version

Summary of OsREG619 (All List)

OrganismOryza sativa  
IDOsREG619  
SequenceGCGGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count731  

Entry Sequences (731 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein. 
J013000E05CACGTGGGGCCCGCANONE 
J013027D08CACGTGGGGCCCGCANONE 
J013045K12CACGTGGGGCCCGCANONE 
J023119M03CACGTGGGGCCCGCANONE 
J065081F02CACGTGGGGCCCGCANONE 
J065180C08CACGTGGGGCCCGCANONE 
J065211M06CACGTGGGGCCCGCANONE 
J075073J06CACGTGGGGCCCGCANONE 
J075123A18CACGTGGGGCCCGCANONE 
J075124A07CACGTGGGGCCCGCANONE 
J075187B05CACGTGGGGCCCGCANONE 
Os01g0144600006-037-H02TGTGGGCCCGCACGCCACNONE 
AK061501TGTGGGCCCGCACGCCACConserved hypothetical protein. 
AK102823TGTGGGCCCGCACGCCACNONE 
J033108P10TGTGGGCCCGCACGCCACNONE 
J043026K08TGTGGGCCCGCACGCCACNONE 
J090009H21TGTGGGCCCGCACGCCACNONE 
Os01g0185200009-146-B06GCGGGCCCACACNONE 
009-163-F01GCGGGCCCACACNONE 
AK062984GCGGGCCCACACNONE 
AK065125GCGGGCCCACACGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222GCGGGCCCACACNONE 
AK111284GCGGGCCCACACNONE 
Os01g0211600AK060710GGGCCCGCCytochrome P450 family protein. 
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein. 
J065013K07GCGGGCCCACTTGTCAGTGNONE 
J065040E15GCGGGCCCACTTGTCAGTGNONE 
J065127F12GCGGGCCCACTTGTCAGTGNONE 
J075155K23GCGGGCCCACTTGTCAGTGNONE 
Os01g0286000AK109824TGCGGGCCCSnf7 family protein. 
Os01g0331100J090084H20GGGGCCCGCCCACTCCNONE 
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J023041L20GCGGGCCCATGGGCCATNONE 
J043003M03GCGGGCCCATGGGCCATNONE 
J075094C04GCGGGCCCATGGGCCATNONE 
J090026M16GCGGGCCCATGGGCCATNONE 
J100023F23GCGGGCCCATGGGCCATNONE 
Y11189GCGGGCCCATGGGCCATNONE 
Os01g0580300AK063468GCGGGCCCCACCTGTCConserved hypothetical protein. 
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE 
AJ251563TGCGGGCCCCACTGACAGNONE 
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel. 
AK104055TGCGGGCCCCACTGACAGNONE 
AK104419TGCGGGCCCCACTGACAGNONE 
J023057A07TGCGGGCCCCACTGACAGNONE 
J023068C08TGCGGGCCCCACTGACAGNONE 
J023148E24TGCGGGCCCCACTGACAGNONE 
J090045O22TGCGGGCCCCACTGACAGNONE 
J090045P03TGCGGGCCCCACTGACAGNONE 
J090050C18TGCGGGCCCCACTGACAGNONE 
J100023F01TGCGGGCCCCACTGACAGNONE 
J100051I18TGCGGGCCCCACTGACAGNONE 
J100060P17TGCGGGCCCCACTGACAGNONE 
Os01g0612600004-008-D07TGCGGGCCCCACTGACNONE 
009-057-C09TGCGGGCCCCACTGACNONE 
009-130-C01TGCGGGCCCCACTGACNONE 
AK062906TGCGGGCCCCACTGACNONE 
AK066561TGCGGGCCCCACTGACProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCCCACTGACNONE 
J013073D14TGCGGGCCCCACTGACNONE 
J023014A21TGCGGGCCCCACTGACNONE 
J023073M13TGCGGGCCCCACTGACNONE 
J023079F02TGCGGGCCCCACTGACNONE 
J023083B16TGCGGGCCCCACTGACNONE 
J023090G19TGCGGGCCCCACTGACNONE 
J023095F15TGCGGGCCCCACTGACNONE 
J023119H11TGCGGGCCCCACTGACNONE 
J033040B01TGCGGGCCCCACTGACNONE 
J033044F13TGCGGGCCCCACTGACNONE 
J033081E23TGCGGGCCCCACTGACNONE 
J033121K07TGCGGGCCCCACTGACNONE 
J033124D11TGCGGGCCCCACTGACNONE 
J033131N22TGCGGGCCCCACTGACNONE 
J065179E10TGCGGGCCCCACTGACNONE 
J090020A13TGCGGGCCCCACTGACNONE 
J090045K17TGCGGGCCCCACTGACNONE 
J090047M24TGCGGGCCCCACTGACNONE 
J090064G23TGCGGGCCCCACTGACNONE 
J090084G08TGCGGGCCCCACTGACNONE 
J090086F18TGCGGGCCCCACTGACNONE 
J100032D09TGCGGGCCCCACTGACNONE 
J100037O18TGCGGGCCCCACTGACNONE 
J100042B03TGCGGGCCCCACTGACNONE 
J100061D06TGCGGGCCCCACTGACNONE 
J100061I03TGCGGGCCCCACTGACNONE 
J100063B17TGCGGGCCCCACTGACNONE 
Os01g0616600009-171-H09GGGCCCGCNONE 
011-005-G09GGGCCCGCNONE 
012-089-C03GGGCCCGCNONE 
AK063911GGGCCCGCProtein prenyltransferase domain containing protein. 
AK101490GGGCCCGCNONE 
Os01g0645000AK108658GCGGGCCCCACGSimilar to TIS11 protein (dTIS11). 
Os01g0658500AK058491GCGGGCCCAACProtein of unknown function DUF852, eukaryotic family protein. 
AK069050GCGGGCCCAACNONE 
J043036P22GCGGGCCCAACNONE 
Os01g0667900013-097-A02GCGGGCCCCCACGGTGACGTCACCNONE 
013-097-A02GCGTCGCGCGGGCCCCACCNONE 
014-011-C01GCGGGCCCCCACGGTGACGTCACCNONE 
014-011-C01GCGTCGCGCGGGCCCCACCNONE 
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein. 
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein. 
J065156F10GCGGGCCCCCACGGTGACGTCACCNONE 
J065156F10GCGTCGCGCGGGCCCCACCNONE 
J065163D22GCGGGCCCCCACGGTGACGTCACCNONE 
J065163D22GCGTCGCGCGGGCCCCACCNONE 
J065197J04GCGGGCCCCCACGGTGACGTCACCNONE 
J065197J04GCGTCGCGCGGGCCCCACCNONE 
J075122C02GCGGGCCCCCACGGTGACGTCACCNONE 
J075122C02GCGTCGCGCGGGCCCCACCNONE 
J100047L16GCGGGCCCCCACGGTGACGTCACCNONE 
J100047L16GCGTCGCGCGGGCCCCACCNONE 
Os01g0672400AK060901GGGGCCCGCNONE 
AK061329GGGGCCCGCDrought induced 19 family protein. 
AK101922GGGGCCCGCNONE 
Os01g0673500AK065017GCGGGCCCSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK069899GCGGGCCCNONE 
Os01g0678600AK071536GCGGGCCCGCNONE 
Os01g0688200AK120982GCGGGCCCACAAlpha/beta hydrolase family protein. 
Os01g0707300AK059962TGCGGGCCCACCTNONE 
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0725100J075035B02CTTGGGCCCGCANONE 
Os01g0730300AK101207GGTGGGGCGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GGTGGGGCGGGCCCCNONE 
Os01g0757400AB110177GCGGGCCCCACCAACNONE 
AK058626GCGGGCCCCACCAACNONE 
AK102585GCGGGCCCCACCAACNONE 
AK105474GCGGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
J033098E22GCGGGCCCCACCAACNONE 
J033105O19GCGGGCCCCACCAACNONE 
J065019C21GCGGGCCCCACCAACNONE 
J090082H11GCGGGCCCCACCAACNONE 
J100050B19GCGGGCCCCACCAACNONE 
J100078H19GCGGGCCCCACCAACNONE 
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein. 
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein. 
Os01g0798500006-106-C11CTGGGGCCCGCANONE 
AK061244CTGGGGCCCGCANONE 
AK068219CTGGGGCCCGCAMalate synthase-like family protein. 
J065199O16CTGGGGCCCGCANONE 
Os01g0835500AK100241GCGGGCCCACTSimilar to Respiratory burst oxidase protein. 
Os01g0918200009-034-H02GCGGGCCCACTNONE 
AK062434GCGGGCCCACTSimilar to Ubiquitin-like protein SMT3. 
AK103092GCGGGCCCACTNONE 
J065093P18GCGGGCCCACTNONE 
J065137C15GCGGGCCCACTNONE 
J065156G01GCGGGCCCACTNONE 
J065206H16GCGGGCCCACTNONE 
J065209D03GCGGGCCCACTNONE 
J075073K05GCGGGCCCACTNONE 
J075099B17GCGGGCCCACTNONE 
J075166N04GCGGGCCCACTNONE 
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase. 
Os02g0163600AK068043AACGGGCCCGCConserved hypothetical protein. 
J013131O20AACGGGCCCGCNONE 
J065006E03AACGGGCCCGCNONE 
Os02g0198200J075078L15CGTGGGGCCCGCANONE 
J075097G10CGTGGGGCCCGCANONE 
J075099N12CGTGGGGCCCGCANONE 
J075142K24CGTGGGGCCCGCANONE 
J075199K14CGTGGGGCCCGCANONE 
Os02g0316200AK073932GTGTGGGGGCCCGCACyclin-like F-box domain containing protein. 
AK105757GTGTGGGGGCCCGCANONE 
J023039G03GTGTGGGGGCCCGCANONE 
J033076K03GTGTGGGGGCCCGCANONE 
J075157J22GTGTGGGGGCCCGCANONE 
J090097K02GTGTGGGGGCCCGCANONE 
J100053F10GTGTGGGGGCCCGCANONE 
Os02g0438700012-040-C07GCGGGCCCCACACNONE 
AK062610GCGGGCCCCACACNONE 
AK105276GCGGGCCCCACACConserved hypothetical protein. 
J065104J01GCGGGCCCCACACNONE 
Os02g0509500009-117-G07GGGGCCCGCGTGCGNONE 
009-122-G08GGGGCCCGCGTGCGNONE 
AK105187GGGGCCCGCGTGCGConserved hypothetical protein. 
J065025C04GGGGCCCGCGTGCGNONE 
J065030F10GGGGCCCGCGTGCGNONE 
J065112P22GGGGCCCGCGTGCGNONE 
J065116I22GGGGCCCGCGTGCGNONE 
J065127F24GGGGCCCGCGTGCGNONE 
J065176E11GGGGCCCGCGTGCGNONE 
J065186F02GGGGCCCGCGTGCGNONE 
J075041F12GGGGCCCGCGTGCGNONE 
J075118L20GGGGCCCGCGTGCGNONE 
J075181D20GGGGCCCGCGTGCGNONE 
J090023P12GGGGCCCGCGTGCGNONE 
Os02g0510100AK058487ATCTGGGCCCGCNONE 
AK122107ATCTGGGCCCGCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06ATCTGGGCCCGCNONE 
J053077L04ATCTGGGCCCGCNONE 
J065010C11ATCTGGGCCCGCNONE 
J075104O14ATCTGGGCCCGCNONE 
J080003G03ATCTGGGCCCGCNONE 
J080014K05ATCTGGGCCCGCNONE 
J080026F03ATCTGGGCCCGCNONE 
J080027O05ATCTGGGCCCGCNONE 
J080037K15ATCTGGGCCCGCNONE 
J080039D24ATCTGGGCCCGCNONE 
J080043G19ATCTGGGCCCGCNONE 
J080047P05ATCTGGGCCCGCNONE 
J080048D22ATCTGGGCCCGCNONE 
J080049F23ATCTGGGCCCGCNONE 
J080062A21ATCTGGGCCCGCNONE 
J080063H20ATCTGGGCCCGCNONE 
J080067P15ATCTGGGCCCGCNONE 
J080068P19ATCTGGGCCCGCNONE 
J080079J15ATCTGGGCCCGCNONE 
J080092K19ATCTGGGCCCGCNONE 
J080096M04ATCTGGGCCCGCNONE 
Os02g0521300AK120851GGGGCCCGCC2 domain containing protein. 
Os02g0625500011-025-C06CCCGGGCCCGCANONE 
AB050624CCCGGGCCCGCANONE 
AK059188CCCGGGCCCGCANONE 
AK059771CCCGGGCCCGCANONE 
AK101791CCCGGGCCCGCASimilar to Adenosine kinase-like protein (Fragment). 
AY224510CCCGGGCCCGCANONE 
J013152H02CCCGGGCCCGCANONE 
J023012P09CCCGGGCCCGCANONE 
J023127D16CCCGGGCCCGCANONE 
J033024G01CCCGGGCCCGCANONE 
J033025L19CCCGGGCCCGCANONE 
J033080M04CCCGGGCCCGCANONE 
J033101A08CCCGGGCCCGCANONE 
J033121L12CCCGGGCCCGCANONE 
J043017N15CCCGGGCCCGCANONE 
J065207J01CCCGGGCCCGCANONE 
J090049G12CCCGGGCCCGCANONE 
J100036A07CCCGGGCCCGCANONE 
J100076C04CCCGGGCCCGCANONE 
J100080N22CCCGGGCCCGCANONE 
Os02g0658500AK120166ACCGGGCCCGCATGTCAGTGNONE 
Os02g0672600AK070286TATTGGGCCCGCSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174TATTGGGCCCGCNONE 
Os02g0708100AK059630TCGTGGGCCCGCNONE 
AK102055TCGTGGGCCCGCSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5). 
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0731700AK072346AGTGGGCCCGCSimilar to CONSTANS-like 1 protein. 
AK120314AGTGGGCCCGCNONE 
Os02g0773300AK071811GGGGCCCGCPyridoxal phosphate-dependent deaminase family protein. 
J013056D10GGGGCCCGCNONE 
J013096G18GGGGCCCGCNONE 
Os02g0778200AK065948GCGGGCCCCAGAminoacyl-tRNA synthetase, class I family protein. 
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE 
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa. 
AK103235GCGGGCCCCACGTGTCNONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0181500AK100798CCTGGGCCCGCNONE 
Os03g0184600AK065264CTTGGGCCCGCNAD-dependent epimerase/dehydratase family protein. 
Os03g0206400AK066494CCCGGGCCCGCAConserved hypothetical protein. 
AK066494GGGTGGGCCCGCConserved hypothetical protein. 
AK107011CCCGGGCCCGCANONE 
AK107011GGGTGGGCCCGCNONE 
J065162G04CCCGGGCCCGCANONE 
J065162G04GGGTGGGCCCGCNONE 
Os03g0268300AK102684TGCGGGCCCCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TGCGGGCCCCNONE 
J013057J23TGCGGGCCCCNONE 
J013149I10TGCGGGCCCCNONE 
J013149M20TGCGGGCCCCNONE 
J013151D14TGCGGGCCCCNONE 
J013162O11TGCGGGCCCCNONE 
J023001F12TGCGGGCCCCNONE 
J023031B21TGCGGGCCCCNONE 
J023080A07TGCGGGCCCCNONE 
J023081N04TGCGGGCCCCNONE 
J023090C08TGCGGGCCCCNONE 
J023134G05TGCGGGCCCCNONE 
J023139G17TGCGGGCCCCNONE 
J023143I10TGCGGGCCCCNONE 
J023147D04TGCGGGCCCCNONE 
J023147O15TGCGGGCCCCNONE 
J033102K23TGCGGGCCCCNONE 
J033106C17TGCGGGCCCCNONE 
J075033G19TGCGGGCCCCNONE 
J075039J18TGCGGGCCCCNONE 
J075050K20TGCGGGCCCCNONE 
J075075J03TGCGGGCCCCNONE 
J075080E16TGCGGGCCCCNONE 
J075086L08TGCGGGCCCCNONE 
J075091K19TGCGGGCCCCNONE 
J075099O20TGCGGGCCCCNONE 
J075104I06TGCGGGCCCCNONE 
J075137C16TGCGGGCCCCNONE 
J075152G03TGCGGGCCCCNONE 
J075176N12TGCGGGCCCCNONE 
J100086K11TGCGGGCCCCNONE 
Os03g0271500AK068546GCGGGCCCACCCACCGCACGCGNONE 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
J013157P04GCGGGCCCACCCACCGCACGCGNONE 
J075041K23GCGGGCCCACCCACCGCACGCGNONE 
Os03g0278200AK103544GCGGGCCCCACCACNAD-dependent epimerase/dehydratase family protein. 
Os03g0287900009-074-B07GCGGGCCCCACGTNONE 
014-027-E07GCGGGCCCCACGTNONE 
AK063663GCGGGCCCCACGTSimilar to Protein disulfide isomerase. 
J065009N21GCGGGCCCCACGTNONE 
Os03g0288400Os03g0288400GCGGGCCCACCAConserved hypothetical protein. 
Os03g0293500015-054-D06GCGGGCCCCANONE 
AK101594GCGGGCCCCASimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC) (Fragment). 
AK119500GCGGGCCCCANONE 
J033051F01GCGGGCCCCANONE 
J090058D14GCGGGCCCCANONE 
J100037N18GCGGGCCCCANONE 
J100042J23GCGGGCCCCANONE 
J100053E20GCGGGCCCCANONE 
J100060G07GCGGGCCCCANONE 
U27350GCGGGCCCCANONE 
Os03g0295700AK067856GCGGGCCCGCConserved hypothetical protein. 
Os03g0302800AK061293GCGGGCCCCACCCCCCAConserved hypothetical protein. 
Os03g0588700Os03g0588700GCGGGCCCCACACConserved hypothetical protein. 
Os03g0659900AK067560GCGGGCCCCASimilar to S3 self-incompatibility locus-linked pollen 3.15 protein. 
J090029C14GCGGGCCCCANONE 
Os03g0666200AK102364GCGGGCCCACTCTPleckstrin homology-type domain containing protein. 
J033097E16GCGGGCCCACTCTNONE 
Os03g0669200J013037D23GCGGGCCCCACGTNONE 
J023026K09GCGGGCCCCACGTNONE 
J075008E21GCGGGCCCCACGTNONE 
J075061B21GCGGGCCCCACGTNONE 
J075151B13GCGGGCCCCACGTNONE 
J075195L02GCGGGCCCCACGTNONE 
J090061B07GCGGGCCCCACGTNONE 
Os03g0796800J065024O22TGTGGGCCCGCConserved hypothetical protein. 
Os03g0825700AK067902TGCGGGCCCCACASimilar to Defective in exine formation. 
Os03g0854000009-186-C03GCGGGCCCACCTNONE 
AK061374GCGGGCCCACCTProtein of unknown function UPF0131 family protein. 
J065138B11GCGGGCCCACCTNONE 
Os04g0128700AK107172TGCGGGCCCATTAThioredoxin-like fold domain containing protein. 
J065102M16TGCGGGCCCATTANONE 
J065124K01TGCGGGCCCATTANONE 
J065129I12TGCGGGCCCATTANONE 
J065192C08TGCGGGCCCATTANONE 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0382300AK071912TGCGGGCCCCACCNONE 
AK101795TGCGGGCCCCACCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0476400J033082D17GCGGGCCCCNONE 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0497000006-097-G07GCGGGCCCAGCNONE 
AK069136GCGGGCCCAGCNONE 
AK109382GCGGGCCCAGCSimilar to Allyl alcohol dehydrogenase. 
J023008C06GCGGGCCCAGCNONE 
J043007K16GCGGGCCCAGCNONE 
J065110K06GCGGGCCCAGCNONE 
J080012F02GCGGGCCCAGCNONE 
J080020N21GCGGGCCCAGCNONE 
J080026H09GCGGGCCCAGCNONE 
J080029D13GCGGGCCCAGCNONE 
J080034C08GCGGGCCCAGCNONE 
J080050J07GCGGGCCCAGCNONE 
Os04g0548000011-097-D07GGGGCCCGCNONE 
AK073099GGGGCCCGCNONE 
AK104979GGGGCCCGCProtein of unknown function DUF862, eukaryotic domain containing protein. 
J065102C18GGGGCCCGCNONE 
J075076A16GGGGCCCGCNONE 
J075082L09GGGGCCCGCNONE 
J075092L18GGGGCCCGCNONE 
J075092N01GGGGCCCGCNONE 
J075122P14GGGGCCCGCNONE 
J075148L06GGGGCCCGCNONE 
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
J033075E19GCCACGTGGGCCCGCACCGCNONE 
J033109O19GCCACGTGGGCCCGCACCGCNONE 
J065002J12GCCACGTGGGCCCGCACCGCNONE 
J065026E22GCCACGTGGGCCCGCACCGCNONE 
J065061F05GCCACGTGGGCCCGCACCGCNONE 
J065068D22GCCACGTGGGCCCGCACCGCNONE 
J065072N14GCCACGTGGGCCCGCACCGCNONE 
J065085F02GCCACGTGGGCCCGCACCGCNONE 
J075055G19GCCACGTGGGCCCGCACCGCNONE 
J075105B14GCCACGTGGGCCCGCACCGCNONE 
J075118M17GCCACGTGGGCCCGCACCGCNONE 
J075193H02GCCACGTGGGCCCGCACCGCNONE 
J100040O05GCCACGTGGGCCCGCACCGCNONE 
J100064I04GCCACGTGGGCCCGCACCGCNONE 
Os04g0674000006-093-C01GCGGGCCCACGCNONE 
009-040-F06GCGGGCCCACGCNONE 
AK071276GCGGGCCCACGCNONE 
AK109377GCGGGCCCACGCConserved hypothetical protein. 
AK119671GCGGGCCCACGCNONE 
J023084J11GCGGGCCCACGCNONE 
J023088F18GCGGGCCCACGCNONE 
J065099M12GCGGGCCCACGCNONE 
J065136J08GCGGGCCCACGCNONE 
J065167H22GCGGGCCCACGCNONE 
J075046L21GCGGGCCCACGCNONE 
J080029F17GCGGGCCCACGCNONE 
J080053C16GCGGGCCCACGCNONE 
J080053E24GCGGGCCCACGCNONE 
J080074D14GCGGGCCCACGCNONE 
J100029C12GCGGGCCCACGCNONE 
J100030D01GCGGGCCCACGCNONE 
J100044E16GCGGGCCCACGCNONE 
J100065N18GCGGGCCCACGCNONE 
J100077D18GCGGGCCCACGCNONE 
J100090P13GCGGGCCCACGCNONE 
Os04g0677033J100048A06CTTGGGCCCGCAConserved hypothetical protein. 
Os05g0116000AK058320CCACTGACATGCGGGCCCCACNONE 
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein. 
J023003L12CCACTGACATGCGGGCCCCACNONE 
J023025C18CCACTGACATGCGGGCCCCACNONE 
J023074E20CCACTGACATGCGGGCCCCACNONE 
J023128H09CCACTGACATGCGGGCCCCACNONE 
J033092N18CCACTGACATGCGGGCCCCACNONE 
J065009J09CCACTGACATGCGGGCCCCACNONE 
J090073L21CCACTGACATGCGGGCCCCACNONE 
Os05g0186300AK070360GCGGGCCCCCACSimilar to NADP-malic enzyme. 
AK099249GCGGGCCCCCACNONE 
AY435404GCGGGCCCCCACNONE 
J023006D11GCGGGCCCCCACNONE 
J023059P07GCGGGCCCCCACNONE 
Os05g0207700AK102665TGCGGGCCCACCCCCACTCCNONE 
AK103861TGCGGGCCCACCCCCACTCCSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os05g0242600016-092-A07CCCGTGGGGCCCGCNONE 
AK107430CCCGTGGGGCCCGCPrefoldin domain containing protein. 
J065218C11CCCGTGGGGCCCGCNONE 
Os05g0364300009-036-C07GGGCCCGCNONE 
AK062440GGGCCCGCConserved hypothetical protein. 
Os05g0408200AK100057GCGGGCCCACCCGSBP domain containing protein. 
AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein. 
J065182F20GCGGGCCCACCCGNONE 
J065182F20GCGGGCCCCACGCGCGACGCNONE 
Os05g0412800AF402803GCGGGCCCGCSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0429900AK066834GCGGGCCCACCACNONE 
AK099108GCGGGCCCACCACNONE 
AK104053GCGGGCCCACCACNONE 
D88617GCGGGCCCACCACSimilar to MybHv5 (Fragment). 
J090031E22GCGGGCCCACCACNONE 
Os05g0529300AK102648GCGGGCCCACGTSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06ACGTGGGCCCGCNONE 
AK063846ACGTGGGCCCGCConserved hypothetical protein. 
AK122038ACGTGGGCCCGCNONE 
J033113C01ACGTGGGCCCGCNONE 
Os05g0535900AK101539GGTGGGGCCCGCANONE 
AK101555GGTGGGGCCCGCAIQ calmodulin-binding region domain containing protein. 
J013047J05GGTGGGGCCCGCANONE 
Os06g0136900AK107405ACAGCCCAGCCCAGGGCCCGCProtein of unknown function DUF296 domain containing protein. 
Os06g0152400AK064640GCGGGCCCSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
J075086I24GCGGGCCCNONE 
J075127E23GCGGGCCCNONE 
J075157B19GCGGGCCCNONE 
J090038E06GCGGGCCCNONE 
Os06g0161800AK064664TGCGGGCCCACCTGTCProtein of unknown function DUF569 family protein. 
Os06g0215200AK065717GCGGGCCCACAZinc finger, U1-type domain containing protein. 
AK072439GCGGGCCCACANONE 
J013038O15GCGGGCCCACANONE 
J013075B08GCGGGCCCACANONE 
J013169N19GCGGGCCCACANONE 
J023034P11GCGGGCCCACANONE 
J023111C14GCGGGCCCACANONE 
J043013M01GCGGGCCCACANONE 
J043015L12GCGGGCCCACANONE 
J090011M08GCGGGCCCACANONE 
J090047D24GCGGGCCCACANONE 
J090056M10GCGGGCCCACANONE 
J090075G18GCGGGCCCACANONE 
J090079G14GCGGGCCCACANONE 
J100055M21GCGGGCCCACANONE 
J100058H23GCGGGCCCACANONE 
J100090A01GCGGGCCCACANONE 
J100090I21GCGGGCCCACANONE 
Os06g0229800AB115915GCGGGCCCCNONE 
AB115916GCGGGCCCCNONE 
AB115917GCGGGCCCCNONE 
AB115918GCGGGCCCCNONE 
AF419099GCGGGCCCCSimilar to Starch synthase IIA. 
AK101978GCGGGCCCCNONE 
Os06g0233000009-177-C07CAGGTGGGCCCGCNONE 
AK063118CAGGTGGGCCCGCConserved hypothetical protein. 
Os06g0258900AK067794GGGCCCGCAKetose-bisphosphate aldolase, class-II family protein. 
AK099384GGGCCCGCANONE 
Os06g0286351AK121119GCGGGCCCGCArmadillo-like helical domain containing protein. 
Os06g0589500AK073322CCCGGGCCCGCAConserved hypothetical protein. 
J033030G15CCCGGGCCCGCANONE 
J033148N18CCCGGGCCCGCANONE 
Os06g0603000AK068856GCGGGCCCACTNONE 
AK104955GCGGGCCCACTSimilar to Heme oxygenase 1 (Fragment). 
Os07g0124100014-015-G11GCGGGCCCACACNONE 
AJ276693GCGGGCCCACACPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GCGGGCCCACACNONE 
Os07g0166800006-038-C11TGCGGGCCCACCCACGGGNONE 
012-080-F02TGCGGGCCCACCCACGGGNONE 
AK070524TGCGGGCCCACCCACGGGRad6 (Ubiquitin carrier protein). 
AK121382TGCGGGCCCACCCACGGGNONE 
J023022D19TGCGGGCCCACCCACGGGNONE 
J023055G02TGCGGGCCCACCCACGGGNONE 
J023073E02TGCGGGCCCACCCACGGGNONE 
J023125B08TGCGGGCCCACCCACGGGNONE 
J023127H21TGCGGGCCCACCCACGGGNONE 
J033052G01TGCGGGCCCACCCACGGGNONE 
J033067F13TGCGGGCCCACCCACGGGNONE 
J065046L14TGCGGGCCCACCCACGGGNONE 
J065178D11TGCGGGCCCACCCACGGGNONE 
J065205N17TGCGGGCCCACCCACGGGNONE 
J075006K17TGCGGGCCCACCCACGGGNONE 
J075051D20TGCGGGCCCACCCACGGGNONE 
J075109L04TGCGGGCCCACCCACGGGNONE 
J090024K15TGCGGGCCCACCCACGGGNONE 
J090025N04TGCGGGCCCACCCACGGGNONE 
J090049N09TGCGGGCCCACCCACGGGNONE 
J090070N12TGCGGGCCCACCCACGGGNONE 
J090078O21TGCGGGCCCACCCACGGGNONE 
J090083L07TGCGGGCCCACCCACGGGNONE 
J100063K16TGCGGGCCCACCCACGGGNONE 
J100083D14TGCGGGCCCACCCACGGGNONE 
Os07g0185200AK066157CAGGTGGGCCCGCSimilar to Membrane related protein-like. 
Os07g0240400009-080-C04GCGGGCCCCACGAANONE 
AK062643GCGGGCCCCACGAAConserved hypothetical protein. 
Os07g0410300AK108503GCGGGCCCCACCGCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0552800AF435651GGGGCCCGCNONE 
AK066835GGGGCCCGCNONE 
J023009K24GGGGCCCGCNONE 
J023050L14GGGGCCCGCNONE 
J023092I02GGGGCCCGCNONE 
J023100P04GGGGCCCGCNONE 
J023112O13GGGGCCCGCNONE 
J023121J20GGGGCCCGCNONE 
Os07g0555400AK070977GCGGGCCCConserved hypothetical protein. 
Os07g0603100AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
J023077E09GCGGGCCCACACAGCCCACCACNONE 
J023081N15GCGGGCCCACACAGCCCACCACNONE 
J033022N22GCGGGCCCACACAGCCCACCACNONE 
J033024M18GCGGGCCCACACAGCCCACCACNONE 
J033034P09GCGGGCCCACACAGCCCACCACNONE 
J033046A06GCGGGCCCACACAGCCCACCACNONE 
J033051K01GCGGGCCCACACAGCCCACCACNONE 
J033081P09GCGGGCCCACACAGCCCACCACNONE 
J033091B17GCGGGCCCACACAGCCCACCACNONE 
J033092K23GCGGGCCCACACAGCCCACCACNONE 
J033132J09GCGGGCCCACACAGCCCACCACNONE 
J033144A14GCGGGCCCACACAGCCCACCACNONE 
J033145A14GCGGGCCCACACAGCCCACCACNONE 
J043021B20GCGGGCCCACACAGCCCACCACNONE 
J053024D23GCGGGCCCACACAGCCCACCACNONE 
J065212J10GCGGGCCCACACAGCCCACCACNONE 
J090055M05GCGGGCCCACACAGCCCACCACNONE 
J090065E14GCGGGCCCACACAGCCCACCACNONE 
J090092J06GCGGGCCCACACAGCCCACCACNONE 
Os07g0605200AF091458GCGGGCCCCANONE 
AF139665GCGGGCCCCANONE 
AJ011675GCGGGCCCCANONE 
AK064704GCGGGCCCCAMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15GCGGGCCCCANONE 
J090034M06GCGGGCCCCANONE 
J090079L24GCGGGCCCCANONE 
Os07g0608800AK059637TGTGGGCCCGCGTCTCSimilar to Peroxisome assembly protein 10 (Peroxin-10) (AthPEX10) (Pex10p) (PER8). 
Os07g0615900AK066317GCGGGCCCCAGZinc finger, GATA-type domain containing protein. 
AK073803GCGGGCCCCAGNONE 
J013026A07GCGGGCCCCAGNONE 
J013064I12GCGGGCCCCAGNONE 
J033068D01GCGGGCCCCAGNONE 
J033074A10GCGGGCCCCAGNONE 
J033129C06GCGGGCCCCAGNONE 
J100035K20GCGGGCCCCAGNONE 
J100044G13GCGGGCCCCAGNONE 
J100050K01GCGGGCCCCAGNONE 
J100069P20GCGGGCCCCAGNONE 
J100071O09GCGGGCCCCAGNONE 
J100086K01GCGGGCCCCAGNONE 
J100089G11GCGGGCCCCAGNONE 
Os07g0623600AK063642TGCGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0647800AK102332GGGGCCCGCAConserved hypothetical protein. 
Os07g0691300009-078-C12GGGCCCGCANONE 
009-132-H04GGGCCCGCANONE 
AK069499GGGCCCGCAWound-induced WI12 family protein. 
Os07g0695100AB189039GCGGGCCCACCANONE 
AB189042GCGGGCCCACCANONE 
AK059514GCGGGCCCACCANONE 
AK066112GCGGGCCCACCACheY-like domain containing protein. 
J013051N02GCGGGCCCACCANONE 
J013127M02GCGGGCCCACCANONE 
J023007I05GCGGGCCCACCANONE 
Os08g0107900014-055-C03TGTGGGGCCCGCANONE 
J065062G20TGTGGGGCCCGCANONE 
Os08g0143400015-006-A10TGCGGGCCCACCANONE 
AK066792TGCGGGCCCACCANONE 
AK120532TGCGGGCCCACCASWIRM domain containing protein. 
J100083F02TGCGGGCCCACCANONE 
Os08g0158900AK067062AAATGGGCCCGCAGTP1/OBG domain containing protein. 
J013089F04AAATGGGCCCGCANONE 
J013092D16AAATGGGCCCGCANONE 
J033120K14AAATGGGCCCGCANONE 
J033133F24AAATGGGCCCGCANONE 
J033145A10AAATGGGCCCGCANONE 
J033145A11AAATGGGCCCGCANONE 
J053048H24AAATGGGCCCGCANONE 
J053075H10AAATGGGCCCGCANONE 
Os08g0163400AB005290GCGGGCCCCSigma-70 factor family protein. 
AK065997GCGGGCCCCNONE 
AK071725GCGGGCCCCNONE 
Os08g0337300AK067509GCGGGCCCACCCNONE 
AK072420GCGGGCCCACCCZinc finger, FYVE/PHD-type domain containing protein. 
Os08g0347200AK058279TGCGGGCCCHypothetical protein. 
J100058J16TGCGGGCCCNONE 
Os08g0459100AK121795CTTGGGCCCGCCCCCACGTLeucine-rich repeat, cysteine-containing containing protein. 
Os08g0459600AK071203GCGGGCCCCACACSimilar to 12-oxophytodienoate reductase 3 (EC 1.3.1.42) (12-oxophytodienoate- 10,11-reductase 3) (OPDA-reductase 3) (LeOPR3). 
AK104843GCGGGCCCCACACNONE 
Os08g0499900J033080E06ATTTGGGCGGGCCCACANONE 
Os08g0536300AF358777GCGGGCCCCACCNONE 
AK099722GCGGGCCCCACCSimilar to Hd1. 
J100054G13GCGGGCCCCACCNONE 
Os08g0554000AK111661TGCGGGCCCACACWD-40 repeat containing protein. 
AK112044TGCGGGCCCACACNONE 
J013039N12TGCGGGCCCACACNONE 
J013134D02TGCGGGCCCACACNONE 
J013153B06TGCGGGCCCACACNONE 
J033044L16TGCGGGCCCACACNONE 
J033073P14TGCGGGCCCACACNONE 
Os09g0274100009-112-B02AGTTGGGCCCGCANONE 
AK062823AGTTGGGCCCGCAConserved hypothetical protein. 
Os09g0309500J100027L22CACTGACAGGGTGGGCCCGCConserved hypothetical protein. 
Os09g0369500013-023-F11TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105322TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105479TGCGGGCCCCACGCCTGGGCCCCConserved hypothetical protein. 
Os09g0401000AK064679GGGGCCCGCMyb factor. 
J075155B13GGGGCCCGCNONE 
Y11351GGGGCCCGCNONE 
Os09g0530700AK058211GCGGGCCCACAConserved hypothetical protein. 
AK100759GCGGGCCCACANONE 
J065039L02GCGGGCCCACANONE 
J065043O03GCGGGCCCACANONE 
J065070M16GCGGGCCCACANONE 
Os09g0558200016-083-C09GCGGGCCCCNONE 
AK068834GCGGGCCCCNONE 
AK103673GCGGGCCCCHomeodomain-like containing protein. 
J013159M18GCGGGCCCCNONE 
J065022I04GCGGGCCCCNONE 
J065089B19GCGGGCCCCNONE 
Os11g0146000009-080-E10GGGCCCGCANONE 
AK062645GGGCCCGCAHypothetical protein. 
Os11g0547000AK100677GCGGGCCCCACCCCCACCACSimilar to FKF1. 
Os11g0615700AB026561ACACGTGGGCCCGCANONE 
AK059521ACACGTGGGCCCGCANONE 
AK103487ACACGTGGGCCCGCAProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ACACGTGGGCCCGCANONE 
J065044A11ACACGTGGGCCCGCANONE 
J065090I02ACACGTGGGCCCGCANONE 
J065104I09ACACGTGGGCCCGCANONE 
J065187J10ACACGTGGGCCCGCANONE 
J075024E07ACACGTGGGCCCGCANONE 
J075025O13ACACGTGGGCCCGCANONE 
J090062N12ACACGTGGGCCCGCANONE 
J090087G06ACACGTGGGCCCGCANONE 
J090098K11ACACGTGGGCCCGCANONE 
Os12g0108201013-071-B01TGCGGGCCCNONE 
J013060C24TGCGGGCCCNONE 
J023026L08TGCGGGCCCHypothetical protein. 
Os12g0188900012-030-C08GCCGGGCCCGCNONE 
J013027N23GCCGGGCCCGCConserved hypothetical protein. 
J013156K23GCCGGGCCCGCNONE 
J023134K02GCCGGGCCCGCNONE 
J033051M18GCCGGGCCCGCNONE 
J033143K05GCCGGGCCCGCNONE 
J080003C24GCCGGGCCCGCNONE 
J080004K05GCCGGGCCCGCNONE 
J080009D14GCCGGGCCCGCNONE 
J080014L12GCCGGGCCCGCNONE 
J080020E23GCCGGGCCCGCNONE 
J080021K20GCCGGGCCCGCNONE 
J080024B19GCCGGGCCCGCNONE 
J080024C12GCCGGGCCCGCNONE 
J080031K10GCCGGGCCCGCNONE 
J080034G09GCCGGGCCCGCNONE 
J080036C10GCCGGGCCCGCNONE 
J080037K18GCCGGGCCCGCNONE 
J080039J17GCCGGGCCCGCNONE 
J080040A20GCCGGGCCCGCNONE 
J080042B06GCCGGGCCCGCNONE 
J080046P07GCCGGGCCCGCNONE 
J080047G02GCCGGGCCCGCNONE 
J080049E12GCCGGGCCCGCNONE 
J080056N14GCCGGGCCCGCNONE 
J080059K10GCCGGGCCCGCNONE 
J080064F05GCCGGGCCCGCNONE 
J080064I04GCCGGGCCCGCNONE 
J080064K17GCCGGGCCCGCNONE 
J080069A15GCCGGGCCCGCNONE 
J080071E22GCCGGGCCCGCNONE 
J080071M24GCCGGGCCCGCNONE 
J080074C17GCCGGGCCCGCNONE 
J080075J07GCCGGGCCCGCNONE 
J080079F11GCCGGGCCCGCNONE 
J080083F15GCCGGGCCCGCNONE 
J080084N21GCCGGGCCCGCNONE 
J080086O03GCCGGGCCCGCNONE 
J080089K02GCCGGGCCCGCNONE 
J080092K22GCCGGGCCCGCNONE 
J080093P09GCCGGGCCCGCNONE 
J090001N04GCCGGGCCCGCNONE 
J090041M02GCCGGGCCCGCNONE 
Os12g0266000J075093G23GCGGGCCCAGCNONE 
Os12g0597500AK101904GCGGGCCCCACCNONE 
AK103799GCGGGCCCCACCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02GCGGGCCCCACCNONE 
J100078O15GCGGGCCCCACCNONE 
Os12g0620400015-008-B10CACGTGGGGCCCGCNONE 
AK059006CACGTGGGGCCCGCNONE 
AK059973CACGTGGGGCCCGCNONE 
AK063843CACGTGGGGCCCGCMethyl-CpG binding domain containing protein. 
AK072503CACGTGGGGCCCGCNONE 
AK072934CACGTGGGGCCCGCNONE 
J023126H05CACGTGGGGCCCGCNONE 
J023131G11CACGTGGGGCCCGCNONE 
J023146E17CACGTGGGGCCCGCNONE 
J033064P08CACGTGGGGCCCGCNONE 
J033095L07CACGTGGGGCCCGCNONE 
J065101N06CACGTGGGGCCCGCNONE 
J065186F11CACGTGGGGCCCGCNONE 
J065215J15CACGTGGGGCCCGCNONE 
J080049H05CACGTGGGGCCCGCNONE 
J080059L05CACGTGGGGCCCGCNONE 
J080061M17CACGTGGGGCCCGCNONE 
J080063D16CACGTGGGGCCCGCNONE 
J090012D01CACGTGGGGCCCGCNONE 
J090023D20CACGTGGGGCCCGCNONE 
J090040A09CACGTGGGGCCCGCNONE 
J090044K08CACGTGGGGCCCGCNONE 
J100019H03CACGTGGGGCCCGCNONE 
J100054N04CACGTGGGGCCCGCNONE 
Os12g0621500AK111785GCGGGCCCACCCGSimilar to IRE. 
Os12g0625000006-117-H03TGCGGGCCCCACCTGNONE 
AF073695TGCGGGCCCCACCTGNONE 
AK061993TGCGGGCCCCACCTGNONE 
AK099598TGCGGGCCCCACCTGCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 
Os12g0631600J075087C06GGGGCCCGCAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.