version

Summary of OsREG622 (All List)

OrganismOryza sativa  
IDOsREG622  
SequenceGGACCCAC  
Annotation  
PPDB MotifGGGACCC  function unknown  
PLACE Motif 
Total Entry Count2081  

Entry Sequences (2081 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812GGTGGGACCCACShikimate kinase domain containing protein. 
J013000E05GGTGGGACCCACNONE 
J013027D08GGTGGGACCCACNONE 
J013045K12GGTGGGACCCACNONE 
J023119M03GGTGGGACCCACNONE 
J065081F02GGTGGGACCCACNONE 
J065180C08GGTGGGACCCACNONE 
J065211M06GGTGGGACCCACNONE 
J075073J06GGTGGGACCCACNONE 
J075123A18GGTGGGACCCACNONE 
J075124A07GGTGGGACCCACNONE 
J075187B05GGTGGGACCCACNONE 
Os01g0103600006-072-A01GTGGGTCCCACNONE 
009-148-C12GTGGGTCCCACNONE 
AK059848GTGGGTCCCACEmopamil-binding family protein. 
AK102848GTGGGTCCCACNONE 
J033036P20GTGGGTCCCACNONE 
J065171N21GTGGGTCCCACNONE 
J065209M02GTGGGTCCCACNONE 
J075067A03GTGGGTCCCACNONE 
J075110C09GTGGGTCCCACNONE 
Os01g0104400006-026-B08GTGGGTCCNONE 
006-030-C01GTGGGTCCNONE 
006-055-E02GTGGGTCCNONE 
006-061-B12GTGGGTCCNONE 
006-064-F06GTGGGTCCNONE 
006-078-G10GTGGGTCCNONE 
006-079-G09GTGGGTCCNONE 
006-080-B08GTGGGTCCNONE 
006-100-E07GTGGGTCCNONE 
006-110-E01GTGGGTCCNONE 
006-118-D10GTGGGTCCNONE 
006-120-C12GTGGGTCCNONE 
AK060132GTGGGTCCNONE 
AK071375GTGGGTCCRicin B-related lectin domain containing protein. 
AK104555GTGGGTCCNONE 
AK104820GTGGGTCCNONE 
J023121J21GTGGGTCCNONE 
Os01g0136200009-086-D11AGAGTGGGTCCNONE 
013-096-H06AGAGTGGGTCCNONE 
014-003-F08AGAGTGGGTCCNONE 
014-010-A11AGAGTGGGTCCNONE 
014-041-G02AGAGTGGGTCCNONE 
014-071-E12AGAGTGGGTCCNONE 
014-079-A06AGAGTGGGTCCNONE 
AK121025AGAGTGGGTCC16.9 kDa class I heat shock protein. 
J023050A14AGAGTGGGTCCNONE 
J023061F18AGAGTGGGTCCNONE 
J053050H23AGAGTGGGTCCNONE 
J075018E12AGAGTGGGTCCNONE 
J075018G01AGAGTGGGTCCNONE 
J075050P17AGAGTGGGTCCNONE 
J075057E02AGAGTGGGTCCNONE 
J075155F14AGAGTGGGTCCNONE 
J075183C11AGAGTGGGTCCNONE 
J075186P15AGAGTGGGTCCNONE 
Os01g0147700AK066686GACAGGTGGGACCCACCCGRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE 
006-081-C11GTGGGTCCAACGGCCCAGCNONE 
009-050-D04GTGGGTCCAACGGCCCAGCNONE 
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GTGGGTCCAACGGCCCAGCNONE 
J023112H22GTGGGTCCAACGGCCCAGCNONE 
J065048P05GTGGGTCCAACGGCCCAGCNONE 
J100068N20GTGGGTCCAACGGCCCAGCNONE 
J100073A02GTGGGTCCAACGGCCCAGCNONE 
Os01g0180300AK120377GTGGGTCCCACCACLipoprotein, type 6 family protein. 
J013071N06GTGGGTCCCACCACNONE 
J023088F12GTGGGTCCCACCACNONE 
J100027H24GTGGGTCCCACCACNONE 
J100053K15GTGGGTCCCACCACNONE 
J100082M15GTGGGTCCCACCACNONE 
Os01g0184800AK073377GGGACCCACGTGPhosducin family protein. 
AK102544GGGACCCACGTGNONE 
J023047L21GGGACCCACGTGNONE 
J023135I09GGGACCCACGTGNONE 
J033028G17GGGACCCACGTGNONE 
J065164L07GGGACCCACGTGNONE 
J065193F22GGGACCCACGTGNONE 
J075035I10GGGACCCACGTGNONE 
J075168H15GGGACCCACGTGNONE 
Os01g0184900AF503585CACGTGGGTCCCNONE 
AK066832CACGTGGGTCCCSimilar to SSRP1 protein. 
AK068959CACGTGGGTCCCNONE 
J013055F18CACGTGGGTCCCNONE 
Os01g0242200AK107468GTGGGTCCZinc finger, C2H2-type domain containing protein. 
Os01g0258600J075028F17ACACGTGGGTCCNONE 
J075061L04ACACGTGGGTCCConserved hypothetical protein. 
J075071B09ACACGTGGGTCCNONE 
J075093E04ACACGTGGGTCCNONE 
J100033B11ACACGTGGGTCCNONE 
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein. 
AK109672TTCGTGGGTCCCACConserved hypothetical protein. 
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE 
J065013K07TTCGTGGGTCCCACNONE 
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE 
J065040E15TTCGTGGGTCCCACNONE 
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE 
J065127F12TTCGTGGGTCCCACNONE 
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE 
J075155K23TTCGTGGGTCCCACNONE 
Os01g0301700003-118-B08GTGGGTCCCACNONE 
016-048-H09GTGGGTCCCACNONE 
AK064223GTGGGTCCCACNONE 
AK100563GTGGGTCCCACProtein prenyltransferase domain containing protein. 
J023104I21GTGGGTCCCACNONE 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0391100AK108533CGCGTGGGACCCACCTGNONE 
AK121200CGCGTGGGACCCACCTGSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
J023042H11CGCGTGGGACCCACCTGNONE 
J023087I02CGCGTGGGACCCACCTGNONE 
J065099C01CGCGTGGGACCCACCTGNONE 
Os01g0528300009-015-C05GTGGGTCCCACCNONE 
AK062349GTGGGTCCCACCSimilar to HcrVf3 protein. 
Os01g0588900AK071695GGACCCACTCCConserved hypothetical protein 730 family protein. 
AK111103GGACCCACTCCNONE 
J013134L19GGACCCACTCCNONE 
J023074A10GGACCCACTCCNONE 
J023109F04GGACCCACTCCNONE 
J023143L07GGACCCACTCCNONE 
J065022F16GGACCCACTCCNONE 
J065083N22GGACCCACTCCNONE 
J100040N10GGACCCACTCCNONE 
J100043F13GGACCCACTCCNONE 
J100075D13GGACCCACTCCNONE 
J100080D22GGACCCACTCCNONE 
Os01g0605700AK099440GTGGGTCCMtN3 and saliva related transmembrane protein family protein. 
J080001K02GTGGGTCCNONE 
J080001P13GTGGGTCCNONE 
J080006I22GTGGGTCCNONE 
J080008F09GTGGGTCCNONE 
J080014M23GTGGGTCCNONE 
J080024L07GTGGGTCCNONE 
J080035D17GTGGGTCCNONE 
J080048D13GTGGGTCCNONE 
J080056K03GTGGGTCCNONE 
J080058M12GTGGGTCCNONE 
J080062B20GTGGGTCCNONE 
J080066B09GTGGGTCCNONE 
J080069L03GTGGGTCCNONE 
J080072P17GTGGGTCCNONE 
J080094C01GTGGGTCCNONE 
Os01g0622800009-061-H04GGACCCACNONE 
009-167-C01GGACCCACNONE 
AK063171GGACCCACConserved hypothetical protein. 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0703600011-041-C08TGGGACCCACNONE 
AK060762TGGGACCCACNONE 
AK065538TGGGACCCACSimilar to Mu1 adaptin. 
J013030K02TGGGACCCACNONE 
J013047M04TGGGACCCACNONE 
J023009H11TGGGACCCACNONE 
J065002E09TGGGACCCACNONE 
J065043G09TGGGACCCACNONE 
J065044C07TGGGACCCACNONE 
J065187M20TGGGACCCACNONE 
J065217N04TGGGACCCACNONE 
J075039G19TGGGACCCACNONE 
J075128P20TGGGACCCACNONE 
J100037C10TGGGACCCACNONE 
Os01g0708700AK102451GGACCCACCCGIQ calmodulin-binding region domain containing protein. 
Os01g0745400AK107872AAAGCCCATGTGGGACCCACSec34-like protein family protein. 
Os01g0763600AK061563GACAGGTGGGTCCNONE 
AK066596GACAGGTGGGTCCGlycerophosphoryl diester phosphodiesterase family protein. 
J023057P15GACAGGTGGGTCCNONE 
J065016A16GACAGGTGGGTCCNONE 
J065039L06GACAGGTGGGTCCNONE 
J090001E03GACAGGTGGGTCCNONE 
J090012J18GACAGGTGGGTCCNONE 
J090085E15GACAGGTGGGTCCNONE 
Os01g0778700AK064933GAGGCGTGGGTCCCConserved hypothetical protein. 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0844200AK109255CAAGTGGGTCCDVL family protein. 
Os01g0844900AK066659GGGACCCACCCGHomeodomain-like containing protein. 
Os01g0846600AK070193GGACCCACTTGProtein of unknown function DUF248, methyltransferase putative family protein. 
J023041I24GGACCCACTTGNONE 
J065002B03GGACCCACTTGNONE 
J065140C09GGACCCACTTGNONE 
J090052A18GGACCCACTTGNONE 
J090081O13GGACCCACTTGNONE 
J100056L06GGACCCACTTGNONE 
Os01g0858900AK107493GTGGGACCCACGlycosyl transferase, family 29 protein. 
J065097H23GTGGGACCCACNONE 
J100070A02GTGGGACCCACNONE 
J100072M10GTGGGACCCACNONE 
Os01g0860700009-026-D05GTGGGACCCACNONE 
AK062402GTGGGACCCACConserved hypothetical protein. 
Os01g0867900AK061366CGCGTCGCAGGTGGGTCCCACCTGProtein of unknown function DUF502 family protein. 
Os01g0897600J065120F23GTGGGTCCCACCNONE 
Os01g0947000011-055-B03GGACCCACNONE 
AK063953GGACCCACSimilar to Beta-1,3-glucanase precursor. 
AK102628GGACCCACNONE 
J033099K11GGACCCACNONE 
Os01g0961200011-099-H06GTGGGTCCCACCNONE 
AK105424GTGGGTCCCACCCBS domain containing protein. 
J065169J18GTGGGTCCCACCNONE 
J075109H12GTGGGTCCCACCNONE 
Os01g0961600011-080-G05GTGGGTCCNONE 
AK063388GTGGGTCCNONE 
AK071901GTGGGTCCConserved hypothetical protein. 
J065078A05GTGGGTCCNONE 
Os01g0975000AK103552GGACCCACNONE 
AK119662GGACCCACProtein of unknown function DUF966 family protein. 
J033132F15GGACCCACNONE 
J065012J09GGACCCACNONE 
J065166N08GGACCCACNONE 
Os01g0976600AK072971GTGGGACCCACSimilar to Methlytransferase, UbiE/COQ5 family. 
J023148G18GTGGGACCCACNONE 
J075095H03GTGGGACCCACNONE 
J090089M19GTGGGACCCACNONE 
Os02g0103800006-046-H11GTGGGTCCCACGTGNONE 
006-060-B05GTGGGTCCCACGTGNONE 
006-097-A09GTGGGTCCCACGTGNONE 
006-102-A10GTGGGTCCCACGTGNONE 
006-104-E11GTGGGTCCCACGTGNONE 
006-112-D09GTGGGTCCCACGTGNONE 
AK061774GTGGGTCCCACGTGNONE 
AK065309GTGGGTCCCACGTGNONE 
AK106213GTGGGTCCCACGTGSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment). 
J013002O13GTGGGTCCCACGTGNONE 
J013026F06GTGGGTCCCACGTGNONE 
J013037O14GTGGGTCCCACGTGNONE 
J013066N06GTGGGTCCCACGTGNONE 
J013108G22GTGGGTCCCACGTGNONE 
J023050M15GTGGGTCCCACGTGNONE 
J023054B21GTGGGTCCCACGTGNONE 
J023073C23GTGGGTCCCACGTGNONE 
J023086H17GTGGGTCCCACGTGNONE 
J023105A20GTGGGTCCCACGTGNONE 
J065019E16GTGGGTCCCACGTGNONE 
J065064G10GTGGGTCCCACGTGNONE 
J065071C18GTGGGTCCCACGTGNONE 
J065103B02GTGGGTCCCACGTGNONE 
J065153G06GTGGGTCCCACGTGNONE 
J075152G24GTGGGTCCCACGTGNONE 
J075166P04GTGGGTCCCACGTGNONE 
J080001F02GTGGGTCCCACGTGNONE 
J080001M07GTGGGTCCCACGTGNONE 
J080001O05GTGGGTCCCACGTGNONE 
J080003I19GTGGGTCCCACGTGNONE 
J080004C12GTGGGTCCCACGTGNONE 
J080008E17GTGGGTCCCACGTGNONE 
J080008M08GTGGGTCCCACGTGNONE 
J080010H21GTGGGTCCCACGTGNONE 
J080011F22GTGGGTCCCACGTGNONE 
J080012C16GTGGGTCCCACGTGNONE 
J080013D20GTGGGTCCCACGTGNONE 
J080018K15GTGGGTCCCACGTGNONE 
J080020O14GTGGGTCCCACGTGNONE 
J080020P21GTGGGTCCCACGTGNONE 
J080021A07GTGGGTCCCACGTGNONE 
J080021B06GTGGGTCCCACGTGNONE 
J080022G21GTGGGTCCCACGTGNONE 
J080022P14GTGGGTCCCACGTGNONE 
J080023H24GTGGGTCCCACGTGNONE 
J080023M08GTGGGTCCCACGTGNONE 
J080027E08GTGGGTCCCACGTGNONE 
J080027E18GTGGGTCCCACGTGNONE 
J080027O16GTGGGTCCCACGTGNONE 
J080029M22GTGGGTCCCACGTGNONE 
J080034A17GTGGGTCCCACGTGNONE 
J080038G04GTGGGTCCCACGTGNONE 
J080040F13GTGGGTCCCACGTGNONE 
J080040F22GTGGGTCCCACGTGNONE 
J080041L15GTGGGTCCCACGTGNONE 
J080042L04GTGGGTCCCACGTGNONE 
J080042M14GTGGGTCCCACGTGNONE 
J080043C22GTGGGTCCCACGTGNONE 
J080043O09GTGGGTCCCACGTGNONE 
J080045N17GTGGGTCCCACGTGNONE 
J080046N08GTGGGTCCCACGTGNONE 
J080047K11GTGGGTCCCACGTGNONE 
J080047O06GTGGGTCCCACGTGNONE 
J080048H10GTGGGTCCCACGTGNONE 
J080048N03GTGGGTCCCACGTGNONE 
J080050N02GTGGGTCCCACGTGNONE 
J080051A05GTGGGTCCCACGTGNONE 
J080052I20GTGGGTCCCACGTGNONE 
J080053E08GTGGGTCCCACGTGNONE 
J080055P05GTGGGTCCCACGTGNONE 
J080056F15GTGGGTCCCACGTGNONE 
J080056H07GTGGGTCCCACGTGNONE 
J080057M20GTGGGTCCCACGTGNONE 
J080059K09GTGGGTCCCACGTGNONE 
J080059M10GTGGGTCCCACGTGNONE 
J080060B12GTGGGTCCCACGTGNONE 
J080061N09GTGGGTCCCACGTGNONE 
J080062H11GTGGGTCCCACGTGNONE 
J080062M13GTGGGTCCCACGTGNONE 
J080063D14GTGGGTCCCACGTGNONE 
J080063G10GTGGGTCCCACGTGNONE 
J080063H18GTGGGTCCCACGTGNONE 
J080066J23GTGGGTCCCACGTGNONE 
J080067J06GTGGGTCCCACGTGNONE 
J080069I11GTGGGTCCCACGTGNONE 
J080069O22GTGGGTCCCACGTGNONE 
J080070P11GTGGGTCCCACGTGNONE 
J080072D06GTGGGTCCCACGTGNONE 
J080072J22GTGGGTCCCACGTGNONE 
J080075A20GTGGGTCCCACGTGNONE 
J080076F11GTGGGTCCCACGTGNONE 
J080076J24GTGGGTCCCACGTGNONE 
J080076K05GTGGGTCCCACGTGNONE 
J080077O10GTGGGTCCCACGTGNONE 
J080078L19GTGGGTCCCACGTGNONE 
J080080I08GTGGGTCCCACGTGNONE 
J080081J23GTGGGTCCCACGTGNONE 
J080083A17GTGGGTCCCACGTGNONE 
J080085C05GTGGGTCCCACGTGNONE 
J080086G24GTGGGTCCCACGTGNONE 
J080087H02GTGGGTCCCACGTGNONE 
J080089A13GTGGGTCCCACGTGNONE 
J080090K08GTGGGTCCCACGTGNONE 
J080092M01GTGGGTCCCACGTGNONE 
J080095A19GTGGGTCCCACGTGNONE 
J080095B20GTGGGTCCCACGTGNONE 
J100028F13GTGGGTCCCACGTGNONE 
J100040G22GTGGGTCCCACGTGNONE 
Os02g0120000AK067383GTGGGTCCProtein prenyltransferase domain containing protein. 
AK101590GTGGGTCCNONE 
J013100B15GTGGGTCCNONE 
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0167700AK069128GGACCCACArmadillo-like helical domain containing protein. 
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0216500AK103179GTGGGTCCCACHypothetical protein. 
Os02g0271900AK120913GTGGGTCCMyb, DNA-binding domain containing protein. 
AK120913GTGGGTCCMyb, DNA-binding domain containing protein. 
Os02g0302900AK110752GGACCCACTCCReticulon family protein. 
Os02g0303200AK107731GTGGGACCCACTTGHypothetical protein. 
Os02g0316200AK073932GGACCCACCyclin-like F-box domain containing protein. 
AK105757GGACCCACNONE 
J023039G03GGACCCACNONE 
J033076K03GGACCCACNONE 
J075157J22GGACCCACNONE 
J090097K02GGACCCACNONE 
J100053F10GGACCCACNONE 
Os02g0317400AK061254GGACCCACClathrin adaptor complex, small chain family protein. 
AK073474GGACCCACNONE 
J033045O22GGACCCACNONE 
J053023I18GGACCCACNONE 
J053034H01GGACCCACNONE 
J053034M24GGACCCACNONE 
J065005K14GGACCCACNONE 
J065092O13GGACCCACNONE 
J065101K24GGACCCACNONE 
J065174G18GGACCCACNONE 
J065203J19GGACCCACNONE 
J065218B15GGACCCACNONE 
J090064B16GGACCCACNONE 
Os02g0332200AK067672GTGGGTCCCACTTGCCACGTGSimilar to T-complex protein 1 delta subunit. 
Os02g0464700AK107077GTGGGACCCACConserved hypothetical protein. 
Os02g0467700AK121672GTGGGTCCGlycosyltransferase 28, C-terminal domain containing protein. 
J033068B18GTGGGTCCNONE 
J080035D09GTGGGTCCNONE 
J080039E21GTGGGTCCNONE 
J080054N01GTGGGTCCNONE 
J080071C12GTGGGTCCNONE 
Os02g0521300AK120851GTGGGTCCCC2 domain containing protein. 
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein. 
Os02g0534600Os02g0534600GTGGGTCCCACCConserved hypothetical protein. 
Os02g0562300AK073250GTGGGACCCACCalmodulin binding protein-like family protein. 
Os02g0577900J065164K11GGACCCACConserved hypothetical protein. 
J065164K11GTGGGTCCConserved hypothetical protein. 
Os02g0578201J065065K19GTGGGTCCCACConserved hypothetical protein. 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
009-199-B01GGGACCCACCTGGGGCCCACCANONE 
011-015-G12GGGACCCACCTGGGGCCCACCANONE 
J023113C24GGGACCCACCTGGGGCCCACCANONE 
Os02g0600200009-154-A06CACTGACAAGTGGGTCCAGANONE 
AK058978CACTGACAAGTGGGTCCAGANONE 
AK066974CACTGACAAGTGGGTCCAGAIQ calmodulin-binding region domain containing protein. 
Os02g0608900AK068690GTGGGTCCCNONE 
AK105867GTGGGTCCCSimilar to Epstein-Barr virus (B95-8 isolate) U2-IR2 domain encoding nuclear protein EBNA2, complete cds. 
J065017D16GTGGGTCCCNONE 
J065042D05GTGGGTCCCNONE 
J065117J15GTGGGTCCCNONE 
J075020G04GTGGGTCCCNONE 
J075052B14GTGGGTCCCNONE 
J075170K13GTGGGTCCCNONE 
J075178D19GTGGGTCCCNONE 
J075182F02GTGGGTCCCNONE 
J075199I18GTGGGTCCCNONE 
J090057A11GTGGGTCCCNONE 
J100048A21GTGGGTCCCNONE 
Os02g0610600006-025-A07GGGACCCACNONE 
006-027-E02GGGACCCACNONE 
AK060088GGGACCCACNONE 
AK099572GGGACCCACSimilar to 9G8-like SR protein (RSZp22 splicing factor). 
AK104726GGGACCCACNONE 
J013035H21GGGACCCACNONE 
J013037C12GGGACCCACNONE 
J013122B01GGGACCCACNONE 
J013124A03GGGACCCACNONE 
J013124C15GGGACCCACNONE 
J013132I24GGGACCCACNONE 
J023008O06GGGACCCACNONE 
J023061J24GGGACCCACNONE 
J023065D02GGGACCCACNONE 
J023066P12GGGACCCACNONE 
J023083J10GGGACCCACNONE 
J033031G05GGGACCCACNONE 
J065117A05GGGACCCACNONE 
J065134H09GGGACCCACNONE 
J065169J22GGGACCCACNONE 
J065211L11GGGACCCACNONE 
J075001M01GGGACCCACNONE 
J075015L09GGGACCCACNONE 
J075019E07GGGACCCACNONE 
J075042J19GGGACCCACNONE 
J075048D15GGGACCCACNONE 
J075054H24GGGACCCACNONE 
J075057F09GGGACCCACNONE 
J075064J05GGGACCCACNONE 
J075074E16GGGACCCACNONE 
J075093A05GGGACCCACNONE 
J075093C08GGGACCCACNONE 
J075104F23GGGACCCACNONE 
J075104L04GGGACCCACNONE 
J075134A01GGGACCCACNONE 
J075149H04GGGACCCACNONE 
J075153O06GGGACCCACNONE 
J075155D03GGGACCCACNONE 
J075179N18GGGACCCACNONE 
J075184M05GGGACCCACNONE 
J075185B17GGGACCCACNONE 
J075188D22GGGACCCACNONE 
J075193O07GGGACCCACNONE 
J080004I08GGGACCCACNONE 
J080014P04GGGACCCACNONE 
J080058K19GGGACCCACNONE 
J080072P16GGGACCCACNONE 
J080303N22GGGACCCACNONE 
J080306I22GGGACCCACNONE 
J080316B03GGGACCCACNONE 
J090021N05GGGACCCACNONE 
J090043J11GGGACCCACNONE 
J090071C02GGGACCCACNONE 
J100019I09GGGACCCACNONE 
J100031A01GGGACCCACNONE 
J100042J07GGGACCCACNONE 
J100044H08GGGACCCACNONE 
J100045N20GGGACCCACNONE 
J100056M18GGGACCCACNONE 
J100061M03GGGACCCACNONE 
J100062C16GGGACCCACNONE 
J100065P08GGGACCCACNONE 
J100073K23GGGACCCACNONE 
Os02g0613200AK064869ACACGTGGGACCCACNONE 
AK065051ACACGTGGGACCCACNONE 
AK098853ACACGTGGGACCCACConserved hypothetical protein. 
AK098974ACACGTGGGACCCACNONE 
J013000H15ACACGTGGGACCCACNONE 
J013001I18ACACGTGGGACCCACNONE 
J013022I18ACACGTGGGACCCACNONE 
J013025D06ACACGTGGGACCCACNONE 
J013037H17ACACGTGGGACCCACNONE 
J013043F22ACACGTGGGACCCACNONE 
J013075E01ACACGTGGGACCCACNONE 
J013088D09ACACGTGGGACCCACNONE 
J013088E19ACACGTGGGACCCACNONE 
J013102O18ACACGTGGGACCCACNONE 
J013110C08ACACGTGGGACCCACNONE 
J013118C06ACACGTGGGACCCACNONE 
J013119F22ACACGTGGGACCCACNONE 
J013128K14ACACGTGGGACCCACNONE 
J013158C17ACACGTGGGACCCACNONE 
J023013P15ACACGTGGGACCCACNONE 
J023044L21ACACGTGGGACCCACNONE 
J033023I04ACACGTGGGACCCACNONE 
J033038I22ACACGTGGGACCCACNONE 
J033095M02ACACGTGGGACCCACNONE 
J043022F05ACACGTGGGACCCACNONE 
J080307N20ACACGTGGGACCCACNONE 
J080315C02ACACGTGGGACCCACNONE 
J080316A15ACACGTGGGACCCACNONE 
J080316G03ACACGTGGGACCCACNONE 
J090029E24ACACGTGGGACCCACNONE 
J090031H15ACACGTGGGACCCACNONE 
J090034F13ACACGTGGGACCCACNONE 
J090047G02ACACGTGGGACCCACNONE 
J090069M24ACACGTGGGACCCACNONE 
J100052E15ACACGTGGGACCCACNONE 
Os02g0621700011-079-F10TGGGACCCACNONE 
AK101006TGGGACCCACSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525TGGGACCCACNONE 
J013026C02TGGGACCCACNONE 
J013104M10TGGGACCCACNONE 
J023003D01TGGGACCCACNONE 
J023007H13TGGGACCCACNONE 
J023019G09TGGGACCCACNONE 
J023020L19TGGGACCCACNONE 
J023022L12TGGGACCCACNONE 
J023022O14TGGGACCCACNONE 
J023036F16TGGGACCCACNONE 
J023047D16TGGGACCCACNONE 
J023052P08TGGGACCCACNONE 
J023077C01TGGGACCCACNONE 
J023083M06TGGGACCCACNONE 
J023105A11TGGGACCCACNONE 
J023117F21TGGGACCCACNONE 
J023119D20TGGGACCCACNONE 
J023148E03TGGGACCCACNONE 
J023149B13TGGGACCCACNONE 
J033029A10TGGGACCCACNONE 
J033046L17TGGGACCCACNONE 
J033052M04TGGGACCCACNONE 
J033057M14TGGGACCCACNONE 
J033066K24TGGGACCCACNONE 
J033069K02TGGGACCCACNONE 
J033079G14TGGGACCCACNONE 
J033101E06TGGGACCCACNONE 
J033116E06TGGGACCCACNONE 
J033118L18TGGGACCCACNONE 
J033135B13TGGGACCCACNONE 
J033136C10TGGGACCCACNONE 
J033136P08TGGGACCCACNONE 
J043027B13TGGGACCCACNONE 
J065039I03TGGGACCCACNONE 
J065185N21TGGGACCCACNONE 
J090008D14TGGGACCCACNONE 
J090029K17TGGGACCCACNONE 
J090047H20TGGGACCCACNONE 
J090048N17TGGGACCCACNONE 
J090085G08TGGGACCCACNONE 
J090089F07TGGGACCCACNONE 
Os02g0636700AK069779GGGACCCACGRAM domain containing protein. 
Os02g0638650J090094O16CGCGTGGGTCCCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os02g0687900AK064814GGACCCACPeptidase S10, serine carboxypeptidase family protein. 
AK064814GGACCCACPeptidase S10, serine carboxypeptidase family protein. 
J023060J12GGACCCACNONE 
J023060J12GGACCCACNONE 
J023125B06GGACCCACNONE 
J023125B06GGACCCACNONE 
J023135G12GGACCCACNONE 
J023135G12GGACCCACNONE 
J023146L10GGACCCACNONE 
J023146L10GGACCCACNONE 
J033113K15GGACCCACNONE 
J033113K15GGACCCACNONE 
J043024O04GGACCCACNONE 
J043024O04GGACCCACNONE 
J090049G02GGACCCACNONE 
J090049G02GGACCCACNONE 
Os02g0735200015-035-A06TGGGACCCACNONE 
015-048-A05TGGGACCCACNONE 
015-091-A06TGGGACCCACNONE 
016-082-G07TGGGACCCACNONE 
016-086-G04TGGGACCCACNONE 
AB037595TGGGACCCACNONE 
AK061157TGGGACCCACNONE 
AK071969TGGGACCCACNONE 
AK104987TGGGACCCACNONE 
AK109397TGGGACCCACGlutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clone lambda-GS28). 
X14245TGGGACCCACNONE 
Os02g0743800AK064134GGACCCACCS domain containing protein. 
AK111254GGACCCACNONE 
Os02g0761600AK120494TGGGACCCACConserved hypothetical protein. 
Os02g0771500006-096-D12CCCGTGGGACCCACNONE 
006-096-D12GTGGGACCCACNONE 
009-011-G02CCCGTGGGACCCACNONE 
009-011-G02GTGGGACCCACNONE 
AK062335CCCGTGGGACCCACNONE 
AK062335GTGGGACCCACNONE 
AK106018CCCGTGGGACCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
AK106018GTGGGACCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
Os02g0780800J090080O19GGACCCACTTGNONE 
J090091I06GGACCCACTTGNONE 
Os03g0108700003-131-E01GTGGGACCCACGTGGCNONE 
AK105115GTGGGACCCACGTGGCConserved hypothetical protein. 
AY224538GTGGGACCCACGTGGCNONE 
J065029A19GTGGGACCCACGTGGCNONE 
J065109N11GTGGGACCCACGTGGCNONE 
Os03g0111100AK102025GGGACCCACTTGSimilar to Dihydrofolate synthetase /folylpolyglutamate synthetase. 
Os03g0114300AK121970GGGACCCACProtein kinase-like domain containing protein. 
Os03g0128500AB037900TGGGACCCACNONE 
AK067991TGGGACCCACSimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04TGGGACCCACNONE 
J090032P09TGGGACCCACNONE 
Os03g0146000006-105-H06GGACCCACACGNONE 
AK061250GGACCCACACGSimilar to RAB1X. 
AK099130GGACCCACACGNONE 
J023043D11GGACCCACACGNONE 
J043009O17GGACCCACACGNONE 
Os03g0151800AK064955GGGACCCACNONE 
AK064955GTGGGACCCACNONE 
AK098874GGGACCCACNONE 
AK098874GTGGGACCCACNONE 
AK098980GGGACCCACNONE 
AK098980GTGGGACCCACNONE 
AK099712GGGACCCACNONE 
AK099712GTGGGACCCACNONE 
AK099889GGGACCCACNONE 
AK099889GTGGGACCCACNONE 
AK121641GGGACCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
AK121641GTGGGACCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05GGGACCCACNONE 
J013001A05GTGGGACCCACNONE 
J013001D04GGGACCCACNONE 
J013001D04GTGGGACCCACNONE 
J013121O12GGGACCCACNONE 
J013121O12GTGGGACCCACNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0174200AK060616CAAGTGGGTCCCACNONE 
AK103762CAAGTGGGTCCCACConserved hypothetical protein. 
J033143G15CAAGTGGGTCCCACNONE 
J090025L02CAAGTGGGTCCCACNONE 
Os03g0177000AK071368CCCACCCGGACCCACTCTCCAGGCCCACAGCN5-related N-acetyltransferase domain containing protein. 
AK071368GTGGGTCCCACCGCN5-related N-acetyltransferase domain containing protein. 
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein. 
Os03g0213600AK100407GGTGGGACCCACCCGConserved hypothetical protein. 
Os03g0218400AK069202GTGGGTCCCACCSimilar to Hexose transporter. 
AK099306GTGGGTCCCACCNONE 
AY342321GTGGGTCCCACCNONE 
J023066K08GTGGGTCCCACCNONE 
J100032N19GTGGGTCCCACCNONE 
Os03g0225200AK065907TGGGACCCACNONE 
AK074008TGGGACCCACCyclin-like domain containing protein. 
J013044F04TGGGACCCACNONE 
J090071F03TGGGACCCACNONE 
Os03g0298900006-028-C11CCCGTGGGACCCACNONE 
006-028-C11GGTGGGACCCACNONE 
AK060996CCCGTGGGACCCACHypothetical protein. 
AK060996GGTGGGACCCACHypothetical protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0338600AK066604GTGGGTCCCAtRNA pseudouridine synthase family protein. 
Os03g0343700AK060603GGTGGGACCCACBrix domain containing protein. 
AK102274GGTGGGACCCACNONE 
J033089C06GGTGGGACCCACNONE 
J090089A17GGTGGGACCCACNONE 
Os03g0395900AK120654GGACCCACNONE 
J075050E23GGACCCACNONE 
Os03g0397400AB112772GGGACCCACNONE 
AK069928GGGACCCACSimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18GGGACCCACNONE 
J023036P06GGGACCCACNONE 
J023145E24GGGACCCACNONE 
J033142I11GGGACCCACNONE 
J043003A10GGGACCCACNONE 
J075023H21GGGACCCACNONE 
J075145O10GGGACCCACNONE 
J075149A03GGGACCCACNONE 
J090099B09GGGACCCACNONE 
J100017L14GGGACCCACNONE 
J100050K18GGGACCCACNONE 
J100063P16GGGACCCACNONE 
Os03g0412400AK110543GGGACCCACConserved hypothetical protein. 
J065080E23GGGACCCACNONE 
Os03g0415500AK108435GGAGTGGGTCCCACMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GGAGTGGGTCCCACNONE 
Os03g0437600006-051-A10GGACCCACNONE 
006-059-D02GGACCCACNONE 
006-074-A04GGACCCACNONE 
006-089-G11GGACCCACNONE 
006-095-H02GGACCCACNONE 
006-118-B09GGACCCACNONE 
009-156-G04GGACCCACNONE 
015-015-G01GGACCCACNONE 
016-089-D06GGACCCACNONE 
AK061303GGACCCACNONE 
AK070773GGACCCACNONE 
AK073355GGACCCACSimilar to Hydrolase. 
AK104138GGACCCACNONE 
AK104400GGACCCACNONE 
J033030A08GGACCCACNONE 
J065056E01GGACCCACNONE 
J065061F16GGACCCACNONE 
J065075L21GGACCCACNONE 
J065102E09GGACCCACNONE 
J065175K12GGACCCACNONE 
J065197D14GGACCCACNONE 
J065199D08GGACCCACNONE 
J075029F13GGACCCACNONE 
J075042F07GGACCCACNONE 
J075056E23GGACCCACNONE 
J075077L02GGACCCACNONE 
J075086N01GGACCCACNONE 
J075095I08GGACCCACNONE 
J075099N21GGACCCACNONE 
J075099O09GGACCCACNONE 
J075109L06GGACCCACNONE 
J075114H11GGACCCACNONE 
J075120E09GGACCCACNONE 
J075137F08GGACCCACNONE 
J075154D10GGACCCACNONE 
J075158A18GGACCCACNONE 
J075197N10GGACCCACNONE 
Os03g0562400AK063408GTGGGTCCAGADi-copper centre-containing domain containing protein. 
Os03g0648300AK067192GTGGGTCCGTCCGAIQ calmodulin-binding region domain containing protein. 
J013098A04GTGGGTCCGTCCGANONE 
J075149P13GTGGGTCCGTCCGANONE 
J100044P16GTGGGTCCGTCCGANONE 
J100053G19GTGGGTCCGTCCGANONE 
Os03g0684400AK100086GTGGGACCCACMg2+ transporter protein, CorA-like family protein. 
Os03g0688200015-014-E12AAGGCCCAGGGTGGGTCCNONE 
AK103539AAGGCCCAGGGTGGGTCCConserved hypothetical protein. 
Os03g0704200AK071176GCCACGTGGGTCCCACCZinc finger, MYND-type domain containing protein. 
J023083O08GCCACGTGGGTCCCACCNONE 
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE 
006-023-C08TCTGGACCCACCTGTCAGTGNONE 
006-029-H02TCTGGACCCACCTGTCAGTGNONE 
006-032-B03TCTGGACCCACCTGTCAGTGNONE 
006-035-C10TCTGGACCCACCTGTCAGTGNONE 
006-040-H05TCTGGACCCACCTGTCAGTGNONE 
006-043-C02TCTGGACCCACCTGTCAGTGNONE 
006-046-B11TCTGGACCCACCTGTCAGTGNONE 
006-046-E05TCTGGACCCACCTGTCAGTGNONE 
006-046-H04TCTGGACCCACCTGTCAGTGNONE 
006-048-A09TCTGGACCCACCTGTCAGTGNONE 
006-050-A02TCTGGACCCACCTGTCAGTGNONE 
006-063-A02TCTGGACCCACCTGTCAGTGNONE 
006-064-A09TCTGGACCCACCTGTCAGTGNONE 
006-070-G11TCTGGACCCACCTGTCAGTGNONE 
006-072-G04TCTGGACCCACCTGTCAGTGNONE 
006-077-G12TCTGGACCCACCTGTCAGTGNONE 
006-080-F04TCTGGACCCACCTGTCAGTGNONE 
006-080-H01TCTGGACCCACCTGTCAGTGNONE 
006-084-D10TCTGGACCCACCTGTCAGTGNONE 
006-084-G06TCTGGACCCACCTGTCAGTGNONE 
006-085-H10TCTGGACCCACCTGTCAGTGNONE 
006-086-C05TCTGGACCCACCTGTCAGTGNONE 
006-087-D10TCTGGACCCACCTGTCAGTGNONE 
006-096-C09TCTGGACCCACCTGTCAGTGNONE 
006-100-F10TCTGGACCCACCTGTCAGTGNONE 
006-108-D12TCTGGACCCACCTGTCAGTGNONE 
006-115-G10TCTGGACCCACCTGTCAGTGNONE 
006-119-C09TCTGGACCCACCTGTCAGTGNONE 
006-120-E05TCTGGACCCACCTGTCAGTGNONE 
011-042-H01TCTGGACCCACCTGTCAGTGNONE 
011-075-B11TCTGGACCCACCTGTCAGTGNONE 
013-003-D03TCTGGACCCACCTGTCAGTGNONE 
013-028-B11TCTGGACCCACCTGTCAGTGNONE 
013-031-A01TCTGGACCCACCTGTCAGTGNONE 
013-035-F03TCTGGACCCACCTGTCAGTGNONE 
013-051-D02TCTGGACCCACCTGTCAGTGNONE 
013-055-D06TCTGGACCCACCTGTCAGTGNONE 
013-059-H03TCTGGACCCACCTGTCAGTGNONE 
013-076-A09TCTGGACCCACCTGTCAGTGNONE 
013-076-B01TCTGGACCCACCTGTCAGTGNONE 
013-090-F09TCTGGACCCACCTGTCAGTGNONE 
013-100-A05TCTGGACCCACCTGTCAGTGNONE 
013-100-F05TCTGGACCCACCTGTCAGTGNONE 
013-100-G12TCTGGACCCACCTGTCAGTGNONE 
014-006-G08TCTGGACCCACCTGTCAGTGNONE 
015-003-B07TCTGGACCCACCTGTCAGTGNONE 
016-093-C06TCTGGACCCACCTGTCAGTGNONE 
AF030548TCTGGACCCACCTGTCAGTGNONE 
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247TCTGGACCCACCTGTCAGTGNONE 
AK119362TCTGGACCCACCTGTCAGTGNONE 
AK119638TCTGGACCCACCTGTCAGTGNONE 
J013066P16TCTGGACCCACCTGTCAGTGNONE 
J023022H18TCTGGACCCACCTGTCAGTGNONE 
J023087O13TCTGGACCCACCTGTCAGTGNONE 
J023121I16TCTGGACCCACCTGTCAGTGNONE 
J023123M09TCTGGACCCACCTGTCAGTGNONE 
J033022M05TCTGGACCCACCTGTCAGTGNONE 
J033087C05TCTGGACCCACCTGTCAGTGNONE 
J065022K07TCTGGACCCACCTGTCAGTGNONE 
J065024E22TCTGGACCCACCTGTCAGTGNONE 
J065041G05TCTGGACCCACCTGTCAGTGNONE 
J065045M11TCTGGACCCACCTGTCAGTGNONE 
J065082K10TCTGGACCCACCTGTCAGTGNONE 
J065121K18TCTGGACCCACCTGTCAGTGNONE 
J065137O07TCTGGACCCACCTGTCAGTGNONE 
J065144B12TCTGGACCCACCTGTCAGTGNONE 
J065152E04TCTGGACCCACCTGTCAGTGNONE 
J065159D24TCTGGACCCACCTGTCAGTGNONE 
J065217E02TCTGGACCCACCTGTCAGTGNONE 
J075014N22TCTGGACCCACCTGTCAGTGNONE 
J075064O17TCTGGACCCACCTGTCAGTGNONE 
J080316L10TCTGGACCCACCTGTCAGTGNONE 
J080318L20TCTGGACCCACCTGTCAGTGNONE 
J090034D01TCTGGACCCACCTGTCAGTGNONE 
J090034P05TCTGGACCCACCTGTCAGTGNONE 
J090041H08TCTGGACCCACCTGTCAGTGNONE 
J090042F20TCTGGACCCACCTGTCAGTGNONE 
J090042I15TCTGGACCCACCTGTCAGTGNONE 
J090050O17TCTGGACCCACCTGTCAGTGNONE 
J090054L13TCTGGACCCACCTGTCAGTGNONE 
J090062A12TCTGGACCCACCTGTCAGTGNONE 
J090068I22TCTGGACCCACCTGTCAGTGNONE 
J090070J23TCTGGACCCACCTGTCAGTGNONE 
J090070M18TCTGGACCCACCTGTCAGTGNONE 
J090084L07TCTGGACCCACCTGTCAGTGNONE 
J090087H13TCTGGACCCACCTGTCAGTGNONE 
J090095H10TCTGGACCCACCTGTCAGTGNONE 
J090099M17TCTGGACCCACCTGTCAGTGNONE 
J100022O10TCTGGACCCACCTGTCAGTGNONE 
J100048A05TCTGGACCCACCTGTCAGTGNONE 
J100057O06TCTGGACCCACCTGTCAGTGNONE 
X91806TCTGGACCCACCTGTCAGTGNONE 
Os03g0735000AK069296GTGGGTCCCACGCGSimilar to Glucose-1-phosphate adenylyltransferase large subunit 2 (EC 2.7.7.27) (ADP-glucose synthase) (ADP-glucose pyrophosphorylase) (AGPASE S) (Alpha-D-glucose-1-phosphate adenyl transferase) (BLPL) (Fragment). 
Os03g0780600AK120180GGGACCCACNONE 
D13224GGGACCCACTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18GGGACCCACNONE 
J033022G05GGGACCCACNONE 
J033028A16GGGACCCACNONE 
J033050M08GGGACCCACNONE 
J090053F04GGGACCCACNONE 
J090064E19GGGACCCACNONE 
J090083J24GGGACCCACNONE 
J100024I23GGGACCCACNONE 
Os03g0791800013-037-A12CGTGGACCCACNONE 
AB079798CGTGGACCCACNONE 
AK067703CGTGGACCCACRad6 (Ubiquitin carrier protein). 
AK120251CGTGGACCCACNONE 
J013045G10CGTGGACCCACNONE 
J023102B18CGTGGACCCACNONE 
J065020J23CGTGGACCCACNONE 
J065127I21CGTGGACCCACNONE 
J065151E11CGTGGACCCACNONE 
J075076B05CGTGGACCCACNONE 
J075116C15CGTGGACCCACNONE 
J075136A07CGTGGACCCACNONE 
J100029G21CGTGGACCCACNONE 
J100030K01CGTGGACCCACNONE 
J100041J02CGTGGACCCACNONE 
J100049C22CGTGGACCCACNONE 
J100057G17CGTGGACCCACNONE 
J100086L12CGTGGACCCACNONE 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0822400013-072-A06CCACTGACAAGTGGGTCCCNONE 
014-009-H06CCACTGACAAGTGGGTCCCNONE 
014-025-G05CCACTGACAAGTGGGTCCCNONE 
014-033-G02CCACTGACAAGTGGGTCCCNONE 
014-038-G06CCACTGACAAGTGGGTCCCNONE 
014-047-H10CCACTGACAAGTGGGTCCCNONE 
014-054-H04CCACTGACAAGTGGGTCCCNONE 
014-055-F05CCACTGACAAGTGGGTCCCNONE 
014-075-E04CCACTGACAAGTGGGTCCCNONE 
014-084-B02CCACTGACAAGTGGGTCCCNONE 
014-087-F10CCACTGACAAGTGGGTCCCNONE 
014-098-D02CCACTGACAAGTGGGTCCCNONE 
014-099-B04CCACTGACAAGTGGGTCCCNONE 
014-100-H10CCACTGACAAGTGGGTCCCNONE 
AK070075CCACTGACAAGTGGGTCCCConserved hypothetical protein. 
AK102425CCACTGACAAGTGGGTCCCNONE 
J065134M15CCACTGACAAGTGGGTCCCNONE 
J090053B16CCACTGACAAGTGGGTCCCNONE 
Os03g0829100AK072669GGACCCACSimilar to Soluble epoxide hydrolase. 
J013073C22GGACCCACNONE 
J033067O15GGACCCACNONE 
J065021D04GGACCCACNONE 
J065102E20GGACCCACNONE 
Os03g0832600AK120137CAAGTGGGTCCCACSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein. 
Os03g0856200AK064097GTGGGTCCNONE 
AK120953GTGGGTCCSimilar to KAP-2. 
Os04g0116200AK064677GGACCCACProtein of unknown function DUF827, plant family protein. 
J065017D03GGACCCACNONE 
J065095C04GGACCCACNONE 
J065211O18GGACCCACNONE 
J065219H18GGACCCACNONE 
Os04g0117100009-025-D02GGGACCCACCCCACCCGGCCCAAGNONE 
009-056-D03GGGACCCACCCCACCCGGCCCAAGNONE 
009-145-F01GGGACCCACCCCACCCGGCCCAAGNONE 
009-146-C06GGGACCCACCCCACCCGGCCCAAGNONE 
009-186-C05GGGACCCACCCCACCCGGCCCAAGNONE 
AK060395GGGACCCACCCCACCCGGCCCAAGNONE 
AK121763GGGACCCACCCCACCCGGCCCAAGConserved hypothetical protein. 
J033090J17GGGACCCACCCCACCCGGCCCAAGNONE 
J065058O06GGGACCCACCCCACCCGGCCCAAGNONE 
J065058P05GGGACCCACCCCACCCGGCCCAAGNONE 
J065141C14GGGACCCACCCCACCCGGCCCAAGNONE 
J065162F07GGGACCCACCCCACCCGGCCCAAGNONE 
J065199N16GGGACCCACCCCACCCGGCCCAAGNONE 
J065214I05GGGACCCACCCCACCCGGCCCAAGNONE 
J075003L04GGGACCCACCCCACCCGGCCCAAGNONE 
J075014C14GGGACCCACCCCACCCGGCCCAAGNONE 
J075063K14GGGACCCACCCCACCCGGCCCAAGNONE 
J075111N19GGGACCCACCCCACCCGGCCCAAGNONE 
J075138E13GGGACCCACCCCACCCGGCCCAAGNONE 
J075189E23GGGACCCACCCCACCCGGCCCAAGNONE 
J080304J23GGGACCCACCCCACCCGGCCCAAGNONE 
J080310L07GGGACCCACCCCACCCGGCCCAAGNONE 
J080318A16GGGACCCACCCCACCCGGCCCAAGNONE 
J100054P14GGGACCCACCCCACCCGGCCCAAGNONE 
Os04g0218900AK071049GTGGGTCCTRAF-like domain containing protein. 
J023004C03GTGGGTCCNONE 
J023060C17GTGGGTCCNONE 
J023077B16GTGGGTCCNONE 
J023106C15GTGGGTCCNONE 
Os04g0258900009-146-B02GTGGGACCCACGTGGGTCCCACNONE 
AK062983GTGGGACCCACGTGGGTCCCACCyclin-like F-box domain containing protein. 
Os04g0259800AK111548GGACCCACCTGConserved hypothetical protein. 
Os04g0274400AK062600GGACCCACYL1 nuclear, C-terminal domain containing protein. 
J065051G04GGACCCACNONE 
Os04g0275966J065015F20GGACCCACCTGConserved hypothetical protein. 
J065118M18GGACCCACCTGNONE 
Os04g0278000AK120988CGTGTGGGACCCACCACSimilar to PRLI-interacting factor G (Fragment). 
Os04g0313300AK121730GGACCCACTTGConserved hypothetical protein. 
J033082F07GGACCCACTTGNONE 
Os04g0390500AK066575CTGACAGGTGGGTCCNONE 
AK099908CTGACAGGTGGGTCCNONE 
AK100148CTGACAGGTGGGTCCNONE 
Os04g0444900AK063657GGGACCCACSimilar to Alfin-1. 
AK098960GGGACCCACNONE 
J065037L14GGGACCCACNONE 
J065037P22GGGACCCACNONE 
J065173O15GGGACCCACNONE 
Os04g0462500006-073-E08GGCCGTGGGACCCACNONE 
AK062065GGCCGTGGGACCCACNONE 
AK071311GGCCGTGGGACCCACSimilar to 14-3-3-like protein GF14-6. 
AK071822GGCCGTGGGACCCACNONE 
AK099243GGCCGTGGGACCCACNONE 
AK101938GGCCGTGGGACCCACNONE 
J013056F02GGCCGTGGGACCCACNONE 
J023020E08GGCCGTGGGACCCACNONE 
J023085B16GGCCGTGGGACCCACNONE 
J023117D08GGCCGTGGGACCCACNONE 
J023133K12GGCCGTGGGACCCACNONE 
J033025G04GGCCGTGGGACCCACNONE 
J033052A15GGCCGTGGGACCCACNONE 
J033074G16GGCCGTGGGACCCACNONE 
J033090A16GGCCGTGGGACCCACNONE 
J033122A07GGCCGTGGGACCCACNONE 
J033133G09GGCCGTGGGACCCACNONE 
J065002F16GGCCGTGGGACCCACNONE 
J065030M09GGCCGTGGGACCCACNONE 
J065056B11GGCCGTGGGACCCACNONE 
J065115I10GGCCGTGGGACCCACNONE 
J065120O09GGCCGTGGGACCCACNONE 
J065124G21GGCCGTGGGACCCACNONE 
J075031C14GGCCGTGGGACCCACNONE 
J075040H07GGCCGTGGGACCCACNONE 
J075047F04GGCCGTGGGACCCACNONE 
J075065F14GGCCGTGGGACCCACNONE 
J075066G20GGCCGTGGGACCCACNONE 
J075105D01GGCCGTGGGACCCACNONE 
J075147B04GGCCGTGGGACCCACNONE 
J075149A12GGCCGTGGGACCCACNONE 
J075172D07GGCCGTGGGACCCACNONE 
J075190J11GGCCGTGGGACCCACNONE 
J090038H18GGCCGTGGGACCCACNONE 
J090087G05GGCCGTGGGACCCACNONE 
J100025A10GGCCGTGGGACCCACNONE 
J100025O10GGCCGTGGGACCCACNONE 
J100027D02GGCCGTGGGACCCACNONE 
J100027P06GGCCGTGGGACCCACNONE 
J100032K04GGCCGTGGGACCCACNONE 
J100056D21GGCCGTGGGACCCACNONE 
J100060J08GGCCGTGGGACCCACNONE 
J100063N19GGCCGTGGGACCCACNONE 
J100064C14GGCCGTGGGACCCACNONE 
J100064K18GGCCGTGGGACCCACNONE 
J100070L21GGCCGTGGGACCCACNONE 
J100072M17GGCCGTGGGACCCACNONE 
J100074F21GGCCGTGGGACCCACNONE 
J100087E05GGCCGTGGGACCCACNONE 
U65956GGCCGTGGGACCCACNONE 
Os04g0480900AK109889TGGGACCCACGlycoside hydrolase, family 5 protein. 
Os04g0485200006-033-B07GTGGGTCCCACTTGNONE 
AK061463GTGGGTCCCACTTGNONE 
J023037H14GTGGGTCCCACTTGNONE 
J023083B19GTGGGTCCCACTTGNONE 
J023104H04GTGGGTCCCACTTGNONE 
J043022C03GTGGGTCCCACTTGNONE 
Os04g0548000011-097-D07GTGGGACCCACNONE 
AK073099GTGGGACCCACNONE 
AK104979GTGGGACCCACProtein of unknown function DUF862, eukaryotic domain containing protein. 
J065102C18GTGGGACCCACNONE 
J075076A16GTGGGACCCACNONE 
J075082L09GTGGGACCCACNONE 
J075092L18GTGGGACCCACNONE 
J075092N01GTGGGACCCACNONE 
J075122P14GTGGGACCCACNONE 
J075148L06GTGGGACCCACNONE 
Os04g0558500J065017H16GTGGGTCCCACConserved hypothetical protein. 
Os04g0563300AK100487CCCACGTGGGTCCCACyclin-like F-box domain containing protein. 
J023097O18CCCACGTGGGTCCCANONE 
J065100E16CCCACGTGGGTCCCANONE 
J075022C23CCCACGTGGGTCCCANONE 
J075023L18CCCACGTGGGTCCCANONE 
J075040N10CCCACGTGGGTCCCANONE 
J075061L14CCCACGTGGGTCCCANONE 
J075069B15CCCACGTGGGTCCCANONE 
J075106C16CCCACGTGGGTCCCANONE 
J075138P13CCCACGTGGGTCCCANONE 
J075139H18CCCACGTGGGTCCCANONE 
J075139L06CCCACGTGGGTCCCANONE 
J075149B07CCCACGTGGGTCCCANONE 
J075177N21CCCACGTGGGTCCCANONE 
Os04g0617050J065197A20GTGGGACCCACCTGTNONE 
J090067K01GTGGGACCCACCTGTAuxin responsive SAUR protein family protein. 
Os04g0629500009-120-G06GGACCCACNONE 
AK072821GGACCCACSimilar to Thioredoxin h. 
AK103985GGACCCACNONE 
AK121437GGACCCACNONE 
J013111B13GGACCCACNONE 
J013128N16GGACCCACNONE 
J023098G05GGACCCACNONE 
J023139A03GGACCCACNONE 
J023140C07GGACCCACNONE 
J065045N21GGACCCACNONE 
J065054G17GGACCCACNONE 
J065054L01GGACCCACNONE 
J100044H07GGACCCACNONE 
J100064L04GGACCCACNONE 
Os04g0631200013-003-B06ACGCGTGGGTCCCNONE 
AK059277ACGCGTGGGTCCCSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331ACGCGTGGGTCCCNONE 
J033024P08ACGCGTGGGTCCCNONE 
J033041G02ACGCGTGGGTCCCNONE 
J053075H12ACGCGTGGGTCCCNONE 
J065016B13ACGCGTGGGTCCCNONE 
J090075B22ACGCGTGGGTCCCNONE 
J100084K17ACGCGTGGGTCCCNONE 
Os04g0685600AK067506GGACCCACExo70 exocyst complex subunit family protein. 
J013108D21GGACCCACNONE 
J023041E19GGACCCACNONE 
J065006M21GGACCCACNONE 
J065060B21GGACCCACNONE 
J065086K07GGACCCACNONE 
J065121N03GGACCCACNONE 
J065201M22GGACCCACNONE 
J075004H05GGACCCACNONE 
J075005G06GGACCCACNONE 
J075032N07GGACCCACNONE 
J075055M01GGACCCACNONE 
J075057A20GGACCCACNONE 
J075078L23GGACCCACNONE 
J075137G04GGACCCACNONE 
J090026N09GGACCCACNONE 
J090044L05GGACCCACNONE 
Os04g0686700AK105746CACTGACAGTGGGTCCKelch repeat containing protein. 
AK105746TGGGACCCACKelch repeat containing protein. 
J065021K04CACTGACAGTGGGTCCNONE 
J065021K04TGGGACCCACNONE 
J065097E18CACTGACAGTGGGTCCNONE 
J065097E18TGGGACCCACNONE 
J075004C12CACTGACAGTGGGTCCNONE 
J075004C12TGGGACCCACNONE 
J080301H10CACTGACAGTGGGTCCNONE 
J080301H10TGGGACCCACNONE 
J090087N02CACTGACAGTGGGTCCNONE 
J090087N02TGGGACCCACNONE 
J100060E19CACTGACAGTGGGTCCNONE 
J100060E19TGGGACCCACNONE 
Os04g0690866014-091-B08GTGGGACCCACGTGConserved hypothetical protein. 
J065085H18GTGGGACCCACGTGNONE 
J065099J05GTGGGACCCACGTGNONE 
J065194D12GTGGGACCCACGTGNONE 
J065197H01GTGGGACCCACGTGNONE 
Os05g0115100015-002-G01TGGGACCCACCACNONE 
016-075-D04TGGGACCCACCACNONE 
AK106226TGGGACCCACCACProtein of unknown function DUF1635 family protein. 
AK110672TGGGACCCACCACNONE 
J075034O20TGGGACCCACCACNONE 
Os05g0116500AK102231GGGACCCACCACConserved hypothetical protein. 
J033088A05GGGACCCACCACNONE 
Os05g0129400AK102359TGGGACCCACGTGGGTCCCACAnkyrin repeat containing protein. 
J033091I05TGGGACCCACGTGGGTCCCACNONE 
Os05g0132100AK069689GGGACCCACAMP-dependent synthetase and ligase domain containing protein. 
AK105618GGGACCCACNONE 
Os05g0162600012-069-E09GTGGGACCCACNONE 
AK063518GTGGGACCCACSimilar to Splicing factor RSZ33. 
AK121854GTGGGACCCACNONE 
J065178M11GTGGGACCCACNONE 
J090016J24GTGGGACCCACNONE 
J090023E07GTGGGACCCACNONE 
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0168500AK100711GGACCCACNonaspanin (TM9SF) family protein. 
J013034G08GGACCCACNONE 
J013039B03GGACCCACNONE 
J013056H15GGACCCACNONE 
J023003H09GGACCCACNONE 
J023012B03GGACCCACNONE 
J023115H14GGACCCACNONE 
J023150N08GGACCCACNONE 
J033055J19GGACCCACNONE 
J053063M15GGACCCACNONE 
J065013M18GGACCCACNONE 
J065089N08GGACCCACNONE 
J065209C13GGACCCACNONE 
J100072F03GGACCCACNONE 
Os05g0169400AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os05g0197300AK106389TGGGACCCACTCCIQ calmodulin-binding region domain containing protein. 
Os05g0200700AK110596GTGGGTCCCConserved hypothetical protein. 
Os05g0207400AK070191GGACCCACRINGv domain containing protein. 
AK104023GGACCCACNONE 
Os05g0220900AK109172GTGGGTCCCACNONE 
AK109456GTGGGTCCCACPrefoldin domain containing protein. 
Os05g0291700AK073234GTGGGTCCNONE 
AK099865GTGGGTCCConserved hypothetical protein. 
AK108453GTGGGTCCNONE 
Os05g0295800AK070232ACACGTGGGTCCSimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03ACACGTGGGTCCNONE 
Os05g0300700014-079-G07GGTGGGACCCACNONE 
AK063728GGTGGGACCCACNONE 
AK067846GGTGGGACCCACConserved hypothetical protein. 
Os05g0319800AK100483GTGGGACCCACSimilar to Plasma membrane H+ ATPase (EC 3.6.3.6). 
Os05g0346100012-005-C07GTGGGTCCNONE 
AK066689GTGGGTCCPhox-like domain containing protein. 
J013073J06GTGGGTCCNONE 
Os05g0350500013-071-D05GGACCCACCTGTCAGTGNONE 
AF020787GGACCCACCTGTCAGTGNONE 
AK061712GGACCCACCTGTCAGTGNONE 
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein. 
J033060G23GGACCCACCTGTCAGTGNONE 
J033112P14GGACCCACCTGTCAGTGNONE 
J033127J04GGACCCACCTGTCAGTGNONE 
J090015L18GGACCCACCTGTCAGTGNONE 
J090047K03GGACCCACCTGTCAGTGNONE 
J090097J17GGACCCACCTGTCAGTGNONE 
Os05g0350600AK066244GGGACCCACSimilar to Atranbp1b protein. 
J075100E12GGGACCCACNONE 
J090024D03GGGACCCACNONE 
J100027C02GGGACCCACNONE 
J100053P05GGGACCCACNONE 
J100055P22GGGACCCACNONE 
Os05g0372400AK068781GGACACGTGGGTCCCACLipase, class 3 family protein. 
Os05g0383000009-135-E10GGGACCCACGTGNONE 
AK058345GGGACCCACGTGTetratricopeptide-like helical domain containing protein. 
AK102079GGGACCCACGTGNONE 
J033082J04GGGACCCACGTGNONE 
J033142L02GGGACCCACGTGNONE 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE 
Os05g0406800AK062566GGACCCACNONE 
AK099640GGACCCACLeucine rich repeat, N-terminal domain containing protein. 
J013060B14GGACCCACNONE 
J090013F14GGACCCACNONE 
J090062E13GGACCCACNONE 
J090063D09GGACCCACNONE 
J090075H10GGACCCACNONE 
J090096E22GGACCCACNONE 
Os05g0440100015-006-F06CACGTGGGTCCCACNONE 
015-076-D04CACGTGGGTCCCACNONE 
AK073094CACGTGGGTCCCACNONE 
AK102786CACGTGGGTCCCACHistone deacetylase superfamily protein. 
J033107M16CACGTGGGTCCCACNONE 
Os05g0498400009-129-A03GTGGGTCCCANONE 
009-192-D10GTGGGTCCCANONE 
009-194-D06GTGGGTCCCANONE 
AK058219GTGGGTCCCASimilar to Protein translation factor SUI1. 
AK070301GTGGGTCCCANONE 
J043038N18GTGGGTCCCANONE 
J065027A13GTGGGTCCCANONE 
J075040J15GTGGGTCCCANONE 
J075165B14GTGGGTCCCANONE 
Os05g0503300011-013-H12GTGTCACTGACAGTGGGACCCACCACNONE 
012-072-B03GTGTCACTGACAGTGGGACCCACCACNONE 
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment). 
AK100773GTGTCACTGACAGTGGGACCCACCACNONE 
AK103289GTGTCACTGACAGTGGGACCCACCACNONE 
J013045K07GTGTCACTGACAGTGGGACCCACCACNONE 
J033075F01GTGTCACTGACAGTGGGACCCACCACNONE 
J033125N07GTGTCACTGACAGTGGGACCCACCACNONE 
J033130G12GTGTCACTGACAGTGGGACCCACCACNONE 
Os05g0512000AK102433GGACCCACGTGGCZinc finger, RING-type domain containing protein. 
Os05g0515600Os05g0515600GTGGGTCCSimilar to O-methyltransferase ZRP4 (EC 2.1.1.-) (OMT). 
Os05g0535900AK101539GGAGTGGGACCCACNONE 
AK101555GGAGTGGGACCCACIQ calmodulin-binding region domain containing protein. 
J013047J05GGAGTGGGACCCACNONE 
Os05g0567500AK073046GGACCCACNONE 
AK121133GGACCCACDNA glycosylase family protein. 
J023075P20GGACCCACNONE 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os05g0585900AK062575GTGGGTCCCACTCCMitochondrial substrate carrier family protein. 
AK098854GTGGGTCCCACTCCNONE 
J013000H16GTGGGTCCCACTCCNONE 
J033118D07GTGGGTCCCACTCCNONE 
Os06g0102600J065187I04GTGGGTCCCHypothetical protein. 
Os06g0102800AK068790GTGGGTCCConserved hypothetical protein. 
Os06g0136900AK107405GTGGGTCCCACCGCACProtein of unknown function DUF296 domain containing protein. 
Os06g0217700009-074-A04GTGGGTCCCANONE 
AK062617GTGGGTCCCAConserved hypothetical protein. 
Os06g0233000009-177-C07GGACCCACNONE 
AK063118GGACCCACConserved hypothetical protein. 
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein. 
Os06g0246600AK107692GTGGGTCCCASimilar to Glutamate receptor 3.3 precursor (Ligand-gated ion channel 3.3). 
Os06g0264300AK061556CAGGTGGGTCCNONE 
AK061556GTGGGTCCCACNONE 
AK073271CAGGTGGGTCCSimilar to RAD23, isoform I. 
AK073271GTGGGTCCCACSimilar to RAD23, isoform I. 
Os06g0265000AK100247GGGACCCACSimilar to Asparagine synthetase. 
D83378GGGACCCACNONE 
J013033O15GGGACCCACNONE 
J013037K20GGGACCCACNONE 
J013058I07GGGACCCACNONE 
J033125M21GGGACCCACNONE 
J033142B02GGGACCCACNONE 
J043030E23GGGACCCACNONE 
J043034K11GGGACCCACNONE 
J053050B10GGGACCCACNONE 
J053061I09GGGACCCACNONE 
J053068F17GGGACCCACNONE 
J053074G11GGGACCCACNONE 
J053095N11GGGACCCACNONE 
J090028M17GGGACCCACNONE 
J090031O08GGGACCCACNONE 
J090094C22GGGACCCACNONE 
J100045M24GGGACCCACNONE 
J100055P03GGGACCCACNONE 
J100073O10GGGACCCACNONE 
J100081K21GGGACCCACNONE 
U55873GGGACCCACNONE 
Os06g0324000AK109614GTGGGACCCACGTGGACCConserved hypothetical protein. 
Os06g0353700J065177D24GGACCCACCTGConserved hypothetical protein. 
Os06g0574200Os06g0574200GTGGGTCCCACACGTGTGGGCCCACCCCCACACAGCCGTTGUspA domain containing protein. 
Os06g0609900AK109324GGTGGGACCCACConserved hypothetical protein. 
Os06g0621300AK068751TGGGACCCACGTGGACCConserved hypothetical protein. 
J013159I20TGGGACCCACGTGGACCNONE 
Os06g0650900AK071882GTGGGTCCNONE 
AK107961GTGGGTCCHeat shock protein DnaJ family protein. 
Os06g0665500015-073-H04GGACCCACGCGNONE 
AK073262GGACCCACGCGAmidase, hydantoinase/carbamoylase family protein. 
J023095H01GGACCCACGCGNONE 
J023150C12GGACCCACGCGNONE 
J033026H23GGACCCACGCGNONE 
J033136A22GGACCCACGCGNONE 
J043021O11GGACCCACGCGNONE 
J065054C02GGACCCACGCGNONE 
J065117N17GGACCCACGCGNONE 
J075020B19GGACCCACGCGNONE 
J075021C15GGACCCACGCGNONE 
J075030E13GGACCCACGCGNONE 
J075046B01GGACCCACGCGNONE 
J075052L03GGACCCACGCGNONE 
J075071L10GGACCCACGCGNONE 
J075083L22GGACCCACGCGNONE 
J075108H22GGACCCACGCGNONE 
J075112G22GGACCCACGCGNONE 
J075112I23GGACCCACGCGNONE 
J075115C09GGACCCACGCGNONE 
J075118B03GGACCCACGCGNONE 
J075123H10GGACCCACGCGNONE 
J075123J08GGACCCACGCGNONE 
J075124J05GGACCCACGCGNONE 
J075125O04GGACCCACGCGNONE 
J075143D17GGACCCACGCGNONE 
J075157I06GGACCCACGCGNONE 
J090031B18GGACCCACGCGNONE 
J100030M07GGACCCACGCGNONE 
J100037E19GGACCCACGCGNONE 
J100087H18GGACCCACGCGNONE 
Os06g0668200011-004-A12GTGGGACCCACNONE 
AK070705GTGGGACCCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
AK101622GTGGGACCCACNONE 
D10408GTGGGACCCACNONE 
J033044L05GTGGGACCCACNONE 
J033052L01GTGGGACCCACNONE 
J033086F09GTGGGACCCACNONE 
J033096I19GTGGGACCCACNONE 
J053072J20GTGGGACCCACNONE 
J065074N09GTGGGACCCACNONE 
J065075K09GTGGGACCCACNONE 
J065130L15GTGGGACCCACNONE 
J065136P12GTGGGACCCACNONE 
J065137M09GTGGGACCCACNONE 
J065139O15GTGGGACCCACNONE 
J075003J03GTGGGACCCACNONE 
J075021J20GTGGGACCCACNONE 
Os06g0677600009-200-F02CGCGTGGGTCCNONE 
AK063252CGCGTGGGTCCLike-Sm ribonucleoprotein, core family protein. 
J075028G10CGCGTGGGTCCNONE 
J075189D08CGCGTGGGTCCNONE 
J090045C02CGCGTGGGTCCNONE 
Os06g0678200AK059456GTGGGTCCNONE 
AK071299GTGGGTCCSimilar to Geranyl diphosphate synthase. 
Os07g0107900011-004-F03GTGGCGTGGGTCCNONE 
011-089-F01GTGGCGTGGGTCCNONE 
AK073520GTGGCGTGGGTCCNONE 
AK073651GTGGCGTGGGTCCConserved hypothetical protein. 
J013118M08GTGGCGTGGGTCCNONE 
J033042E18GTGGCGTGGGTCCNONE 
J033066E10GTGGCGTGGGTCCNONE 
J080303I24GTGGCGTGGGTCCNONE 
J080316O19GTGGCGTGGGTCCNONE 
J090019H13GTGGCGTGGGTCCNONE 
Os07g0124600AK073437GTGGGACCCACCTGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GTGGGACCCACCTGTCNONE 
J033136G07GTGGGACCCACCTGTCNONE 
J065092I12GTGGGACCCACCTGTCNONE 
J065132F04GTGGGACCCACCTGTCNONE 
J065143I11GTGGGACCCACCTGTCNONE 
Os07g0154900009-142-E09GTGGGACCCACNONE 
AK062969GTGGGACCCACConserved hypothetical protein. 
Os07g0164100AK111557GGACCCACHistone deacetylase superfamily protein. 
Os07g0164200009-038-C11GTGGGTCCNONE 
AK059382GTGGGTCCTranslation factor domain containing protein. 
AK107096GTGGGTCCNONE 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0256200AK072904GGACCCACTGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GGACCCACTGACNONE 
Os07g0408700004-019-E03CAAGTGGGACCCACNONE 
015-093-D01CAAGTGGGACCCACNONE 
AJ251298CAAGTGGGACCCACNONE 
AK060916CAAGTGGGACCCACNONE 
AK099606CAAGTGGGACCCACSimilar to Spermidine synthase 2 (EC 2.5.1.16) (Putrescine aminopropyltransferase 2) (SPDSY 2). 
J013052G01CAAGTGGGACCCACNONE 
Os07g0419800J080309B06GGACCCACNONE 
Os07g0442000AK068559GTGGGACCCACGGGCCCACCACyclin-like F-box domain containing protein. 
Os07g0551300AK102758TGGGACCCACSimilar to KI domain interacting kinase 1. 
Os07g0562700003-111-G08GTGGGTCCCANONE 
004-013-E07GTGGGTCCCANONE 
006-021-D03GTGGGTCCCANONE 
006-021-D07GTGGGTCCCANONE 
006-021-F09GTGGGTCCCANONE 
006-023-D01GTGGGTCCCANONE 
006-024-F04GTGGGTCCCANONE 
006-024-G09GTGGGTCCCANONE 
006-024-G11GTGGGTCCCANONE 
006-025-A10GTGGGTCCCANONE 
006-025-B08GTGGGTCCCANONE 
006-025-E10GTGGGTCCCANONE 
006-025-F10GTGGGTCCCANONE 
006-026-B04GTGGGTCCCANONE 
006-026-C08GTGGGTCCCANONE 
006-026-D03GTGGGTCCCANONE 
006-026-F03GTGGGTCCCANONE 
006-026-F08GTGGGTCCCANONE 
006-026-F12GTGGGTCCCANONE 
006-027-A10GTGGGTCCCANONE 
006-027-C03GTGGGTCCCANONE 
006-028-C03GTGGGTCCCANONE 
006-029-E02GTGGGTCCCANONE 
006-029-G05GTGGGTCCCANONE 
006-030-A10GTGGGTCCCANONE 
006-030-C06GTGGGTCCCANONE 
006-030-D03GTGGGTCCCANONE 
006-030-D06GTGGGTCCCANONE 
006-030-G05GTGGGTCCCANONE 
006-031-B10GTGGGTCCCANONE 
006-031-D04GTGGGTCCCANONE 
006-031-D11GTGGGTCCCANONE 
006-031-H09GTGGGTCCCANONE 
006-032-C09GTGGGTCCCANONE 
006-032-H09GTGGGTCCCANONE 
006-033-B02GTGGGTCCCANONE 
006-033-B09GTGGGTCCCANONE 
006-033-E01GTGGGTCCCANONE 
006-033-F06GTGGGTCCCANONE 
006-033-G03GTGGGTCCCANONE 
006-034-A08GTGGGTCCCANONE 
006-034-C09GTGGGTCCCANONE 
006-034-F06GTGGGTCCCANONE 
006-035-B12GTGGGTCCCANONE 
006-035-C12GTGGGTCCCANONE 
006-035-H04GTGGGTCCCANONE 
006-035-H12GTGGGTCCCANONE 
006-036-A05GTGGGTCCCANONE 
006-036-A09GTGGGTCCCANONE 
006-036-B10GTGGGTCCCANONE 
006-036-C03GTGGGTCCCANONE 
006-036-E06GTGGGTCCCANONE 
006-037-H11GTGGGTCCCANONE 
006-038-G01GTGGGTCCCANONE 
006-039-B01GTGGGTCCCANONE 
006-039-B12GTGGGTCCCANONE 
006-039-C02GTGGGTCCCANONE 
006-039-E06GTGGGTCCCANONE 
006-039-G12GTGGGTCCCANONE 
006-040-G07GTGGGTCCCANONE 
006-041-H04GTGGGTCCCANONE 
006-042-A11GTGGGTCCCANONE 
006-042-E07GTGGGTCCCANONE 
006-042-F12GTGGGTCCCANONE 
006-043-C01GTGGGTCCCANONE 
006-045-H12GTGGGTCCCANONE 
006-046-A12GTGGGTCCCANONE 
006-046-F03GTGGGTCCCANONE 
006-047-A07GTGGGTCCCANONE 
006-047-A09GTGGGTCCCANONE 
006-047-E10GTGGGTCCCANONE 
006-047-G12GTGGGTCCCANONE 
006-048-B04GTGGGTCCCANONE 
006-049-D01GTGGGTCCCANONE 
006-049-G02GTGGGTCCCANONE 
006-049-G10GTGGGTCCCANONE 
006-049-H04GTGGGTCCCANONE 
006-050-D05GTGGGTCCCANONE 
006-050-F05GTGGGTCCCANONE 
006-051-B05GTGGGTCCCANONE 
006-051-G12GTGGGTCCCANONE 
006-052-D12GTGGGTCCCANONE 
006-053-D06GTGGGTCCCANONE 
006-054-H02GTGGGTCCCANONE 
006-055-A03GTGGGTCCCANONE 
006-055-C01GTGGGTCCCANONE 
006-055-E07GTGGGTCCCANONE 
006-055-H06GTGGGTCCCANONE 
006-056-F06GTGGGTCCCANONE 
006-057-D03GTGGGTCCCANONE 
006-057-D05GTGGGTCCCANONE 
006-057-G01GTGGGTCCCANONE 
006-058-A03GTGGGTCCCANONE 
006-058-B06GTGGGTCCCANONE 
006-059-A09GTGGGTCCCANONE 
006-059-H11GTGGGTCCCANONE 
006-060-A04GTGGGTCCCANONE 
006-060-A09GTGGGTCCCANONE 
006-060-C11GTGGGTCCCANONE 
006-060-D08GTGGGTCCCANONE 
006-061-A04GTGGGTCCCANONE 
006-061-E01GTGGGTCCCANONE 
006-061-G10GTGGGTCCCANONE 
006-061-H12GTGGGTCCCANONE 
006-062-B07GTGGGTCCCANONE 
006-062-G03GTGGGTCCCANONE 
006-062-H12GTGGGTCCCANONE 
006-063-D05GTGGGTCCCANONE 
006-063-E04GTGGGTCCCANONE 
006-063-F05GTGGGTCCCANONE 
006-063-G05GTGGGTCCCANONE 
006-064-B07GTGGGTCCCANONE 
006-065-C11GTGGGTCCCANONE 
006-065-H02GTGGGTCCCANONE 
006-067-C12GTGGGTCCCANONE 
006-067-F10GTGGGTCCCANONE 
006-068-E02GTGGGTCCCANONE 
006-068-G04GTGGGTCCCANONE 
006-069-A02GTGGGTCCCANONE 
006-071-A07GTGGGTCCCANONE 
006-072-F11GTGGGTCCCANONE 
006-072-F12GTGGGTCCCANONE 
006-073-E12GTGGGTCCCANONE 
006-073-F08GTGGGTCCCANONE 
006-073-H07GTGGGTCCCANONE 
006-074-A07GTGGGTCCCANONE 
006-075-A12GTGGGTCCCANONE 
006-075-B01GTGGGTCCCANONE 
006-075-H10GTGGGTCCCANONE 
006-075-H12GTGGGTCCCANONE 
006-076-B06GTGGGTCCCANONE 
006-077-A09GTGGGTCCCANONE 
006-077-D05GTGGGTCCCANONE 
006-078-C11GTGGGTCCCANONE 
006-078-D12GTGGGTCCCANONE 
006-078-E02GTGGGTCCCANONE 
006-079-A01GTGGGTCCCANONE 
006-079-E02GTGGGTCCCANONE 
006-079-F03GTGGGTCCCANONE 
006-080-G11GTGGGTCCCANONE 
006-081-C02GTGGGTCCCANONE 
006-081-C08GTGGGTCCCANONE 
006-082-B06GTGGGTCCCANONE 
006-082-C11GTGGGTCCCANONE 
006-082-H04GTGGGTCCCANONE 
006-083-E04GTGGGTCCCANONE 
006-083-H12GTGGGTCCCANONE 
006-084-C08GTGGGTCCCANONE 
006-084-E07GTGGGTCCCANONE 
006-084-E10GTGGGTCCCANONE 
006-085-E06GTGGGTCCCANONE 
006-085-E10GTGGGTCCCANONE 
006-086-F06GTGGGTCCCANONE 
006-087-D08GTGGGTCCCANONE 
006-087-F03GTGGGTCCCANONE 
006-087-F10GTGGGTCCCANONE 
006-087-G07GTGGGTCCCANONE 
006-088-A02GTGGGTCCCANONE 
006-089-A04GTGGGTCCCANONE 
006-089-B12GTGGGTCCCANONE 
006-089-D06GTGGGTCCCANONE 
006-089-D10GTGGGTCCCANONE 
006-089-H05GTGGGTCCCANONE 
006-090-C06GTGGGTCCCANONE 
006-091-A03GTGGGTCCCANONE 
006-091-E04GTGGGTCCCANONE 
006-091-H12GTGGGTCCCANONE 
006-092-A08GTGGGTCCCANONE 
006-092-F01GTGGGTCCCANONE 
006-092-G08GTGGGTCCCANONE 
006-093-B12GTGGGTCCCANONE 
006-093-D04GTGGGTCCCANONE 
006-093-F01GTGGGTCCCANONE 
006-094-A08GTGGGTCCCANONE 
006-094-F01GTGGGTCCCANONE 
006-094-F03GTGGGTCCCANONE 
006-095-C12GTGGGTCCCANONE 
006-095-E10GTGGGTCCCANONE 
006-095-E12GTGGGTCCCANONE 
006-095-G06GTGGGTCCCANONE 
006-096-B12GTGGGTCCCANONE 
006-096-C12GTGGGTCCCANONE 
006-096-G02GTGGGTCCCANONE 
006-097-D01GTGGGTCCCANONE 
006-097-D07GTGGGTCCCANONE 
006-097-F04GTGGGTCCCANONE 
006-098-C07GTGGGTCCCANONE 
006-098-D04GTGGGTCCCANONE 
006-099-E06GTGGGTCCCANONE 
006-099-F02GTGGGTCCCANONE 
006-099-F10GTGGGTCCCANONE 
006-100-A07GTGGGTCCCANONE 
006-100-B10GTGGGTCCCANONE 
006-100-G01GTGGGTCCCANONE 
006-100-H06GTGGGTCCCANONE 
006-101-D01GTGGGTCCCANONE 
006-101-F03GTGGGTCCCANONE 
006-102-A12GTGGGTCCCANONE 
006-102-B11GTGGGTCCCANONE 
006-102-C03GTGGGTCCCANONE 
006-102-F11GTGGGTCCCANONE 
006-103-A08GTGGGTCCCANONE 
006-103-B06GTGGGTCCCANONE 
006-103-D01GTGGGTCCCANONE 
006-103-F02GTGGGTCCCANONE 
006-104-B02GTGGGTCCCANONE 
006-104-C01GTGGGTCCCANONE 
006-104-F09GTGGGTCCCANONE 
006-104-H11GTGGGTCCCANONE 
006-105-A03GTGGGTCCCANONE 
006-105-D09GTGGGTCCCANONE 
006-106-B10GTGGGTCCCANONE 
006-107-A06GTGGGTCCCANONE 
006-107-C04GTGGGTCCCANONE 
006-107-E03GTGGGTCCCANONE 
006-107-F05GTGGGTCCCANONE 
006-108-C09GTGGGTCCCANONE 
006-109-C09GTGGGTCCCANONE 
006-109-D10GTGGGTCCCANONE 
006-109-E06GTGGGTCCCANONE 
006-109-E10GTGGGTCCCANONE 
006-110-A06GTGGGTCCCANONE 
006-110-C11GTGGGTCCCANONE 
006-111-A02GTGGGTCCCANONE 
006-111-F02GTGGGTCCCANONE 
006-112-A08GTGGGTCCCANONE 
006-112-H06GTGGGTCCCANONE 
006-113-A08GTGGGTCCCANONE 
006-113-B01GTGGGTCCCANONE 
006-113-C05GTGGGTCCCANONE 
006-113-D01GTGGGTCCCANONE 
006-113-D04GTGGGTCCCANONE 
006-113-D06GTGGGTCCCANONE 
006-113-E09GTGGGTCCCANONE 
006-114-F06GTGGGTCCCANONE 
006-116-B02GTGGGTCCCANONE 
006-117-B07GTGGGTCCCANONE 
006-117-G04GTGGGTCCCANONE 
006-118-D01GTGGGTCCCANONE 
006-118-D12GTGGGTCCCANONE 
006-118-F12GTGGGTCCCANONE 
006-118-G12GTGGGTCCCANONE 
006-119-B08GTGGGTCCCANONE 
006-120-E09GTGGGTCCCANONE 
006-120-G05GTGGGTCCCANONE 
006-120-G10GTGGGTCCCANONE 
009-022-D12GTGGGTCCCANONE 
009-051-H08GTGGGTCCCANONE 
009-065-F05GTGGGTCCCANONE 
009-070-A06GTGGGTCCCANONE 
009-073-B07GTGGGTCCCANONE 
009-092-C10GTGGGTCCCANONE 
009-093-D03GTGGGTCCCANONE 
009-103-B04GTGGGTCCCANONE 
009-106-H08GTGGGTCCCANONE 
009-120-B05GTGGGTCCCANONE 
009-121-F05GTGGGTCCCANONE 
009-122-B04GTGGGTCCCANONE 
009-122-D08GTGGGTCCCANONE 
009-123-F07GTGGGTCCCANONE 
009-125-G02GTGGGTCCCANONE 
009-128-F02GTGGGTCCCANONE 
009-128-H07GTGGGTCCCANONE 
009-131-C06GTGGGTCCCANONE 
009-132-F08GTGGGTCCCANONE 
009-133-G08GTGGGTCCCANONE 
009-134-D09GTGGGTCCCANONE 
009-135-F01GTGGGTCCCANONE 
009-149-E11GTGGGTCCCANONE 
009-153-H04GTGGGTCCCANONE 
009-161-E04GTGGGTCCCANONE 
009-163-A09GTGGGTCCCANONE 
009-163-C05GTGGGTCCCANONE 
009-163-E10GTGGGTCCCANONE 
009-165-F04GTGGGTCCCANONE 
009-166-A07GTGGGTCCCANONE 
009-169-G12GTGGGTCCCANONE 
009-172-G08GTGGGTCCCANONE 
009-179-E06GTGGGTCCCANONE 
009-181-F09GTGGGTCCCANONE 
009-190-G07GTGGGTCCCANONE 
009-191-D01GTGGGTCCCANONE 
009-195-G02GTGGGTCCCANONE 
AF022738GTGGGTCCCANONE 
AK061512GTGGGTCCCANONE 
AK068972GTGGGTCCCANONE 
AK103926GTGGGTCCCANONE 
AK103999GTGGGTCCCANONE 
AK104224GTGGGTCCCANONE 
AK104465GTGGGTCCCANONE 
AK104495GTGGGTCCCANONE 
AK109399GTGGGTCCCASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GTGGGTCCCANONE 
AK119545GTGGGTCCCANONE 
J013043L10GTGGGTCCCANONE 
J013050A09GTGGGTCCCANONE 
J023001G03GTGGGTCCCANONE 
J023024D14GTGGGTCCCANONE 
J023072E11GTGGGTCCCANONE 
J023149E18GTGGGTCCCANONE 
J033029B16GTGGGTCCCANONE 
J065001O21GTGGGTCCCANONE 
J065035B04GTGGGTCCCANONE 
J065044D18GTGGGTCCCANONE 
J065057F12GTGGGTCCCANONE 
J065060A11GTGGGTCCCANONE 
J065062G15GTGGGTCCCANONE 
J065080F13GTGGGTCCCANONE 
J065084N12GTGGGTCCCANONE 
J065101D02GTGGGTCCCANONE 
J065107C07GTGGGTCCCANONE 
J065112N24GTGGGTCCCANONE 
J065141I16GTGGGTCCCANONE 
J065147D05GTGGGTCCCANONE 
J065167H02GTGGGTCCCANONE 
J065207K23GTGGGTCCCANONE 
J075008E16GTGGGTCCCANONE 
J075014F03GTGGGTCCCANONE 
J075015O17GTGGGTCCCANONE 
J075020H20GTGGGTCCCANONE 
J075021E22GTGGGTCCCANONE 
J075023N13GTGGGTCCCANONE 
J075028H10GTGGGTCCCANONE 
J075040F20GTGGGTCCCANONE 
J075051L23GTGGGTCCCANONE 
J075069G16GTGGGTCCCANONE 
J075084F24GTGGGTCCCANONE 
J075090H09GTGGGTCCCANONE 
J075092M21GTGGGTCCCANONE 
J075110C10GTGGGTCCCANONE 
J075111J12GTGGGTCCCANONE 
J075114L04GTGGGTCCCANONE 
J075139E02GTGGGTCCCANONE 
J075160M10GTGGGTCCCANONE 
J075176J03GTGGGTCCCANONE 
J075183I17GTGGGTCCCANONE 
J075191N10GTGGGTCCCANONE 
J075193D07GTGGGTCCCANONE 
J075194M16GTGGGTCCCANONE 
J075197K04GTGGGTCCCANONE 
J080032I11GTGGGTCCCANONE 
J080076M11GTGGGTCCCANONE 
J080311J08GTGGGTCCCANONE 
J080317E05GTGGGTCCCANONE 
J090034L08GTGGGTCCCANONE 
J100040D19GTGGGTCCCANONE 
J100074C11GTGGGTCCCANONE 
Os07g0568300AK067784CCACTGACAGGTGGGTCCCACNONE 
AK067895CCACTGACAGGTGGGTCCCACSimilar to ZF protein (Fragment). 
J013119M01CCACTGACAGGTGGGTCCCACNONE 
J013120B09CCACTGACAGGTGGGTCCCACNONE 
J013123G12CCACTGACAGGTGGGTCCCACNONE 
J023012C12CCACTGACAGGTGGGTCCCACNONE 
J023020G17CCACTGACAGGTGGGTCCCACNONE 
J023037E23CCACTGACAGGTGGGTCCCACNONE 
J033076I01CCACTGACAGGTGGGTCCCACNONE 
J033108A07CCACTGACAGGTGGGTCCCACNONE 
J033138J02CCACTGACAGGTGGGTCCCACNONE 
J075033L09CCACTGACAGGTGGGTCCCACNONE 
J075049E02CCACTGACAGGTGGGTCCCACNONE 
J075060N23CCACTGACAGGTGGGTCCCACNONE 
J075094H13CCACTGACAGGTGGGTCCCACNONE 
J075179L18CCACTGACAGGTGGGTCCCACNONE 
J080005P09CCACTGACAGGTGGGTCCCACNONE 
J080044J03CCACTGACAGGTGGGTCCCACNONE 
J080062G20CCACTGACAGGTGGGTCCCACNONE 
J080063L23CCACTGACAGGTGGGTCCCACNONE 
J080065B16CCACTGACAGGTGGGTCCCACNONE 
J080071K09CCACTGACAGGTGGGTCCCACNONE 
J080089C23CCACTGACAGGTGGGTCCCACNONE 
J090008P21CCACTGACAGGTGGGTCCCACNONE 
J090046B22CCACTGACAGGTGGGTCCCACNONE 
J090094C19CCACTGACAGGTGGGTCCCACNONE 
J090096B19CCACTGACAGGTGGGTCCCACNONE 
J100060G03CCACTGACAGGTGGGTCCCACNONE 
J100082D16CCACTGACAGGTGGGTCCCACNONE 
Os07g0573700AK070473GTGGGTCCCANucleotide-sugar transporter family protein. 
Os07g0583000009-007-G05GTGGGTCCCACNONE 
009-190-E05GTGGGTCCCACNONE 
AK121047GTGGGTCCCACRibosome associated membrane RAMP4 family protein. 
J023055F01GTGGGTCCCACNONE 
J023102M16GTGGGTCCCACNONE 
J065014E08GTGGGTCCCACNONE 
J065022K10GTGGGTCCCACNONE 
J065022L10GTGGGTCCCACNONE 
J065108H15GTGGGTCCCACNONE 
J065142D09GTGGGTCCCACNONE 
J065209L19GTGGGTCCCACNONE 
J075063E11GTGGGTCCCACNONE 
J075072D09GTGGGTCCCACNONE 
J075095G11GTGGGTCCCACNONE 
J075112K10GTGGGTCCCACNONE 
J075128I05GTGGGTCCCACNONE 
J075130O07GTGGGTCCCACNONE 
J075137F12GTGGGTCCCACNONE 
J075139O19GTGGGTCCCACNONE 
J075173L21GTGGGTCCCACNONE 
J075194I22GTGGGTCCCACNONE 
J090062I16GTGGGTCCCACNONE 
J100055L14GTGGGTCCCACNONE 
J100058G14GTGGGTCCCACNONE 
J100058H12GTGGGTCCCACNONE 
J100067L21GTGGGTCCCACNONE 
Os07g0588600AK108320GTGGGTCCCACCZinc finger, C2H2-type domain containing protein. 
Os07g0592200AK099740GACAGGTGGGACCCACGCGPeptidase A1, pepsin family protein. 
AK110717GACAGGTGGGACCCACGCGNONE 
Os07g0597000009-013-A01GGGACCCACNONE 
009-077-A02GGGACCCACNONE 
009-195-H04GGGACCCACNONE 
AF094773GGGACCCACNONE 
AK062134GGGACCCACNONE 
AK103429GGGACCCACSimilar to Eukaryotic translation initiation factor 5A (eIF-5A). 
J013088G19GGGACCCACNONE 
J013152D01GGGACCCACNONE 
J023024K09GGGACCCACNONE 
J023058J15GGGACCCACNONE 
J023097I07GGGACCCACNONE 
J023132B05GGGACCCACNONE 
J033065L11GGGACCCACNONE 
J033086B12GGGACCCACNONE 
J033128M07GGGACCCACNONE 
J043010M23GGGACCCACNONE 
J043024A05GGGACCCACNONE 
J053057P08GGGACCCACNONE 
J065022G24GGGACCCACNONE 
J065028I10GGGACCCACNONE 
J065065D08GGGACCCACNONE 
J065103D22GGGACCCACNONE 
J065153K16GGGACCCACNONE 
J065210B16GGGACCCACNONE 
J075015H18GGGACCCACNONE 
J075102C14GGGACCCACNONE 
J080302G09GGGACCCACNONE 
J080302L20GGGACCCACNONE 
J080303K11GGGACCCACNONE 
J080312C18GGGACCCACNONE 
J080316F08GGGACCCACNONE 
J090023I05GGGACCCACNONE 
J090023I07GGGACCCACNONE 
J090053C21GGGACCCACNONE 
J090067J22GGGACCCACNONE 
J090070E24GGGACCCACNONE 
J090078H04GGGACCCACNONE 
J090089P06GGGACCCACNONE 
J090092E21GGGACCCACNONE 
J100014G01GGGACCCACNONE 
J100022L20GGGACCCACNONE 
J100024I05GGGACCCACNONE 
J100025L08GGGACCCACNONE 
J100030J03GGGACCCACNONE 
J100031K12GGGACCCACNONE 
J100036N01GGGACCCACNONE 
J100050C23GGGACCCACNONE 
J100062G12GGGACCCACNONE 
J100067L17GGGACCCACNONE 
J100074O09GGGACCCACNONE 
Os07g0597625J065130O18GGTGGGACCCACGTGGCD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065130O18TGGGACCCACD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065166J07GGTGGGACCCACGTGGCNONE 
J065166J07TGGGACCCACNONE 
Os07g0598500AK073214ACGCGTGGGTCCCACProtein prenyltransferase domain containing protein. 
J065192M24ACGCGTGGGTCCCACNONE 
J100039G03ACGCGTGGGTCCCACNONE 
Os07g0633400AK071894CGGGTGGGTCCCACCACIQ calmodulin-binding region domain containing protein. 
Os07g0669600AK066595GGACCCACCTGTConserved hypothetical protein. 
J065042J05GGACCCACCTGTNONE 
Os07g0670300006-085-D04CAAGTGGGTCCCACTCCNONE 
006-116-A08CAAGTGGGTCCCACTCCNONE 
AK061154CAAGTGGGTCCCACTCCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK099020CAAGTGGGTCCCACTCCNONE 
J100056C05CAAGTGGGTCCCACTCCNONE 
Os07g0679000AK070738GGACCCACSimilar to Potassium transporter 2 (AtPOT2) (AtKUP2) (AtKT2). 
Os07g0679300AK065079CAGGTGGGTCCCANONE 
AK099229CAGGTGGGTCCCASimilar to Alpha-galactosidase precursor (EC 3.2.1.22) (Melibiase) (Alpha-D- galactoside galactohydrolase). 
J013033F05CAGGTGGGTCCCANONE 
J013049N18CAGGTGGGTCCCANONE 
J013071C14CAGGTGGGTCCCANONE 
J013088P15CAGGTGGGTCCCANONE 
J013092D24CAGGTGGGTCCCANONE 
J013093O14CAGGTGGGTCCCANONE 
J023095E17CAGGTGGGTCCCANONE 
J043005E21CAGGTGGGTCCCANONE 
J043015E06CAGGTGGGTCCCANONE 
J043027P22CAGGTGGGTCCCANONE 
J065038B15CAGGTGGGTCCCANONE 
J065073M21CAGGTGGGTCCCANONE 
J065165P06CAGGTGGGTCCCANONE 
J065198I06CAGGTGGGTCCCANONE 
J075007E08CAGGTGGGTCCCANONE 
J075038I07CAGGTGGGTCCCANONE 
J075130L20CAGGTGGGTCCCANONE 
J090057G17CAGGTGGGTCCCANONE 
J100029K23CAGGTGGGTCCCANONE 
J100086O16CAGGTGGGTCCCANONE 
J100087M02CAGGTGGGTCCCANONE 
Os08g0119800AJ437536CAGGTGGGACCCACNONE 
AK060602CAGGTGGGACCCACSimilar to Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine metabolising enzyme) (L-AME) [Contains: Photosystem II protein psbY-1 (psbY-A1); Photosystem II protein psbY-2 (psbY-A2)]. 
AK067636CAGGTGGGACCCACNONE 
AK068273CAGGTGGGACCCACNONE 
J100075K05CAGGTGGGACCCACNONE 
Os08g0121900AK101512CCCGTGGGACCCACCTGTCProtein of unknown function DUF23 family protein. 
Os08g0122700AK111089GGACGGACCCACGTGTCConserved hypothetical protein. 
Os08g0126500AK110941TGGGACCCACCACProtein of unknown function DUF295 family protein. 
Os08g0128200AK120428GTGGGTCCCACCACConserved hypothetical protein. 
Os08g0143400015-006-A10CACTGACAAGTGGGACCCACNONE 
AK066792CACTGACAAGTGGGACCCACNONE 
AK120532CACTGACAAGTGGGACCCACSWIRM domain containing protein. 
J100083F02CACTGACAAGTGGGACCCACNONE 
Os08g0175200AK072367GGACCCACCCCATCCACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16GGACCCACCCCATCCACCNONE 
J023075K04GGACCCACCCCATCCACCNONE 
J023082L15GGACCCACCCCATCCACCNONE 
J043015G07GGACCCACCCCATCCACCNONE 
J065052L17GGACCCACCCCATCCACCNONE 
J065202P07GGACCCACCCCATCCACCNONE 
J075061D17GGACCCACCCCATCCACCNONE 
J100088P13GGACCCACCCCATCCACCNONE 
Os08g0282000016-023-A09CAAGTGGGTGGGTCCNONE 
AK101411CAAGTGGGTGGGTCCCD9/CD37/CD63 antigen family protein. 
J033037J09CAAGTGGGTGGGTCCNONE 
J090047I07CAAGTGGGTGGGTCCNONE 
J100021H13CAAGTGGGTGGGTCCNONE 
Os08g0316900013-024-A06GTGGGTCCCACCNONE 
J033112J20GTGGGTCCCACCNONE 
J065025M22GTGGGTCCCACCNONE 
J065026E15GTGGGTCCCACCNONE 
Os08g0360100AK066365ACACGTGGGTCCCACCRS1/YhbY domain containing protein. 
Os08g0416400AK064144GTGGGTCCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0425800009-168-F06CCACTGACAGGTGGGTCCNONE 
AK061339CCACTGACAGGTGGGTCCConserved hypothetical protein. 
AK101198CCACTGACAGGTGGGTCCNONE 
J033030L06CCACTGACAGGTGGGTCCNONE 
J100036D08CCACTGACAGGTGGGTCCNONE 
J100052I22CCACTGACAGGTGGGTCCNONE 
Os08g0439900AK110628TGTGGGGCCCATGTGGGTCCCACMitochondrial glycoprotein family protein. 
J065118D13TGTGGGGCCCATGTGGGTCCCACNONE 
Os08g0465300AK108076GTGGGTCCCACConserved hypothetical protein. 
Os08g0469600009-080-H09GGGACCCACNONE 
009-080-H09GTGGGTCCNONE 
AK062647GGGACCCACConserved hypothetical protein. 
AK062647GTGGGTCCConserved hypothetical protein. 
Os08g0492100AK060178GTGGGTCCNONE 
AK071053GTGGGTCCParaneoplastic encephalomyelitis antigen family protein. 
AK100101GTGGGTCCNONE 
J023004I20GTGGGTCCNONE 
J023067D13GTGGGTCCNONE 
J033028G05GTGGGTCCNONE 
J033060L15GTGGGTCCNONE 
J033103N12GTGGGTCCNONE 
J033125B19GTGGGTCCNONE 
J065132A12GTGGGTCCNONE 
J065161F02GTGGGTCCNONE 
J065162L05GTGGGTCCNONE 
J090093I18GTGGGTCCNONE 
J100061I05GTGGGTCCNONE 
J100081G13GTGGGTCCNONE 
Os08g0511400AK069673CAGGTGGGTCCCACCConserved hypothetical protein. 
J065161H07CAGGTGGGTCCCACCNONE 
Os08g0517300AK069175GTGGGTCCCACCZinc finger, C2H2-type domain containing protein. 
Os08g0533300Os08g0533300TGGGACCCACAmino acid-binding ACT domain containing protein. 
Os08g0537900AK119425CACTGACAGGTGGGTCCNONE 
AY341827CACTGACAGGTGGGTCCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os09g0348800AK063411TGGGACCCACConserved hypothetical protein. 
Os09g0380400009-200-D01GACAGGTGGGTCCCACTTGNONE 
AK063909GACAGGTGGGTCCCACTTGNONE 
AK072517GACAGGTGGGTCCCACTTGConserved hypothetical protein. 
AK073073GACAGGTGGGTCCCACTTGNONE 
J065205F20GACAGGTGGGTCCCACTTGNONE 
J100036D22GACAGGTGGGTCCCACTTGNONE 
J100047M01GACAGGTGGGTCCCACTTGNONE 
J100071G04GACAGGTGGGTCCCACTTGNONE 
Os09g0412900014-003-F10GACACGTGGGTCCCACNONE 
AK102254GACACGTGGGTCCCACProtein prenyltransferase domain containing protein. 
AK102867GACACGTGGGTCCCACNONE 
J033088H22GACACGTGGGTCCCACNONE 
Os09g0424850J065006K24GTGGGTCCCConserved hypothetical protein. 
J065006K24GTGGGTCCCACCConserved hypothetical protein. 
Os09g0448100AK070293CACGTGGGTCCCACyclin-like F-box domain containing protein. 
AK070628CACGTGGGTCCCANONE 
J023050H06CACGTGGGTCCCANONE 
J053091I22CACGTGGGTCCCANONE 
J065051I11CACGTGGGTCCCANONE 
J065066L13CACGTGGGTCCCANONE 
Os09g0465600AB107218GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
AK068061GACAGGTGGGTCCCACGTGGTGACGTGGCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
Os09g0477700AK121644CACTGACAGGTGGGTCCCACGGGConserved hypothetical protein. 
Os09g0479400AK109596GTGGGACCCACPhenylalanyl-tRNA synthetase, class IIc family protein. 
Os09g0493600AK065737GTGGGTCCSimilar to IojAP protein-like (Expressed protein). 
Os09g0547500009-006-F11GTGGGTCCCACCNONE 
Os09g0572000J065136G16AGAGTGGGGTGGGTCCCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
J065136G16GTGGGTCCCACCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os11g0109500015-062-C02GGTGGGACCCACNONE 
AK064326GGTGGGACCCACStaphylococcus nuclease (SNase-like) domain containing protein. 
Os11g0118200AK105536GTGGGACCCACGTGTCGHypothetical protein. 
Os11g0127700AK103742GGACCCACACGHypothetical protein. 
J090083M11GGACCCACACGNONE 
Os11g0148000AK108267TGGGACCCACSodium/calcium exchanger membrane region domain containing protein. 
J065051O11TGGGACCCACNONE 
J065110G12TGGGACCCACNONE 
Os11g0159000AK065738CCACTGACACGTGGGTCCCACConserved hypothetical protein. 
Os11g0229100AK105557TGGGACCCACGTGTConserved hypothetical protein. 
Os11g0256200AK107906GTGGGTCCCACProtein of unknown function DUF842, eukaryotic family protein. 
J065007J01GTGGGTCCCACNONE 
J065167G22GTGGGTCCCACNONE 
J075001G14GTGGGTCCCACNONE 
J075121L13GTGGGTCCCACNONE 
Os11g0484000012-001-D04GTGGGACCCACNONE 
AK065321GTGGGACCCACClass II aldolase/adducin, N-terminal family protein. 
J013002P15GTGGGACCCACNONE 
Os11g0487100J065058M03GGACCCACConserved hypothetical protein. 
J100029B11GGACCCACNONE 
J100070A07GGACCCACNONE 
Os11g0527000J065137N17GTGGGTCCCACCTGTCConserved hypothetical protein. 
Os11g0568300016-075-B02GGTGGGACCCACNONE 
AK064398GGTGGGACCCACHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282GGTGGGACCCACNONE 
J033124M10GGTGGGACCCACNONE 
J065120I21GGTGGGACCCACNONE 
J065144H16GGTGGGACCCACNONE 
Os11g0615700AB026561CAGGTGGGTCCCNONE 
AK059521CAGGTGGGTCCCNONE 
AK103487CAGGTGGGTCCCProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14CAGGTGGGTCCCNONE 
J065044A11CAGGTGGGTCCCNONE 
J065090I02CAGGTGGGTCCCNONE 
J065104I09CAGGTGGGTCCCNONE 
J065187J10CAGGTGGGTCCCNONE 
J075024E07CAGGTGGGTCCCNONE 
J075025O13CAGGTGGGTCCCNONE 
J090062N12CAGGTGGGTCCCNONE 
J090087G06CAGGTGGGTCCCNONE 
J090098K11CAGGTGGGTCCCNONE 
Os11g0648000AK066444GCCACGTGGCCCACAGGTGGGTCCCACSimilar to Na+/H+ antiporter. 
AK066444GGACCCACGTGSimilar to Na+/H+ antiporter. 
AK072026GCCACGTGGCCCACAGGTGGGTCCCACNONE 
AK072026GGACCCACGTGNONE 
Os12g0109200AK103380GGTGGGACCCACSimilar to Ca(2+)-dependent nuclease. 
J033127E15GGTGGGACCCACNONE 
J090085H16GGTGGGACCCACNONE 
Os12g0123900016-031-A06GGACCCACACGNONE 
AK061862GGACCCACACGHypothetical protein. 
J013031P10GGACCCACACGNONE 
J053034P22GGACCCACACGNONE 
J053046O16GGACCCACACGNONE 
J053048D20GGACCCACACGNONE 
J090031I07GGACCCACACGNONE 
J100025B02GGACCCACACGNONE 
Os12g0145200AK111428GTGGGACCCACGTGGGCCCCACASimilar to Protein MONOCULM 1. 
J065208D22GTGGGACCCACGTGGGCCCCACANONE 
Os12g0151500AK058389GTGGGTCCCACCACSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GTGGGTCCCACCACNONE 
Os12g0175400009-157-A08CAAGTGGGACCCACTCCNONE 
011-089-A10CAAGTGGGACCCACTCCNONE 
AK063027CAAGTGGGACCCACTCCNONE 
D88618CAAGTGGGACCCACTCCHomeodomain-like containing protein. 
Os12g0278800003-004-E01GGGACCCACNONE 
AK111498GGGACCCACNONE 
AK111962GGGACCCACNONE 
AK121774GGGACCCACSimilar to Zinc finger CCCH type domain containing protein ZFN-like 1. Splice isoform 3. 
J013000H23GGGACCCACNONE 
J033034P15GGGACCCACNONE 
J033064D07GGGACCCACNONE 
J033089C02GGGACCCACNONE 
J033092M18GGGACCCACNONE 
J033097M16GGGACCCACNONE 
J043001K06GGGACCCACNONE 
J090083L17GGGACCCACNONE 
J100090M02GGGACCCACNONE 
Os12g0405300AK070969GTGGGACCCACCTGTCConserved hypothetical protein. 
Os12g0413201J065083D05GGACCCACTTGNONE 
J065095J19GGACCCACTTGNONE 
J065118H21GGACCCACTTGNONE 
J065162E19GGACCCACTTGNONE 
J065196J19GGACCCACTTGConserved hypothetical protein. 
J065196M07GGACCCACTTGNONE 
J075041N09GGACCCACTTGNONE 
J075054K04GGACCCACTTGNONE 
Os12g0420400006-024-B08GGGACCCACNONE 
006-113-B02GGGACCCACNONE 
009-114-G08GGGACCCACNONE 
009-167-G07GGGACCCACNONE 
009-168-E04GGGACCCACNONE 
009-182-B06GGGACCCACNONE 
AK058207GGGACCCACNONE 
AK059750GGGACCCACSimilar to Photosystem I reaction center subunit XI, chloroplast precursor (PSI- L) (PSI subunit V). 
AK063111GGGACCCACNONE 
AK099109GGGACCCACNONE 
AK105154GGGACCCACNONE 
AK119162GGGACCCACNONE 
J023030F01GGGACCCACNONE 
J065025H24GGGACCCACNONE 
J065130O03GGGACCCACNONE 
J065142N22GGGACCCACNONE 
J065152F08GGGACCCACNONE 
J065156E07GGGACCCACNONE 
J075086B17GGGACCCACNONE 
J075150I07GGGACCCACNONE 
J075157D08GGGACCCACNONE 
J080010D11GGGACCCACNONE 
J080041B04GGGACCCACNONE 
J080305G13GGGACCCACNONE 
J080307D21GGGACCCACNONE 
J090015D20GGGACCCACNONE 
Os12g0460800J023003J21CCCGTGGGTCCCACCNONE 
Os12g0541000J065083F23GTGGTGGGTCCLumazine-binding protein family protein. 
J100073N23GTGGTGGGTCCNONE 
Os12g0581700AK111563GTGGGTCCConserved hypothetical protein. 
J023011D12GTGGGTCCNONE 
J065176G05GTGGGTCCNONE 
J065192E06GTGGGTCCNONE 
J100075L05GTGGGTCCNONE 
Os12g0586600AK066259GACACGTGGGTCCSimilar to Plasma membrane Ca2+-ATPase. 
AK100436GACACGTGGGTCCNONE 
Os12g0605800AK121511CTGACAGGTGGGTCCCACTCCSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 
Os12g0613300AB118014GTGGGTCCCNONE 
AK100618GTGGGTCCCSimilar to Single myb histone 6. 
AK105660GTGGGTCCCNONE 
Os12g0620400015-008-B10GTGGGTCCNONE 
AK059006GTGGGTCCNONE 
AK059973GTGGGTCCNONE 
AK063843GTGGGTCCMethyl-CpG binding domain containing protein. 
AK072503GTGGGTCCNONE 
AK072934GTGGGTCCNONE 
J023126H05GTGGGTCCNONE 
J023131G11GTGGGTCCNONE 
J023146E17GTGGGTCCNONE 
J033064P08GTGGGTCCNONE 
J033095L07GTGGGTCCNONE 
J065101N06GTGGGTCCNONE 
J065186F11GTGGGTCCNONE 
J065215J15GTGGGTCCNONE 
J080049H05GTGGGTCCNONE 
J080059L05GTGGGTCCNONE 
J080061M17GTGGGTCCNONE 
J080063D16GTGGGTCCNONE 
J090012D01GTGGGTCCNONE 
J090023D20GTGGGTCCNONE 
J090040A09GTGGGTCCNONE 
J090044K08GTGGGTCCNONE 
J100019H03GTGGGTCCNONE 
J100054N04GTGGGTCCNONE 
Os12g0641500AK065733GTGGGTCCNONE 
AK120333GTGGGTCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.