version

Summary of OsREG620 (All List)

OrganismOryza sativa  
IDOsREG620  
SequenceGCTGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2643  

Entry Sequences (2643 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE 
006-081-C11GTGGGTCCAACGGCCCAGCNONE 
009-050-D04GTGGGTCCAACGGCCCAGCNONE 
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GTGGGTCCAACGGCCCAGCNONE 
J023112H22GTGGGTCCAACGGCCCAGCNONE 
J065048P05GTGGGTCCAACGGCCCAGCNONE 
J100068N20GTGGGTCCAACGGCCCAGCNONE 
J100073A02GTGGGTCCAACGGCCCAGCNONE 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0172000012-070-G06GCTGGGCCTGNONE 
AK068405GCTGGGCCTGALG3 family protein. 
J013149A07GCTGGGCCTGNONE 
J053047H05GCTGGGCCTGNONE 
J065075N03GCTGGGCCTGNONE 
J065093G22GCTGGGCCTGNONE 
J065130N21GCTGGGCCTGNONE 
J065143P05GCTGGGCCTGNONE 
J065216H07GCTGGGCCTGNONE 
J075013B06GCTGGGCCTGNONE 
J075196M05GCTGGGCCTGNONE 
J100039G24GCTGGGCCTGNONE 
J100041B11GCTGGGCCTGNONE 
J100069A16GCTGGGCCTGNONE 
J100069L12GCTGGGCCTGNONE 
J100074P16GCTGGGCCTGNONE 
Os01g0172200AK100326TGTGGGCTGGGCCGGAWW/Rsp5/WWP domain containing protein. 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0184500AK060699GCTGGGCCGAAADEAD/DEAH box helicase, N-terminal domain containing protein. 
Os01g0226700014-020-B10TGCGGCCCAGCCNONE 
AK063653TGCGGCCCAGCCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0231700012-002-F11GCCGGCCCAAGTAGGCCCAGCNONE 
013-082-F05GCCGGCCCAAGTAGGCCCAGCNONE 
AK107453GCCGGCCCAAGTAGGCCCAGCSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22GCCGGCCCAAGTAGGCCCAGCNONE 
J065023E21GCCGGCCCAAGTAGGCCCAGCNONE 
J065036H21GCCGGCCCAAGTAGGCCCAGCNONE 
J065037M24GCCGGCCCAAGTAGGCCCAGCNONE 
J065049L04GCCGGCCCAAGTAGGCCCAGCNONE 
J065072F17GCCGGCCCAAGTAGGCCCAGCNONE 
J065085H10GCCGGCCCAAGTAGGCCCAGCNONE 
J065109N19GCCGGCCCAAGTAGGCCCAGCNONE 
J065117M19GCCGGCCCAAGTAGGCCCAGCNONE 
J065144C15GCCGGCCCAAGTAGGCCCAGCNONE 
J065159G24GCCGGCCCAAGTAGGCCCAGCNONE 
J065164N14GCCGGCCCAAGTAGGCCCAGCNONE 
J075025K16GCCGGCCCAAGTAGGCCCAGCNONE 
J075057L05GCCGGCCCAAGTAGGCCCAGCNONE 
J075070I16GCCGGCCCAAGTAGGCCCAGCNONE 
J075089D10GCCGGCCCAAGTAGGCCCAGCNONE 
J075138F10GCCGGCCCAAGTAGGCCCAGCNONE 
J090018C11GCCGGCCCAAGTAGGCCCAGCNONE 
J100018L19GCCGGCCCAAGTAGGCCCAGCNONE 
J100024B14GCCGGCCCAAGTAGGCCCAGCNONE 
J100048L02GCCGGCCCAAGTAGGCCCAGCNONE 
J100055A22GCCGGCCCAAGTAGGCCCAGCNONE 
J100069K01GCCGGCCCAAGTAGGCCCAGCNONE 
Os01g0246100AK120732GGCTGGGCCAGProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0248800009-103-G11CTGGCCCAGCNONE 
AK062766CTGGCCCAGCConserved hypothetical protein. 
Os01g0276500006-030-E04GGCTGGGCCTGANONE 
AK061002GGCTGGGCCTGASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335GGCTGGGCCTGANONE 
Os01g0298400J065186D02TTGGCCCAGCMyb, DNA-binding domain containing protein. 
Os01g0332100AK120720CAGGTGGGCCCAGCSimilar to Neutral invertase-like protein (Fragment). 
AY187621CAGGTGGGCCCAGCNONE 
J080021I24CAGGTGGGCCCAGCNONE 
Os01g0525000015-038-B04CACGGCCCAGCNONE 
AK064104CACGGCCCAGCConserved hypothetical protein. 
Os01g0530300AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0592500AK111253GCCGGCCCAGCProtein of unknown function DUF1070 family protein. 
Os01g0678600009-114-H06CTCGGCCCAGCNONE 
AK063019CTCGGCCCAGCNONE 
AK071536CTCGGCCCAGCNONE 
AK120629CTCGGCCCAGCRibosomal protein S20 family protein. 
J013045E23CTCGGCCCAGCNONE 
J013153D21CTCGGCCCAGCNONE 
J013157A14CTCGGCCCAGCNONE 
J023048M04CTCGGCCCAGCNONE 
J065006P11CTCGGCCCAGCNONE 
J065042O14CTCGGCCCAGCNONE 
J065080D15CTCGGCCCAGCNONE 
J065096M02CTCGGCCCAGCNONE 
J065109M14CTCGGCCCAGCNONE 
J065204H02CTCGGCCCAGCNONE 
J065207L21CTCGGCCCAGCNONE 
J075028D22CTCGGCCCAGCNONE 
J075040O12CTCGGCCCAGCNONE 
J075051O03CTCGGCCCAGCNONE 
J075071M13CTCGGCCCAGCNONE 
J075151H15CTCGGCCCAGCNONE 
J075153D16CTCGGCCCAGCNONE 
J075153I21CTCGGCCCAGCNONE 
J080311L16CTCGGCCCAGCNONE 
J100053A20CTCGGCCCAGCNONE 
J100071P19CTCGGCCCAGCNONE 
Os01g0692100J043022J20TTGGCCCAGCGlutathione S-transferase, N-terminal domain containing protein. 
J100032K22TTGGCCCAGCNONE 
Os01g0709000Os01g0709000TCAGGCCCAGCSimilar to Transcription factor MYB1. 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
Os01g0719250AK105184GCTGGGCCACConserved hypothetical protein. 
Os01g0748100AK071261GTGGCCCAAGCTGGGCCTAHypothetical protein. 
J023084C08GTGGCCCAAGCTGGGCCTANONE 
J065058A07GTGGCCCAAGCTGGGCCTANONE 
Os01g0748600AK104674GGGGCCCAGCNONE 
Os01g0749900AK103588GCTGGGCCGCProtein of unknown function DUF250 domain containing protein. 
J033090O22GCTGGGCCGCNONE 
J033133C05GCTGGGCCGCNONE 
J065122N01GCTGGGCCGCNONE 
J065188K04GCTGGGCCGCNONE 
J090012D18GCTGGGCCGCNONE 
J100074N02GCTGGGCCGCNONE 
Os01g0764600AK060621ACCGGCCCAGCFosfomycin resistance kinase FomA family protein. 
J013111L18ACCGGCCCAGCNONE 
J013134N08ACCGGCCCAGCNONE 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0833000AK067226GCGGCCCAGCProtein prenyltransferase domain containing protein. 
J013098M23GCGGCCCAGCNONE 
Os01g0834700AK101559GAGGCCCAGCCZinc finger, CCCH-type domain containing protein. 
AK106074GAGGCCCAGCCNONE 
Os01g0844900AK066659GCTGGGCCCCHomeodomain-like containing protein. 
Os01g0848200AK069425GGCTGGGCCTGSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230GGCTGGGCCTGNONE 
Os01g0889000AK103621TCGGCCCAGCTetratricopeptide-like helical domain containing protein. 
Os01g0894700009-177-F04AAGGCCCAGCCNONE 
009-177-F04GAGGCCCAGCNONE 
AK067623AAGGCCCAGCCConserved hypothetical protein. 
AK067623GAGGCCCAGCConserved hypothetical protein. 
AK104876AAGGCCCAGCCNONE 
AK104876GAGGCCCAGCNONE 
J013095G01AAGGCCCAGCCNONE 
J013095G01GAGGCCCAGCNONE 
J013108L20AAGGCCCAGCCNONE 
J013108L20GAGGCCCAGCNONE 
J013120P13AAGGCCCAGCCNONE 
J013120P13GAGGCCCAGCNONE 
Os01g0908100AK072293GCTGGGCCGAAATTTCGGCCCAGTARabGAP/TBC domain containing protein. 
J065010B13GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065010M12GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065047C19GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065069B18GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065071K24GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065142P04GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065170E11GCTGGGCCGAAATTTCGGCCCAGTANONE 
Os01g0921600AK071344GGTGGGCTGGGCCGGGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GGTGGGCTGGGCCGGGNONE 
J013109E03GGTGGGCTGGGCCGGGNONE 
J023081J12GGTGGGCTGGGCCGGGNONE 
J023091E24GGTGGGCTGGGCCGGGNONE 
J033022A01GGTGGGCTGGGCCGGGNONE 
J033074C13GGTGGGCTGGGCCGGGNONE 
J065199E03GGTGGGCTGGGCCGGGNONE 
J075172O04GGTGGGCTGGGCCGGGNONE 
J090007G18GGTGGGCTGGGCCGGGNONE 
J090052B17GGTGGGCTGGGCCGGGNONE 
J090074H01GGTGGGCTGGGCCGGGNONE 
J100043J09GGTGGGCTGGGCCGGGNONE 
J100059J05GGTGGGCTGGGCCGGGNONE 
Os01g0924000004-020-C09CCCACGTGCTGGGCCGGCNONE 
004-020-C09GCTGGGCCAANONE 
005-014-A06CCCACGTGCTGGGCCGGCNONE 
005-014-A06GCTGGGCCAANONE 
009-085-G12CCCACGTGCTGGGCCGGCNONE 
009-085-G12GCTGGGCCAANONE 
009-123-A08CCCACGTGCTGGGCCGGCNONE 
009-123-A08GCTGGGCCAANONE 
009-134-A05CCCACGTGCTGGGCCGGCNONE 
009-134-A05GCTGGGCCAANONE 
009-137-F06CCCACGTGCTGGGCCGGCNONE 
009-137-F06GCTGGGCCAANONE 
016-016-B08CCCACGTGCTGGGCCGGCNONE 
016-016-B08GCTGGGCCAANONE 
AF050674CCCACGTGCTGGGCCGGCNONE 
AF050674GCTGGGCCAANONE 
AK061690CCCACGTGCTGGGCCGGCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK061690GCTGGGCCAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797CCCACGTGCTGGGCCGGCNONE 
AK120797GCTGGGCCAANONE 
J013040A15CCCACGTGCTGGGCCGGCNONE 
J013040A15GCTGGGCCAANONE 
J013104L20CCCACGTGCTGGGCCGGCNONE 
J013104L20GCTGGGCCAANONE 
J013127E12CCCACGTGCTGGGCCGGCNONE 
J013127E12GCTGGGCCAANONE 
J013158O05CCCACGTGCTGGGCCGGCNONE 
J013158O05GCTGGGCCAANONE 
J023012E09CCCACGTGCTGGGCCGGCNONE 
J023012E09GCTGGGCCAANONE 
J023126L23CCCACGTGCTGGGCCGGCNONE 
J023126L23GCTGGGCCAANONE 
J023143B03CCCACGTGCTGGGCCGGCNONE 
J023143B03GCTGGGCCAANONE 
J065005B16CCCACGTGCTGGGCCGGCNONE 
J065005B16GCTGGGCCAANONE 
J065101J15CCCACGTGCTGGGCCGGCNONE 
J065101J15GCTGGGCCAANONE 
J065105K16CCCACGTGCTGGGCCGGCNONE 
J065105K16GCTGGGCCAANONE 
J065155K16CCCACGTGCTGGGCCGGCNONE 
J065155K16GCTGGGCCAANONE 
J065171M17CCCACGTGCTGGGCCGGCNONE 
J065171M17GCTGGGCCAANONE 
J065182F07CCCACGTGCTGGGCCGGCNONE 
J065182F07GCTGGGCCAANONE 
J065187D10CCCACGTGCTGGGCCGGCNONE 
J065187D10GCTGGGCCAANONE 
J065194I24CCCACGTGCTGGGCCGGCNONE 
J065194I24GCTGGGCCAANONE 
J065207E24CCCACGTGCTGGGCCGGCNONE 
J065207E24GCTGGGCCAANONE 
J075001C24CCCACGTGCTGGGCCGGCNONE 
J075001C24GCTGGGCCAANONE 
J075090O10CCCACGTGCTGGGCCGGCNONE 
J075090O10GCTGGGCCAANONE 
J075095H17CCCACGTGCTGGGCCGGCNONE 
J075095H17GCTGGGCCAANONE 
J075109M24CCCACGTGCTGGGCCGGCNONE 
J075109M24GCTGGGCCAANONE 
J075123C18CCCACGTGCTGGGCCGGCNONE 
J075123C18GCTGGGCCAANONE 
J075148G22CCCACGTGCTGGGCCGGCNONE 
J075148G22GCTGGGCCAANONE 
J090009B09CCCACGTGCTGGGCCGGCNONE 
J090009B09GCTGGGCCAANONE 
J090075K17CCCACGTGCTGGGCCGGCNONE 
J090075K17GCTGGGCCAANONE 
J090081H23CCCACGTGCTGGGCCGGCNONE 
J090081H23GCTGGGCCAANONE 
J090097H21CCCACGTGCTGGGCCGGCNONE 
J090097H21GCTGGGCCAANONE 
J100063P14CCCACGTGCTGGGCCGGCNONE 
J100063P14GCTGGGCCAANONE 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0951800AK069239TCAGGCCCAGCCCProtein prenyltransferase domain containing protein. 
Os01g0959900AK058375GCTGGGCCTGAConserved hypothetical protein. 
AK066497GCTGGGCCTGANONE 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os01g0976800J065105P05GAGGCCCAGCZinc finger, GATA-type domain containing protein. 
J065189M03GAGGCCCAGCNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCAGCCCATAANONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCAGCCCATAANONE 
Os02g0175800009-083-C02TCGGCCCAGCCNONE 
009-184-H07TCGGCCCAGCCNONE 
009-199-D07TCGGCCCAGCCNONE 
AK058292TCGGCCCAGCCNONE 
AK120215TCGGCCCAGCCConserved hypothetical protein. 
J013040G12TCGGCCCAGCCNONE 
J065050N21TCGGCCCAGCCNONE 
J065077O07TCGGCCCAGCCNONE 
J065102G05TCGGCCCAGCCNONE 
J065197A04TCGGCCCAGCCNONE 
J075024L24TCGGCCCAGCCNONE 
J075038K01TCGGCCCAGCCNONE 
J075044L04TCGGCCCAGCCNONE 
J075063D23TCGGCCCAGCCNONE 
J075079P13TCGGCCCAGCCNONE 
J075084G03TCGGCCCAGCCNONE 
J075135G07TCGGCCCAGCCNONE 
J075148D17TCGGCCCAGCCNONE 
J075150F13TCGGCCCAGCCNONE 
J075157F06TCGGCCCAGCCNONE 
J090054A05TCGGCCCAGCCNONE 
J090085O04TCGGCCCAGCCNONE 
J100023C04TCGGCCCAGCCNONE 
J100023H23TCGGCCCAGCCNONE 
J100026A16TCGGCCCAGCCNONE 
J100035K13TCGGCCCAGCCNONE 
Os02g0176400009-099-H11TAGGCCCAGCNONE 
AK062746TAGGCCCAGCProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0186900J100059N12TTGGCCCAGCCytochrome P450 family protein. 
Os02g0202600AK068376GCTGGGCCTANONE 
AK099277GCTGGGCCTANONE 
AK101844GCTGGGCCTATetratricopeptide-like helical domain containing protein. 
J080001G13GCTGGGCCTANONE 
J080011J23GCTGGGCCTANONE 
J080015F12GCTGGGCCTANONE 
J080017J03GCTGGGCCTANONE 
J080030J24GCTGGGCCTANONE 
J080038H02GCTGGGCCTANONE 
J080041G13GCTGGGCCTANONE 
J080044B13GCTGGGCCTANONE 
J080044L10GCTGGGCCTANONE 
J080046H11GCTGGGCCTANONE 
J080057J01GCTGGGCCTANONE 
J080062E13GCTGGGCCTANONE 
J080062N11GCTGGGCCTANONE 
J080063C17GCTGGGCCTANONE 
J080064K11GCTGGGCCTANONE 
J080064N09GCTGGGCCTANONE 
J080067C17GCTGGGCCTANONE 
J080067C23GCTGGGCCTANONE 
J080069J21GCTGGGCCTANONE 
J080070L23GCTGGGCCTANONE 
J080085N15GCTGGGCCTANONE 
J080094F03GCTGGGCCTANONE 
Os02g0316800009-104-A11GCTGGGCCAGNONE 
AK062767GCTGGGCCAGSimilar to MRNA binding protein precursor. 
Os02g0321800AK067188GGGCTGGGCCGTANONE 
AK070852GGGCTGGGCCGTAB-cell receptor-associated 31-like family protein. 
J013094K24GGGCTGGGCCGTANONE 
Os02g0326000006-099-D01GCCGGCCCAGCCNONE 
AK059937GCCGGCCCAGCCNONE 
AK102973GCCGGCCCAGCCConserved hypothetical protein. 
J033115K18GCCGGCCCAGCCNONE 
J075069J04GCCGGCCCAGCCNONE 
Os02g0478700AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0501350J090074D10CCAGCCCAAGGCCCAGCNONE 
J090080M08CCAGCCCAAGGCCCAGCNONE 
J090083F07CCAGCCCAAGGCCCAGCConserved hypothetical protein. 
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE 
AK100111GCTGGGCCCACGTGTCNONE 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
J013074C19GCTGGGCCCACGTGTCNONE 
J013153K16GCTGGGCCCACGTGTCNONE 
J023078O21GCTGGGCCCACGTGTCNONE 
J033127M18GCTGGGCCCACGTGTCNONE 
J043038D17GCTGGGCCCACGTGTCNONE 
J065090L08GCTGGGCCCACGTGTCNONE 
J065110P16GCTGGGCCCACGTGTCNONE 
J065163C03GCTGGGCCCACGTGTCNONE 
J065213D23GCTGGGCCCACGTGTCNONE 
J090010M14GCTGGGCCCACGTGTCNONE 
J090016E02GCTGGGCCCACGTGTCNONE 
J090044J20GCTGGGCCCACGTGTCNONE 
J090091M16GCTGGGCCCACGTGTCNONE 
J090099I23GCTGGGCCCACGTGTCNONE 
Os02g0520800AK102815AGCCCAAGGCCCAGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09AGCCCAAGGCCCAGCNONE 
J100038E09AGCCCAAGGCCCAGCNONE 
J100076G11AGCCCAAGGCCCAGCNONE 
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein. 
Os02g0593500AK067498GCTGGGCCACPhosphate transporter family protein. 
AK104702GCTGGGCCACNONE 
Os02g0614400016-088-D04GCTGGGCCCTNONE 
AK071805GCTGGGCCCTConserved hypothetical protein. 
J023108N22GCTGGGCCCTNONE 
Os02g0616600AK106681CTTGGGCTGCCGGCCCAGCConserved hypothetical protein. 
J065062G16CTTGGGCTGCCGGCCCAGCNONE 
Os02g0632500AK101701GCCGGCCCAGCCArf GTPase activating protein family protein. 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0637900AK110708CAGGCCCAGCCConserved hypothetical protein. 
AK110708GCTGGGCCATGGCCCATGTConserved hypothetical protein. 
J065038O03CAGGCCCAGCCNONE 
J065038O03GCTGGGCCATGGCCCATGTNONE 
J065052A19CAGGCCCAGCCNONE 
J065052A19GCTGGGCCATGGCCCATGTNONE 
J065052A20CAGGCCCAGCCNONE 
J065052A20GCTGGGCCATGGCCCATGTNONE 
J065063D06CAGGCCCAGCCNONE 
J065063D06GCTGGGCCATGGCCCATGTNONE 
J065069D12CAGGCCCAGCCNONE 
J065069D12GCTGGGCCATGGCCCATGTNONE 
J065074H07CAGGCCCAGCCNONE 
J065074H07GCTGGGCCATGGCCCATGTNONE 
J065174K17CAGGCCCAGCCNONE 
J065174K17GCTGGGCCATGGCCCATGTNONE 
J065215M12CAGGCCCAGCCNONE 
J065215M12GCTGGGCCATGGCCCATGTNONE 
J075007E12CAGGCCCAGCCNONE 
J075007E12GCTGGGCCATGGCCCATGTNONE 
J075057K20CAGGCCCAGCCNONE 
J075057K20GCTGGGCCATGGCCCATGTNONE 
J075119I10CAGGCCCAGCCNONE 
J075119I10GCTGGGCCATGGCCCATGTNONE 
Os02g0638000AK103830AGATGGGCCCAGCNONE 
AK106548AGATGGGCCCAGCConserved hypothetical protein. 
Os02g0638400AK060633GCTGGGCCAGBRO1 domain containing protein. 
J065083J17GCTGGGCCAGNONE 
Os02g0641800AK066504CCCGGCCCAGCCSimilar to RNA helicase (Fragment). 
AK072124CCCGGCCCAGCCNONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0705100012-046-E01GCCGGCCCAGCCNONE 
AK063491GCCGGCCCAGCCEpoxide hydrolase family protein. 
J065184H07GCCGGCCCAGCCNONE 
Os02g0714700AK067734TTGGCCCAGCConserved hypothetical protein. 
Os02g0753000AK121015GCTGGGCCCACTCCSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0759800012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0767900009-154-G01TGCGGCCCAGCCCNONE 
009-172-H09TGCGGCCCAGCCCNONE 
AK099885TGCGGCCCAGCCCGlutaredoxin 2 family protein. 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0780500AK072784GCTGGGCCGGCCCAACNONE 
AK121143GCTGGGCCGGCCCAACConserved hypothetical protein. 
J023075M13GCTGGGCCGGCCCAACNONE 
J023077P14GCTGGGCCGGCCCAACNONE 
J023123C16GCTGGGCCGGCCCAACNONE 
J023142P06GCTGGGCCGGCCCAACNONE 
Os02g0798700AK101070GCTGGGCCGGANeurochondrin family protein. 
AK103079GCTGGGCCGGANONE 
J090045L09GCTGGGCCGGANONE 
Os02g0800000J100043O08GCTGGGCCTTGGGCCTTGGGCTNONE 
J100064O18GCTGGGCCTTGGGCCTTGGGCTNONE 
Os02g0803200AK063404GCTGGGCCGGCCCACCSimilar to 30S ribosomal protein S15. 
Os02g0804300006-046-D12GCTGGGCCGGGNONE 
AK060165GCTGGGCCGGGNONE 
AK067584GCTGGGCCGGGSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12GCTGGGCCGGGNONE 
J023098C22GCTGGGCCGGGNONE 
J033123P06GCTGGGCCGGGNONE 
J065060N24GCTGGGCCGGGNONE 
J065069H22GCTGGGCCGGGNONE 
J065155N20GCTGGGCCGGGNONE 
J065170K07GCTGGGCCGGGNONE 
J090033D12GCTGGGCCGGGNONE 
Os02g0824900AK073217GCGGCCCAGCNONE 
AK103528GCGGCCCAGCConserved hypothetical protein. 
J090069J01GCGGCCCAGCNONE 
J090081B04GCGGCCCAGCNONE 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os03g0126300AK061256GCTGGGCCTCNONE 
AK061961GCTGGGCCTCNONE 
AY346336GCTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17GCTGGGCCTCNONE 
J090023H12GCTGGGCCTCNONE 
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein. 
J013152D10TAGGCCCAGCAAAGCCCACGTNONE 
J075167I20TAGGCCCAGCAAAGCCCACGTNONE 
J090067O04TAGGCCCAGCAAAGCCCACGTNONE 
Os03g0130700AK110670GCTGGGCCGGTNONE 
AK110670GGCTGGGCCCAACANONE 
Os03g0143600AB110188TTGGCCCAGCNONE 
AK068424TTGGCCCAGCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464TTGGCCCAGCNONE 
AY224545TTGGCCCAGCNONE 
J013154F02TTGGCCCAGCNONE 
Os03g0152800AK066205GCTGGGCCTTGProtein kinase-like domain containing protein. 
AK100518GCTGGGCCTTGNONE 
Os03g0172200AK069130TCCGGCCCAGCCACACGArmadillo-like helical domain containing protein. 
Os03g0184100AK067400GGTGGGGCCCAGCHypothetical protein. 
J013030J24GGTGGGGCCCAGCNONE 
J013037M23GGTGGGGCCCAGCNONE 
J013106B15GGTGGGGCCCAGCNONE 
J013130H10GGTGGGGCCCAGCNONE 
J013152B03GGTGGGGCCCAGCNONE 
J013157J24GGTGGGGCCCAGCNONE 
J013157K04GGTGGGGCCCAGCNONE 
J033093A19GGTGGGGCCCAGCNONE 
J033106E24GGTGGGGCCCAGCNONE 
J090043G12GGTGGGGCCCAGCNONE 
Os03g0190100AK061907GCGGCCCAGCCNONE 
AK066332GCGGCCCAGCCUbiA prenyltransferase family protein. 
J013051N11GCGGCCCAGCCNONE 
J013060C07GCGGCCCAGCCNONE 
J065117L08GCGGCCCAGCCNONE 
J100067H10GCGGCCCAGCCNONE 
Os03g0206600AK058618GCTGGGCCCACGCProtein of unknown function DUF588 family protein. 
Os03g0218200AK073971AGGGCCCAGCCyclin-like F-box domain containing protein. 
Os03g0240500003-116-E06CAGGCCCAGCCCNONE 
AK058676CAGGCCCAGCCCSimilar to Toc34-2 protein. 
AK099032CAGGCCCAGCCCNONE 
J013128A13CAGGCCCAGCCCNONE 
J075064H17CAGGCCCAGCCCNONE 
J075075N03CAGGCCCAGCCCNONE 
J075079H24CAGGCCCAGCCCNONE 
J075127D23CAGGCCCAGCCCNONE 
J075132C09CAGGCCCAGCCCNONE 
J075159D02CAGGCCCAGCCCNONE 
J090053O11CAGGCCCAGCCCNONE 
J090062N04CAGGCCCAGCCCNONE 
Os03g0243700011-089-H03GCTGGGCCTTNONE 
AK059149GCTGGGCCTTGlycoside hydrolase, family 10 protein. 
J065048D08GCTGGGCCTTNONE 
J065075F03GCTGGGCCTTNONE 
J065093L06GCTGGGCCTTNONE 
J065120A17GCTGGGCCTTNONE 
J065131J21GCTGGGCCTTNONE 
J065140D06GCTGGGCCTTNONE 
J065155F01GCTGGGCCTTNONE 
J065157G07GCTGGGCCTTNONE 
J065157G24GCTGGGCCTTNONE 
J065165D02GCTGGGCCTTNONE 
J065179P03GCTGGGCCTTNONE 
J065179P04GCTGGGCCTTNONE 
J065183F18GCTGGGCCTTNONE 
J065185A02GCTGGGCCTTNONE 
J100018L10GCTGGGCCTTNONE 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0278400015-014-G10GCTGGGCCCGGGNONE 
AK070052GCTGGGCCCGGGSimilar to ADP ribosylation GTPase-like protein (Fragment). 
AY224461GCTGGGCCCGGGNONE 
J065218E15GCTGGGCCCGGGNONE 
J075115A06GCTGGGCCCGGGNONE 
J075134I05GCTGGGCCCGGGNONE 
J100032D08GCTGGGCCCGGGNONE 
J100044O13GCTGGGCCCGGGNONE 
J100051G15GCTGGGCCCGGGNONE 
J100052O21GCTGGGCCCGGGNONE 
J100071A12GCTGGGCCCGGGNONE 
Os03g0294200AK069285GCTGGGCCCACCTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0300700AK071770TTGGCCCAGCRetrotransposon gag protein family protein. 
J023112P05TTGGCCCAGCNONE 
Os03g0308000016-023-H09AAGGCCCAGCCNONE 
AK100355AAGGCCCAGCCUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05AAGGCCCAGCCNONE 
J023043K04AAGGCCCAGCCNONE 
J023083I20AAGGCCCAGCCNONE 
J033068F22AAGGCCCAGCCNONE 
J033125P21AAGGCCCAGCCNONE 
J065207A22AAGGCCCAGCCNONE 
J100018D20AAGGCCCAGCCNONE 
J100026L17AAGGCCCAGCCNONE 
J100055D14AAGGCCCAGCCNONE 
J100060P03AAGGCCCAGCCNONE 
J100078A20AAGGCCCAGCCNONE 
Os03g0308500AK103891CCACGGCCCAGCCCDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os03g0333000AK109811TATGGGCTGGGCCAAConserved hypothetical protein. 
J065152D04TATGGGCTGGGCCAANONE 
J090011B05TATGGGCTGGGCCAANONE 
Os03g0333100AK101050TTGGCCCAGCCCATAProtein of unknown function DUF663 domain containing protein. 
Os03g0337100AK107981TAGGCCCAGCConserved hypothetical protein. 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0386000AK072984GGCTGGGCCTGGSimilar to WD domain protein-like. 
J065009K18GGCTGGGCCTGGNONE 
J065165P09GGCTGGGCCTGGNONE 
Os03g0388100AK059680GCTGGGCCATHeavy metal transport/detoxification protein domain containing protein. 
AK099133GCTGGGCCATNONE 
Os03g0438400AK070383AAGGCCCAGCCConserved hypothetical protein. 
J023054E02AAGGCCCAGCCNONE 
Os03g0583800AK064786CTGGCCCAGCCMpv17/PMP22 family protein. 
AK099233CTGGCCCAGCCNONE 
J013000B17CTGGCCCAGCCNONE 
J013071N13CTGGCCCAGCCNONE 
J013095M11CTGGCCCAGCCNONE 
J080068F05CTGGCCCAGCCNONE 
J080069C02CTGGCCCAGCCNONE 
J080072E22CTGGCCCAGCCNONE 
J100052H10CTGGCCCAGCCNONE 
J100053H09CTGGCCCAGCCNONE 
J100056G03CTGGCCCAGCCNONE 
Os03g0612600009-073-H01GACGGCCCAGCNONE 
AK071403GACGGCCCAGCRibosomal protein L25-like domain containing protein. 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0648400005-003-D07CCCGGGCCCAGCNONE 
006-048-C12CCCGGGCCCAGCNONE 
006-049-A03CCCGGGCCCAGCNONE 
011-008-F07CCCGGGCCCAGCNONE 
011-039-A07CCCGGGCCCAGCNONE 
011-044-D10CCCGGGCCCAGCNONE 
011-099-C01CCCGGGCCCAGCNONE 
012-051-B09CCCGGGCCCAGCNONE 
012-051-D08CCCGGGCCCAGCNONE 
012-056-G07CCCGGGCCCAGCNONE 
012-062-A01CCCGGGCCCAGCNONE 
012-079-C03CCCGGGCCCAGCNONE 
014-003-A06CCCGGGCCCAGCNONE 
015-010-D02CCCGGGCCCAGCNONE 
AK102263CCCGGGCCCAGCSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763CCCGGGCCCAGCNONE 
AK105028CCCGGGCCCAGCNONE 
AY224432CCCGGGCCCAGCNONE 
J013043H01CCCGGGCCCAGCNONE 
J013134K10CCCGGGCCCAGCNONE 
J023037D18CCCGGGCCCAGCNONE 
J023077K20CCCGGGCCCAGCNONE 
J023105M19CCCGGGCCCAGCNONE 
J023131M09CCCGGGCCCAGCNONE 
J033022F05CCCGGGCCCAGCNONE 
J033051J22CCCGGGCCCAGCNONE 
J033061D03CCCGGGCCCAGCNONE 
J033084H04CCCGGGCCCAGCNONE 
J033088M01CCCGGGCCCAGCNONE 
J033119H12CCCGGGCCCAGCNONE 
J033131C18CCCGGGCCCAGCNONE 
J043030C06CCCGGGCCCAGCNONE 
J080032A08CCCGGGCCCAGCNONE 
J090008C11CCCGGGCCCAGCNONE 
J090014D24CCCGGGCCCAGCNONE 
J090024C20CCCGGGCCCAGCNONE 
J090024H08CCCGGGCCCAGCNONE 
J090029F10CCCGGGCCCAGCNONE 
J090032K16CCCGGGCCCAGCNONE 
J090034L14CCCGGGCCCAGCNONE 
J090035C20CCCGGGCCCAGCNONE 
J090044H05CCCGGGCCCAGCNONE 
J090048M09CCCGGGCCCAGCNONE 
J090056I15CCCGGGCCCAGCNONE 
J090062B01CCCGGGCCCAGCNONE 
J090076F06CCCGGGCCCAGCNONE 
J090077A02CCCGGGCCCAGCNONE 
J090084E21CCCGGGCCCAGCNONE 
J090084J09CCCGGGCCCAGCNONE 
J090086G11CCCGGGCCCAGCNONE 
J090092C20CCCGGGCCCAGCNONE 
J100018G14CCCGGGCCCAGCNONE 
J100018I22CCCGGGCCCAGCNONE 
J100024N14CCCGGGCCCAGCNONE 
J100032K09CCCGGGCCCAGCNONE 
J100036F09CCCGGGCCCAGCNONE 
J100041M04CCCGGGCCCAGCNONE 
J100042H05CCCGGGCCCAGCNONE 
J100043P19CCCGGGCCCAGCNONE 
J100044B04CCCGGGCCCAGCNONE 
J100049L24CCCGGGCCCAGCNONE 
J100050M21CCCGGGCCCAGCNONE 
J100057F24CCCGGGCCCAGCNONE 
J100063I11CCCGGGCCCAGCNONE 
J100064J24CCCGGGCCCAGCNONE 
J100070B13CCCGGGCCCAGCNONE 
J100076A13CCCGGGCCCAGCNONE 
J100081C20CCCGGGCCCAGCNONE 
J100081L09CCCGGGCCCAGCNONE 
J100084G23CCCGGGCCCAGCNONE 
J100088H02CCCGGGCCCAGCNONE 
Os03g0669000AK067769GCTGGGCCCATTTSimilar to RNA helicase (Fragment). 
AK099820GCTGGGCCCATTTNONE 
Os03g0704400AK101297AAGGCCCAGCProtein kinase domain containing protein. 
J033033I19AAGGCCCAGCNONE 
J090009M06AAGGCCCAGCNONE 
Os03g0712600015-008-G03CAGGCCCAGCCNONE 
AK103705CAGGCCCAGCCHypothetical protein. 
J033136N14CAGGCCCAGCCNONE 
Os03g0734700AK072060GCTGGGCCGGCMitochondrial substrate carrier family protein. 
AK120533GCTGGGCCGGCNONE 
J043026E20GCTGGGCCGGCNONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0753100AB003324GCTGGGCCAGNONE 
AK100227GCTGGGCCAGTranscription factor, MADS-box domain containing protein. 
AY551917GCTGGGCCAGNONE 
AY551922GCTGGGCCAGNONE 
AY551926GCTGGGCCAGNONE 
J023012N20GCTGGGCCAGNONE 
J023048E14GCTGGGCCAGNONE 
Os03g0763000AK120812GGCTGGGCCATSimilar to Casein kinase II alpha subunit. 
Os03g0770100AK108776AACGGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0784000AK067337GCTGGGCCGGANONE 
AK100003GCTGGGCCGGAFAD dependent oxidoreductase family protein. 
J013102O14GCTGGGCCGGANONE 
J013135F18GCTGGGCCGGANONE 
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE 
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE 
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0807200011-031-F07CCCGGCCCAGCNONE 
AK063932CCCGGCCCAGCNONE 
AK103496CCCGGCCCAGCProtein of unknown function DUF1639 family protein. 
J033131A04CCCGGCCCAGCNONE 
J065109O03CCCGGCCCAGCNONE 
J080001M11CCCGGCCCAGCNONE 
J080002H18CCCGGCCCAGCNONE 
J080005I08CCCGGCCCAGCNONE 
J080006B05CCCGGCCCAGCNONE 
J080006D17CCCGGCCCAGCNONE 
J080007M19CCCGGCCCAGCNONE 
J080011E07CCCGGCCCAGCNONE 
J080012H06CCCGGCCCAGCNONE 
J080014D08CCCGGCCCAGCNONE 
J080017D06CCCGGCCCAGCNONE 
J080017K17CCCGGCCCAGCNONE 
J080020B17CCCGGCCCAGCNONE 
J080021O05CCCGGCCCAGCNONE 
J080021O15CCCGGCCCAGCNONE 
J080023I18CCCGGCCCAGCNONE 
J080025A21CCCGGCCCAGCNONE 
J080027P22CCCGGCCCAGCNONE 
J080028M22CCCGGCCCAGCNONE 
J080029B09CCCGGCCCAGCNONE 
J080029M07CCCGGCCCAGCNONE 
J080029M17CCCGGCCCAGCNONE 
J080030H23CCCGGCCCAGCNONE 
J080030K16CCCGGCCCAGCNONE 
J080030L19CCCGGCCCAGCNONE 
J080031A12CCCGGCCCAGCNONE 
J080031N21CCCGGCCCAGCNONE 
J080032G05CCCGGCCCAGCNONE 
J080032P20CCCGGCCCAGCNONE 
J080033H20CCCGGCCCAGCNONE 
J080034H22CCCGGCCCAGCNONE 
J080034J03CCCGGCCCAGCNONE 
J080034J16CCCGGCCCAGCNONE 
J080034N01CCCGGCCCAGCNONE 
J080035K20CCCGGCCCAGCNONE 
J080036I04CCCGGCCCAGCNONE 
J080036I19CCCGGCCCAGCNONE 
J080036O21CCCGGCCCAGCNONE 
J080038D06CCCGGCCCAGCNONE 
J080039J15CCCGGCCCAGCNONE 
J080039P18CCCGGCCCAGCNONE 
J080041H20CCCGGCCCAGCNONE 
J080041M11CCCGGCCCAGCNONE 
J080042F14CCCGGCCCAGCNONE 
J080043G10CCCGGCCCAGCNONE 
J080043J02CCCGGCCCAGCNONE 
J080044C19CCCGGCCCAGCNONE 
J080044G11CCCGGCCCAGCNONE 
J080045M03CCCGGCCCAGCNONE 
J080045N07CCCGGCCCAGCNONE 
J080047K14CCCGGCCCAGCNONE 
J080049I21CCCGGCCCAGCNONE 
J080050A06CCCGGCCCAGCNONE 
J080050I16CCCGGCCCAGCNONE 
J080050N16CCCGGCCCAGCNONE 
J080052C23CCCGGCCCAGCNONE 
J080052D18CCCGGCCCAGCNONE 
J080052F20CCCGGCCCAGCNONE 
J080052F23CCCGGCCCAGCNONE 
J080053M03CCCGGCCCAGCNONE 
J080054G13CCCGGCCCAGCNONE 
J080054H12CCCGGCCCAGCNONE 
J080055N03CCCGGCCCAGCNONE 
J080056E07CCCGGCCCAGCNONE 
J080057L04CCCGGCCCAGCNONE 
J080063O19CCCGGCCCAGCNONE 
J080064E21CCCGGCCCAGCNONE 
J080065D18CCCGGCCCAGCNONE 
J080065F18CCCGGCCCAGCNONE 
J080065H14CCCGGCCCAGCNONE 
J080065K15CCCGGCCCAGCNONE 
J080065M24CCCGGCCCAGCNONE 
J080066B18CCCGGCCCAGCNONE 
J080066B19CCCGGCCCAGCNONE 
J080071H19CCCGGCCCAGCNONE 
J080072E18CCCGGCCCAGCNONE 
J080074K21CCCGGCCCAGCNONE 
J080075B06CCCGGCCCAGCNONE 
J080076H07CCCGGCCCAGCNONE 
J080079D16CCCGGCCCAGCNONE 
J080082B20CCCGGCCCAGCNONE 
J080084N16CCCGGCCCAGCNONE 
J080085L07CCCGGCCCAGCNONE 
J080086L04CCCGGCCCAGCNONE 
J080086M07CCCGGCCCAGCNONE 
J080087D02CCCGGCCCAGCNONE 
J080087D15CCCGGCCCAGCNONE 
J080087J19CCCGGCCCAGCNONE 
J080088G20CCCGGCCCAGCNONE 
J080092M15CCCGGCCCAGCNONE 
J080093O10CCCGGCCCAGCNONE 
J080095L09CCCGGCCCAGCNONE 
J080096A18CCCGGCCCAGCNONE 
J080097C03CCCGGCCCAGCNONE 
J090019J07CCCGGCCCAGCNONE 
J090024N12CCCGGCCCAGCNONE 
J090049I09CCCGGCCCAGCNONE 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0822200AK069405GCTGGGCCGGANAD-dependent epimerase/dehydratase family protein. 
AK104151GCTGGGCCGGANONE 
AK104209GCTGGGCCGGANONE 
J065107D01GCTGGGCCGGANONE 
J065191L23GCTGGGCCGGANONE 
J065217B05GCTGGGCCGGANONE 
Os03g0822300AK060050TCCGGCCCAGCRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
J065198I20TCCGGCCCAGCNONE 
Os03g0822900AK099787GGCTGGGCCGGTZinc finger, BED-type predicted domain containing protein. 
J013042C24GGCTGGGCCGGTNONE 
J013096O21GGCTGGGCCGGTNONE 
J023109I23GGCTGGGCCGGTNONE 
J033106N09GGCTGGGCCGGTNONE 
J033107H03GGCTGGGCCGGTNONE 
J033118G03GGCTGGGCCGGTNONE 
J033145I24GGCTGGGCCGGTNONE 
J065138D15GGCTGGGCCGGTNONE 
J065140L13GGCTGGGCCGGTNONE 
J065179M13GGCTGGGCCGGTNONE 
J065200F05GGCTGGGCCGGTNONE 
J075104F20GGCTGGGCCGGTNONE 
J075143A15GGCTGGGCCGGTNONE 
J075197J11GGCTGGGCCGGTNONE 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
Os03g0843500AK067985CGGGCCCAGCCCACGCNONE 
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAGCCCACGCNONE 
J080302L23CGGGCCCAGCCCACGCNONE 
Os03g0844000AK059033GGGGCCCAGCNONE 
AK065633GGGGCCCAGCProtein prenyltransferase domain containing protein. 
J013031L22GGGGCCCAGCNONE 
J065099H18GGGGCCCAGCNONE 
Os03g0846400AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
Os03g0854000009-186-C03GGCTGGGCCCACGCGNONE 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
J065138B11GGCTGGGCCCACGCGNONE 
Os03g0855700AK070400GCTGGGCCCGGTNucleic acid-binding, OB-fold domain containing protein. 
Os03g0858700006-024-D11GGTGGGGCTGGGCCGTCNONE 
AK061723GGTGGGGCTGGGCCGTCProtein of unknown function DUF1499 family protein. 
AK064976GGTGGGGCTGGGCCGTCNONE 
J013001B23GGTGGGGCTGGGCCGTCNONE 
Os03g0859550J065092L21CGTGGGGGCTCAGCTGGGCCTCConserved hypothetical protein. 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0117800Os04g0117800GCAGCCCAGGCCCAGCCAmidase family protein. 
Os04g0170500AK103323GAGGCCCAGCHypothetical protein. 
Os04g0208400AK069629GCCGGCCCGGCACGGCCCAGCCyclin-like F-box domain containing protein. 
AK069629GCTGGGCCGGGCCGCyclin-like F-box domain containing protein. 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0282400AK120187GCTGGGCCCCACCSimilar to FPF1 protein-like (RAA1). 
J013034O10GCTGGGCCCCACCNONE 
J013071G20GCTGGGCCCCACCNONE 
Os04g0387600009-148-E01CGGGCCCAGCNONE 
009-155-A11CGGGCCCAGCNONE 
009-175-F04CGGGCCCAGCNONE 
AK063862CGGGCCCAGCConserved hypothetical protein. 
J065035F12CGGGCCCAGCNONE 
J065162C13CGGGCCCAGCNONE 
J065169L19CGGGCCCAGCNONE 
Os04g0390700AK107261ATGGCCCAGCGlucose/ribitol dehydrogenase family protein. 
Os04g0407300AK101793GCTGGGCCAGNONE 
AK121980GCTGGGCCAGHypothetical protein. 
J033065K23GCTGGGCCAGNONE 
J033108L11GCTGGGCCAGNONE 
Os04g0440100AK101324GCTGGGCCCACTCTNONE 
AK105415GCTGGGCCCACTCTNonsense-mediated decay UPF3 domain containing protein. 
Os04g0441800AK064785TAGGCCCAGCCTGF-beta receptor, type I/II extracellular region family protein. 
J013000B16TAGGCCCAGCCNONE 
J100043P07TAGGCCCAGCCNONE 
Os04g0461100009-136-H10GCTGGGCCATATTGGGCTTTNONE 
009-147-H12GCTGGGCCATATTGGGCTTTNONE 
AK068022GCTGGGCCATATTGGGCTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24GCTGGGCCATATTGGGCTTTNONE 
J065019D10GCTGGGCCATATTGGGCTTTNONE 
J065168O21GCTGGGCCATATTGGGCTTTNONE 
J075051G06GCTGGGCCATATTGGGCTTTNONE 
J075148G11GCTGGGCCATATTGGGCTTTNONE 
Os04g0479300AK106088TACGGCCCAGCCConserved hypothetical protein. 
Os04g0497000006-097-G07GCGGGCCCAGCNONE 
AK069136GCGGGCCCAGCNONE 
AK109382GCGGGCCCAGCSimilar to Allyl alcohol dehydrogenase. 
J023008C06GCGGGCCCAGCNONE 
J043007K16GCGGGCCCAGCNONE 
J065110K06GCGGGCCCAGCNONE 
J080012F02GCGGGCCCAGCNONE 
J080020N21GCGGGCCCAGCNONE 
J080026H09GCGGGCCCAGCNONE 
J080029D13GCGGGCCCAGCNONE 
J080034C08GCGGGCCCAGCNONE 
J080050J07GCGGGCCCAGCNONE 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0528100009-090-G06TTTCGGCCCAGCCNONE 
009-168-C11TTTCGGCCCAGCCNONE 
AK065957TTTCGGCCCAGCCConserved hypothetical protein. 
J013039G20TTTCGGCCCAGCCNONE 
J013044D08TTTCGGCCCAGCCNONE 
J065013L14TTTCGGCCCAGCCNONE 
J065143H08TTTCGGCCCAGCCNONE 
J065146C14TTTCGGCCCAGCCNONE 
J065149K22TTTCGGCCCAGCCNONE 
J065156B18TTTCGGCCCAGCCNONE 
J065201A04TTTCGGCCCAGCCNONE 
J065209A04TTTCGGCCCAGCCNONE 
Os04g0551300AK103502AACGGCCCAGCSimilar to Growth regulator like protein. 
Os04g0580700AF095646GCTGGGCCCCNONE 
AK070540GCTGGGCCCCNONE 
AY551918GCTGGGCCCCMADS box transcription factor MADS17. 
J023057B01GCTGGGCCCCNONE 
Os04g0584100012-063-E01GCTGGGCCTGGNONE 
AK105292GCTGGGCCTGGConserved hypothetical protein. 
Os04g0594500015-024-B07TCAGGCCCAGCNONE 
AK106269TCAGGCCCAGCProtein of unknown function DUF674 family protein. 
Os04g0617050J065197A20GCTGGGCCCCACNONE 
J090067K01GCTGGGCCCCACAuxin responsive SAUR protein family protein. 
Os04g0626400006-050-B09CAAGGCCCTGGCCCAGCNONE 
006-072-C12CAAGGCCCTGGCCCAGCNONE 
006-092-C11CAAGGCCCTGGCCCAGCNONE 
AK059851CAAGGCCCTGGCCCAGCCalycin-like family protein. 
AK100069CAAGGCCCTGGCCCAGCNONE 
AK104062CAAGGCCCTGGCCCAGCNONE 
AK104663CAAGGCCCTGGCCCAGCNONE 
Os04g0636400006-064-G07TTCGGCCCAGGCCCAGCNONE 
006-097-D05TTCGGCCCAGGCCCAGCNONE 
AK061848TTCGGCCCAGGCCCAGCSimilar to Senescence-associated protein 6. 
AK099573TTCGGCCCAGGCCCAGCNONE 
J013035J20TTCGGCCCAGGCCCAGCNONE 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0659400AK070174GGCTGGGCCGGCENT domain containing protein. 
Os04g0663800013-021-G09GCGGCCCAGCNONE 
AK105321GCGGCCCAGCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0116600AK109828GCTGGGCCCTGGGCCATF-box associated type 1 domain containing protein. 
Os05g0119300004-011-B09GCTGGGCCCCACGCGNONE 
006-063-A03GCTGGGCCCCACGCGNONE 
006-077-E12GCTGGGCCCCACGCGNONE 
006-079-E12GCTGGGCCCCACGCGNONE 
006-100-B11GCTGGGCCCCACGCGNONE 
009-109-A12GCTGGGCCCCACGCGNONE 
009-123-C07GCTGGGCCCCACGCGNONE 
009-163-D09GCTGGGCCCCACGCGNONE 
009-170-D11GCTGGGCCCCACGCGNONE 
009-173-C01GCTGGGCCCCACGCGNONE 
009-192-E01GCTGGGCCCCACGCGNONE 
011-048-G01GCTGGGCCCCACGCGNONE 
AK060883GCTGGGCCCCACGCGNONE 
AK068289GCTGGGCCCCACGCGNONE 
AK071554GCTGGGCCCCACGCGNONE 
AK099495GCTGGGCCCCACGCGXYPPX repeat containing protein. 
AY348312GCTGGGCCCCACGCGNONE 
J013037L16GCTGGGCCCCACGCGNONE 
J013088P04GCTGGGCCCCACGCGNONE 
J013099D14GCTGGGCCCCACGCGNONE 
J013146E19GCTGGGCCCCACGCGNONE 
J013147E18GCTGGGCCCCACGCGNONE 
J023104E19GCTGGGCCCCACGCGNONE 
J023128O20GCTGGGCCCCACGCGNONE 
J023132D16GCTGGGCCCCACGCGNONE 
J023143E13GCTGGGCCCCACGCGNONE 
J033028F15GCTGGGCCCCACGCGNONE 
J033133D24GCTGGGCCCCACGCGNONE 
J053091M07GCTGGGCCCCACGCGNONE 
J075029L15GCTGGGCCCCACGCGNONE 
J075097M12GCTGGGCCCCACGCGNONE 
J075103J11GCTGGGCCCCACGCGNONE 
J075138J10GCTGGGCCCCACGCGNONE 
J075172K18GCTGGGCCCCACGCGNONE 
J080001C15GCTGGGCCCCACGCGNONE 
J080002M13GCTGGGCCCCACGCGNONE 
J080009K01GCTGGGCCCCACGCGNONE 
J080010N01GCTGGGCCCCACGCGNONE 
J080011D23GCTGGGCCCCACGCGNONE 
J080013C13GCTGGGCCCCACGCGNONE 
J080013M16GCTGGGCCCCACGCGNONE 
J080018J02GCTGGGCCCCACGCGNONE 
J080020F03GCTGGGCCCCACGCGNONE 
J080020G05GCTGGGCCCCACGCGNONE 
J080021D05GCTGGGCCCCACGCGNONE 
J080030A19GCTGGGCCCCACGCGNONE 
J080031A16GCTGGGCCCCACGCGNONE 
J080033J23GCTGGGCCCCACGCGNONE 
J080035H07GCTGGGCCCCACGCGNONE 
J080039M24GCTGGGCCCCACGCGNONE 
J080042B16GCTGGGCCCCACGCGNONE 
J080043B03GCTGGGCCCCACGCGNONE 
J080045G01GCTGGGCCCCACGCGNONE 
J080045K17GCTGGGCCCCACGCGNONE 
J080047A09GCTGGGCCCCACGCGNONE 
J080047I22GCTGGGCCCCACGCGNONE 
J080048M14GCTGGGCCCCACGCGNONE 
J080049J02GCTGGGCCCCACGCGNONE 
J080052C15GCTGGGCCCCACGCGNONE 
J080052E11GCTGGGCCCCACGCGNONE 
J080052M22GCTGGGCCCCACGCGNONE 
J080056O21GCTGGGCCCCACGCGNONE 
J080059J04GCTGGGCCCCACGCGNONE 
J080059O17GCTGGGCCCCACGCGNONE 
J080064N04GCTGGGCCCCACGCGNONE 
J080066A03GCTGGGCCCCACGCGNONE 
J080066I22GCTGGGCCCCACGCGNONE 
J080069C13GCTGGGCCCCACGCGNONE 
J080069J03GCTGGGCCCCACGCGNONE 
J080069N04GCTGGGCCCCACGCGNONE 
J080071A01GCTGGGCCCCACGCGNONE 
J080071C03GCTGGGCCCCACGCGNONE 
J080071J02GCTGGGCCCCACGCGNONE 
J080080D17GCTGGGCCCCACGCGNONE 
J080084O06GCTGGGCCCCACGCGNONE 
J080085O20GCTGGGCCCCACGCGNONE 
J080086H15GCTGGGCCCCACGCGNONE 
J080094K06GCTGGGCCCCACGCGNONE 
J080095C05GCTGGGCCCCACGCGNONE 
J080095G04GCTGGGCCCCACGCGNONE 
J080096F03GCTGGGCCCCACGCGNONE 
J080096F20GCTGGGCCCCACGCGNONE 
J090004H05GCTGGGCCCCACGCGNONE 
J090012P10GCTGGGCCCCACGCGNONE 
J090021B09GCTGGGCCCCACGCGNONE 
J090034M08GCTGGGCCCCACGCGNONE 
J090046G21GCTGGGCCCCACGCGNONE 
J090055K24GCTGGGCCCCACGCGNONE 
J090055L05GCTGGGCCCCACGCGNONE 
J090057H17GCTGGGCCCCACGCGNONE 
J090082K21GCTGGGCCCCACGCGNONE 
J100022A07GCTGGGCCCCACGCGNONE 
J100022M02GCTGGGCCCCACGCGNONE 
J100069K11GCTGGGCCCCACGCGNONE 
J100086C24GCTGGGCCCCACGCGNONE 
Os05g0169400AK073439GCTGGGCCGGATCGGGCCGAProtein of unknown function DUF1421 family protein. 
J013110E15GCTGGGCCGGATCGGGCCGANONE 
J033044H02GCTGGGCCGGATCGGGCCGANONE 
Os05g0180700J100062K04GCTGGGCCGGTConserved hypothetical protein. 
Os05g0193800AK058865TTGGCCCAGCNONE 
AK067940TTGGCCCAGCConserved hypothetical protein. 
J065043K19TTGGCCCAGCNONE 
J065095O10TTGGCCCAGCNONE 
J065095O12TTGGCCCAGCNONE 
J080002K02TTGGCCCAGCNONE 
J080012L17TTGGCCCAGCNONE 
J080013J02TTGGCCCAGCNONE 
J080013O11TTGGCCCAGCNONE 
J080020A17TTGGCCCAGCNONE 
J080028E18TTGGCCCAGCNONE 
J080036P11TTGGCCCAGCNONE 
J080042E10TTGGCCCAGCNONE 
J080042L10TTGGCCCAGCNONE 
J080047B11TTGGCCCAGCNONE 
J080048N05TTGGCCCAGCNONE 
J080057E20TTGGCCCAGCNONE 
J080057K13TTGGCCCAGCNONE 
J080058L03TTGGCCCAGCNONE 
J080063H07TTGGCCCAGCNONE 
J080066L23TTGGCCCAGCNONE 
J080069G22TTGGCCCAGCNONE 
J080072E12TTGGCCCAGCNONE 
J080076D06TTGGCCCAGCNONE 
J080077A22TTGGCCCAGCNONE 
J080081A01TTGGCCCAGCNONE 
J080090M13TTGGCCCAGCNONE 
J080093G07TTGGCCCAGCNONE 
J080094O20TTGGCCCAGCNONE 
J080097F13TTGGCCCAGCNONE 
Os05g0255600AK073067CTTGGGCTGGGCCCTThioredoxin domain 2 containing protein. 
J033022A04CTTGGGCTGGGCCCTNONE 
J033022B03CTTGGGCTGGGCCCTNONE 
J033116F22CTTGGGCTGGGCCCTNONE 
J065017H13CTTGGGCTGGGCCCTNONE 
J065038G20CTTGGGCTGGGCCCTNONE 
J065076J16CTTGGGCTGGGCCCTNONE 
J065135D06CTTGGGCTGGGCCCTNONE 
J065168P22CTTGGGCTGGGCCCTNONE 
J065188G21CTTGGGCTGGGCCCTNONE 
J065207C14CTTGGGCTGGGCCCTNONE 
J080014C23CTTGGGCTGGGCCCTNONE 
J080018G12CTTGGGCTGGGCCCTNONE 
J080021F03CTTGGGCTGGGCCCTNONE 
J100068C14CTTGGGCTGGGCCCTNONE 
Os05g0346300009-033-C06GCGGCCCAGCAAGGCCCATCGNONE 
AF529175GCGGCCCAGCAAGGCCCATCGNONE 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
AK103081GCGGCCCAGCAAGGCCCATCGNONE 
AK104191GCGGCCCAGCAAGGCCCATCGNONE 
J013049B09GCGGCCCAGCAAGGCCCATCGNONE 
J023142E24GCGGCCCAGCAAGGCCCATCGNONE 
J033052M14GCGGCCCAGCAAGGCCCATCGNONE 
J033089N04GCGGCCCAGCAAGGCCCATCGNONE 
J033118F01GCGGCCCAGCAAGGCCCATCGNONE 
J065054E07GCGGCCCAGCAAGGCCCATCGNONE 
J065066L18GCGGCCCAGCAAGGCCCATCGNONE 
J065078C21GCGGCCCAGCAAGGCCCATCGNONE 
J065127G23GCGGCCCAGCAAGGCCCATCGNONE 
J065128N24GCGGCCCAGCAAGGCCCATCGNONE 
J065144P17GCGGCCCAGCAAGGCCCATCGNONE 
J065147P14GCGGCCCAGCAAGGCCCATCGNONE 
J065170E16GCGGCCCAGCAAGGCCCATCGNONE 
J065175D17GCGGCCCAGCAAGGCCCATCGNONE 
J065176M05GCGGCCCAGCAAGGCCCATCGNONE 
J065218G20GCGGCCCAGCAAGGCCCATCGNONE 
J090074J12GCGGCCCAGCAAGGCCCATCGNONE 
J100019H16GCGGCCCAGCAAGGCCCATCGNONE 
J100031N24GCGGCCCAGCAAGGCCCATCGNONE 
J100072G08GCGGCCCAGCAAGGCCCATCGNONE 
J100086I23GCGGCCCAGCAAGGCCCATCGNONE 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0377000Os05g0377000GCTGGGCCAGATGGGCCGGASimilar to Acyl carrier protein (ACP). 
Os05g0382000AK072704ATGGCCCAGCNONE 
AK121203ATGGCCCAGCSimilar to ABL164Cp. 
Os05g0386900AK071425GCTGGGCCCCACCCGNONE 
AK073634GCTGGGCCCCACCCGReticulon family protein. 
Os05g0424700AK107848GCCGGCCCAGCSimilar to Copper transporter 1. 
Os05g0451200AK073037GCTGGGCCGGAConserved hypothetical protein. 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0519800AK069435CTGGCCCAGCProtein of unknown function DUF28 family protein. 
J023024L22CTGGCCCAGCNONE 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0543700AK071113GGTGGGGCCCAGCCSimilar to Chaperone protein dnaJ. 
AK103912GGTGGGGCCCAGCCNONE 
Os05g0566300AK099641GGCTGGGCCGA16S rRNA processing protein RimM family protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0597100011-044-C10GGACGGCCCAGCNONE 
AF255711GGACGGCCCAGCNONE 
AK072845GGACGGCCCAGCSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16GGACGGCCCAGCNONE 
J023135M22GGACGGCCCAGCNONE 
J023141B21GGACGGCCCAGCNONE 
J023142J09GGACGGCCCAGCNONE 
J033025E09GGACGGCCCAGCNONE 
J033111A20GGACGGCCCAGCNONE 
J033126I01GGACGGCCCAGCNONE 
Os06g0128400AK064390AAGGCCCAGCNONE 
AK121983AAGGCCCAGCWD40-like domain containing protein. 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0132600006-104-C03GCGGCCCAGCNONE 
AK061226GCGGCCCAGCConserved hypothetical protein. 
AK074010GCGGCCCAGCNONE 
J033076A22GCGGCCCAGCNONE 
Os06g0140400AK059116GGCTGGGCCTCNONE 
AK102692GGCTGGGCCTCSimilar to HAHB-6 (Fragment). 
AY554033GGCTGGGCCTCNONE 
J033103D12GGCTGGGCCTCNONE 
Os06g0156700AK107226GCCGGCCCAGCCCLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCGGCCCAGCCCNONE 
J075023M12GCCGGCCCAGCCCNONE 
J075041C14GCCGGCCCAGCCCNONE 
J075041C19GCCGGCCCAGCCCNONE 
J075064F08GCCGGCCCAGCCCNONE 
J075116I03GCCGGCCCAGCCCNONE 
J075123I02GCCGGCCCAGCCCNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0215100J090029F19GAGGCCCAGCProtein of unknown function DUF1645 family protein. 
Os06g0226600006-083-D04TTGGCCCAGCNONE 
AK061806TTGGCCCAGCNONE 
AK102752TTGGCCCAGCTB2/DP1 and HVA22 related protein family protein. 
J013089J11TTGGCCCAGCNONE 
J033106M05TTGGCCCAGCNONE 
J100044M21TTGGCCCAGCNONE 
J100056E06TTGGCCCAGCNONE 
J100059F06TTGGCCCAGCNONE 
Os06g0266800009-057-G11CGGCCCAGCNONE 
AK062516CGGCCCAGCSimilar to GAST1 protein precursor. 
Os06g0291100J043017O10CTTGGGCTTCCGGCCCAGCHypothetical protein. 
Os06g0320500004-013-F05TTGGCCCAGCNONE 
006-021-B06TTGGCCCAGCNONE 
006-021-D12TTGGCCCAGCNONE 
006-022-A12TTGGCCCAGCNONE 
006-024-B10TTGGCCCAGCNONE 
006-029-F07TTGGCCCAGCNONE 
006-029-H12TTGGCCCAGCNONE 
006-031-A05TTGGCCCAGCNONE 
006-033-C03TTGGCCCAGCNONE 
006-036-B12TTGGCCCAGCNONE 
006-048-C08TTGGCCCAGCNONE 
006-050-F03TTGGCCCAGCNONE 
006-051-C12TTGGCCCAGCNONE 
006-054-C03TTGGCCCAGCNONE 
006-057-D12TTGGCCCAGCNONE 
006-067-F01TTGGCCCAGCNONE 
006-071-G12TTGGCCCAGCNONE 
006-072-G11TTGGCCCAGCNONE 
006-072-H01TTGGCCCAGCNONE 
006-081-E02TTGGCCCAGCNONE 
006-082-A11TTGGCCCAGCNONE 
006-084-A04TTGGCCCAGCNONE 
006-085-C08TTGGCCCAGCNONE 
006-086-D03TTGGCCCAGCNONE 
006-088-B05TTGGCCCAGCNONE 
006-088-G02TTGGCCCAGCNONE 
006-092-G10TTGGCCCAGCNONE 
006-094-D11TTGGCCCAGCNONE 
006-094-E04TTGGCCCAGCNONE 
006-103-G12TTGGCCCAGCNONE 
006-106-G08TTGGCCCAGCNONE 
006-111-E06TTGGCCCAGCNONE 
006-114-C07TTGGCCCAGCNONE 
006-115-A04TTGGCCCAGCNONE 
006-117-G11TTGGCCCAGCNONE 
006-118-G09TTGGCCCAGCNONE 
009-010-F03TTGGCCCAGCNONE 
009-076-G01TTGGCCCAGCNONE 
009-134-E10TTGGCCCAGCNONE 
009-193-D07TTGGCCCAGCNONE 
AF094776TTGGCCCAGCNONE 
AK060904TTGGCCCAGCSimilar to Light-harvesting complex I (Fragment). 
AK098864TTGGCCCAGCNONE 
J013001A03TTGGCCCAGCNONE 
J013098P14TTGGCCCAGCNONE 
J013127B16TTGGCCCAGCNONE 
J013169J24TTGGCCCAGCNONE 
J023084H23TTGGCCCAGCNONE 
J023093F05TTGGCCCAGCNONE 
J033041I05TTGGCCCAGCNONE 
J065196G15TTGGCCCAGCNONE 
J075019K01TTGGCCCAGCNONE 
J075053H16TTGGCCCAGCNONE 
J075055M09TTGGCCCAGCNONE 
J075099G10TTGGCCCAGCNONE 
J075099L23TTGGCCCAGCNONE 
J075127I09TTGGCCCAGCNONE 
J080001C14TTGGCCCAGCNONE 
J080016B11TTGGCCCAGCNONE 
J080029C14TTGGCCCAGCNONE 
J080029I17TTGGCCCAGCNONE 
J080034F13TTGGCCCAGCNONE 
J080039E02TTGGCCCAGCNONE 
J080040N05TTGGCCCAGCNONE 
J080042O17TTGGCCCAGCNONE 
J080043N15TTGGCCCAGCNONE 
J080056K02TTGGCCCAGCNONE 
J080063N15TTGGCCCAGCNONE 
J080069H05TTGGCCCAGCNONE 
J080070N15TTGGCCCAGCNONE 
J080075J22TTGGCCCAGCNONE 
J080076F12TTGGCCCAGCNONE 
J080086G05TTGGCCCAGCNONE 
J090046G07TTGGCCCAGCNONE 
J090059H01TTGGCCCAGCNONE 
J090099C09TTGGCCCAGCNONE 
J100028E12TTGGCCCAGCNONE 
J100048J04TTGGCCCAGCNONE 
J100054O05TTGGCCCAGCNONE 
J100062C09TTGGCCCAGCNONE 
J100075C17TTGGCCCAGCNONE 
J100075C23TTGGCCCAGCNONE 
J100075I23TTGGCCCAGCNONE 
Os06g0355500AK065914GCTGGGCCGCCCAACABromodomain containing protein. 
Os06g0472200AK059428CAGGCCCAGCCNONE 
AK103043CAGGCCCAGCCSimilar to Isoflavone reductase homolog Bet v 6.0101 (Fragment). 
J033117F05CAGGCCCAGCCNONE 
Os06g0530200009-042-B02ACCGGCCCAGCNONE 
009-050-E10ACCGGCCCAGCNONE 
009-060-F07ACCGGCCCAGCNONE 
009-117-H08ACCGGCCCAGCNONE 
009-129-C10ACCGGCCCAGCNONE 
AK073116ACCGGCCCAGCConserved hypothetical protein. 
AK104077ACCGGCCCAGCNONE 
J065032N16ACCGGCCCAGCNONE 
J065153K07ACCGGCCCAGCNONE 
J065169N18ACCGGCCCAGCNONE 
J065190H18ACCGGCCCAGCNONE 
J075127E14ACCGGCCCAGCNONE 
J090008F20ACCGGCCCAGCNONE 
Os06g0564700AK070508GCTGGGCCATSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23GCTGGGCCATNONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0701400013-010-G06GGCTGGGCCAANONE 
AK121229GGCTGGGCCAASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16GGCTGGGCCAANONE 
J033023L12GGCTGGGCCAANONE 
J065043I07GGCTGGGCCAANONE 
J065049E09GGCTGGGCCAANONE 
J065054I05GGCTGGGCCAANONE 
J065072H13GGCTGGGCCAANONE 
J065073L10GGCTGGGCCAANONE 
J065079P09GGCTGGGCCAANONE 
J065112I06GGCTGGGCCAANONE 
J065167C03GGCTGGGCCAANONE 
J065167I03GGCTGGGCCAANONE 
J065176P13GGCTGGGCCAANONE 
J065205M07GGCTGGGCCAANONE 
J075018E13GGCTGGGCCAANONE 
J075021E04GGCTGGGCCAANONE 
J075038F13GGCTGGGCCAANONE 
J075051E05GGCTGGGCCAANONE 
J075067C10GGCTGGGCCAANONE 
J075079A12GGCTGGGCCAANONE 
J075084A13GGCTGGGCCAANONE 
J075103E20GGCTGGGCCAANONE 
J075116E09GGCTGGGCCAANONE 
J075118F15GGCTGGGCCAANONE 
J075121I15GGCTGGGCCAANONE 
J075129B01GGCTGGGCCAANONE 
J075138A22GGCTGGGCCAANONE 
J075159B22GGCTGGGCCAANONE 
J075165I11GGCTGGGCCAANONE 
J075186E09GGCTGGGCCAANONE 
J075190J09GGCTGGGCCAANONE 
J075191I07GGCTGGGCCAANONE 
J080301C05GGCTGGGCCAANONE 
J080302L02GGCTGGGCCAANONE 
J100035C19GGCTGGGCCAANONE 
J100059P06GGCTGGGCCAANONE 
Os06g0704700AK120907GGGGCCCAGCNmrA-like family protein. 
AY224493GGGGCCCAGCNONE 
Os06g0707200006-022-G09GCTGGGCCACNONE 
AK059411GCTGGGCCACNONE 
AK071568GCTGGGCCACProtein of unknown function DUF563 family protein. 
J065101E21GCTGGGCCACNONE 
Os06g0709100006-057-D06GCTGGGCCGTCNONE 
011-040-A08GCTGGGCCGTCNONE 
016-044-A01GCTGGGCCGTCNONE 
AK059732GCTGGGCCGTCNONE 
AK070881GCTGGGCCGTCCyclin-like F-box domain containing protein. 
AK103683GCTGGGCCGTCNONE 
J065026P10GCTGGGCCGTCNONE 
J090017L13GCTGGGCCGTCNONE 
Os06g0715000AK107114GGGCTGGGCCGGCConserved hypothetical protein. 
Os07g0110100009-059-D11GCTGGGCCGAGNONE 
AK071499GCTGGGCCGAGConserved hypothetical protein. 
J065064P17GCTGGGCCGAGNONE 
J065111B09GCTGGGCCGAGNONE 
J075099A14GCTGGGCCGAGNONE 
J075139C23GCTGGGCCGAGNONE 
Os07g0112600AK109561GTGGCCCAGCCConserved hypothetical protein. 
Os07g0136300AK064609GCTGGGCCGAAConserved hypothetical protein. 
Os07g0139400AB096864TGTGGGGCCCAGCNONE 
AK065558TGTGGGGCCCAGCUDP-glucose 4-epimerase family protein. 
AK099140TGTGGGGCCCAGCNONE 
AK099183TGTGGGGCCCAGCNONE 
J013033B01TGTGGGGCCCAGCNONE 
J013157B14TGTGGGGCCCAGCNONE 
J023052E04TGTGGGGCCCAGCNONE 
J023086K05TGTGGGGCCCAGCNONE 
J023099C15TGTGGGGCCCAGCNONE 
J033025C08TGTGGGGCCCAGCNONE 
J033072I24TGTGGGGCCCAGCNONE 
J043020I04TGTGGGGCCCAGCNONE 
J090039I21TGTGGGGCCCAGCNONE 
J090078P20TGTGGGGCCCAGCNONE 
J090084C18TGTGGGGCCCAGCNONE 
J100024F07TGTGGGGCCCAGCNONE 
J100054D22TGTGGGGCCCAGCNONE 
J100062O08TGTGGGGCCCAGCNONE 
Os07g0155200006-036-E03AAAGCCCATTTAGGCCCAGCCNONE 
006-036-E04AAAGCCCATTTAGGCCCAGCCNONE 
AK061006AAAGCCCATTTAGGCCCAGCCProtein of unknown function DUF150 family protein. 
AK104606AAAGCCCATTTAGGCCCAGCCNONE 
Os07g0164100AK111557GCTGGGCCTAHistone deacetylase superfamily protein. 
Os07g0164500J013094M18GGCTGGGCCGTGNONE 
J013153L05GGCTGGGCCGTGNONE 
J023011J18GGCTGGGCCGTGNONE 
J023106H21GGCTGGGCCGTGNONE 
J033105F10GGCTGGGCCGTGNONE 
J065210M20GGCTGGGCCGTGSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05GGCTGGGCCGTGNONE 
J090061C13GGCTGGGCCGTGNONE 
J090074K15GGCTGGGCCGTGNONE 
Os07g0180900006-055-B11CAAGGCCCAGCCCANONE 
006-103-F09CAAGGCCCAGCCCANONE 
011-009-E03CAAGGCCCAGCCCANONE 
011-035-H08CAAGGCCCAGCCCANONE 
014-043-F08CAAGGCCCAGCCCANONE 
AK060711CAAGGCCCAGCCCARibosomal protein L4/L1e family protein. 
AK060963CAAGGCCCAGCCCANONE 
AK104447CAAGGCCCAGCCCANONE 
AK104504CAAGGCCCAGCCCANONE 
AK104629CAAGGCCCAGCCCANONE 
J023003P15CAAGGCCCAGCCCANONE 
J023075H14CAAGGCCCAGCCCANONE 
J033101N17CAAGGCCCAGCCCANONE 
J033132M11CAAGGCCCAGCCCANONE 
J065081C24CAAGGCCCAGCCCANONE 
J080004L10CAAGGCCCAGCCCANONE 
J080009H21CAAGGCCCAGCCCANONE 
J080013F01CAAGGCCCAGCCCANONE 
J080022K24CAAGGCCCAGCCCANONE 
J080023C22CAAGGCCCAGCCCANONE 
J080024M16CAAGGCCCAGCCCANONE 
J080026K06CAAGGCCCAGCCCANONE 
J080030J23CAAGGCCCAGCCCANONE 
J080030L05CAAGGCCCAGCCCANONE 
J080031G03CAAGGCCCAGCCCANONE 
J080033C03CAAGGCCCAGCCCANONE 
J080033D02CAAGGCCCAGCCCANONE 
J080035A11CAAGGCCCAGCCCANONE 
J080035A14CAAGGCCCAGCCCANONE 
J080039E08CAAGGCCCAGCCCANONE 
J080040L15CAAGGCCCAGCCCANONE 
J080040M03CAAGGCCCAGCCCANONE 
J080041L21CAAGGCCCAGCCCANONE 
J080043E09CAAGGCCCAGCCCANONE 
J080048B14CAAGGCCCAGCCCANONE 
J080048O09CAAGGCCCAGCCCANONE 
J080051H01CAAGGCCCAGCCCANONE 
J080052H06CAAGGCCCAGCCCANONE 
J080065K05CAAGGCCCAGCCCANONE 
J080066D10CAAGGCCCAGCCCANONE 
J080066E23CAAGGCCCAGCCCANONE 
J080069F10CAAGGCCCAGCCCANONE 
J080074M06CAAGGCCCAGCCCANONE 
J080075D13CAAGGCCCAGCCCANONE 
J080076G02CAAGGCCCAGCCCANONE 
J080082G15CAAGGCCCAGCCCANONE 
J080082K06CAAGGCCCAGCCCANONE 
J080082P12CAAGGCCCAGCCCANONE 
J080085F01CAAGGCCCAGCCCANONE 
J080090H22CAAGGCCCAGCCCANONE 
J080092D07CAAGGCCCAGCCCANONE 
J080094M03CAAGGCCCAGCCCANONE 
J080094O10CAAGGCCCAGCCCANONE 
J090008I06CAAGGCCCAGCCCANONE 
J100058N20CAAGGCCCAGCCCANONE 
J100060M07CAAGGCCCAGCCCANONE 
J100062M08CAAGGCCCAGCCCANONE 
J100064L07CAAGGCCCAGCCCANONE 
J100073H16CAAGGCCCAGCCCANONE 
J100074C10CAAGGCCCAGCCCANONE 
J100075N06CAAGGCCCAGCCCANONE 
J100087P11CAAGGCCCAGCCCANONE 
J100088B13CAAGGCCCAGCCCANONE 
J100088J16CAAGGCCCAGCCCANONE 
J100088L17CAAGGCCCAGCCCANONE 
J100088O12CAAGGCCCAGCCCANONE 
Os07g0191700AK066389GCGGCCCAGCCCAAGSimilar to AT.I.24-9 protein (Fragment). 
AK103768GCGGCCCAGCCCAAGNONE 
Os07g0222800009-072-E05AAACGGCCCAGCNONE 
AK060442AAACGGCCCAGCNONE 
AK100823AAACGGCCCAGCAcyl carrier protein-like protein. 
AK103131AAACGGCCCAGCNONE 
AY224456AAACGGCCCAGCNONE 
J075026H13AAACGGCCCAGCNONE 
J075142G06AAACGGCCCAGCNONE 
J100033K08AAACGGCCCAGCNONE 
Os07g0242600AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0245100J023048C16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J023110L14CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053023B18CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053031L17CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065035I22CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065043D21CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065072L16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065214I23CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
Os07g0301200AB110202GCCGGCCCGGCACGGCCCAGCNONE 
AB110202GCTGGGCCGGGCCGNONE 
AK073463GCCGGCCCGGCACGGCCCAGCSimilar to RNA helicase (Fragment). 
AK073463GCTGGGCCGGGCCGSimilar to RNA helicase (Fragment). 
Os07g0406300AK064867TCGGCCCAGCSimilar to Glucose-6-phosphate 1-dehydrogenase precursor (EC 1.1.1.49). 
AK099891TCGGCCCAGCNONE 
AY339367TCGGCCCAGCNONE 
Os07g0459400AK101767GCTGGGCCCACTRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
Os07g0472400AK105684GCTGGGCCAAATGGGCProtein kinase domain containing protein. 
Os07g0480900012-002-E04GCTGGGCCTTNONE 
AK063422GCTGGGCCTTSimilar to Cysteine protease (Fragment). 
J065073E02GCTGGGCCTTNONE 
J065122P21GCTGGGCCTTNONE 
J075108D13GCTGGGCCTTNONE 
J075147K14GCTGGGCCTTNONE 
Os07g0498900AK073263ATGGCCCAGCProtein of unknown function DUF231, plant domain containing protein. 
AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20ATGGCCCAGCNONE 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19ATGGCCCAGCNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0537300015-019-C12GCTGGGCCCCACCTGTCSimilar to Serine/threonine kinase receptor-like protein. 
J033140L16GCTGGGCCCCACCTGTCNONE 
J043034B12GCTGGGCCCCACCTGTCNONE 
Os07g0541500AK111550CTGGCCCAGCSimilar to KI domain interacting kinase 1. 
Os07g0541600AK110523CTGGCCCAGCHypothetical protein. 
Os07g0555400AK070977GCTGGGCCGGGCCGCCCATTTConserved hypothetical protein. 
Os07g0562700003-111-G08GCTGGGCCGAAANONE 
004-013-E07GCTGGGCCGAAANONE 
006-021-D03GCTGGGCCGAAANONE 
006-021-D07GCTGGGCCGAAANONE 
006-021-F09GCTGGGCCGAAANONE 
006-023-D01GCTGGGCCGAAANONE 
006-024-F04GCTGGGCCGAAANONE 
006-024-G09GCTGGGCCGAAANONE 
006-024-G11GCTGGGCCGAAANONE 
006-025-A10GCTGGGCCGAAANONE 
006-025-B08GCTGGGCCGAAANONE 
006-025-E10GCTGGGCCGAAANONE 
006-025-F10GCTGGGCCGAAANONE 
006-026-B04GCTGGGCCGAAANONE 
006-026-C08GCTGGGCCGAAANONE 
006-026-D03GCTGGGCCGAAANONE 
006-026-F03GCTGGGCCGAAANONE 
006-026-F08GCTGGGCCGAAANONE 
006-026-F12GCTGGGCCGAAANONE 
006-027-A10GCTGGGCCGAAANONE 
006-027-C03GCTGGGCCGAAANONE 
006-028-C03GCTGGGCCGAAANONE 
006-029-E02GCTGGGCCGAAANONE 
006-029-G05GCTGGGCCGAAANONE 
006-030-A10GCTGGGCCGAAANONE 
006-030-C06GCTGGGCCGAAANONE 
006-030-D03GCTGGGCCGAAANONE 
006-030-D06GCTGGGCCGAAANONE 
006-030-G05GCTGGGCCGAAANONE 
006-031-B10GCTGGGCCGAAANONE 
006-031-D04GCTGGGCCGAAANONE 
006-031-D11GCTGGGCCGAAANONE 
006-031-H09GCTGGGCCGAAANONE 
006-032-C09GCTGGGCCGAAANONE 
006-032-H09GCTGGGCCGAAANONE 
006-033-B02GCTGGGCCGAAANONE 
006-033-B09GCTGGGCCGAAANONE 
006-033-E01GCTGGGCCGAAANONE 
006-033-F06GCTGGGCCGAAANONE 
006-033-G03GCTGGGCCGAAANONE 
006-034-A08GCTGGGCCGAAANONE 
006-034-C09GCTGGGCCGAAANONE 
006-034-F06GCTGGGCCGAAANONE 
006-035-B12GCTGGGCCGAAANONE 
006-035-C12GCTGGGCCGAAANONE 
006-035-H04GCTGGGCCGAAANONE 
006-035-H12GCTGGGCCGAAANONE 
006-036-A05GCTGGGCCGAAANONE 
006-036-A09GCTGGGCCGAAANONE 
006-036-B10GCTGGGCCGAAANONE 
006-036-C03GCTGGGCCGAAANONE 
006-036-E06GCTGGGCCGAAANONE 
006-037-H11GCTGGGCCGAAANONE 
006-038-G01GCTGGGCCGAAANONE 
006-039-B01GCTGGGCCGAAANONE 
006-039-B12GCTGGGCCGAAANONE 
006-039-C02GCTGGGCCGAAANONE 
006-039-E06GCTGGGCCGAAANONE 
006-039-G12GCTGGGCCGAAANONE 
006-040-G07GCTGGGCCGAAANONE 
006-041-H04GCTGGGCCGAAANONE 
006-042-A11GCTGGGCCGAAANONE 
006-042-E07GCTGGGCCGAAANONE 
006-042-F12GCTGGGCCGAAANONE 
006-043-C01GCTGGGCCGAAANONE 
006-045-H12GCTGGGCCGAAANONE 
006-046-A12GCTGGGCCGAAANONE 
006-046-F03GCTGGGCCGAAANONE 
006-047-A07GCTGGGCCGAAANONE 
006-047-A09GCTGGGCCGAAANONE 
006-047-E10GCTGGGCCGAAANONE 
006-047-G12GCTGGGCCGAAANONE 
006-048-B04GCTGGGCCGAAANONE 
006-049-D01GCTGGGCCGAAANONE 
006-049-G02GCTGGGCCGAAANONE 
006-049-G10GCTGGGCCGAAANONE 
006-049-H04GCTGGGCCGAAANONE 
006-050-D05GCTGGGCCGAAANONE 
006-050-F05GCTGGGCCGAAANONE 
006-051-B05GCTGGGCCGAAANONE 
006-051-G12GCTGGGCCGAAANONE 
006-052-D12GCTGGGCCGAAANONE 
006-053-D06GCTGGGCCGAAANONE 
006-054-H02GCTGGGCCGAAANONE 
006-055-A03GCTGGGCCGAAANONE 
006-055-C01GCTGGGCCGAAANONE 
006-055-E07GCTGGGCCGAAANONE 
006-055-H06GCTGGGCCGAAANONE 
006-056-F06GCTGGGCCGAAANONE 
006-057-D03GCTGGGCCGAAANONE 
006-057-D05GCTGGGCCGAAANONE 
006-057-G01GCTGGGCCGAAANONE 
006-058-A03GCTGGGCCGAAANONE 
006-058-B06GCTGGGCCGAAANONE 
006-059-A09GCTGGGCCGAAANONE 
006-059-H11GCTGGGCCGAAANONE 
006-060-A04GCTGGGCCGAAANONE 
006-060-A09GCTGGGCCGAAANONE 
006-060-C11GCTGGGCCGAAANONE 
006-060-D08GCTGGGCCGAAANONE 
006-061-A04GCTGGGCCGAAANONE 
006-061-E01GCTGGGCCGAAANONE 
006-061-G10GCTGGGCCGAAANONE 
006-061-H12GCTGGGCCGAAANONE 
006-062-B07GCTGGGCCGAAANONE 
006-062-G03GCTGGGCCGAAANONE 
006-062-H12GCTGGGCCGAAANONE 
006-063-D05GCTGGGCCGAAANONE 
006-063-E04GCTGGGCCGAAANONE 
006-063-F05GCTGGGCCGAAANONE 
006-063-G05GCTGGGCCGAAANONE 
006-064-B07GCTGGGCCGAAANONE 
006-065-C11GCTGGGCCGAAANONE 
006-065-H02GCTGGGCCGAAANONE 
006-067-C12GCTGGGCCGAAANONE 
006-067-F10GCTGGGCCGAAANONE 
006-068-E02GCTGGGCCGAAANONE 
006-068-G04GCTGGGCCGAAANONE 
006-069-A02GCTGGGCCGAAANONE 
006-071-A07GCTGGGCCGAAANONE 
006-072-F11GCTGGGCCGAAANONE 
006-072-F12GCTGGGCCGAAANONE 
006-073-E12GCTGGGCCGAAANONE 
006-073-F08GCTGGGCCGAAANONE 
006-073-H07GCTGGGCCGAAANONE 
006-074-A07GCTGGGCCGAAANONE 
006-075-A12GCTGGGCCGAAANONE 
006-075-B01GCTGGGCCGAAANONE 
006-075-H10GCTGGGCCGAAANONE 
006-075-H12GCTGGGCCGAAANONE 
006-076-B06GCTGGGCCGAAANONE 
006-077-A09GCTGGGCCGAAANONE 
006-077-D05GCTGGGCCGAAANONE 
006-078-C11GCTGGGCCGAAANONE 
006-078-D12GCTGGGCCGAAANONE 
006-078-E02GCTGGGCCGAAANONE 
006-079-A01GCTGGGCCGAAANONE 
006-079-E02GCTGGGCCGAAANONE 
006-079-F03GCTGGGCCGAAANONE 
006-080-G11GCTGGGCCGAAANONE 
006-081-C02GCTGGGCCGAAANONE 
006-081-C08GCTGGGCCGAAANONE 
006-082-B06GCTGGGCCGAAANONE 
006-082-C11GCTGGGCCGAAANONE 
006-082-H04GCTGGGCCGAAANONE 
006-083-E04GCTGGGCCGAAANONE 
006-083-H12GCTGGGCCGAAANONE 
006-084-C08GCTGGGCCGAAANONE 
006-084-E07GCTGGGCCGAAANONE 
006-084-E10GCTGGGCCGAAANONE 
006-085-E06GCTGGGCCGAAANONE 
006-085-E10GCTGGGCCGAAANONE 
006-086-F06GCTGGGCCGAAANONE 
006-087-D08GCTGGGCCGAAANONE 
006-087-F03GCTGGGCCGAAANONE 
006-087-F10GCTGGGCCGAAANONE 
006-087-G07GCTGGGCCGAAANONE 
006-088-A02GCTGGGCCGAAANONE 
006-089-A04GCTGGGCCGAAANONE 
006-089-B12GCTGGGCCGAAANONE 
006-089-D06GCTGGGCCGAAANONE 
006-089-D10GCTGGGCCGAAANONE 
006-089-H05GCTGGGCCGAAANONE 
006-090-C06GCTGGGCCGAAANONE 
006-091-A03GCTGGGCCGAAANONE 
006-091-E04GCTGGGCCGAAANONE 
006-091-H12GCTGGGCCGAAANONE 
006-092-A08GCTGGGCCGAAANONE 
006-092-F01GCTGGGCCGAAANONE 
006-092-G08GCTGGGCCGAAANONE 
006-093-B12GCTGGGCCGAAANONE 
006-093-D04GCTGGGCCGAAANONE 
006-093-F01GCTGGGCCGAAANONE 
006-094-A08GCTGGGCCGAAANONE 
006-094-F01GCTGGGCCGAAANONE 
006-094-F03GCTGGGCCGAAANONE 
006-095-C12GCTGGGCCGAAANONE 
006-095-E10GCTGGGCCGAAANONE 
006-095-E12GCTGGGCCGAAANONE 
006-095-G06GCTGGGCCGAAANONE 
006-096-B12GCTGGGCCGAAANONE 
006-096-C12GCTGGGCCGAAANONE 
006-096-G02GCTGGGCCGAAANONE 
006-097-D01GCTGGGCCGAAANONE 
006-097-D07GCTGGGCCGAAANONE 
006-097-F04GCTGGGCCGAAANONE 
006-098-C07GCTGGGCCGAAANONE 
006-098-D04GCTGGGCCGAAANONE 
006-099-E06GCTGGGCCGAAANONE 
006-099-F02GCTGGGCCGAAANONE 
006-099-F10GCTGGGCCGAAANONE 
006-100-A07GCTGGGCCGAAANONE 
006-100-B10GCTGGGCCGAAANONE 
006-100-G01GCTGGGCCGAAANONE 
006-100-H06GCTGGGCCGAAANONE 
006-101-D01GCTGGGCCGAAANONE 
006-101-F03GCTGGGCCGAAANONE 
006-102-A12GCTGGGCCGAAANONE 
006-102-B11GCTGGGCCGAAANONE 
006-102-C03GCTGGGCCGAAANONE 
006-102-F11GCTGGGCCGAAANONE 
006-103-A08GCTGGGCCGAAANONE 
006-103-B06GCTGGGCCGAAANONE 
006-103-D01GCTGGGCCGAAANONE 
006-103-F02GCTGGGCCGAAANONE 
006-104-B02GCTGGGCCGAAANONE 
006-104-C01GCTGGGCCGAAANONE 
006-104-F09GCTGGGCCGAAANONE 
006-104-H11GCTGGGCCGAAANONE 
006-105-A03GCTGGGCCGAAANONE 
006-105-D09GCTGGGCCGAAANONE 
006-106-B10GCTGGGCCGAAANONE 
006-107-A06GCTGGGCCGAAANONE 
006-107-C04GCTGGGCCGAAANONE 
006-107-E03GCTGGGCCGAAANONE 
006-107-F05GCTGGGCCGAAANONE 
006-108-C09GCTGGGCCGAAANONE 
006-109-C09GCTGGGCCGAAANONE 
006-109-D10GCTGGGCCGAAANONE 
006-109-E06GCTGGGCCGAAANONE 
006-109-E10GCTGGGCCGAAANONE 
006-110-A06GCTGGGCCGAAANONE 
006-110-C11GCTGGGCCGAAANONE 
006-111-A02GCTGGGCCGAAANONE 
006-111-F02GCTGGGCCGAAANONE 
006-112-A08GCTGGGCCGAAANONE 
006-112-H06GCTGGGCCGAAANONE 
006-113-A08GCTGGGCCGAAANONE 
006-113-B01GCTGGGCCGAAANONE 
006-113-C05GCTGGGCCGAAANONE 
006-113-D01GCTGGGCCGAAANONE 
006-113-D04GCTGGGCCGAAANONE 
006-113-D06GCTGGGCCGAAANONE 
006-113-E09GCTGGGCCGAAANONE 
006-114-F06GCTGGGCCGAAANONE 
006-116-B02GCTGGGCCGAAANONE 
006-117-B07GCTGGGCCGAAANONE 
006-117-G04GCTGGGCCGAAANONE 
006-118-D01GCTGGGCCGAAANONE 
006-118-D12GCTGGGCCGAAANONE 
006-118-F12GCTGGGCCGAAANONE 
006-118-G12GCTGGGCCGAAANONE 
006-119-B08GCTGGGCCGAAANONE 
006-120-E09GCTGGGCCGAAANONE 
006-120-G05GCTGGGCCGAAANONE 
006-120-G10GCTGGGCCGAAANONE 
009-022-D12GCTGGGCCGAAANONE 
009-051-H08GCTGGGCCGAAANONE 
009-065-F05GCTGGGCCGAAANONE 
009-070-A06GCTGGGCCGAAANONE 
009-073-B07GCTGGGCCGAAANONE 
009-092-C10GCTGGGCCGAAANONE 
009-093-D03GCTGGGCCGAAANONE 
009-103-B04GCTGGGCCGAAANONE 
009-106-H08GCTGGGCCGAAANONE 
009-120-B05GCTGGGCCGAAANONE 
009-121-F05GCTGGGCCGAAANONE 
009-122-B04GCTGGGCCGAAANONE 
009-122-D08GCTGGGCCGAAANONE 
009-123-F07GCTGGGCCGAAANONE 
009-125-G02GCTGGGCCGAAANONE 
009-128-F02GCTGGGCCGAAANONE 
009-128-H07GCTGGGCCGAAANONE 
009-131-C06GCTGGGCCGAAANONE 
009-132-F08GCTGGGCCGAAANONE 
009-133-G08GCTGGGCCGAAANONE 
009-134-D09GCTGGGCCGAAANONE 
009-135-F01GCTGGGCCGAAANONE 
009-149-E11GCTGGGCCGAAANONE 
009-153-H04GCTGGGCCGAAANONE 
009-161-E04GCTGGGCCGAAANONE 
009-163-A09GCTGGGCCGAAANONE 
009-163-C05GCTGGGCCGAAANONE 
009-163-E10GCTGGGCCGAAANONE 
009-165-F04GCTGGGCCGAAANONE 
009-166-A07GCTGGGCCGAAANONE 
009-169-G12GCTGGGCCGAAANONE 
009-172-G08GCTGGGCCGAAANONE 
009-179-E06GCTGGGCCGAAANONE 
009-181-F09GCTGGGCCGAAANONE 
009-190-G07GCTGGGCCGAAANONE 
009-191-D01GCTGGGCCGAAANONE 
009-195-G02GCTGGGCCGAAANONE 
AF022738GCTGGGCCGAAANONE 
AK061512GCTGGGCCGAAANONE 
AK068972GCTGGGCCGAAANONE 
AK103926GCTGGGCCGAAANONE 
AK103999GCTGGGCCGAAANONE 
AK104224GCTGGGCCGAAANONE 
AK104465GCTGGGCCGAAANONE 
AK104495GCTGGGCCGAAANONE 
AK109399GCTGGGCCGAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCTGGGCCGAAANONE 
AK119545GCTGGGCCGAAANONE 
J013043L10GCTGGGCCGAAANONE 
J013050A09GCTGGGCCGAAANONE 
J023001G03GCTGGGCCGAAANONE 
J023024D14GCTGGGCCGAAANONE 
J023072E11GCTGGGCCGAAANONE 
J023149E18GCTGGGCCGAAANONE 
J033029B16GCTGGGCCGAAANONE 
J065001O21GCTGGGCCGAAANONE 
J065035B04GCTGGGCCGAAANONE 
J065044D18GCTGGGCCGAAANONE 
J065057F12GCTGGGCCGAAANONE 
J065060A11GCTGGGCCGAAANONE 
J065062G15GCTGGGCCGAAANONE 
J065080F13GCTGGGCCGAAANONE 
J065084N12GCTGGGCCGAAANONE 
J065101D02GCTGGGCCGAAANONE 
J065107C07GCTGGGCCGAAANONE 
J065112N24GCTGGGCCGAAANONE 
J065141I16GCTGGGCCGAAANONE 
J065147D05GCTGGGCCGAAANONE 
J065167H02GCTGGGCCGAAANONE 
J065207K23GCTGGGCCGAAANONE 
J075008E16GCTGGGCCGAAANONE 
J075014F03GCTGGGCCGAAANONE 
J075015O17GCTGGGCCGAAANONE 
J075020H20GCTGGGCCGAAANONE 
J075021E22GCTGGGCCGAAANONE 
J075023N13GCTGGGCCGAAANONE 
J075028H10GCTGGGCCGAAANONE 
J075040F20GCTGGGCCGAAANONE 
J075051L23GCTGGGCCGAAANONE 
J075069G16GCTGGGCCGAAANONE 
J075084F24GCTGGGCCGAAANONE 
J075090H09GCTGGGCCGAAANONE 
J075092M21GCTGGGCCGAAANONE 
J075110C10GCTGGGCCGAAANONE 
J075111J12GCTGGGCCGAAANONE 
J075114L04GCTGGGCCGAAANONE 
J075139E02GCTGGGCCGAAANONE 
J075160M10GCTGGGCCGAAANONE 
J075176J03GCTGGGCCGAAANONE 
J075183I17GCTGGGCCGAAANONE 
J075191N10GCTGGGCCGAAANONE 
J075193D07GCTGGGCCGAAANONE 
J075194M16GCTGGGCCGAAANONE 
J075197K04GCTGGGCCGAAANONE 
J080032I11GCTGGGCCGAAANONE 
J080076M11GCTGGGCCGAAANONE 
J080311J08GCTGGGCCGAAANONE 
J080317E05GCTGGGCCGAAANONE 
J090034L08GCTGGGCCGAAANONE 
J100040D19GCTGGGCCGAAANONE 
J100074C11GCTGGGCCGAAANONE 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0578600AK067155GCTGGGCCTTSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065GCTGGGCCTTNONE 
Os07g0585800006-106-A05AACTGGGCCCAGCNONE 
AK066419AACTGGGCCCAGCNONE 
AK105064AACTGGGCCCAGCSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01AACTGGGCCCAGCNONE 
J065085B08AACTGGGCCCAGCNONE 
J065099I23AACTGGGCCCAGCNONE 
J065169A01AACTGGGCCCAGCNONE 
J065187N13AACTGGGCCCAGCNONE 
J065191L18AACTGGGCCCAGCNONE 
J065194D04AACTGGGCCCAGCNONE 
J065211M09AACTGGGCCCAGCNONE 
J065212I02AACTGGGCCCAGCNONE 
J090003C10AACTGGGCCCAGCNONE 
J090025O11AACTGGGCCCAGCNONE 
J090092F10AACTGGGCCCAGCNONE 
J100055A04AACTGGGCCCAGCNONE 
J100064A01AACTGGGCCCAGCNONE 
J100080L02AACTGGGCCCAGCNONE 
Os07g0588800015-027-E02GCTGGGCCGCNONE 
AK070635GCTGGGCCGCNONE 
AK103183GCTGGGCCGCConserved hypothetical protein. 
J023058H18GCTGGGCCGCNONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0626600Os07g0626600GCTGGGCCTTSimilar to Embryogenic callus protein-like. 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0673700AK071934TCGGCCCAGCCCACCCCyclin-like F-box domain containing protein. 
AK107556TCGGCCCAGCCCACCCNONE 
Os07g0681700AK103213TCCGGCCCAGCGlycosyl transferase, family 8 protein. 
AK103213TTTCGGCCCAGCGlycosyl transferase, family 8 protein. 
Os07g0683900004-013-C10GGTGGGCCCAGCNONE 
006-064-B09GGTGGGCCCAGCNONE 
006-084-B03GGTGGGCCCAGCNONE 
006-102-F10GGTGGGCCCAGCNONE 
011-057-F12GGTGGGCCCAGCNONE 
011-098-A02GGTGGGCCCAGCNONE 
012-012-H02GGTGGGCCCAGCNONE 
013-099-D06GGTGGGCCCAGCNONE 
AK060899GGTGGGCCCAGCNONE 
AK103324GGTGGGCCCAGCRicin B-related lectin domain containing protein. 
J013098G05GGTGGGCCCAGCNONE 
J023138L02GGTGGGCCCAGCNONE 
J033030M14GGTGGGCCCAGCNONE 
J033111J21GGTGGGCCCAGCNONE 
J033125K07GGTGGGCCCAGCNONE 
J033131O15GGTGGGCCCAGCNONE 
J033135I19GGTGGGCCCAGCNONE 
J043016G14GGTGGGCCCAGCNONE 
J043020F07GGTGGGCCCAGCNONE 
J043022F24GGTGGGCCCAGCNONE 
J043022J03GGTGGGCCCAGCNONE 
J065005N24GGTGGGCCCAGCNONE 
J065083B02GGTGGGCCCAGCNONE 
J065093J20GGTGGGCCCAGCNONE 
J065096G16GGTGGGCCCAGCNONE 
J065096H24GGTGGGCCCAGCNONE 
J065111H06GGTGGGCCCAGCNONE 
J065128C09GGTGGGCCCAGCNONE 
J065136L13GGTGGGCCCAGCNONE 
J065137I02GGTGGGCCCAGCNONE 
J065147B15GGTGGGCCCAGCNONE 
J065163I16GGTGGGCCCAGCNONE 
J075013E11GGTGGGCCCAGCNONE 
J075018H08GGTGGGCCCAGCNONE 
J075019C23GGTGGGCCCAGCNONE 
J075051C07GGTGGGCCCAGCNONE 
J075062A21GGTGGGCCCAGCNONE 
J075065K07GGTGGGCCCAGCNONE 
J075095E05GGTGGGCCCAGCNONE 
J075128H08GGTGGGCCCAGCNONE 
J075137J06GGTGGGCCCAGCNONE 
J075180M24GGTGGGCCCAGCNONE 
J075193A04GGTGGGCCCAGCNONE 
J075198J06GGTGGGCCCAGCNONE 
J075199C21GGTGGGCCCAGCNONE 
J090003A20GGTGGGCCCAGCNONE 
J090021J16GGTGGGCCCAGCNONE 
J090029K24GGTGGGCCCAGCNONE 
J090055L04GGTGGGCCCAGCNONE 
J090058E17GGTGGGCCCAGCNONE 
J090069J18GGTGGGCCCAGCNONE 
J090081H06GGTGGGCCCAGCNONE 
J100028P13GGTGGGCCCAGCNONE 
J100034E19GGTGGGCCCAGCNONE 
J100046H21GGTGGGCCCAGCNONE 
J100048P04GGTGGGCCCAGCNONE 
J100052M01GGTGGGCCCAGCNONE 
J100066L01GGTGGGCCCAGCNONE 
J100078H20GGTGGGCCCAGCNONE 
J100081K17GGTGGGCCCAGCNONE 
Y08987GGTGGGCCCAGCNONE 
Os07g0685800AK064532GCTGGGCCGGCGlucose/ribitol dehydrogenase family protein. 
Os07g0686100AK110915GGTTGGGCCCAGCCAGCCCAGSimilar to Abscisic acid responsive elements-binding factor. 
Os07g0695100AB189039GTGGCCCAGCNONE 
AB189042GTGGCCCAGCNONE 
AK059514GTGGCCCAGCNONE 
AK066112GTGGCCCAGCCheY-like domain containing protein. 
J013051N02GTGGCCCAGCNONE 
J013127M02GTGGCCCAGCNONE 
J023007I05GTGGCCCAGCNONE 
Os08g0127600AK058365CCCACGCGTGCTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CCCACGCGTGCTGGGCCCCNONE 
J013149L10CCCACGCGTGCTGGGCCCCNONE 
J075027H17CCCACGCGTGCTGGGCCCCNONE 
J075060F10CCCACGCGTGCTGGGCCCCNONE 
Os08g0127700012-086-F03GGGGCCCAGCACGCGTGGGNONE 
AK059350GGGGCCCAGCACGCGTGGGNONE 
AK099242GGGGCCCAGCACGCGTGGGNONE 
AK121348GGGGCCCAGCACGCGTGGGConserved hypothetical protein. 
J033027J18GGGGCCCAGCACGCGTGGGNONE 
J065012F22GGGGCCCAGCACGCGTGGGNONE 
J065046N17GGGGCCCAGCACGCGTGGGNONE 
J065197B02GGGGCCCAGCACGCGTGGGNONE 
J100018P04GGGGCCCAGCACGCGTGGGNONE 
J100052C14GGGGCCCAGCACGCGTGGGNONE 
J100083A12GGGGCCCAGCACGCGTGGGNONE 
Os08g0172300AK111274TTGGCCCAGCHAT dimerisation domain containing protein. 
J065184J06TTGGCCCAGCNONE 
Os08g0234400J065186B17GGCCGTCCACGTGGCCCAGCConserved hypothetical protein. 
Os08g0323400006-027-G07TTGGCCCAGCNONE 
009-152-D11TTGGCCCAGCNONE 
009-160-B08TTGGCCCAGCNONE 
AK068722TTGGCCCAGCSimilar to Rubredoxin (Rd). 
AK104226TTGGCCCAGCNONE 
J065086N20TTGGCCCAGCNONE 
J065138B16TTGGCCCAGCNONE 
J065138O10TTGGCCCAGCNONE 
J075089M06TTGGCCCAGCNONE 
Os08g0375800AK101199AGCCCAACGCGGCCCAGCProtein prenyltransferase domain containing protein. 
J033030L22AGCCCAACGCGGCCCAGCNONE 
Os08g0390700009-094-H10GGGCTGGGCCTCNONE 
AK062714GGGCTGGGCCTCSimilar to 2-oxoglutarate-dependent oxygenase. 
Os08g0412100AK072641TACGGCCCAGCDisease resistance protein family protein. 
Os08g0414300AK072217ATGGCCCAGCCConserved hypothetical protein. 
J065039C07ATGGCCCAGCCNONE 
J065098N11ATGGCCCAGCCNONE 
J065120J15ATGGCCCAGCCNONE 
J075076H12ATGGCCCAGCCNONE 
J075101N16ATGGCCCAGCCNONE 
J080010A07ATGGCCCAGCCNONE 
J080023C16ATGGCCCAGCCNONE 
J080027G22ATGGCCCAGCCNONE 
J080053D02ATGGCCCAGCCNONE 
J080065E17ATGGCCCAGCCNONE 
J080068C15ATGGCCCAGCCNONE 
J090061J10ATGGCCCAGCCNONE 
Os08g0427900AK103217GGGCTGGGCCGTASimilar to Hin19 (Fragment). 
AK109208GGGCTGGGCCGTANONE 
J080005C08GGGCTGGGCCGTANONE 
J080010B10GGGCTGGGCCGTANONE 
J080013C21GGGCTGGGCCGTANONE 
J080022L12GGGCTGGGCCGTANONE 
J080029C08GGGCTGGGCCGTANONE 
J080029G09GGGCTGGGCCGTANONE 
J080035L14GGGCTGGGCCGTANONE 
J080040M20GGGCTGGGCCGTANONE 
J080043M18GGGCTGGGCCGTANONE 
J080045K15GGGCTGGGCCGTANONE 
J080048I17GGGCTGGGCCGTANONE 
J080051P16GGGCTGGGCCGTANONE 
J080053L16GGGCTGGGCCGTANONE 
J080059P14GGGCTGGGCCGTANONE 
J080063E13GGGCTGGGCCGTANONE 
J080075N18GGGCTGGGCCGTANONE 
J080077E05GGGCTGGGCCGTANONE 
J080080H23GGGCTGGGCCGTANONE 
J080081L16GGGCTGGGCCGTANONE 
J080083F17GGGCTGGGCCGTANONE 
J080085C23GGGCTGGGCCGTANONE 
J080086A12GGGCTGGGCCGTANONE 
J080088N06GGGCTGGGCCGTANONE 
J080092G10GGGCTGGGCCGTANONE 
J080093F04GGGCTGGGCCGTANONE 
J080094C03GGGCTGGGCCGTANONE 
J090032L12GGGCTGGGCCGTANONE 
Os08g0433200013-023-E07AAGGCCCAGCNONE 
AK099471AAGGCCCAGCConserved hypothetical protein. 
J013024A05AAGGCCCAGCNONE 
J013065N03AAGGCCCAGCNONE 
J023111A21AAGGCCCAGCNONE 
J065035F10AAGGCCCAGCNONE 
J065083H01AAGGCCCAGCNONE 
J065159E03AAGGCCCAGCNONE 
J065186A03AAGGCCCAGCNONE 
J075032B02AAGGCCCAGCNONE 
J075038L14AAGGCCCAGCNONE 
J075047N21AAGGCCCAGCNONE 
J075076H05AAGGCCCAGCNONE 
J075110C08AAGGCCCAGCNONE 
J090096K17AAGGCCCAGCNONE 
Os08g0442300006-067-F05GCTGGGCCAGGCCGGGCCGGANONE 
AK059843GCTGGGCCAGGCCGGGCCGGANONE 
AK071719GCTGGGCCAGGCCGGGCCGGASimilar to Calcineurin-like protein. 
AK102411GCTGGGCCAGGCCGGGCCGGANONE 
J023108H11GCTGGGCCAGGCCGGGCCGGANONE 
J033092P05GCTGGGCCAGGCCGGGCCGGANONE 
J075109C09GCTGGGCCAGGCCGGGCCGGANONE 
J090070B02GCTGGGCCAGGCCGGGCCGGANONE 
J090076M14GCTGGGCCAGGCCGGGCCGGANONE 
J100064B16GCTGGGCCAGGCCGGGCCGGANONE 
Os08g0465800AY428025CACGGCCCAGCCNONE 
J013029M24CACGGCCCAGCCNONE 
J013030K15CACGGCCCAGCCNONE 
J013048G12CACGGCCCAGCCNONE 
J023041H10CACGGCCCAGCCNONE 
J023065G12CACGGCCCAGCCNONE 
J023074A02CACGGCCCAGCCNONE 
J023092B20CACGGCCCAGCCNONE 
J023147A01CACGGCCCAGCCNONE 
J023150L07CACGGCCCAGCCNONE 
J043007P21CACGGCCCAGCCNONE 
J090004P19CACGGCCCAGCCNONE 
J100030K13CACGGCCCAGCCNONE 
J100060N03CACGGCCCAGCCNONE 
Os08g0480000006-053-A10GCCGGCCCAGCCNONE 
AK067748GCCGGCCCAGCCMulti antimicrobial extrusion protein MatE family protein. 
J013118K06GCCGGCCCAGCCNONE 
Os08g0517600009-066-H05GCTGGGCCCAAACNONE 
AK073374GCTGGGCCCAAACNONE 
AK105385GCTGGGCCCAAACSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07GCTGGGCCCAAACNONE 
J075004A12GCTGGGCCCAAACNONE 
J075062F16GCTGGGCCCAAACNONE 
J075115K05GCTGGGCCCAAACNONE 
J075116H09GCTGGGCCCAAACNONE 
Os08g0520100AK059686GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCNONE 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
Os08g0526400J065038L03GGCTGGGCCTTNONE 
J065048D07GGCTGGGCCTTNONE 
J065057B11GGCTGGGCCTTNONE 
J065149F16GGCTGGGCCTTNONE 
J065152P03GGCTGGGCCTTNONE 
J065192J12GGCTGGGCCTTNONE 
Os08g0529400J100040D07ATGGCCCAGCCyclin-like F-box domain containing protein. 
Os08g0550100AB070258GACGGCCCAGCTCAGCCCAGCNONE 
AK061287GACGGCCCAGCTCAGCCCAGCSimilar to 26S proteasome subunit RPN3a. 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0120033AK069069TTGGCCCAGCCConserved hypothetical protein. 
Os09g0296400J090084M08GCCCGGCCCAGCCConserved hypothetical protein. 
Os09g0325100J080009O19GCGGCCCAGCCNONE 
J080011H14GCGGCCCAGCCConserved hypothetical protein. 
J080014F14GCGGCCCAGCCNONE 
J080014M09GCGGCCCAGCCNONE 
J080014N20GCGGCCCAGCCNONE 
J080018K13GCGGCCCAGCCNONE 
J080023C08GCGGCCCAGCCNONE 
J080023C09GCGGCCCAGCCNONE 
J080023K14GCGGCCCAGCCNONE 
J080025I09GCGGCCCAGCCNONE 
J080030J04GCGGCCCAGCCNONE 
J080039D08GCGGCCCAGCCNONE 
J080039L17GCGGCCCAGCCNONE 
J080041B13GCGGCCCAGCCNONE 
J080041P21GCGGCCCAGCCNONE 
J080042J21GCGGCCCAGCCNONE 
J080042L19GCGGCCCAGCCNONE 
J080045F07GCGGCCCAGCCNONE 
J080047B10GCGGCCCAGCCNONE 
J080051F23GCGGCCCAGCCNONE 
J080053D15GCGGCCCAGCCNONE 
J080053K02GCGGCCCAGCCNONE 
J080058K18GCGGCCCAGCCNONE 
J080061M13GCGGCCCAGCCNONE 
J080064M24GCGGCCCAGCCNONE 
J080067H07GCGGCCCAGCCNONE 
J080080B21GCGGCCCAGCCNONE 
J080080D18GCGGCCCAGCCNONE 
J080082G07GCGGCCCAGCCNONE 
J080088B01GCGGCCCAGCCNONE 
J080088E09GCGGCCCAGCCNONE 
J080093L01GCGGCCCAGCCNONE 
Os09g0375700AK068295CGCGTGGGCCGGCCCAGCHypothetical protein. 
Os09g0392000AK120392CCATGGGCCCAGCConserved hypothetical protein. 
J013074N02CCATGGGCCCAGCNONE 
Os09g0437900AK107833TCCGGCCCAGCSimilar to Adrenodoxin. 
Os09g0465800009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0468900AK120990GCTGGGCCGTCCConserved hypothetical protein. 
J013123P13GCTGGGCCGTCCNONE 
J023013I09GCTGGGCCGTCCNONE 
J023023G08GCTGGGCCGTCCNONE 
J023043E08GCTGGGCCGTCCNONE 
J033124D24GCTGGGCCGTCCNONE 
J065047I07GCTGGGCCGTCCNONE 
J065093C16GCTGGGCCGTCCNONE 
J090088O03GCTGGGCCGTCCNONE 
J100032M21GCTGGGCCGTCCNONE 
Os09g0482400012-003-B01AAGGCCCAGCNONE 
012-008-B05AAGGCCCAGCNONE 
012-010-C09AAGGCCCAGCNONE 
012-080-B07AAGGCCCAGCNONE 
012-083-G11AAGGCCCAGCNONE 
012-089-D09AAGGCCCAGCNONE 
012-091-C01AAGGCCCAGCNONE 
015-053-A11AAGGCCCAGCNONE 
AB111810AAGGCCCAGCSimilar to Heat shock protein 82. 
J033032D17AAGGCCCAGCNONE 
J033124F14AAGGCCCAGCNONE 
J065054M12AAGGCCCAGCNONE 
J065085K18AAGGCCCAGCNONE 
J065103F22AAGGCCCAGCNONE 
J065120O18AAGGCCCAGCNONE 
J065122B08AAGGCCCAGCNONE 
J065127I15AAGGCCCAGCNONE 
J065128C06AAGGCCCAGCNONE 
J065130N10AAGGCCCAGCNONE 
J065152D21AAGGCCCAGCNONE 
J065207P17AAGGCCCAGCNONE 
J065208E07AAGGCCCAGCNONE 
J075011C19AAGGCCCAGCNONE 
J075020E07AAGGCCCAGCNONE 
J075079G06AAGGCCCAGCNONE 
J075092D22AAGGCCCAGCNONE 
J080042F22AAGGCCCAGCNONE 
J080057N10AAGGCCCAGCNONE 
J080059D14AAGGCCCAGCNONE 
J090009E01AAGGCCCAGCNONE 
J090016L14AAGGCCCAGCNONE 
J090026O14AAGGCCCAGCNONE 
J090030D09AAGGCCCAGCNONE 
J090030E13AAGGCCCAGCNONE 
J090044D22AAGGCCCAGCNONE 
J090047O17AAGGCCCAGCNONE 
J090065K19AAGGCCCAGCNONE 
J090066J12AAGGCCCAGCNONE 
J090068D04AAGGCCCAGCNONE 
J090074B12AAGGCCCAGCNONE 
J090078L24AAGGCCCAGCNONE 
J090083A07AAGGCCCAGCNONE 
J090091E02AAGGCCCAGCNONE 
J090093F23AAGGCCCAGCNONE 
J090095K09AAGGCCCAGCNONE 
J100021G05AAGGCCCAGCNONE 
J100022I18AAGGCCCAGCNONE 
J100028G20AAGGCCCAGCNONE 
J100035E22AAGGCCCAGCNONE 
J100037I09AAGGCCCAGCNONE 
J100039L12AAGGCCCAGCNONE 
J100041O10AAGGCCCAGCNONE 
J100045N10AAGGCCCAGCNONE 
J100049H24AAGGCCCAGCNONE 
J100057E17AAGGCCCAGCNONE 
J100058H08AAGGCCCAGCNONE 
J100063D02AAGGCCCAGCNONE 
J100064E04AAGGCCCAGCNONE 
J100068D15AAGGCCCAGCNONE 
J100069J01AAGGCCCAGCNONE 
J100070E03AAGGCCCAGCNONE 
J100074G01AAGGCCCAGCNONE 
J100080C21AAGGCCCAGCNONE 
J100082M08AAGGCCCAGCNONE 
J100086E08AAGGCCCAGCNONE 
Os09g0509200AK069525GGCTGGGCCTTTGGGCCAASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0521700014-005-C08GCGGGTCGCTGGGCCTCNONE 
AK063628GCGGGTCGCTGGGCCTCSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507GCGGGTCGCTGGGCCTCNONE 
Os09g0534000AK100026CTGGCCCAGCConserved hypothetical protein. 
Os09g0535300AK071211AAGGCCCAGCCCAAGXAP5 protein family protein. 
Os09g0554000J065123C23CTGGCCCAGCSimilar to Mitochondrial phosphate transporter. 
Os11g0109900011-064-B04CAAGTGGGCCCATCGCTGGGCCTCNONE 
AK063961CAAGTGGGCCCATCGCTGGGCCTCDouble-stranded RNA binding domain containing protein. 
AK121852CAAGTGGGCCCATCGCTGGGCCTCNONE 
J065183M14CAAGTGGGCCCATCGCTGGGCCTCNONE 
Os11g0116400AK059833GCTGGGCCGATGGGCTTCSimilar to Elongation factor P (EF-P). 
Os11g0146700AK065900GCGGCCCAGCNONE 
AK072412GCGGCCCAGCRED-like, C-terminal family protein. 
Os11g0162200009-059-H04GCGGCCCAGCCNONE 
AK060396GCGGCCCAGCCSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11GCGGCCCAGCCNONE 
J065105K09GCGGCCCAGCCNONE 
J075024G12GCGGCCCAGCCNONE 
J075040K04GCGGCCCAGCCNONE 
J075066D13GCGGCCCAGCCNONE 
J075108A11GCGGCCCAGCCNONE 
J100031D04GCGGCCCAGCCNONE 
J100060O05GCGGCCCAGCCNONE 
J100075M22GCGGCCCAGCCNONE 
Os11g0184900011-088-C07GCGGCCCAGCCCAGCNONE 
015-036-B03GCGGCCCAGCCCAGCNONE 
016-087-F07GCGGCCCAGCCCAGCNONE 
AB028184GCGGCCCAGCCCAGCNONE 
AK063399GCGGCCCAGCCCAGCSimilar to NAC-domain protein 5-7. 
AK064292GCGGCCCAGCCCAGCNONE 
AK102475GCGGCCCAGCCCAGCNONE 
J033094I01GCGGCCCAGCCCAGCNONE 
J090087J16GCGGCCCAGCCCAGCNONE 
Os11g0209100016-063-F03AAATGGGCCCAGCNONE 
AK064391AAATGGGCCCAGCCyclin-like F-box domain containing protein. 
J075027K02AAATGGGCCCAGCNONE 
J075154K15AAATGGGCCCAGCNONE 
Os11g0216400Os11g0216400TCCGGCCCAGCCProteinase inhibitor, propeptide domain containing protein. 
Os11g0256000J065001O05TTGGCCCAGCAcetolactate synthase, small subunit family protein. 
J065019G09TTGGCCCAGCNONE 
J065039G02TTGGCCCAGCNONE 
J065054A11TTGGCCCAGCNONE 
J065059K07TTGGCCCAGCNONE 
J065077D22TTGGCCCAGCNONE 
Os11g0423200AK111297ATGGCCCAGCHypothetical protein. 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os11g0482000006-056-D12GGCTGGGCCTTGNONE 
006-102-C10GGCTGGGCCTTGNONE 
009-005-E07GGCTGGGCCTTGNONE 
014-088-D03GGCTGGGCCTTGNONE 
AK059558GGCTGGGCCTTGSimilar to 40S ribosomal protein S5-1. 
AK103918GGCTGGGCCTTGNONE 
Os11g0488600AK111309CACGGCCCAGCCCACGAConserved hypothetical protein. 
J075011H20CACGGCCCAGCCCACGANONE 
J075068E17CACGGCCCAGCCCACGANONE 
J075102G16CACGGCCCAGCCCACGANONE 
Os11g0497000AK111924GCTGGGCCGTTSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GCTGGGCCGTTNONE 
J065097A08GCTGGGCCGTTNONE 
J065123J10GCTGGGCCGTTNONE 
J075096F04GCTGGGCCGTTNONE 
J080065C15GCTGGGCCGTTNONE 
J090033J04GCTGGGCCGTTNONE 
J090072N23GCTGGGCCGTTNONE 
J100021E08GCTGGGCCGTTNONE 
J100063H21GCTGGGCCGTTNONE 
Os11g0513900AK101049GGCTGGGCTGGGCCTTGConserved hypothetical protein. 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0587100J065046D15GCTGGGCCATProtein prenyltransferase domain containing protein. 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0642100AK107010TAATGGGCCCAGCCCCyclin-like F-box domain containing protein. 
Os11g0648000AK066444GTGGTGGGCCCAGCCSimilar to Na+/H+ antiporter. 
AK072026GTGGTGGGCCCAGCCNONE 
Os11g0657200AK059959CACGGCCCAGC2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07GCTGGGCCGTGNONE 
AK062752GCTGGGCCGTGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os12g0133600AK103096TCCGGCCCAGCCConserved hypothetical protein. 
J033118M03TCCGGCCCAGCCNONE 
Os12g0156400012-065-D02GCTGGGCCGTGNONE 
AK072086GCTGGGCCGTGNONE 
AK099278GCTGGGCCGTGDcp1-like decapping family protein. 
J013063H09GCTGGGCCGTGNONE 
J023125D09GCTGGGCCGTGNONE 
J023149G21GCTGGGCCGTGNONE 
J033064E07GCTGGGCCGTGNONE 
J033093C07GCTGGGCCGTGNONE 
J033107E06GCTGGGCCGTGNONE 
J075172A11GCTGGGCCGTGNONE 
J090009E07GCTGGGCCGTGNONE 
J090023F13GCTGGGCCGTGNONE 
J090071N18GCTGGGCCGTGNONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0266000J075093G23GCGGGCCCAGCNONE 
Os12g0274200009-166-H09ACCGGCCCAGCCNONE 
AK063071ACCGGCCCAGCCLipolytic enzyme, G-D-S-L family protein. 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
Os12g0538500006-077-B08AGTGGGCCCAGCCCNONE 
AK059316AGTGGGCCCAGCCCSimilar to PGPD14 protein. 
AK069502AGTGGGCCCAGCCCNONE 
AK104170AGTGGGCCCAGCCCNONE 
AK104287AGTGGGCCCAGCCCNONE 
J023020D18AGTGGGCCCAGCCCNONE 
J090079P08AGTGGGCCCAGCCCNONE 
Os12g0550800006-091-A05ATGGCCCAGCNONE 
AK061828ATGGCCCAGCNONE 
AK098944ATGGCCCAGCNONE 
AK102550ATGGCCCAGCHypothetical protein. 
J013045G24ATGGCCCAGCNONE 
J065156K11ATGGCCCAGCNONE 
J065201E21ATGGCCCAGCNONE 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0565800AK072828GCTGGGCCACCGCACZinc finger, TTF-type domain containing protein. 
Os12g0580300AK102871GCTGGGCCCCACCSimilar to TATA-binding protein TBP2. 
Os12g0584100006-083-C12TAGGCCCAGCCCACCCNONE 
006-104-C06TAGGCCCAGCCCACCCNONE 
AK066829TAGGCCCAGCCCACCCNONE 
AK071424TAGGCCCAGCCCACCCConserved hypothetical protein. 
J013075O22TAGGCCCAGCCCACCCNONE 
J023091J20TAGGCCCAGCCCACCCNONE 
J065167K15TAGGCCCAGCCCACCCNONE 
J065213C02TAGGCCCAGCCCACCCNONE 
J075001B17TAGGCCCAGCCCACCCNONE 
J075165D13TAGGCCCAGCCCACCCNONE 
J075195C24TAGGCCCAGCCCACCCNONE 
Os12g0588900AK069966GACGGCCCAGCTAGGCCCAATTConserved hypothetical protein. 
J023038A10GACGGCCCAGCTAGGCCCAATTNONE 
J065061J23GACGGCCCAGCTAGGCCCAATTNONE 
J065176O08GACGGCCCAGCTAGGCCCAATTNONE 
J075143K13GACGGCCCAGCTAGGCCCAATTNONE 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0628100AK121150GTGGCCCAGCCSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J023078I07GTGGCCCAGCCNONE 
J075153L01GTGGCCCAGCCNONE 
J100050C05GTGGCCCAGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.