 
J065170L03GCGGCCCATGTNONE 
J065170L03GTGGTGGGCCGCNONE 
J065171C08GCGGCCCATAANONE 
J065171C08GCGGCCCATGTNONE 
J065171C08GTGGTGGGCCGCNONE 
J065173G11GCGGCCCATAANONE 
J065173G11GCGGCCCATGTNONE 
J065173G11GTGGTGGGCCGCNONE 
J065173M09GCGGCCCATAANONE 
J065173M09GCGGCCCATGTNONE 
J065173M09GTGGTGGGCCGCNONE 
J065176P07GCGGCCCATAANONE 
J065176P07GCGGCCCATGTNONE 
J065176P07GTGGTGGGCCGCNONE 
J065178K24GCGGCCCATAANONE 
J065178K24GCGGCCCATGTNONE 
J065178K24GTGGTGGGCCGCNONE 
J065185O12GCGGCCCATAANONE 
J065185O12GCGGCCCATGTNONE 
J065185O12GTGGTGGGCCGCNONE 
J065191E02GCGGCCCATAANONE 
J065191E02GCGGCCCATGTNONE 
J065191E02GTGGTGGGCCGCNONE 
J065204H10GCGGCCCATAANONE 
J065204H10GCGGCCCATGTNONE 
J065204H10GTGGTGGGCCGCNONE 
J075033C23GCGGCCCATAANONE 
J075033C23GCGGCCCATGTNONE 
J075033C23GTGGTGGGCCGCNONE 
J075041M21GCGGCCCATAANONE 
J075041M21GCGGCCCATGTNONE 
J075041M21GTGGTGGGCCGCNONE 
J075043F13GCGGCCCATAANONE 
J075043F13GCGGCCCATGTNONE 
J075043F13GTGGTGGGCCGCNONE 
J075044D02GCGGCCCATAANONE 
J075044D02GCGGCCCATGTNONE 
J075044D02GTGGTGGGCCGCNONE 
J075044J15GCGGCCCATAANONE 
J075044J15GCGGCCCATGTNONE 
J075044J15GTGGTGGGCCGCNONE 
J075048L07GCGGCCCATAANONE 
J075048L07GCGGCCCATGTNONE 
J075048L07GTGGTGGGCCGCNONE 
J075054G12GCGGCCCATAANONE 
J075054G12GCGGCCCATGTNONE 
J075054G12GTGGTGGGCCGCNONE 
J075055J10GCGGCCCATAANONE 
J075055J10GCGGCCCATGTNONE 
J075055J10GTGGTGGGCCGCNONE 
J075059F09GCGGCCCATAANONE 
J075059F09GCGGCCCATGTNONE 
J075059F09GTGGTGGGCCGCNONE 
J075066M23GCGGCCCATAANONE 
J075066M23GCGGCCCATGTNONE 
J075066M23GTGGTGGGCCGCNONE 
J075071O09GCGGCCCATAANONE 
J075071O09GCGGCCCATGTNONE 
J075071O09GTGGTGGGCCGCNONE 
J075085G23GCGGCCCATAANONE 
J075085G23GCGGCCCATGTNONE 
J075085G23GTGGTGGGCCGCNONE 
J075086B21GCGGCCCATAANONE 
J075086B21GCGGCCCATGTNONE 
J075086B21GTGGTGGGCCGCNONE 
J075087L18GCGGCCCATAANONE 
J075087L18GCGGCCCATGTNONE 
J075087L18GTGGTGGGCCGCNONE 
J075087L21GCGGCCCATAANONE 
J075087L21GCGGCCCATGTNONE 
J075087L21GTGGTGGGCCGCNONE 
J075087N14GCGGCCCATAANONE 
J075087N14GCGGCCCATGTNONE 
J075087N14GTGGTGGGCCGCNONE 
J075088O13GCGGCCCATAANONE 
J075088O13GCGGCCCATGTNONE 
J075088O13GTGGTGGGCCGCNONE 
J075089B06GCGGCCCATAANONE 
J075089B06GCGGCCCATGTNONE 
J075089B06GTGGTGGGCCGCNONE 
J075089E20GCGGCCCATAANONE 
J075089E20GCGGCCCATGTNONE 
J075089E20GTGGTGGGCCGCNONE 
J075090J01GCGGCCCATAANONE 
J075090J01GCGGCCCATGTNONE 
J075090J01GTGGTGGGCCGCNONE 
J075090L05GCGGCCCATAANONE 
J075090L05GCGGCCCATGTNONE 
J075090L05GTGGTGGGCCGCNONE 
J075091G05GCGGCCCATAANONE 
J075091G05GCGGCCCATGTNONE 
J075091G05GTGGTGGGCCGCNONE 
J075091N06GCGGCCCATAANONE 
J075091N06GCGGCCCATGTNONE 
J075091N06GTGGTGGGCCGCNONE 
J075093G08GCGGCCCATAANONE 
J075093G08GCGGCCCATGTNONE 
J075093G08GTGGTGGGCCGCNONE 
J075094C13GCGGCCCATAANONE 
J075094C13GCGGCCCATGTNONE 
J075094C13GTGGTGGGCCGCNONE 
J075095K01GCGGCCCATAANONE 
J075095K01GCGGCCCATGTNONE 
J075095K01GTGGTGGGCCGCNONE 
J075096C02GCGGCCCATAANONE 
J075096C02GCGGCCCATGTNONE 
J075096C02GTGGTGGGCCGCNONE 
J075097L16GCGGCCCATAANONE 
J075097L16GCGGCCCATGTNONE 
J075097L16GTGGTGGGCCGCNONE 
J075097O10GCGGCCCATAANONE 
J075097O10GCGGCCCATGTNONE 
J075097O10GTGGTGGGCCGCNONE 
J075098H24GCGGCCCATAANONE 
J075098H24GCGGCCCATGTNONE 
J075098H24GTGGTGGGCCGCNONE 
J075099H02GCGGCCCATAANONE 
J075099H02GCGGCCCATGTNONE 
J075099H02GTGGTGGGCCGCNONE 
J075099J11GCGGCCCATAANONE 
J075099J11GCGGCCCATGTNONE 
J075099J11GTGGTGGGCCGCNONE 
J075099L08GCGGCCCATAANONE 
J075099L08GCGGCCCATGTNONE 
J075099L08GTGGTGGGCCGCNONE 
J075109I11GCGGCCCATAANONE 
J075109I11GCGGCCCATGTNONE 
J075109I11GTGGTGGGCCGCNONE 
J075114F03GCGGCCCATAANONE 
J075114F03GCGGCCCATGTNONE 
J075114F03GTGGTGGGCCGCNONE 
J075121G07GCGGCCCATAANONE 
J075121G07GCGGCCCATGTNONE 
J075121G07GTGGTGGGCCGCNONE 
J075122D23GCGGCCCATAANONE 
J075122D23GCGGCCCATGTNONE 
J075122D23GTGGTGGGCCGCNONE 
J075132O07GCGGCCCATAANONE 
J075132O07GCGGCCCATGTNONE 
J075132O07GTGGTGGGCCGCNONE 
J075141L21GCGGCCCATAANONE 
J075141L21GCGGCCCATGTNONE 
J075141L21GTGGTGGGCCGCNONE 
J075142I08GCGGCCCATAANONE 
J075142I08GCGGCCCATGTNONE 
J075142I08GTGGTGGGCCGCNONE 
J075145A06GCGGCCCATAANONE 
J075145A06GCGGCCCATGTNONE 
J075145A06GTGGTGGGCCGCNONE 
J075147J15GCGGCCCATAANONE 
J075147J15GCGGCCCATGTNONE 
J075147J15GTGGTGGGCCGCNONE 
J075150B09GCGGCCCATAANONE 
J075150B09GCGGCCCATGTNONE 
J075150B09GTGGTGGGCCGCNONE 
J075151E07GCGGCCCATAANONE 
J075151E07GCGGCCCATGTNONE 
J075151E07GTGGTGGGCCGCNONE 
J075161M16GCGGCCCATAANONE 
J075161M16GCGGCCCATGTNONE 
J075161M16GTGGTGGGCCGCNONE 
J075190I16GCGGCCCATAANONE 
J075190I16GCGGCCCATGTNONE 
J075190I16GTGGTGGGCCGCNONE 
J075192L05GCGGCCCATAANONE 
J075192L05GCGGCCCATGTNONE 
J075192L05GTGGTGGGCCGCNONE 
J075192O03GCGGCCCATAANONE 
J075192O03GCGGCCCATGTNONE 
J075192O03GTGGTGGGCCGCNONE 
J075192O08GCGGCCCATAANONE 
J075192O08GCGGCCCATGTNONE 
J075192O08GTGGTGGGCCGCNONE 
J075193L12GCGGCCCATAANONE 
J075193L12GCGGCCCATGTNONE 
J075193L12GTGGTGGGCCGCNONE 
J080001M24GCGGCCCATAANONE 
J080001M24GCGGCCCATGTNONE 
J080001M24GTGGTGGGCCGCNONE 
J080004E20GCGGCCCATAANONE 
J080004E20GCGGCCCATGTNONE 
J080004E20GTGGTGGGCCGCNONE 
J080005K15GCGGCCCATAANONE 
J080005K15GCGGCCCATGTNONE 
J080005K15GTGGTGGGCCGCNONE 
J080005L05GCGGCCCATAANONE 
J080005L05GCGGCCCATGTNONE 
J080005L05GTGGTGGGCCGCNONE 
J080014P20GCGGCCCATAANONE 
J080014P20GCGGCCCATGTNONE 
J080014P20GTGGTGGGCCGCNONE 
J080029D12GCGGCCCATAANONE 
J080029D12GCGGCCCATGTNONE 
J080029D12GTGGTGGGCCGCNONE 
J080030H09GCGGCCCATAANONE 
J080030H09GCGGCCCATGTNONE 
J080030H09GTGGTGGGCCGCNONE 
J080039G05GCGGCCCATAANONE 
J080039G05GCGGCCCATGTNONE 
J080039G05GTGGTGGGCCGCNONE 
J080040E18GCGGCCCATAANONE 
J080040E18GCGGCCCATGTNONE 
J080040E18GTGGTGGGCCGCNONE 
J080041B02GCGGCCCATAANONE 
J080041B02GCGGCCCATGTNONE 
J080041B02GTGGTGGGCCGCNONE 
J080041E06GCGGCCCATAANONE 
J080041E06GCGGCCCATGTNONE 
J080041E06GTGGTGGGCCGCNONE 
J080041G05GCGGCCCATAANONE 
J080041G05GCGGCCCATGTNONE 
J080041G05GTGGTGGGCCGCNONE 
J080041G24GCGGCCCATAANONE 
J080041G24GCGGCCCATGTNONE 
J080041G24GTGGTGGGCCGCNONE 
J080041H07GCGGCCCATAANONE 
J080041H07GCGGCCCATGTNONE 
J080041H07GTGGTGGGCCGCNONE 
J080041K03GCGGCCCATAANONE 
J080041K03GCGGCCCATGTNONE 
J080041K03GTGGTGGGCCGCNONE 
J080047G01GCGGCCCATAANONE 
J080047G01GCGGCCCATGTNONE 
J080047G01GTGGTGGGCCGCNONE 
J080052E07GCGGCCCATAANONE 
J080052E07GCGGCCCATGTNONE 
J080052E07GTGGTGGGCCGCNONE 
J080053B15GCGGCCCATAANONE 
J080053B15GCGGCCCATGTNONE 
J080053B15GTGGTGGGCCGCNONE 
J080053N01GCGGCCCATAANONE 
J080053N01GCGGCCCATGTNONE 
J080053N01GTGGTGGGCCGCNONE 
J080054I01GCGGCCCATAANONE 
J080054I01GCGGCCCATGTNONE 
J080054I01GTGGTGGGCCGCNONE 
J080054N02GCGGCCCATAANONE 
J080054N02GCGGCCCATGTNONE 
J080054N02GTGGTGGGCCGCNONE 
J080063P03GCGGCCCATAANONE 
J080063P03GCGGCCCATGTNONE 
J080063P03GTGGTGGGCCGCNONE 
J080064E13GCGGCCCATAANONE 
J080064E13GCGGCCCATGTNONE 
J080064E13GTGGTGGGCCGCNONE 
J080064G13GCGGCCCATAANONE 
J080064G13GCGGCCCATGTNONE 
J080064G13GTGGTGGGCCGCNONE 
J080065F02GCGGCCCATAANONE 
J080065F02GCGGCCCATGTNONE 
J080065F02GTGGTGGGCCGCNONE 
J080065G03GCGGCCCATAANONE 
J080065G03GCGGCCCATGTNONE 
J080065G03GTGGTGGGCCGCNONE 
J080065K17GCGGCCCATAANONE 
J080065K17GCGGCCCATGTNONE 
J080065K17GTGGTGGGCCGCNONE 
J080067D06GCGGCCCATAANONE 
J080067D06GCGGCCCATGTNONE 
J080067D06GTGGTGGGCCGCNONE 
J080067H23GCGGCCCATAANONE 
J080067H23GCGGCCCATGTNONE 
J080067H23GTGGTGGGCCGCNONE 
J080067M15GCGGCCCATAANONE 
J080067M15GCGGCCCATGTNONE 
J080067M15GTGGTGGGCCGCNONE 
J080068B20GCGGCCCATAANONE 
J080068B20GCGGCCCATGTNONE 
J080068B20GTGGTGGGCCGCNONE 
J080068G24GCGGCCCATAANONE 
J080068G24GCGGCCCATGTNONE 
J080068G24GTGGTGGGCCGCNONE 
J080072K19GCGGCCCATAANONE 
J080072K19GCGGCCCATGTNONE 
J080072K19GTGGTGGGCCGCNONE 
J080076I24GCGGCCCATAANONE 
J080076I24GCGGCCCATGTNONE 
J080076I24GTGGTGGGCCGCNONE 
J080092F05GCGGCCCATAANONE 
J080092F05GCGGCCCATGTNONE 
J080092F05GTGGTGGGCCGCNONE 
J080092K14GCGGCCCATAANONE 
J080092K14GCGGCCCATGTNONE 
J080092K14GTGGTGGGCCGCNONE 
J080092N22GCGGCCCATAANONE 
J080092N22GCGGCCCATGTNONE 
J080092N22GTGGTGGGCCGCNONE 
J080093K02GCGGCCCATAANONE 
J080093K02GCGGCCCATGTNONE 
J080093K02GTGGTGGGCCGCNONE 
J080094C08GCGGCCCATAANONE 
J080094C08GCGGCCCATGTNONE 
J080094C08GTGGTGGGCCGCNONE 
J080094E09GCGGCCCATAANONE 
J080094E09GCGGCCCATGTNONE 
J080094E09GTGGTGGGCCGCNONE 
J080094E20GCGGCCCATAANONE 
J080094E20GCGGCCCATGTNONE 
J080094E20GTGGTGGGCCGCNONE 
J080094G08GCGGCCCATAANONE 
J080094G08GCGGCCCATGTNONE 
J080094G08GTGGTGGGCCGCNONE 
J080094H18GCGGCCCATAANONE 
J080094H18GCGGCCCATGTNONE 
J080094H18GTGGTGGGCCGCNONE 
J080094P22GCGGCCCATAANONE 
J080094P22GCGGCCCATGTNONE 
J080094P22GTGGTGGGCCGCNONE 
J080095J23GCGGCCCATAANONE 
J080095J23GCGGCCCATGTNONE 
J080095J23GTGGTGGGCCGCNONE 
J080096F14GCGGCCCATAANONE 
J080096F14GCGGCCCATGTNONE 
J080096F14GTGGTGGGCCGCNONE 
J080097A21GCGGCCCATAANONE 
J080097A21GCGGCCCATGTNONE 
J080097A21GTGGTGGGCCGCNONE 
J080097I07GCGGCCCATAANONE 
J080097I07GCGGCCCATGTNONE 
J080097I07GTGGTGGGCCGCNONE 
J080097J02GCGGCCCATAANONE 
J080097J02GCGGCCCATGTNONE 
J080097J02GTGGTGGGCCGCNONE 
J080097K01GCGGCCCATAANONE 
J080097K01GCGGCCCATGTNONE 
J080097K01GTGGTGGGCCGCNONE 
J080097K03GCGGCCCATAANONE 
J080097K03GCGGCCCATGTNONE 
J080097K03GTGGTGGGCCGCNONE 
J080305H18GCGGCCCATAANONE 
J080305H18GCGGCCCATGTNONE 
J080305H18GTGGTGGGCCGCNONE 
J080306G01GCGGCCCATAANONE 
J080306G01GCGGCCCATGTNONE 
J080306G01GTGGTGGGCCGCNONE 
J080306O08GCGGCCCATAANONE 
J080306O08GCGGCCCATGTNONE 
J080306O08GTGGTGGGCCGCNONE 
J080311I01GCGGCCCATAANONE 
J080311I01GCGGCCCATGTNONE 
J080311I01GTGGTGGGCCGCNONE 
J080315N24GCGGCCCATAANONE 
J080315N24GCGGCCCATGTNONE 
J080315N24GTGGTGGGCCGCNONE 
J090003K21GCGGCCCATAANONE 
J090003K21GCGGCCCATGTNONE 
J090003K21GTGGTGGGCCGCNONE 
J090008C20GCGGCCCATAANONE 
J090008C20GCGGCCCATGTNONE 
J090008C20GTGGTGGGCCGCNONE 
J090008K19GCGGCCCATAANONE 
J090008K19GCGGCCCATGTNONE 
J090008K19GTGGTGGGCCGCNONE 
J090008P13GCGGCCCATAANONE 
J090008P13GCGGCCCATGTNONE 
J090008P13GTGGTGGGCCGCNONE 
J090015H22GCGGCCCATAANONE 
J090015H22GCGGCCCATGTNONE 
J090015H22GTGGTGGGCCGCNONE 
J090016M01GCGGCCCATAANONE 
J090016M01GCGGCCCATGTNONE 
J090016M01GTGGTGGGCCGCNONE 
J090018E13GCGGCCCATAANONE 
J090018E13GCGGCCCATGTNONE 
J090018E13GTGGTGGGCCGCNONE 
J090018G03GCGGCCCATAANONE 
J090018G03GCGGCCCATGTNONE 
J090018G03GTGGTGGGCCGCNONE 
J090018L17GCGGCCCATAANONE 
J090018L17GCGGCCCATGTNONE 
J090018L17GTGGTGGGCCGCNONE 
J090019H11GCGGCCCATAANONE 
J090019H11GCGGCCCATGTNONE 
J090019H11GTGGTGGGCCGCNONE 
J090021B19GCGGCCCATAANONE 
J090021B19GCGGCCCATGTNONE 
J090021B19GTGGTGGGCCGCNONE 
J090021K02GCGGCCCATAANONE 
J090021K02GCGGCCCATGTNONE 
J090021K02GTGGTGGGCCGCNONE 
J090023H15GCGGCCCATAANONE 
J090023H15GCGGCCCATGTNONE 
J090023H15GTGGTGGGCCGCNONE 
J090034E03GCGGCCCATAANONE 
J090034E03GCGGCCCATGTNONE 
J090034E03GTGGTGGGCCGCNONE 
J090045D16GCGGCCCATAANONE 
J090045D16GCGGCCCATGTNONE 
J090045D16GTGGTGGGCCGCNONE 
J090045I06GCGGCCCATAANONE 
J090045I06GCGGCCCATGTNONE 
J090045I06GTGGTGGGCCGCNONE 
J090047L09GCGGCCCATAANONE 
J090047L09GCGGCCCATGTNONE 
J090047L09GTGGTGGGCCGCNONE 
J090048B05GCGGCCCATAANONE 
J090048B05GCGGCCCATGTNONE 
J090048B05GTGGTGGGCCGCNONE 
J090048D11GCGGCCCATAANONE 
J090048D11GCGGCCCATGTNONE 
J090048D11GTGGTGGGCCGCNONE 
J090048N11GCGGCCCATAANONE 
J090048N11GCGGCCCATGTNONE 
J090048N11GTGGTGGGCCGCNONE 
J090050F20GCGGCCCATAANONE 
J090050F20GCGGCCCATGTNONE 
J090050F20GTGGTGGGCCGCNONE 
J090052M20GCGGCCCATAANONE 
J090052M20GCGGCCCATGTNONE 
J090052M20GTGGTGGGCCGCNONE 
J090083H03GCGGCCCATAANONE 
J090083H03GCGGCCCATGTNONE 
J090083H03GTGGTGGGCCGCNONE 
J090084C12GCGGCCCATAANONE 
J090084C12GCGGCCCATGTNONE 
J090084C12GTGGTGGGCCGCNONE 
J090095B05GCGGCCCATAANONE 
J090095B05GCGGCCCATGTNONE 
J090095B05GTGGTGGGCCGCNONE 
J090095M18GCGGCCCATAANONE 
J090095M18GCGGCCCATGTNONE 
J090095M18GTGGTGGGCCGCNONE 
J100024I22GCGGCCCATAANONE 
J100024I22GCGGCCCATGTNONE 
J100024I22GTGGTGGGCCGCNONE 
J100024J12GCGGCCCATAANONE 
J100024J12GCGGCCCATGTNONE 
J100024J12GTGGTGGGCCGCNONE 
J100024J22GCGGCCCATAANONE 
J100024J22GCGGCCCATGTNONE 
J100024J22GTGGTGGGCCGCNONE 
J100025F07GCGGCCCATAANONE 
J100025F07GCGGCCCATGTNONE 
J100025F07GTGGTGGGCCGCNONE 
J100026B13GCGGCCCATAANONE 
J100026B13GCGGCCCATGTNONE 
J100026B13GTGGTGGGCCGCNONE 
J100027N03GCGGCCCATAANONE 
J100027N03GCGGCCCATGTNONE 
J100027N03GTGGTGGGCCGCNONE 
J100029F14GCGGCCCATAANONE 
J100029F14GCGGCCCATGTNONE 
J100029F14GTGGTGGGCCGCNONE 
J100029L20GCGGCCCATAANONE 
J100029L20GCGGCCCATGTNONE 
J100029L20GTGGTGGGCCGCNONE 
J100032C22GCGGCCCATAANONE 
J100032C22GCGGCCCATGTNONE 
J100032C22GTGGTGGGCCGCNONE 
J100032I08GCGGCCCATAANONE 
J100032I08GCGGCCCATGTNONE 
J100032I08GTGGTGGGCCGCNONE 
J100032O05GCGGCCCATAANONE 
J100032O05GCGGCCCATGTNONE 
J100032O05GTGGTGGGCCGCNONE 
J100033J24GCGGCCCATAANONE 
J100033J24GCGGCCCATGTNONE 
J100033J24GTGGTGGGCCGCNONE 
J100033L12GCGGCCCATAANONE 
J100033L12GCGGCCCATGTNONE 
J100033L12GTGGTGGGCCGCNONE 
J100034K06GCGGCCCATAANONE 
J100034K06GCGGCCCATGTNONE 
J100034K06GTGGTGGGCCGCNONE 
J100037D09GCGGCCCATAANONE 
J100037D09GCGGCCCATGTNONE 
J100037D09GTGGTGGGCCGCNONE 
J100038H02GCGGCCCATAANONE 
J100038H02GCGGCCCATGTNONE 
J100038H02GTGGTGGGCCGCNONE 
J100039A12GCGGCCCATAANONE 
J100039A12GCGGCCCATGTNONE 
J100039A12GTGGTGGGCCGCNONE 
J100039N12GCGGCCCATAANONE 
J100039N12GCGGCCCATGTNONE 
J100039N12GTGGTGGGCCGCNONE 
J100039O21GCGGCCCATAANONE 
J100039O21GCGGCCCATGTNONE 
J100039O21GTGGTGGGCCGCNONE 
J100040K05GCGGCCCATAANONE 
J100040K05GCGGCCCATGTNONE 
J100040K05GTGGTGGGCCGCNONE 
J100042A02GCGGCCCATAANONE 
J100042A02GCGGCCCATGTNONE 
J100042A02GTGGTGGGCCGCNONE 
J100042A17GCGGCCCATAANONE 
J100042A17GCGGCCCATGTNONE 
J100042A17GTGGTGGGCCGCNONE 
J100043C15GCGGCCCATAANONE 
J100043C15GCGGCCCATGTNONE 
J100043C15GTGGTGGGCCGCNONE 
J100044A17GCGGCCCATAANONE 
J100044A17GCGGCCCATGTNONE 
J100044A17GTGGTGGGCCGCNONE 
J100044E18GCGGCCCATAANONE 
J100044E18GCGGCCCATGTNONE 
J100044E18GTGGTGGGCCGCNONE 
J100044I11GCGGCCCATAANONE 
J100044I11GCGGCCCATGTNONE 
J100044I11GTGGTGGGCCGCNONE 
J100044J15GCGGCCCATAANONE 
J100044J15GCGGCCCATGTNONE 
J100044J15GTGGTGGGCCGCNONE 
J100045E23GCGGCCCATAANONE 
J100045E23GCGGCCCATGTNONE 
J100045E23GTGGTGGGCCGCNONE 
J100049B18GCGGCCCATAANONE 
J100049B18GCGGCCCATGTNONE 
J100049B18GTGGTGGGCCGCNONE 
J100050G04GCGGCCCATAANONE 
J100050G04GCGGCCCATGTNONE 
J100050G04GTGGTGGGCCGCNONE 
J100051D06GCGGCCCATAANONE 
J100051D06GCGGCCCATGTNONE 
J100051D06GTGGTGGGCCGCNONE 
J100051H20GCGGCCCATAANONE 
J100051H20GCGGCCCATGTNONE 
J100051H20GTGGTGGGCCGCNONE 
J100052J01GCGGCCCATAANONE 
J100052J01GCGGCCCATGTNONE 
J100052J01GTGGTGGGCCGCNONE 
J100052K07GCGGCCCATAANONE 
J100052K07GCGGCCCATGTNONE 
J100052K07GTGGTGGGCCGCNONE 
J100055I01GCGGCCCATAANONE 
J100055I01GCGGCCCATGTNONE 
J100055I01GTGGTGGGCCGCNONE 
J100057D02GCGGCCCATAANONE 
J100057D02GCGGCCCATGTNONE 
J100057D02GTGGTGGGCCGCNONE 
J100059G14GCGGCCCATAANONE 
J100059G14GCGGCCCATGTNONE 
J100059G14GTGGTGGGCCGCNONE 
J100059G21GCGGCCCATAANONE 
J100059G21GCGGCCCATGTNONE 
J100059G21GTGGTGGGCCGCNONE 
J100059H03GCGGCCCATAANONE 
J100059H03GCGGCCCATGTNONE 
J100059H03GTGGTGGGCCGCNONE 
J100059H15GCGGCCCATAANONE 
J100059H15GCGGCCCATGTNONE 
J100059H15GTGGTGGGCCGCNONE 
J100063E13GCGGCCCATAANONE 
J100063E13GCGGCCCATGTNONE 
J100063E13GTGGTGGGCCGCNONE 
J100063M02GCGGCCCATAANONE 
J100063M02GCGGCCCATGTNONE 
J100063M02GTGGTGGGCCGCNONE 
J100064B17GCGGCCCATAANONE 
J100064B17GCGGCCCATGTNONE 
J100064B17GTGGTGGGCCGCNONE 
J100064F11GCGGCCCATAANONE 
J100064F11GCGGCCCATGTNONE 
J100064F11GTGGTGGGCCGCNONE 
J100066G12GCGGCCCATAANONE 
J100066G12GCGGCCCATGTNONE 
J100066G12GTGGTGGGCCGCNONE 
J100066H09GCGGCCCATAANONE 
J100066H09GCGGCCCATGTNONE 
J100066H09GTGGTGGGCCGCNONE 
J100068B12GCGGCCCATAANONE 
J100068B12GCGGCCCATGTNONE 
J100068B12GTGGTGGGCCGCNONE 
J100068L16GCGGCCCATAANONE 
J100068L16GCGGCCCATGTNONE 
J100068L16GTGGTGGGCCGCNONE 
J100068M23GCGGCCCATAANONE 
J100068M23GCGGCCCATGTNONE 
J100068M23GTGGTGGGCCGCNONE 
J100069A02GCGGCCCATAANONE 
J100069A02GCGGCCCATGTNONE 
J100069A02GTGGTGGGCCGCNONE 
J100069D07GCGGCCCATAANONE 
J100069D07GCGGCCCATGTNONE 
J100069D07GTGGTGGGCCGCNONE 
J100069M13GCGGCCCATAANONE 
J100069M13GCGGCCCATGTNONE 
J100069M13GTGGTGGGCCGCNONE 
J100070C07GCGGCCCATAANONE 
J100070C07GCGGCCCATGTNONE 
J100070C07GTGGTGGGCCGCNONE 
J100070J11GCGGCCCATAANONE 
J100070J11GCGGCCCATGTNONE 
J100070J11GTGGTGGGCCGCNONE 
J100070L20GCGGCCCATAANONE 
J100070L20GCGGCCCATGTNONE 
J100070L20GTGGTGGGCCGCNONE 
J100071H10GCGGCCCATAANONE 
J100071H10GCGGCCCATGTNONE 
J100071H10GTGGTGGGCCGCNONE 
J100072L14GCGGCCCATAANONE 
J100072L14GCGGCCCATGTNONE 
J100072L14GTGGTGGGCCGCNONE 
J100072N12GCGGCCCATAANONE 
J100072N12GCGGCCCATGTNONE 
J100072N12GTGGTGGGCCGCNONE 
J100073A21GCGGCCCATAANONE 
J100073A21GCGGCCCATGTNONE 
J100073A21GTGGTGGGCCGCNONE 
J100074K17GCGGCCCATAANONE 
J100074K17GCGGCCCATGTNONE 
J100074K17GTGGTGGGCCGCNONE 
J100074M04GCGGCCCATAANONE 
J100074M04GCGGCCCATGTNONE 
J100074M04GTGGTGGGCCGCNONE 
J100075F11GCGGCCCATAANONE 
J100075F11GCGGCCCATGTNONE 
J100075F11GTGGTGGGCCGCNONE 
J100076E23GCGGCCCATAANONE 
J100076E23GCGGCCCATGTNONE 
J100076E23GTGGTGGGCCGCNONE 
J100076G03GCGGCCCATAANONE 
J100076G03GCGGCCCATGTNONE 
J100076G03GTGGTGGGCCGCNONE 
J100077K01GCGGCCCATAANONE 
J100077K01GCGGCCCATGTNONE 
J100077K01GTGGTGGGCCGCNONE 
J100077N23GCGGCCCATAANONE 
J100077N23GCGGCCCATGTNONE 
J100077N23GTGGTGGGCCGCNONE 
J100079H17GCGGCCCATAANONE 
J100079H17GCGGCCCATGTNONE 
J100079H17GTGGTGGGCCGCNONE 
J100081N01GCGGCCCATAANONE 
J100081N01GCGGCCCATGTNONE 
J100081N01GTGGTGGGCCGCNONE 
J100082E04GCGGCCCATAANONE 
J100082E04GCGGCCCATGTNONE 
J100082E04GTGGTGGGCCGCNONE 
J100082K11GCGGCCCATAANONE 
J100082K11GCGGCCCATGTNONE 
J100082K11GTGGTGGGCCGCNONE 
J100085H23GCGGCCCATAANONE 
J100085H23GCGGCCCATGTNONE 
J100085H23GTGGTGGGCCGCNONE 
J100086O18GCGGCCCATAANONE 
J100086O18GCGGCCCATGTNONE 
J100086O18GTGGTGGGCCGCNONE 
J100087F21GCGGCCCATAANONE 
J100087F21GCGGCCCATGTNONE 
J100087F21GTGGTGGGCCGCNONE 
J100088E02GCGGCCCATAANONE 
J100088E02GCGGCCCATGTNONE 
J100088E02GTGGTGGGCCGCNONE 
J100088F08GCGGCCCATAANONE 
J100088F08GCGGCCCATGTNONE 
J100088F08GTGGTGGGCCGCNONE 
J100088G24GCGGCCCATAANONE 
J100088G24GCGGCCCATGTNONE 
J100088G24GTGGTGGGCCGCNONE 
J100088K20GCGGCCCATAANONE 
J100088K20GCGGCCCATGTNONE 
J100088K20GTGGTGGGCCGCNONE 
J100089B19GCGGCCCATAANONE 
J100089B19GCGGCCCATGTNONE 
J100089B19GTGGTGGGCCGCNONE 
J100089K22GCGGCCCATAANONE 
J100089K22GCGGCCCATGTNONE 
J100089K22GTGGTGGGCCGCNONE 
J100089N22GCGGCCCATAANONE 
J100089N22GCGGCCCATGTNONE 
J100089N22GTGGTGGGCCGCNONE 
J100089O17GCGGCCCATAANONE 
J100089O17GCGGCCCATGTNONE 
J100089O17GTGGTGGGCCGCNONE 
J100090N05GCGGCCCATAANONE 
J100090N05GCGGCCCATGTNONE 
J100090N05GTGGTGGGCCGCNONE 
Os03g0685000009-031-F08GCGGCCCAAACNONE 
009-031-F08GGATGGGCCGCNONE 
AK059896GCGGCCCAAACSimilar to Ferredoxin. 
AK059896GGATGGGCCGCSimilar to Ferredoxin. 
AK098989GCGGCCCAAACNONE 
AK098989GGATGGGCCGCNONE 
AK099303GCGGCCCAAACNONE 
AK099303GGATGGGCCGCNONE 
J065041E14GCGGCCCAAACNONE 
J065041E14GGATGGGCCGCNONE 
J065085G22GCGGCCCAAACNONE 
J065085G22GGATGGGCCGCNONE 
Os03g0708400006-108-F11CTTGGGCCGCNONE 
AK066216CTTGGGCCGCProtein of unknown function DUF1295 family protein. 
Os03g0716200Os03g0716200GCGGCCCAAConserved hypothetical protein. 
Os03g0725300011-085-E09TGCGGCCCATANONE 
AK063969TGCGGCCCATASimilar to Dbr1-prov protein. 
AK073636TGCGGCCCATANONE 
J033050L15TGCGGCCCATANONE 
J053082G03TGCGGCCCATANONE 
Os03g0734700AK072060GCGGCCCATGAMitochondrial substrate carrier family protein. 
AK120533GCGGCCCATGANONE 
J043026E20GCGGCCCATGANONE 
Os03g0743200J065049G14GCGGCCCATAANONE 
J065158O18GCGGCCCATAANONE 
Os03g0746000AK073682GCGGCCCACAConserved hypothetical protein. 
AK111472GCGGCCCACANONE 
J090083F05GCGGCCCACANONE 
Os03g0758700AK106620TGCGGCCCACGGWD40-like domain containing protein. 
Os03g0760700AK060701TGTGGGCCGCSimilar to Aspartate-semialdehyde dehydrogenase (EC 1.2.1.11) (Fragment). 
Os03g0765000AK073918TGCGGCCCAACTSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0776900AK107941GCGGCCCACGASimilar to DNAJ protein-like. 
J053100E14GCGGCCCACGANONE 
J075111A12GCGGCCCACGANONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0800800AK065406GCGGCCCAACSMAD/FHA domain containing protein. 
J013020B01GCGGCCCAACNONE 
J033116K11GCGGCCCAACNONE 
J090079M08GCGGCCCAACNONE 
Os03g0822200AK069405GCGGCCCAACANAD-dependent epimerase/dehydratase family protein. 
AK104151GCGGCCCAACANONE 
AK104209GCGGCCCAACANONE 
J065107D01GCGGCCCAACANONE 
J065191L23GCGGCCCAACANONE 
J065217B05GCGGCCCAACANONE 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0850600AK067191TGCGGCCCAATConserved hypothetical protein. 
J013095N12TGCGGCCCAATNONE 
J065214L06TGCGGCCCAATNONE 
J075093J10TGCGGCCCAATNONE 
Os03g0854000009-186-C03TGTTGGGCCGCANONE 
AK061374TGTTGGGCCGCAProtein of unknown function UPF0131 family protein. 
J065138B11TGTTGGGCCGCANONE 
Os04g0115400015-048-B05AGTGGGCCGCANONE 
AK070523AGTGGGCCGCAD111/G-patch domain containing protein. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0320200012-089-H09GCGGCCCAGTANONE 
AK069513GCGGCCCAGTAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028GCGGCCCAGTANONE 
AK119256GCGGCCCAGTANONE 
J023020H09GCGGCCCAGTANONE 
J065112F21GCGGCCCAGTANONE 
J100036M07GCGGCCCAGTANONE 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0418000006-025-C05ATTGGGCCGCANONE 
006-025-D11ATTGGGCCGCANONE 
006-045-F02ATTGGGCCGCANONE 
006-060-B04ATTGGGCCGCANONE 
006-063-E03ATTGGGCCGCANONE 
006-070-G08ATTGGGCCGCANONE 
006-072-H05ATTGGGCCGCANONE 
AK061030ATTGGGCCGCANONE 
AK099124ATTGGGCCGCANONE 
AK106155ATTGGGCCGCAConserved hypothetical protein. 
AK119714ATTGGGCCGCANONE 
J023039I07ATTGGGCCGCANONE 
J065025N03ATTGGGCCGCANONE 
Os04g0434800011-033-F12GCGGCCCACCACNONE 
011-049-F07GCGGCCCACCACNONE 
AB114855GCGGCCCACCACNONE 
AK063934GCGGCCCACCACNONE 
AK103344GCGGCCCACCACSimilar to Thylakoid-bound ascorbate peroxidase (EC 1.11.1.11) (Fragment). 
Os04g0459600006-039-H09AGATGGGCCGCNONE 
AK061516AGATGGGCCGCRan-interacting Mog1 protein family protein. 
J065112J03AGATGGGCCGCNONE 
Os04g0477900006-046-B01ATTTGGGCCGCANONE 
006-103-C03ATTTGGGCCGCANONE 
006-106-F09ATTTGGGCCGCANONE 
009-093-B07ATTTGGGCCGCANONE 
AK059948ATTTGGGCCGCASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTTGGGCCGCANONE 
J013158A11ATTTGGGCCGCANONE 
J023050E17ATTTGGGCCGCANONE 
J023078J03ATTTGGGCCGCANONE 
J033027G18ATTTGGGCCGCANONE 
J033086G10ATTTGGGCCGCANONE 
J090060G14ATTTGGGCCGCANONE 
Os04g0502300009-116-F02TGCGGCCCATGTNONE 
009-130-H06TGCGGCCCATGTNONE 
AK120520TGCGGCCCATGTSimilar to 40S ribosomal protein S11. 
J013124K01TGCGGCCCATGTNONE 
J023102F03TGCGGCCCATGTNONE 
J033094F17TGCGGCCCATGTNONE 
J053054C22TGCGGCCCATGTNONE 
J065024N13TGCGGCCCATGTNONE 
J065083J18TGCGGCCCATGTNONE 
J065132O14TGCGGCCCATGTNONE 
J065156M09TGCGGCCCATGTNONE 
J065176N15TGCGGCCCATGTNONE 
J065208H08TGCGGCCCATGTNONE 
J075054B03TGCGGCCCATGTNONE 
J090053E20TGCGGCCCATGTNONE 
J100075B09TGCGGCCCATGTNONE 
J100089H12TGCGGCCCATGTNONE 
Os04g0504600J065162K24TAATGGGCCGCNONE 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
Os04g0625600AK070994AGTTGGGCCGCTRAF-like domain containing protein. 
J023080H04AGTTGGGCCGCNONE 
J023086H15AGTTGGGCCGCNONE 
J033037L21AGTTGGGCCGCNONE 
J033044P14AGTTGGGCCGCNONE 
J065075C23AGTTGGGCCGCNONE 
J065167C18AGTTGGGCCGCNONE 
J100024E02AGTTGGGCCGCNONE 
J100068N24AGTTGGGCCGCNONE 
J100070G20AGTTGGGCCGCNONE 
Os04g0661700AK066532GCGGCCCATAConserved hypothetical protein. 
J065083O18GCGGCCCATANONE 
Os04g0663800013-021-G09GCGGCCCAGCNONE 
AK105321GCGGCCCAGCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0667000AK069874CCATGGGCGGCCCACATafazzin family protein. 
J100055P09CCATGGGCGGCCCACANONE 
J100057O12CCATGGGCGGCCCACANONE 
J100067H07CCATGGGCGGCCCACANONE 
J100070D06CCATGGGCGGCCCACANONE 
J100071J16CCATGGGCGGCCCACANONE 
J100072C15CCATGGGCGGCCCACANONE 
Os04g0669300AK071148TCTGGGCCGCDynamin family protein. 
Os04g0674100J080097J12TCATGGGCCGCAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TGCGGCCCATGANONE 
AK103795TGCGGCCCATGACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TGCGGCCCATGANONE 
J065020P20TGCGGCCCATGANONE 
J065057I21TGCGGCCCATGANONE 
J065059P11TGCGGCCCATGANONE 
J065083A22TGCGGCCCATGANONE 
J065093K10TGCGGCCCATGANONE 
J065097D03TGCGGCCCATGANONE 
J065103P05TGCGGCCCATGANONE 
J065113K09TGCGGCCCATGANONE 
J065118F23TGCGGCCCATGANONE 
J065119M06TGCGGCCCATGANONE 
J065146K17TGCGGCCCATGANONE 
J065161N12TGCGGCCCATGANONE 
J065169L02TGCGGCCCATGANONE 
J065189H12TGCGGCCCATGANONE 
J065192E24TGCGGCCCATGANONE 
J065193K17TGCGGCCCATGANONE 
J065197O21TGCGGCCCATGANONE 
J065214D09TGCGGCCCATGANONE 
J065217B11TGCGGCCCATGANONE 
J075132K07TGCGGCCCATGANONE 
J100059D14TGCGGCCCATGANONE 
Os04g0674350J065104O14AGATGGGCCGCNONE 
J065118J19AGATGGGCCGCNONE 
J065167I12AGATGGGCCGCHypothetical protein. 
Os04g0674400015-042-B08GCGGCCCATCTNONE 
AK102124GCGGCCCATCTSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22GCGGCCCATCTNONE 
J023022I24GCGGCCCATCTNONE 
J023120A15GCGGCCCATCTNONE 
J023123P20GCGGCCCATCTNONE 
J033068P09GCGGCCCATCTNONE 
J033107G22GCGGCCCATCTNONE 
J033116G12GCGGCCCATCTNONE 
J033133F03GCGGCCCATCTNONE 
J033143B20GCGGCCCATCTNONE 
J043006G12GCGGCCCATCTNONE 
J043027M18GCGGCCCATCTNONE 
J043034H17GCGGCCCATCTNONE 
J090091E20GCGGCCCATCTNONE 
J100035H09GCGGCCCATCTNONE 
J100037J04GCGGCCCATCTNONE 
J100047J24GCGGCCCATCTNONE 
J100059G06GCGGCCCATCTNONE 
J100066O12GCGGCCCATCTNONE 
J100074G23GCGGCCCATCTNONE 
J100077M12GCGGCCCATCTNONE 
Os04g0685600AK067506GCGGCCCACGCGExo70 exocyst complex subunit family protein. 
J013108D21GCGGCCCACGCGNONE 
J023041E19GCGGCCCACGCGNONE 
J065006M21GCGGCCCACGCGNONE 
J065060B21GCGGCCCACGCGNONE 
J065086K07GCGGCCCACGCGNONE 
J065121N03GCGGCCCACGCGNONE 
J065201M22GCGGCCCACGCGNONE 
J075004H05GCGGCCCACGCGNONE 
J075005G06GCGGCCCACGCGNONE 
J075032N07GCGGCCCACGCGNONE 
J075055M01GCGGCCCACGCGNONE 
J075057A20GCGGCCCACGCGNONE 
J075078L23GCGGCCCACGCGNONE 
J075137G04GCGGCCCACGCGNONE 
J090026N09GCGGCCCACGCGNONE 
J090044L05GCGGCCCACGCGNONE 
Os04g0687300AK060617TGCGGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04TGCGGCCCATAANONE 
Os04g0692500AK101528GCGGCCCAACANONE 
AK101528GCGGCCCATTNONE 
Os05g0101400009-126-G06AGTTGGGCTTGGGCCGCNONE 
AK067481AGTTGGGCTTGGGCCGCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10AGTTGGGCTTGGGCCGCNONE 
J065186D05AGTTGGGCTTGGGCCGCNONE 
J065193A14AGTTGGGCTTGGGCCGCNONE 
J075082A02AGTTGGGCTTGGGCCGCNONE 
J075100F11AGTTGGGCTTGGGCCGCNONE 
J075111O16AGTTGGGCTTGGGCCGCNONE 
J075172I24AGTTGGGCTTGGGCCGCNONE 
Os05g0110100009-015-D08TGCGGCCCATATNONE 
009-023-C09TGCGGCCCATATNONE 
009-031-B11TGCGGCCCATATNONE 
009-034-C02TGCGGCCCATATNONE 
009-050-B08TGCGGCCCATATNONE 
009-065-D12TGCGGCCCATATNONE 
009-090-G08TGCGGCCCATATNONE 
009-111-H07TGCGGCCCATATNONE 
009-136-F12TGCGGCCCATATNONE 
009-138-E06TGCGGCCCATATNONE 
009-138-G12TGCGGCCCATATNONE 
009-141-D08TGCGGCCCATATNONE 
009-143-D01TGCGGCCCATATNONE 
009-179-D09TGCGGCCCATATNONE 
009-179-E03TGCGGCCCATATNONE 
009-196-A09TGCGGCCCATATNONE 
009-199-F04TGCGGCCCATATNONE 
013-021-E05TGCGGCCCATATNONE 
013-076-C04TGCGGCCCATATNONE 
013-096-F06TGCGGCCCATATNONE 
014-071-A05TGCGGCCCATATNONE 
014-077-F09TGCGGCCCATATNONE 
AK099779TGCGGCCCATATNONE 
AK121142TGCGGCCCATATConserved hypothetical protein. 
J013095A16TGCGGCCCATATNONE 
J013111A17TGCGGCCCATATNONE 
J013132G04TGCGGCCCATATNONE 
J023077M04TGCGGCCCATATNONE 
J065001B11TGCGGCCCATATNONE 
J065001E11TGCGGCCCATATNONE 
J065057G10TGCGGCCCATATNONE 
J065057L08TGCGGCCCATATNONE 
J065080E07TGCGGCCCATATNONE 
J065087K10TGCGGCCCATATNONE 
J065091M15TGCGGCCCATATNONE 
J065167A15TGCGGCCCATATNONE 
J075018F02TGCGGCCCATATNONE 
J075063F20TGCGGCCCATATNONE 
J075064F18TGCGGCCCATATNONE 
J075066N19TGCGGCCCATATNONE 
J075073I02TGCGGCCCATATNONE 
J075080P17TGCGGCCCATATNONE 
J075081F11TGCGGCCCATATNONE 
J075085E03TGCGGCCCATATNONE 
J075101G18TGCGGCCCATATNONE 
J075149N08TGCGGCCCATATNONE 
J075158I21TGCGGCCCATATNONE 
J075161M20TGCGGCCCATATNONE 
J075190F12TGCGGCCCATATNONE 
J075194K16TGCGGCCCATATNONE 
J080001E08TGCGGCCCATATNONE 
J080001F21TGCGGCCCATATNONE 
J080001H19TGCGGCCCATATNONE 
J080001O15TGCGGCCCATATNONE 
J080005I22TGCGGCCCATATNONE 
J080006K23TGCGGCCCATATNONE 
J080014D20TGCGGCCCATATNONE 
J080014I05TGCGGCCCATATNONE 
J080014K21TGCGGCCCATATNONE 
J080017I24TGCGGCCCATATNONE 
J080017K11TGCGGCCCATATNONE 
J080018F11TGCGGCCCATATNONE 
J080022L18TGCGGCCCATATNONE 
J080024N23TGCGGCCCATATNONE 
J080027J23TGCGGCCCATATNONE 
J080029B14TGCGGCCCATATNONE 
J080032F14TGCGGCCCATATNONE 
J080032K19TGCGGCCCATATNONE 
J080032O21TGCGGCCCATATNONE 
J080033P17TGCGGCCCATATNONE 
J080034I06TGCGGCCCATATNONE 
J080039F24TGCGGCCCATATNONE 
J080040O13TGCGGCCCATATNONE 
J080042B02TGCGGCCCATATNONE 
J080043E12TGCGGCCCATATNONE 
J080043J15TGCGGCCCATATNONE 
J080043N09TGCGGCCCATATNONE 
J080052J08TGCGGCCCATATNONE 
J080053K01TGCGGCCCATATNONE 
J080053K19TGCGGCCCATATNONE 
J080055J09TGCGGCCCATATNONE 
J080058D07TGCGGCCCATATNONE 
J080062F11TGCGGCCCATATNONE 
J080063J24TGCGGCCCATATNONE 
J080066H04TGCGGCCCATATNONE 
J080066I09TGCGGCCCATATNONE 
J080067B02TGCGGCCCATATNONE 
J080067N09TGCGGCCCATATNONE 
J080068D22TGCGGCCCATATNONE 
J080068K13TGCGGCCCATATNONE 
J080069N19TGCGGCCCATATNONE 
J080070D07TGCGGCCCATATNONE 
J080070E05TGCGGCCCATATNONE 
J080071G04TGCGGCCCATATNONE 
J080077G05TGCGGCCCATATNONE 
J080077O06TGCGGCCCATATNONE 
J080085F05TGCGGCCCATATNONE 
J080086E07TGCGGCCCATATNONE 
J080089G16TGCGGCCCATATNONE 
J080092K15TGCGGCCCATATNONE 
J080094A08TGCGGCCCATATNONE 
J080097A09TGCGGCCCATATNONE 
J080097J07TGCGGCCCATATNONE 
J090027N01TGCGGCCCATATNONE 
J090081J05TGCGGCCCATATNONE 
Os05g0110300AK067116TGCGGCCCAGTANONE 
AK071038TGCGGCCCAGTANAD-dependent epimerase/dehydratase family protein. 
J065060E20TGCGGCCCAGTANONE 
J065093K05TGCGGCCCAGTANONE 
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE 
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE 
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE 
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE 
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE 
AB037970TTGGCCCATGGGCCGCCACGTCNONE 
AK061836TTGGCCCATGGGCCGCCACGTCNONE 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AY074786TTGGCCCATGGGCCGCCACGTCNONE 
J013022K21TTGGCCCATGGGCCGCCACGTCNONE 
J013154A03TTGGCCCATGGGCCGCCACGTCNONE 
J023074C02TTGGCCCATGGGCCGCCACGTCNONE 
J023091I19TTGGCCCATGGGCCGCCACGTCNONE 
J023135M05TTGGCCCATGGGCCGCCACGTCNONE 
J065027L11TTGGCCCATGGGCCGCCACGTCNONE 
J065065A08TTGGCCCATGGGCCGCCACGTCNONE 
J065120A08TTGGCCCATGGGCCGCCACGTCNONE 
J065174A05TTGGCCCATGGGCCGCCACGTCNONE 
J065184O22TTGGCCCATGGGCCGCCACGTCNONE 
J065191D07TTGGCCCATGGGCCGCCACGTCNONE 
J065209D04TTGGCCCATGGGCCGCCACGTCNONE 
J075014F11TTGGCCCATGGGCCGCCACGTCNONE 
J075036D03TTGGCCCATGGGCCGCCACGTCNONE 
J075157D23TTGGCCCATGGGCCGCCACGTCNONE 
J080007F15TTGGCCCATGGGCCGCCACGTCNONE 
J080008N12TTGGCCCATGGGCCGCCACGTCNONE 
J080010F22TTGGCCCATGGGCCGCCACGTCNONE 
J080011C19TTGGCCCATGGGCCGCCACGTCNONE 
J080011F12TTGGCCCATGGGCCGCCACGTCNONE 
J080012E11TTGGCCCATGGGCCGCCACGTCNONE 
J080015B12TTGGCCCATGGGCCGCCACGTCNONE 
J080015O16TTGGCCCATGGGCCGCCACGTCNONE 
J080016G24TTGGCCCATGGGCCGCCACGTCNONE 
J080016K13TTGGCCCATGGGCCGCCACGTCNONE 
J080018A02TTGGCCCATGGGCCGCCACGTCNONE 
J080018H03TTGGCCCATGGGCCGCCACGTCNONE 
J080022M01TTGGCCCATGGGCCGCCACGTCNONE 
J080023D20TTGGCCCATGGGCCGCCACGTCNONE 
J080023I01TTGGCCCATGGGCCGCCACGTCNONE 
J080023J05TTGGCCCATGGGCCGCCACGTCNONE 
J080024A09TTGGCCCATGGGCCGCCACGTCNONE 
J080024I09TTGGCCCATGGGCCGCCACGTCNONE 
J080025A10TTGGCCCATGGGCCGCCACGTCNONE 
J080025G04TTGGCCCATGGGCCGCCACGTCNONE 
J080027D21TTGGCCCATGGGCCGCCACGTCNONE 
J080029M05TTGGCCCATGGGCCGCCACGTCNONE 
J080030J01TTGGCCCATGGGCCGCCACGTCNONE 
J080034D10TTGGCCCATGGGCCGCCACGTCNONE 
J080036F18TTGGCCCATGGGCCGCCACGTCNONE 
J080038N11TTGGCCCATGGGCCGCCACGTCNONE 
J080039B07TTGGCCCATGGGCCGCCACGTCNONE 
J080039E01TTGGCCCATGGGCCGCCACGTCNONE 
J080039K11TTGGCCCATGGGCCGCCACGTCNONE 
J080040B09TTGGCCCATGGGCCGCCACGTCNONE 
J080040G11TTGGCCCATGGGCCGCCACGTCNONE 
J080041H08TTGGCCCATGGGCCGCCACGTCNONE 
J080041H19TTGGCCCATGGGCCGCCACGTCNONE 
J080041O20TTGGCCCATGGGCCGCCACGTCNONE 
J080042C15TTGGCCCATGGGCCGCCACGTCNONE 
J080043C16TTGGCCCATGGGCCGCCACGTCNONE 
J080043F18TTGGCCCATGGGCCGCCACGTCNONE 
J080044B17TTGGCCCATGGGCCGCCACGTCNONE 
J080044N10TTGGCCCATGGGCCGCCACGTCNONE 
J080044O07TTGGCCCATGGGCCGCCACGTCNONE 
J080045H15TTGGCCCATGGGCCGCCACGTCNONE 
J080045I03TTGGCCCATGGGCCGCCACGTCNONE 
J080046A05TTGGCCCATGGGCCGCCACGTCNONE 
J080048I06TTGGCCCATGGGCCGCCACGTCNONE 
J080049L04TTGGCCCATGGGCCGCCACGTCNONE 
J080049M09TTGGCCCATGGGCCGCCACGTCNONE 
J080050G11TTGGCCCATGGGCCGCCACGTCNONE 
J080051G20TTGGCCCATGGGCCGCCACGTCNONE 
J080053C09TTGGCCCATGGGCCGCCACGTCNONE 
J080053I05TTGGCCCATGGGCCGCCACGTCNONE 
J080053P18TTGGCCCATGGGCCGCCACGTCNONE 
J080054K10TTGGCCCATGGGCCGCCACGTCNONE 
J080054P14TTGGCCCATGGGCCGCCACGTCNONE 
J080057L05TTGGCCCATGGGCCGCCACGTCNONE 
J080062K11TTGGCCCATGGGCCGCCACGTCNONE 
J080063C19TTGGCCCATGGGCCGCCACGTCNONE 
J080065B03TTGGCCCATGGGCCGCCACGTCNONE 
J080066E15TTGGCCCATGGGCCGCCACGTCNONE 
J080066H05TTGGCCCATGGGCCGCCACGTCNONE 
J080066I05TTGGCCCATGGGCCGCCACGTCNONE 
J080068O11TTGGCCCATGGGCCGCCACGTCNONE 
J080070L22TTGGCCCATGGGCCGCCACGTCNONE 
J080071I12TTGGCCCATGGGCCGCCACGTCNONE 
J080071N20TTGGCCCATGGGCCGCCACGTCNONE 
J080072D10TTGGCCCATGGGCCGCCACGTCNONE 
J080072I10TTGGCCCATGGGCCGCCACGTCNONE 
J080074G03TTGGCCCATGGGCCGCCACGTCNONE 
J080076E23TTGGCCCATGGGCCGCCACGTCNONE 
J080076N03TTGGCCCATGGGCCGCCACGTCNONE 
J080077N23TTGGCCCATGGGCCGCCACGTCNONE 
J080084B13TTGGCCCATGGGCCGCCACGTCNONE 
J080084F07TTGGCCCATGGGCCGCCACGTCNONE 
J080085J15TTGGCCCATGGGCCGCCACGTCNONE 
J080085P20TTGGCCCATGGGCCGCCACGTCNONE 
J080090F21TTGGCCCATGGGCCGCCACGTCNONE 
J080093H16TTGGCCCATGGGCCGCCACGTCNONE 
J080093J01TTGGCCCATGGGCCGCCACGTCNONE 
J080093L04TTGGCCCATGGGCCGCCACGTCNONE 
J080097E24TTGGCCCATGGGCCGCCACGTCNONE 
J090012G04TTGGCCCATGGGCCGCCACGTCNONE 
J090054K05TTGGCCCATGGGCCGCCACGTCNONE 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0120800AK066865ATATGGGCCGCAConserved hypothetical protein. 
AK066865ATATGGGCCGCAConserved hypothetical protein. 
Os05g0122900009-052-C11TAATGGGCCGCNONE 
009-132-C12TAATGGGCCGCNONE 
014-091-G03TAATGGGCCGCNONE 
AB072977TAATGGGCCGCNONE 
AK071296TAATGGGCCGCNONE 
AK099375TAATGGGCCGCNONE 
AK104970TAATGGGCCGCBLE1 protein. 
J065007I09TAATGGGCCGCNONE 
J065081H07TAATGGGCCGCNONE 
J065122B18TAATGGGCCGCNONE 
J065181G15TAATGGGCCGCNONE 
J065182J07TAATGGGCCGCNONE 
J065197D23TAATGGGCCGCNONE 
J065197G08TAATGGGCCGCNONE 
J065201H20TAATGGGCCGCNONE 
J090034E11TAATGGGCCGCNONE 
J100077M04TAATGGGCCGCNONE 
Os05g0126200AK059554GCGGCCCAACAConserved hypothetical protein. 
AK121734GCGGCCCAACANONE 
J033084B09GCGGCCCAACANONE 
J090010I10GCGGCCCAACANONE 
Os05g0128100009-051-B07CTTGGGCCGCCGGCCCATCTNONE 
009-127-B08CTTGGGCCGCCGGCCCATCTNONE 
009-144-H03CTTGGGCCGCCGGCCCATCTNONE 
009-176-B05CTTGGGCCGCCGGCCCATCTNONE 
AK108556CTTGGGCCGCCGGCCCATCTNONE 
AK119308CTTGGGCCGCCGGCCCATCTNONE 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
J023036J15CTTGGGCCGCCGGCCCATCTNONE 
J065122L01CTTGGGCCGCCGGCCCATCTNONE 
J075104P10CTTGGGCCGCCGGCCCATCTNONE 
Os05g0139200AK108058TGCGGCCCACATGGGTCCCACCyclin-like F-box domain containing protein. 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0176600009-151-A09ACATGGGCCGCNONE 
AK071760ACATGGGCCGCConserved hypothetical protein. 
J023110C14ACATGGGCCGCNONE 
J065116G18ACATGGGCCGCNONE 
J065131I04ACATGGGCCGCNONE 
J065163H12ACATGGGCCGCNONE 
J075088L08ACATGGGCCGCNONE 
J075165F17ACATGGGCCGCNONE 
Os05g0215600AK066642TGCGGCCCAGTConserved hypothetical protein. 
AK099688TGCGGCCCAGTNONE 
Os05g0322900006-057-H12CGCGTGGGCCGCNONE 
014-051-A08CGCGTGGGCCGCNONE 
AK063697CGCGTGGGCCGCNONE 
AK066255CGCGTGGGCCGCSimilar to WRKY transcription factor 45. 
AK103959CGCGTGGGCCGCNONE 
AY870611CGCGTGGGCCGCNONE 
J100068H13CGCGTGGGCCGCNONE 
Os05g0325200J090038J19GGGCTGGGCGGCCCATTTGGGCCyclin-like domain containing protein. 
Os05g0346300009-033-C06GCGGCCCAGCAAGGCCCATCGNONE 
AF529175GCGGCCCAGCAAGGCCCATCGNONE 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
AK103081GCGGCCCAGCAAGGCCCATCGNONE 
AK104191GCGGCCCAGCAAGGCCCATCGNONE 
J013049B09GCGGCCCAGCAAGGCCCATCGNONE 
J023142E24GCGGCCCAGCAAGGCCCATCGNONE 
J033052M14GCGGCCCAGCAAGGCCCATCGNONE 
J033089N04GCGGCCCAGCAAGGCCCATCGNONE 
J033118F01GCGGCCCAGCAAGGCCCATCGNONE 
J065054E07GCGGCCCAGCAAGGCCCATCGNONE 
J065066L18GCGGCCCAGCAAGGCCCATCGNONE 
J065078C21GCGGCCCAGCAAGGCCCATCGNONE 
J065127G23GCGGCCCAGCAAGGCCCATCGNONE 
J065128N24GCGGCCCAGCAAGGCCCATCGNONE 
J065144P17GCGGCCCAGCAAGGCCCATCGNONE 
J065147P14GCGGCCCAGCAAGGCCCATCGNONE 
J065170E16GCGGCCCAGCAAGGCCCATCGNONE 
J065175D17GCGGCCCAGCAAGGCCCATCGNONE 
J065176M05GCGGCCCAGCAAGGCCCATCGNONE 
J065218G20GCGGCCCAGCAAGGCCCATCGNONE 
J090074J12GCGGCCCAGCAAGGCCCATCGNONE 
J100019H16GCGGCCCAGCAAGGCCCATCGNONE 
J100031N24GCGGCCCAGCAAGGCCCATCGNONE 
J100072G08GCGGCCCAGCAAGGCCCATCGNONE 
J100086I23GCGGCCCAGCAAGGCCCATCGNONE 
Os05g0361700AJ575218GCGGCCCATCANONE 
AK100184GCGGCCCATCASimilar to EREBP-2 protein (Fragment). 
AK111676GCGGCCCATCANONE 
J013155B14GCGGCCCATCANONE 
J065073N01GCGGCCCATCANONE 
J065161J12GCGGCCCATCANONE 
J075074A07GCGGCCCATCANONE 
J100029H13GCGGCCCATCANONE 
Os05g0378800AK058210TGCGGCCCAATNONE 
Os05g0406100AK069515TGATGGGCCGCInosine/uridine-preferring nucleoside hydrolase domain containing protein. 
J023019G14TGATGGGCCGCNONE 
Os05g0415600AK065818GCGGCCCAAAANONE 
AK065818TGCGGCCCAGGNONE 
J013042K21GCGGCCCAAAANONE 
J013042K21TGCGGCCCAGGNONE 
J013114E15GCGGCCCAAAANONE 
J013114E15TGCGGCCCAGGNONE 
J013131H02GCGGCCCAAAANONE 
J013131H02TGCGGCCCAGGNONE 
J023041G06GCGGCCCAAAANONE 
J023041G06TGCGGCCCAGGNONE 
J100037M21GCGGCCCAAAANONE 
J100037M21TGCGGCCCAGGNONE 
Os05g0437200014-036-D04GCGGCCCAAAANONE 
AK059283GCGGCCCAAAANONE 
AK121867GCGGCCCAAAAProtein of unknown function DUF502 family protein. 
Os05g0438500006-102-F01GCGGCCCACCCNONE 
AK059951GCGGCCCACCCSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
Os05g0443300Os05g0443300AGTTGGGCCGCSec23/Sec24 trunk region domain containing protein. 
Os05g0450300AK071191GCGGCCCATCGConserved hypothetical protein. 
J023084G11GCGGCCCATCGNONE 
Os05g0456000AK058420TATGGGCCGCMitochondrial glycoprotein family protein. 
AK102036TATGGGCCGCNONE 
J065066F02TATGGGCCGCNONE 
Os05g0467300006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0481000AK059369GCGGCCCAATGCN5-related N-acetyltransferase domain containing protein. 
AK068619GCGGCCCAATNONE 
Os05g0488900AK071883TGCGGCCCACACSimilar to Cytochrome b5 reductase. 
AK073699TGCGGCCCACACNONE 
AK105459TGCGGCCCACACNONE 
J080009C06TGCGGCCCACACNONE 
J080021N09TGCGGCCCACACNONE 
J080041K24TGCGGCCCACACNONE 
J080058H15TGCGGCCCACACNONE 
J080064P06TGCGGCCCACACNONE 
J080077B16TGCGGCCCACACNONE 
Os05g0500500AK110627GCGGCCCACGGHSP20-like chaperone domain containing protein. 
Os05g0526300AK099438CCTGGGCCGCNONE 
Os05g0531500AK120867CTTGGGCCGCProtein of unknown function DUF616 family protein. 
Os05g0533600AK067577CACTGACATGTGGGCCGCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560CACTGACATGTGGGCCGCNONE 
AY373258CACTGACATGTGGGCCGCNONE 
Os05g0539300Os05g0539300AATTGGGCCGCAProtein of unknown function DUF295 family protein. 
Os05g0540100AB021666CACGTGGGCCGCANONE 
AK060623CACGTGGGCCGCANONE 
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0548100AK060333GCGGCCCAGATConserved hypothetical protein. 
AK100682GCGGCCCAGATNONE 
J013151E01GCGGCCCAGATNONE 
J023113L22GCGGCCCAGATNONE 
J043027A19GCGGCCCAGATNONE 
J075093E06GCGGCCCAGATNONE 
J090060D15GCGGCCCAGATNONE 
J090082J03GCGGCCCAGATNONE 
J100050E01GCGGCCCAGATNONE 
Os05g0553700006-100-D08TGCGGCCCACANONE 
AK099747TGCGGCCCACANONE 
AK101606TGCGGCCCACANONE 
AK103396TGCGGCCCACASimilar to Syntaxin 71 (AtSYP71). 
J033022M23TGCGGCCCACANONE 
J090086G01TGCGGCCCACANONE 
Os05g0555300009-032-C03GCGGCCCAACANONE 
009-125-E08GCGGCCCAACANONE 
009-149-C12GCGGCCCAACANONE 
009-172-C01GCGGCCCAACANONE 
AK062890GCGGCCCAACAFerredoxin domain containing protein. 
AK062997GCGGCCCAACANONE 
Os05g0565200004-015-E06TATTGGGCCGCANONE 
AK067090TATTGGGCCGCASimilar to Urease accessory protein G. 
AK104200TATTGGGCCGCANONE 
AK104368TATTGGGCCGCANONE 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0571400009-019-B04AGCCCATGCGGCCCAAAANONE 
009-043-H02AGCCCATGCGGCCCAAAANONE 
AK062369AGCCCATGCGGCCCAAAAConserved hypothetical protein. 
Os06g0115400AK111656GCGGCCCACTSimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0132600006-104-C03GCGGCCCAGCNONE 
AK061226GCGGCCCAGCConserved hypothetical protein. 
AK074010GCGGCCCAGCNONE 
J033076A22GCGGCCCAGCNONE 
Os06g0140100011-063-A02TGCGGCCCATCTNONE 
AK063371TGCGGCCCATCTLeucine carboxyl methyltransferase family protein. 
Os06g0144000AK068998TGTTGGGCCGCBRCT domain containing protein. 
J023001F16TGTTGGGCCGCNONE 
Os06g0194200AK111269TGTGGGCCGCAConserved hypothetical protein. 
J090084F15TGTGGGCCGCANONE 
Os06g0257200J053059P05GCGGCCCAAATAAATGGGCCCCNONE 
J075006K03GCGGCCCAAATAAATGGGCCCCNONE 
J075067F07GCGGCCCAAATAAATGGGCCCCNONE 
J075068F14GCGGCCCAAATAAATGGGCCCCNONE 
J075068H14GCGGCCCAAATAAATGGGCCCCNONE 
J075098N06GCGGCCCAAATAAATGGGCCCCNONE 
J075099F08GCGGCCCAAATAAATGGGCCCCNONE 
J075154G24GCGGCCCAAATAAATGGGCCCCNONE 
J075195H09GCGGCCCAAATAAATGGGCCCCNONE 
Os06g0338900016-067-B02GGGCCGGGCGGCCCANONE 
AK100837GGGCCGGGCGGCCCANucleotidyl transferase domain containing protein. 
J013058L01GGGCCGGGCGGCCCANONE 
J013135N01GGGCCGGGCGGCCCANONE 
J023123E15GGGCCGGGCGGCCCANONE 
J033051J01GGGCCGGGCGGCCCANONE 
J090002O21GGGCCGGGCGGCCCANONE 
J090013F06GGGCCGGGCGGCCCANONE 
J090056F16GGGCCGGGCGGCCCANONE 
J090081G13GGGCCGGGCGGCCCANONE 
J090090P21GGGCCGGGCGGCCCANONE 
J100039F05GGGCCGGGCGGCCCANONE 
J100059J03GGGCCGGGCGGCCCANONE 
Os06g0355500AK065914GCTGGGCCGCCCAACABromodomain containing protein. 
Os06g0482200AK119703TGTTGGGCCGCAThioredoxin fold domain containing protein. 
J065014B11TGTTGGGCCGCANONE 
J065055E22TGTTGGGCCGCANONE 
J065092L13TGTTGGGCCGCANONE 
J065113E21TGTTGGGCCGCANONE 
J065191D11TGTTGGGCCGCANONE 
J065214F18TGTTGGGCCGCANONE 
J075104E18TGTTGGGCCGCANONE 
J075149O19TGTTGGGCCGCANONE 
J075170I11TGTTGGGCCGCANONE 
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE 
AK068592AACGGCCCGTGGGCCGCANONE 
AK073844AACGGCCCGTGGGCCGCANONE 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
J013154A14AACGGCCCGTGGGCCGCANONE 
J100049K24AACGGCCCGTGGGCCGCANONE 
J100059C18AACGGCCCGTGGGCCGCANONE 
J100082N13AACGGCCCGTGGGCCGCANONE 
Os06g0598900AK100386GCGGCCCACACSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05GCGGCCCACACNONE 
J090043L20GCGGCCCACACNONE 
Os06g0616900AK107912TGCGGCCCATTAConserved hypothetical protein. 
Os06g0646900AY222862GCGGCCCAATGGGCTGANONE 
Os06g0647100009-005-F12GCGGCCCACANONE 
009-113-D11GCGGCCCACANONE 
009-132-D09GCGGCCCACANONE 
009-147-G06GCGGCCCACANONE 
AK066837GCGGCCCACASimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
J065073M03GCGGCCCACANONE 
Os06g0647900AK073750GCGGCCCAACAConserved hypothetical protein. 
AK073750GCGGCCCAACAConserved hypothetical protein. 
J033029K17GCGGCCCAACANONE 
J033029K17GCGGCCCAACANONE 
J033070L21GCGGCCCAACANONE 
J033070L21GCGGCCCAACANONE 
Os06g0656800AK109762GCGGCCCATTTBeta-Ig-H3/fasciclin domain containing protein. 
Os06g0682800011-092-E01GGTTGGGCCGCNONE 
AK064816GGTTGGGCCGCZinc finger, CCCH-type domain containing protein. 
J013000E13GGTTGGGCCGCNONE 
J013035J22GGTTGGGCCGCNONE 
J013045M06GGTTGGGCCGCNONE 
J013120A07GGTTGGGCCGCNONE 
J033144H15GGTTGGGCCGCNONE 
J033145H15GGTTGGGCCGCNONE 
J033145N16GGTTGGGCCGCNONE 
J090019J02GGTTGGGCCGCNONE 
Os06g0687200AK058749TGCGGCCCACCAZinc finger, RING-type domain containing protein. 
Os06g0688100AK063450AATTGGGCCGCNONE 
AK101144AATTGGGCCGCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0708600009-019-C12ATCTGGGCCGCNONE 
013-092-H09ATCTGGGCCGCNONE 
014-031-G05ATCTGGGCCGCNONE 
AK100915ATCTGGGCCGCConserved hypothetical protein. 
J065065F24ATCTGGGCCGCNONE 
J065208J10ATCTGGGCCGCNONE 
J100068H01ATCTGGGCCGCNONE 
J100084D18ATCTGGGCCGCNONE 
Os07g0122300015-004-G08ATATGGGCCGCANONE 
AK103212ATATGGGCCGCANONE 
AK119295ATATGGGCCGCAProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09ATATGGGCCGCANONE 
J090007P13ATATGGGCCGCANONE 
Os07g0146600J075074M15GCGGCCCAGAConserved hypothetical protein. 
J075120F11GCGGCCCAGANONE 
J075170L13GCGGCCCAGANONE 
J080302A21GCGGCCCAGANONE 
J080304J04GCGGCCCAGANONE 
J080308I12GCGGCCCAGANONE 
J080312F11GCGGCCCAGANONE 
J080315M22GCGGCCCAGANONE 
Os07g0158900AK064980GCGGCCCAAGCyclin-like F-box domain containing protein. 
Os07g0191700AK066389GCGGCCCAGCCCAAGSimilar to AT.I.24-9 protein (Fragment). 
AK103768GCGGCCCAGCCCAAGNONE 
Os07g0205000009-018-A12GCGGCCCAANONE 
AK103963GCGGCCCAANONE 
AK121368GCGGCCCAANONE 
J023001M20GCGGCCCAANONE 
J023125I03GCGGCCCAANONE 
J053034L22GCGGCCCAANONE 
J065078A21GCGGCCCAANONE 
J065089G24GCGGCCCAANONE 
J065096G23GCGGCCCAANONE 
J065103N06GCGGCCCAANONE 
J065146J22GCGGCCCAANONE 
J065159K18GCGGCCCAANONE 
J065204L04GCGGCCCAANONE 
J065207N07GCGGCCCAANONE 
J065208E24GCGGCCCAANONE 
J075057F19GCGGCCCAANONE 
J075058K01GCGGCCCAANONE 
J075072H13GCGGCCCAANONE 
J080003D08GCGGCCCAANONE 
J080025F02GCGGCCCAANONE 
Os07g0205700AK120553GCGGCCCAGTTSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24GCGGCCCAGTTNONE 
Os07g0270900015-039-A02ATTTGGGCCGCNONE 
AK058966ATTTGGGCCGCMak16 protein family protein. 
AK068904ATTTGGGCCGCNONE 
J013169N21ATTTGGGCCGCNONE 
J065039I11ATTTGGGCCGCNONE 
J065081J11ATTTGGGCCGCNONE 
J065162P04ATTTGGGCCGCNONE 
Os07g0463100009-138-B06GCGGCCCAAATNONE 
AK121807GCGGCCCAAATDNA-directed RNA polymerase, 14 to 18 kDa subunit family protein. 
J013162G21GCGGCCCAAATNONE 
J065061H22GCGGCCCAAATNONE 
J075091J19GCGGCCCAAATNONE 
J075107E13GCGGCCCAAATNONE 
J075141I11GCGGCCCAAATNONE 
J075172E07GCGGCCCAAATNONE 
J080305N05GCGGCCCAAATNONE 
J080311B17GCGGCCCAAATNONE 
J080316I07GCGGCCCAAATNONE 
Os07g0490300AK068288GCGGCCCACAGCCCAACCSimilar to Preproacrosin. 
J013149P03GCGGCCCACAGCCCAACCNONE 
J065039L14GCGGCCCACAGCCCAACCNONE 
J100024A06GCGGCCCACAGCCCAACCNONE 
Os07g0490400AK067941GGTTGGGCTGTGGGCCGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22GGTTGGGCTGTGGGCCGCNONE 
Os07g0516900009-108-C10GCGGCCCAGATNONE 
AK062798GCGGCCCAGATNONE 
Os07g0564000AK069806TGCGGCCCATATConserved hypothetical protein. 
Os07g0567700AK059008CCTGGGCCGCNONE 
Os07g0585800006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0588800015-027-E02GCTGGGCCGCNONE 
AK070635GCTGGGCCGCNONE 
AK103183GCTGGGCCGCConserved hypothetical protein. 
J023058H18GCTGGGCCGCNONE 
Os07g0589400AK072501AACTGGGCCGCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617AACTGGGCCGCANONE 
AK104756AACTGGGCCGCANONE 
Os07g0595700003-103-G05AGTTGGGCCGCNONE 
AK108488AGTTGGGCCGCConserved hypothetical protein. 
J065136O05AGTTGGGCCGCNONE 
Os07g0595800011-069-G09GCGGCCCAACTNONE 
AK066349GCGGCCCAACTPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05GCGGCCCAACTNONE 
Os07g0603100AK101352GCGGCCCATGGNuclear transport factor 2 domain containing protein. 
J023077E09GCGGCCCATGGNONE 
J023081N15GCGGCCCATGGNONE 
J033022N22GCGGCCCATGGNONE 
J033024M18GCGGCCCATGGNONE 
J033034P09GCGGCCCATGGNONE 
J033046A06GCGGCCCATGGNONE 
J033051K01GCGGCCCATGGNONE 
J033081P09GCGGCCCATGGNONE 
J033091B17GCGGCCCATGGNONE 
J033092K23GCGGCCCATGGNONE 
J033132J09GCGGCCCATGGNONE 
J033144A14GCGGCCCATGGNONE 
J033145A14GCGGCCCATGGNONE 
J043021B20GCGGCCCATGGNONE 
J053024D23GCGGCCCATGGNONE 
J065212J10GCGGCCCATGGNONE 
J090055M05GCGGCCCATGGNONE 
J090065E14GCGGCCCATGGNONE 
J090092J06GCGGCCCATGGNONE 
Os07g0614100AB032062TTTTGGGCCGCANONE 
AK058885TTTTGGGCCGCANONE 
AK069145TTTTGGGCCGCANONE 
AK102448TTTTGGGCCGCAAlpha 1-2 subunit of 20S proteasome. 
J023007E07TTTTGGGCCGCANONE 
J033093O06TTTTGGGCCGCANONE 
Os07g0622700AK107120AGTGGGCCGCEpoxide hydrolase family protein. 
Os07g0633200AK061338GCGGCCCACACSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GCGGCCCACACNONE 
J033096E22GCGGCCCACACNONE 
J033125D06GCGGCCCACACNONE 
J075048C23GCGGCCCACACNONE 
J075050G02GCGGCCCACACNONE 
J075104J04GCGGCCCACACNONE 
J075144N04GCGGCCCACACNONE 
Os07g0638300AK101401ACATGGGCCGCNONE 
AK102982ACATGGGCCGCSimilar to 1-Cys peroxiredoxin. 
AY336994ACATGGGCCGCNONE 
D63917ACATGGGCCGCNONE 
J033044N01ACATGGGCCGCNONE 
J033055M23ACATGGGCCGCNONE 
J033057E19ACATGGGCCGCNONE 
J033114I23ACATGGGCCGCNONE 
J033115O22ACATGGGCCGCNONE 
J033120C03ACATGGGCCGCNONE 
J033121H24ACATGGGCCGCNONE 
J043034H13ACATGGGCCGCNONE 
J065029D17ACATGGGCCGCNONE 
J065058P20ACATGGGCCGCNONE 
J065062L08ACATGGGCCGCNONE 
J065082B12ACATGGGCCGCNONE 
J065131K01ACATGGGCCGCNONE 
J065181F09ACATGGGCCGCNONE 
J065200F11ACATGGGCCGCNONE 
J075003I12ACATGGGCCGCNONE 
J075006B18ACATGGGCCGCNONE 
J075013E13ACATGGGCCGCNONE 
J075013I03ACATGGGCCGCNONE 
J075017J08ACATGGGCCGCNONE 
J075019J19ACATGGGCCGCNONE 
J075030G22ACATGGGCCGCNONE 
J075037E04ACATGGGCCGCNONE 
J075048L18ACATGGGCCGCNONE 
J075056A08ACATGGGCCGCNONE 
J075059G05ACATGGGCCGCNONE 
J075062J04ACATGGGCCGCNONE 
J075070F14ACATGGGCCGCNONE 
J075072N23ACATGGGCCGCNONE 
J075085J23ACATGGGCCGCNONE 
J075091L01ACATGGGCCGCNONE 
J075094B10ACATGGGCCGCNONE 
J075098M05ACATGGGCCGCNONE 
J075106B18ACATGGGCCGCNONE 
J075116K24ACATGGGCCGCNONE 
J075136C06ACATGGGCCGCNONE 
J075137I15ACATGGGCCGCNONE 
J075140K14ACATGGGCCGCNONE 
J075147H07ACATGGGCCGCNONE 
J075167I19ACATGGGCCGCNONE 
J075182O03ACATGGGCCGCNONE 
J075188G23ACATGGGCCGCNONE 
J075194C06ACATGGGCCGCNONE 
Os07g0639800AK074012AAATGGGCCGCASimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592AAATGGGCCGCANONE 
AK104739AAATGGGCCGCANONE 
Os07g0669000AK099431GCGGCCCACTSimilar to Catalytic subunit of polymerase zeta. 
J065073M09GCGGCCCACTNONE 
Os07g0673500005-016-H01TGCGGCCCAACCNONE 
AK072839TGCGGCCCAACCNONE 
AK106176TGCGGCCCAACCSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TGCGGCCCAACCNONE 
J013153M24TGCGGCCCAACCNONE 
J023129E21TGCGGCCCAACCNONE 
J023141I23TGCGGCCCAACCNONE 
J033069A22TGCGGCCCAACCNONE 
J075021G17TGCGGCCCAACCNONE 
J075022B06TGCGGCCCAACCNONE 
J075049O15TGCGGCCCAACCNONE 
J075060O14TGCGGCCCAACCNONE 
J075073G03TGCGGCCCAACCNONE 
J075095D13TGCGGCCCAACCNONE 
J075120M18TGCGGCCCAACCNONE 
J075130D09TGCGGCCCAACCNONE 
J075152C20TGCGGCCCAACCNONE 
J075158L19TGCGGCCCAACCNONE 
J075199P18TGCGGCCCAACCNONE 
J090011K21TGCGGCCCAACCNONE 
J090078O10TGCGGCCCAACCNONE 
Os07g0681700AK103213GCGGCCCACGCGlycosyl transferase, family 8 protein. 
Os07g0682700003-131-G11ATATGGGCCGCNONE 
016-086-E10ATATGGGCCGCNONE 
AK065098ATATGGGCCGCSimilar to Chitin-binding lectin 1 precursor (PL-I). 
AK103680ATATGGGCCGCNONE 
J013001M18ATATGGGCCGCNONE 
J033136D22ATATGGGCCGCNONE 
Os08g0107500013-094-H02GCGGCCCATTTNONE 
013-095-E07GCGGCCCATTTNONE 
AK064053GCGGCCCATTTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418GCGGCCCATTTNONE 
J033037P14GCGGCCCATTTNONE 
J090025I15GCGGCCCATTTNONE 
J100022F23GCGGCCCATTTNONE 
Os08g0107900014-055-C03TGTTGGGCCGCANONE 
J065062G20TGTTGGGCCGCANONE 
Os08g0120000006-042-E02GCGGCCCATAANONE 
006-051-F06GCGGCCCATAANONE 
006-052-G03GCGGCCCATAANONE 
006-095-B11GCGGCCCATAANONE 
AB017427GCGGCCCATAANONE 
AB017428GCGGCCCATAANONE 
AK059789GCGGCCCATAANONE 
AK059815GCGGCCCATAASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077GCGGCCCATAANONE 
AK102607GCGGCCCATAANONE 
AK104303GCGGCCCATAANONE 
AK104304GCGGCCCATAANONE 
AK104421GCGGCCCATAANONE 
D10414GCGGCCCATAANONE 
J013170D08GCGGCCCATAANONE 
J023086D16GCGGCCCATAANONE 
J033099B04GCGGCCCATAANONE 
J065042P05GCGGCCCATAANONE 
J065144E22GCGGCCCATAANONE 
J065162J20GCGGCCCATAANONE 
J065196N13GCGGCCCATAANONE 
J090013B11GCGGCCCATAANONE 
Os08g0129200014-040-E08AGTTGGGCCGCNONE 
AK070034AGTTGGGCCGCNONE 
AK101577AGTTGGGCCGCSimilar to Cold shock protein-1. 
J065137A09AGTTGGGCCGCNONE 
J100062K14AGTTGGGCCGCNONE 
Os08g0167500006-063-D04AATTGGGCCGCANONE 
006-066-G09AATTGGGCCGCANONE 
AK061061AATTGGGCCGCAConserved hypothetical protein. 
AK071197AATTGGGCCGCANONE 
J023082N10AATTGGGCCGCANONE 
Os08g0195400006-057-E04GCGGCCCACANONE 
006-060-B10GCGGCCCACANONE 
AK070464GCGGCCCACAConserved hypothetical protein. 
AK104389GCGGCCCACANONE 
AK106140GCGGCCCACANONE 
J023013G08GCGGCCCACANONE 
J023054K19GCGGCCCACANONE 
J023089D18GCGGCCCACANONE 
J023092K05GCGGCCCACANONE 
J033025A08GCGGCCCACANONE 
J033067P12GCGGCCCACANONE 
J033098A10GCGGCCCACANONE 
J065219L04GCGGCCCACANONE 
J090021P06GCGGCCCACANONE 
J090062M05GCGGCCCACANONE 
J090079F15GCGGCCCACANONE 
J100041H19GCGGCCCACANONE 
Os08g0224200AK101331GCGGCCCACASimilar to Ythdf2-prov protein. 
Os08g0227100AK071657TCATGGGCCGCTRAF-like domain containing protein. 
AK103481TCATGGGCCGCNONE 
J065183O06TCATGGGCCGCNONE 
J090013C07TCATGGGCCGCNONE 
J090081F11TCATGGGCCGCNONE 
Os08g0314800AK065167GCGGCCCAGTNONE 
AK098867GCGGCCCAGTSimilar to Poly(A)-binding protein. 
Os08g0328300AK102227GCGGCCCAAGNONE 
AK105392GCGGCCCAAGENT domain containing protein. 
Os08g0375800AK101199AGCCCAACGCGGCCCAGCProtein prenyltransferase domain containing protein. 
J033030L22AGCCCAACGCGGCCCAGCNONE 
Os08g0414200AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
J033048B10TGCGGCCCACCAGCCCACCACNONE 
J033071G24TGCGGCCCACCAGCCCACCACNONE 
J033107O17TGCGGCCCACCAGCCCACCACNONE 
Os08g0441400011-033-F01ATTTGGGCCGCANONE 
015-084-B04ATTTGGGCCGCANONE 
AK063317ATTTGGGCCGCANONE 
AK064141ATTTGGGCCGCAConserved hypothetical protein. 
J065060F06ATTTGGGCCGCANONE 
J075110A22ATTTGGGCCGCANONE 
J080307P11ATTTGGGCCGCANONE 
J090041E06ATTTGGGCCGCANONE 
Os08g0495300Os08g0495300GCGGCCCATAConserved hypothetical protein. 
Os08g0517600009-066-H05GCGGCCCACCTNONE 
AK073374GCGGCCCACCTNONE 
AK105385GCGGCCCACCTSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07GCGGCCCACCTNONE 
J075004A12GCGGCCCACCTNONE 
J075062F16GCGGCCCACCTNONE 
J075115K05GCGGCCCACCTNONE 
J075116H09GCGGCCCACCTNONE 
Os08g0535400004-001-H10GCGGCCCATGANONE 
AK071527GCGGCCCATGAZinc finger, DHHC-type domain containing protein. 
J023107B02GCGGCCCATGANONE 
Os08g0547000AK120698GCGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0554000AK111661CATGGGCCGCAWD-40 repeat containing protein. 
AK111661TGCGGCCCATATWD-40 repeat containing protein. 
AK112044CATGGGCCGCANONE 
AK112044TGCGGCCCATATNONE 
J013039N12CATGGGCCGCANONE 
J013039N12TGCGGCCCATATNONE 
J013134D02CATGGGCCGCANONE 
J013134D02TGCGGCCCATATNONE 
J013153B06CATGGGCCGCANONE 
J013153B06TGCGGCCCATATNONE 
J033044L16CATGGGCCGCANONE 
J033044L16TGCGGCCCATATNONE 
J033073P14CATGGGCCGCANONE 
J033073P14TGCGGCCCATATNONE 
Os08g0558400AK071334GGTTGGGCCGCAGCCCACAASimilar to Kinesin heavy chain (Fragment). 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0240500009-064-F01TATTGGGCCGCNONE 
009-169-F01TATTGGGCCGCNONE 
AK062192TATTGGGCCGCNONE 
Os09g0324300AK109691TTATGGGCCGCCGTGGGCTTTCyclin-like F-box domain containing protein. 
Os09g0325100J080009O19GCGGCCCAGCCNONE 
J080011H14GCGGCCCAGCCConserved hypothetical protein. 
J080014F14GCGGCCCAGCCNONE 
J080014M09GCGGCCCAGCCNONE 
J080014N20GCGGCCCAGCCNONE 
J080018K13GCGGCCCAGCCNONE 
J080023C08GCGGCCCAGCCNONE 
J080023C09GCGGCCCAGCCNONE 
J080023K14GCGGCCCAGCCNONE 
J080025I09GCGGCCCAGCCNONE 
J080030J04GCGGCCCAGCCNONE 
J080039D08GCGGCCCAGCCNONE 
J080039L17GCGGCCCAGCCNONE 
J080041B13GCGGCCCAGCCNONE 
J080041P21GCGGCCCAGCCNONE 
J080042J21GCGGCCCAGCCNONE 
J080042L19GCGGCCCAGCCNONE 
J080045F07GCGGCCCAGCCNONE 
J080047B10GCGGCCCAGCCNONE 
J080051F23GCGGCCCAGCCNONE 
J080053D15GCGGCCCAGCCNONE 
J080053K02GCGGCCCAGCCNONE 
J080058K18GCGGCCCAGCCNONE 
J080061M13GCGGCCCAGCCNONE 
J080064M24GCGGCCCAGCCNONE 
J080067H07GCGGCCCAGCCNONE 
J080080B21GCGGCCCAGCCNONE 
J080080D18GCGGCCCAGCCNONE 
J080082G07GCGGCCCAGCCNONE 
J080088B01GCGGCCCAGCCNONE 
J080088E09GCGGCCCAGCCNONE 
J080093L01GCGGCCCAGCCNONE 
Os09g0325300011-005-H08GCGGCCCAGGNONE 
AK068435GCGGCCCAGGConserved hypothetical protein. 
AK073998GCGGCCCAGGNONE 
J033071H21GCGGCCCAGGNONE 
J065214H05GCGGCCCAGGNONE 
Os09g0332100009-067-H06ACATGGGCCGCNONE 
009-092-B11ACATGGGCCGCNONE 
009-094-D10ACATGGGCCGCNONE 
009-095-C09ACATGGGCCGCNONE 
009-147-F07ACATGGGCCGCNONE 
AK069759ACATGGGCCGCConserved hypothetical protein. 
J080092G16ACATGGGCCGCNONE 
J090053I07ACATGGGCCGCNONE 
Os09g0347900AK071224TGCGGCCCATTAConserved hypothetical protein. 
J023087B12TGCGGCCCATTANONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0406900012-044-F05GCGGCCCAGANONE 
AK063485GCGGCCCAGANONE 
AK067460GCGGCCCAGAConserved hypothetical protein. 
Os09g0421700AK108547GCGGCCCAAZinc finger, C2H2-type domain containing protein. 
J053037L19GCGGCCCAANONE 
J065008J09GCGGCCCAANONE 
J065090B09GCGGCCCAANONE 
J065212K02GCGGCCCAANONE 
Os09g0424600AK073882TATGGGCCGCAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
AK073882TTATGGGCCGCAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0464000AK060777TGCGGCCCATGNONE 
AK069530TGCGGCCCATGSimilar to Carbonate dehydratase-like protein. 
Os09g0467700AK061600GCGGCCCAATConserved hypothetical protein. 
AK061600TGCGGCCCATTAConserved hypothetical protein. 
Os09g0477700AK121644AGATGGGCCGCConserved hypothetical protein. 
Os09g0482860006-045-G12GCGTGGGCCGCCCAACTNONE 
AK071910GCGTGGGCCGCCCAACTNONE 
AK099026GCGTGGGCCGCCCAACTNONE 
AK105917GCGTGGGCCGCCCAACTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013127L05GCGTGGGCCGCCCAACTNONE 
J065102M20GCGTGGGCCGCCCAACTNONE 
J065119M08GCGTGGGCCGCCCAACTNONE 
Os09g0538700Os09g0538700GCGGCCCACGCCCAATAGlutelin family protein. 
Os09g0552300AK111721GCGGCCCATTTProtein kinase-like domain containing protein. 
J043013E21GCGGCCCATTTNONE 
Os09g0567700AK065913ATCTGGGCCGCWD40-like domain containing protein. 
Os11g0104400D78505TGCGGCCCATCCASimilar to W-3 fatty acid desaturase (Fragment). 
J013109G14TGCGGCCCATCCANONE 
J075027J03TGCGGCCCATCCANONE 
J090006L16TGCGGCCCATCCANONE 
J090021A01TGCGGCCCATCCANONE 
J090049M01TGCGGCCCATCCANONE 
J090084O20TGCGGCCCATCCANONE 
Os11g0116400AK059833TGATGGGCCGCSimilar to Elongation factor P (EF-P). 
Os11g0128400AK102291TGCGGCCCAAGCDC45-like protein family protein. 
J033089K18TGCGGCCCAAGNONE 
Os11g0146700AK065900GCGGCCCAGCNONE 
AK072412GCGGCCCAGCRED-like, C-terminal family protein. 
Os11g0162200009-059-H04GCGGCCCAGCCNONE 
AK060396GCGGCCCAGCCSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11GCGGCCCAGCCNONE 
J065105K09GCGGCCCAGCCNONE 
J075024G12GCGGCCCAGCCNONE 
J075040K04GCGGCCCAGCCNONE 
J075066D13GCGGCCCAGCCNONE 
J075108A11GCGGCCCAGCCNONE 
J100031D04GCGGCCCAGCCNONE 
J100060O05GCGGCCCAGCCNONE 
J100075M22GCGGCCCAGCCNONE 
Os11g0167300AK071335TAATGGGCCGCProtein of unknown function DUF537 family protein. 
AK101314TAATGGGCCGCNONE 
Os11g0184900011-088-C07GCGGCCCAGCCCAGCNONE 
011-088-C07TGCGGCCCAGGCCCACGCNONE 
015-036-B03GCGGCCCAGCCCAGCNONE 
015-036-B03TGCGGCCCAGGCCCACGCNONE 
016-087-F07GCGGCCCAGCCCAGCNONE 
016-087-F07TGCGGCCCAGGCCCACGCNONE 
AB028184GCGGCCCAGCCCAGCNONE 
AB028184TGCGGCCCAGGCCCACGCNONE 
AK063399GCGGCCCAGCCCAGCSimilar to NAC-domain protein 5-7. 
AK063399TGCGGCCCAGGCCCACGCSimilar to NAC-domain protein 5-7. 
AK064292GCGGCCCAGCCCAGCNONE 
AK064292TGCGGCCCAGGCCCACGCNONE 
AK102475GCGGCCCAGCCCAGCNONE 
AK102475TGCGGCCCAGGCCCACGCNONE 
J033094I01GCGGCCCAGCCCAGCNONE 
J033094I01TGCGGCCCAGGCCCACGCNONE 
J090087J16GCGGCCCAGCCCAGCNONE 
J090087J16TGCGGCCCAGGCCCACGCNONE 
Os11g0219400AK069850GCGGCCCAGAAnkyrin repeat containing protein. 
AK099123GCGGCCCAGANONE 
J023143G18GCGGCCCAGANONE 
Os11g0227600AK101375TTGTGGGCCGCAConserved hypothetical protein. 
AK102193TTGTGGGCCGCANONE 
J033087C03TTGTGGGCCGCANONE 
Os11g0640000Os11g0640000GCGGCCCAATTNB-ARC domain containing protein. 
Os11g0660000AK066709GCGGCCCAAGSodium/calcium exchanger membrane region domain containing protein. 
J013074O18GCGGCCCAAGNONE 
J023081H12GCGGCCCAAGNONE 
J065072E24GCGGCCCAAGNONE 
J065186K08GCGGCCCAAGNONE 
J075079E19GCGGCCCAAGNONE 
J075093J05GCGGCCCAAGNONE 
J075124I21GCGGCCCAAGNONE 
J075187F09GCGGCCCAAGNONE 
J090037O16GCGGCCCAAGNONE 
Os11g0660500009-031-D10GCGGCCCAGATNONE 
009-100-G09GCGGCCCAGATNONE 
009-162-G10GCGGCCCAGATNONE 
009-183-H11GCGGCCCAGATNONE 
013-010-B11GCGGCCCAGATNONE 
013-050-A05GCGGCCCAGATNONE 
013-070-E10GCGGCCCAGATNONE 
AK105453GCGGCCCAGATSimilar to Translationally controlled tumor protein (Fragment). 
D12626GCGGCCCAGATNONE 
J013128M15GCGGCCCAGATNONE 
J023004I19GCGGCCCAGATNONE 
J033114F08GCGGCCCAGATNONE 
J033147I20GCGGCCCAGATNONE 
J065031M04GCGGCCCAGATNONE 
J065033J03GCGGCCCAGATNONE 
J065038E01GCGGCCCAGATNONE 
J065048O06GCGGCCCAGATNONE 
J065054E01GCGGCCCAGATNONE 
J065075N08GCGGCCCAGATNONE 
J065080C07GCGGCCCAGATNONE 
J065096A12GCGGCCCAGATNONE 
J065115P22GCGGCCCAGATNONE 
J065122I21GCGGCCCAGATNONE 
J065127A13GCGGCCCAGATNONE 
J065158B06GCGGCCCAGATNONE 
J065162E04GCGGCCCAGATNONE 
J065162E05GCGGCCCAGATNONE 
J065163L06GCGGCCCAGATNONE 
J065177B16GCGGCCCAGATNONE 
J065181M15GCGGCCCAGATNONE 
J065201G15GCGGCCCAGATNONE 
J065202J06GCGGCCCAGATNONE 
J075002B19GCGGCCCAGATNONE 
J075008G19GCGGCCCAGATNONE 
J075010P05GCGGCCCAGATNONE 
J075018H23GCGGCCCAGATNONE 
J075051E18GCGGCCCAGATNONE 
J075053C24GCGGCCCAGATNONE 
J075077B06GCGGCCCAGATNONE 
J075080B11GCGGCCCAGATNONE 
J075083M04GCGGCCCAGATNONE 
J075085H01GCGGCCCAGATNONE 
J075109E11GCGGCCCAGATNONE 
J075111O09GCGGCCCAGATNONE 
J075130D13GCGGCCCAGATNONE 
J075132H13GCGGCCCAGATNONE 
J075147H19GCGGCCCAGATNONE 
J075148J01GCGGCCCAGATNONE 
J075159A18GCGGCCCAGATNONE 
J075166F03GCGGCCCAGATNONE 
J075191F09GCGGCCCAGATNONE 
J075192K09GCGGCCCAGATNONE 
J080006P15GCGGCCCAGATNONE 
J080013J18GCGGCCCAGATNONE 
J080023O06GCGGCCCAGATNONE 
J080024I17GCGGCCCAGATNONE 
J080029P03GCGGCCCAGATNONE 
J080030C14GCGGCCCAGATNONE 
J080038K15GCGGCCCAGATNONE 
J080042I15GCGGCCCAGATNONE 
J080053L07GCGGCCCAGATNONE 
J080061H12GCGGCCCAGATNONE 
J080064H24GCGGCCCAGATNONE 
J080066J20GCGGCCCAGATNONE 
J080074N07GCGGCCCAGATNONE 
J080079F16GCGGCCCAGATNONE 
J080079O07GCGGCCCAGATNONE 
J080092E15GCGGCCCAGATNONE 
J080301F19GCGGCCCAGATNONE 
J080302O21GCGGCCCAGATNONE 
J080306L02GCGGCCCAGATNONE 
J080307F16GCGGCCCAGATNONE 
J080307G01GCGGCCCAGATNONE 
J080307K01GCGGCCCAGATNONE 
J080309O22GCGGCCCAGATNONE 
J080311E17GCGGCCCAGATNONE 
J080311N08GCGGCCCAGATNONE 
J080312O12GCGGCCCAGATNONE 
J080315C08GCGGCCCAGATNONE 
J080316D07GCGGCCCAGATNONE 
J080318C17GCGGCCCAGATNONE 
J090004B08GCGGCCCAGATNONE 
J090009K02GCGGCCCAGATNONE 
J090025O15GCGGCCCAGATNONE 
J090026L03GCGGCCCAGATNONE 
J090036P17GCGGCCCAGATNONE 
J090047A21GCGGCCCAGATNONE 
J090053O03GCGGCCCAGATNONE 
J090059C04GCGGCCCAGATNONE 
J090062O21GCGGCCCAGATNONE 
J090064M11GCGGCCCAGATNONE 
J090070C14GCGGCCCAGATNONE 
J090075I03GCGGCCCAGATNONE 
J090081G22GCGGCCCAGATNONE 
J090083E18GCGGCCCAGATNONE 
J090084A05GCGGCCCAGATNONE 
J100019L11GCGGCCCAGATNONE 
J100022D16GCGGCCCAGATNONE 
J100042F09GCGGCCCAGATNONE 
J100051J12GCGGCCCAGATNONE 
J100065G21GCGGCCCAGATNONE 
J100066D08GCGGCCCAGATNONE 
J100069H04GCGGCCCAGATNONE 
J100078I16GCGGCCCAGATNONE 
J100090D15GCGGCCCAGATNONE 
Os12g0111600009-151-A07GCGGCCCACAANONE 
AK119685GCGGCCCACAANONE 
AK120264GCGGCCCACAAHypoxia induced protein conserved region family protein. 
J013047D01GCGGCCCACAANONE 
J023111D22GCGGCCCACAANONE 
J023128C07GCGGCCCACAANONE 
J065170J03GCGGCCCACAANONE 
J065198L01GCGGCCCACAANONE 
J100037I18GCGGCCCACAANONE 
J100073O19GCGGCCCACAANONE 
Os12g0112250J013069O10TATTGGGCCGCASaposin B domain containing protein. 
J065206G04TATTGGGCCGCANONE 
J080302C06TATTGGGCCGCANONE 
J080306K06TATTGGGCCGCANONE 
J080307O09TATTGGGCCGCANONE 
J080310J07TATTGGGCCGCANONE 
J080311G18TATTGGGCCGCANONE 
J080318C07TATTGGGCCGCANONE 
Os12g0124700AK073156TGCGGCCCAAGCDC45-like protein family protein. 
AK073156TGCGGCCCATGTCDC45-like protein family protein. 
J090013O22TGCGGCCCAAGNONE 
J090013O22TGCGGCCCATGTNONE 
Os12g0133600AK103096TATTGGGCCGCAConserved hypothetical protein. 
J033118M03TATTGGGCCGCANONE 
Os12g0223300006-037-D03GCGGCCCATGTNONE 
AJ429043GCGGCCCATGTNONE 
AK060133GCGGCCCATGTSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GCGGCCCATGTNONE 
J065085K05GCGGCCCATGTNONE 
J075053C01GCGGCCCATGTNONE 
J075055O06GCGGCCCATGTNONE 
J075073B01GCGGCCCATGTNONE 
J075089M07GCGGCCCATGTNONE 
J075095E16GCGGCCCATGTNONE 
J075112O19GCGGCCCATGTNONE 
J075143A11GCGGCCCATGTNONE 
J075173D24GCGGCCCATGTNONE 
J075199G18GCGGCCCATGTNONE 
J090030N06GCGGCCCATGTNONE 
J100052H12GCGGCCCATGTNONE 
J100079F09GCGGCCCATGTNONE 
Os12g0406200004-006-C10GCGGCCCATCTNONE 
AK071037GCGGCCCATCTSimilar to 40S ribosomal protein S3a (CYC07 protein). 
Os12g0527500AK109836GCGGCCCACCACCyclin-like F-box domain containing protein. 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0572400016-084-F04GCAGCCCAAACATATGGGCCGCANONE 
AK065531GCAGCCCAAACATATGGGCCGCASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03GCAGCCCAAACATATGGGCCGCANONE 
J013034H02GCAGCCCAAACATATGGGCCGCANONE 
J033117N05GCAGCCCAAACATATGGGCCGCANONE 
J065027L09GCAGCCCAAACATATGGGCCGCANONE 
J065037D09GCAGCCCAAACATATGGGCCGCANONE 
J065197I09GCAGCCCAAACATATGGGCCGCANONE 
J090045C01GCAGCCCAAACATATGGGCCGCANONE 
J100031E11GCAGCCCAAACATATGGGCCGCANONE 
Os12g0615300AK119448AAATGGGCCGCAEGF-like calcium-binding domain containing protein. 
AK119448TATTGGGCCGCAEGF-like calcium-binding domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.