version

Summary of OsREG623 (All List)

OrganismOryza sativa  
IDOsREG623  
SequenceGGACGGAC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count769  

Entry Sequences (769 entries)

LocusGene modelSequenceDescription
Os01g0149800009-003-D05CGGACGGACNONE 
009-075-F04CGGACGGACNONE 
009-164-H05CGGACGGACNONE 
J013021G22CGGACGGACNONE 
J013026A08CGGACGGACNONE 
J013055B05CGGACGGACNONE 
J013064G22CGGACGGACNONE 
J013105C09CGGACGGACNONE 
J013129K15CGGACGGACNONE 
J023129B01CGGACGGACNONE 
J033036H01CGGACGGACNONE 
J033057B09CGGACGGACNONE 
J043037E20CGGACGGACNONE 
J043039C11CGGACGGACNONE 
J043039D02CGGACGGACNONE 
J043039G15CGGACGGACNONE 
J043040L16CGGACGGACNONE 
J053034B13CGGACGGACNONE 
J053061F14CGGACGGACNONE 
J053097D22CGGACGGACNONE 
J065032N05CGGACGGACNONE 
J065050F21CGGACGGACNONE 
J065052D11CGGACGGACNONE 
J065097I08CGGACGGACNONE 
J065109M12CGGACGGACNONE 
J065162C19CGGACGGACNONE 
J065162C20CGGACGGACNONE 
J065171G23CGGACGGACNONE 
J065206I03CGGACGGACNONE 
J065218O18CGGACGGACNONE 
J080020M17CGGACGGACNONE 
J080030J11CGGACGGACNONE 
J080032A22CGGACGGACNONE 
J080036E19CGGACGGACNONE 
J080037I16CGGACGGACNONE 
J080051D03CGGACGGACNONE 
J080051D05CGGACGGACNONE 
J080054K06CGGACGGACNONE 
J080076G01CGGACGGACNONE 
J080077P08CGGACGGACNONE 
J080085E13CGGACGGACNONE 
J080087A22CGGACGGACNONE 
J080310A13CGGACGGACNONE 
J090080A15CGGACGGACNONE 
J090087N14CGGACGGACNONE 
J100017E03CGGACGGACNONE 
J100024B10CGGACGGACNONE 
J100025A07CGGACGGACNONE 
J100026G16CGGACGGACNONE 
J100030A10CGGACGGACNONE 
J100030M18CGGACGGACNONE 
J100044D08CGGACGGACNONE 
J100045F20CGGACGGACNONE 
J100046L06CGGACGGACNONE 
J100050J10CGGACGGACNONE 
J100054E07CGGACGGACNONE 
J100054G22CGGACGGACNONE 
J100054L21CGGACGGACNONE 
J100058A12CGGACGGACNONE 
J100064O14CGGACGGACNONE 
J100069M10CGGACGGACNONE 
J100073C18CGGACGGACNONE 
J100077H21CGGACGGACNONE 
J100078A09CGGACGGACNONE 
J100081F01CGGACGGACNONE 
J100082H17CGGACGGACNONE 
J100090C20CGGACGGACNONE 
U43530CGGACGGACMetallothionein-like protein type 2. 
Os01g0218500AK072979TCCGTCCGTCCSimilar to SP3D. 
AK100491TCCGTCCGTCCNONE 
AK108673TCCGTCCGTCCNONE 
J023098H12TCCGTCCGTCCNONE 
Os01g0242900009-042-C12ATCGGACGGACNONE 
AK071658ATCGGACGGACConserved hypothetical protein. 
J090060H23ATCGGACGGACNONE 
J090083G05ATCGGACGGACNONE 
J090083K20ATCGGACGGACNONE 
J100029D18ATCGGACGGACNONE 
J100068A08ATCGGACGGACNONE 
Os01g0254900AK068204CGGACGGACGGACSimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530CGGACGGACGGACNONE 
Os01g0286100AK102252CGGACGGACGGACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J033088H11CGGACGGACGGACNONE 
J053035J07CGGACGGACGGACNONE 
J053060F08CGGACGGACGGACNONE 
J053065C21CGGACGGACGGACNONE 
J053099E20CGGACGGACGGACNONE 
J053100O10CGGACGGACGGACNONE 
J065022L02CGGACGGACGGACNONE 
J065023K01CGGACGGACGGACNONE 
J065053A21CGGACGGACGGACNONE 
J065122B21CGGACGGACGGACNONE 
J065205D01CGGACGGACGGACNONE 
J075022K02CGGACGGACGGACNONE 
J075125G03CGGACGGACGGACNONE 
J075152H09CGGACGGACGGACNONE 
J075152H10CGGACGGACGGACNONE 
J090013L06CGGACGGACGGACNONE 
J090096I16CGGACGGACGGACNONE 
J100024G07CGGACGGACGGACNONE 
Os01g0502400004-005-F01GTCCGTCCNONE 
AK065149GTCCGTCCProlyl 4-hydroxylase, alpha subunit domain containing protein. 
AK104357GTCCGTCCNONE 
AK106095GTCCGTCCNONE 
J013002B07GTCCGTCCNONE 
J013098G12GTCCGTCCNONE 
J033149E15GTCCGTCCNONE 
J075012L21GTCCGTCCNONE 
J075065B15GTCCGTCCNONE 
J075091B11GTCCGTCCNONE 
J100043F16GTCCGTCCNONE 
Os01g0610100006-029-C12ATCGGACGGACNONE 
006-050-D02ATCGGACGGACNONE 
006-099-A06ATCGGACGGACNONE 
009-029-G03ATCGGACGGACNONE 
009-158-F07ATCGGACGGACNONE 
AK059810ATCGGACGGACSimilar to Clone ZZZ51 mRNA sequence. 
AK104951ATCGGACGGACNONE 
J065067E14ATCGGACGGACNONE 
J065073H01ATCGGACGGACNONE 
J065094E10ATCGGACGGACNONE 
J075041P17ATCGGACGGACNONE 
J075051M22ATCGGACGGACNONE 
J075089J01ATCGGACGGACNONE 
J075119L21ATCGGACGGACNONE 
J075161I08ATCGGACGGACNONE 
J090072B22ATCGGACGGACNONE 
Os01g0749400AK064990GTCCGTCCNONE 
AK067731GTCCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775GTCCGTCCNONE 
J023001B06GTCCGTCCNONE 
Os01g0767100AK109493GGACGGACSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0794400AK122041CGGACGGACGGACGGCThioredoxin domain 2 containing protein. 
Os01g0813400006-025-B06ATCGGACGGACNONE 
006-030-C07ATCGGACGGACNONE 
006-068-F06ATCGGACGGACNONE 
006-096-E09ATCGGACGGACNONE 
006-097-B11ATCGGACGGACNONE 
006-104-H02ATCGGACGGACNONE 
AK062251ATCGGACGGACNONE 
AK065370ATCGGACGGACSimilar to ADP-ribosylation factor 1. 
J013022G24ATCGGACGGACNONE 
J013104C07ATCGGACGGACNONE 
J023074M17ATCGGACGGACNONE 
J043027C07ATCGGACGGACNONE 
J065026K05ATCGGACGGACNONE 
J065103I01ATCGGACGGACNONE 
J090025M17ATCGGACGGACNONE 
J100027L03ATCGGACGGACNONE 
J100054I20ATCGGACGGACNONE 
Os01g0815400AK121388CGGACGGACConserved hypothetical protein. 
AK121388GGACGGACConserved hypothetical protein. 
J023013D09CGGACGGACNONE 
J023013D09GGACGGACNONE 
J023044L20CGGACGGACNONE 
J023044L20GGACGGACNONE 
J023128J12CGGACGGACNONE 
J023128J12GGACGGACNONE 
J075010E04CGGACGGACNONE 
J075010E04GGACGGACNONE 
J090090E03CGGACGGACNONE 
J090090E03GGACGGACNONE 
Os01g0817800AK073827CCGTCGGACGGACWD40-like domain containing protein. 
J033068H02CCGTCGGACGGACNONE 
J065042H22CCGTCGGACGGACNONE 
J090083M24CCGTCGGACGGACNONE 
Os01g0855000006-061-G08GTCCGTCCNONE 
AK070880GTCCGTCCNONE 
AK105944GTCCGTCCSimilar to Glycerol-3-phosphate acyltransferase 6 (EC 2.3.1.15) (AtGPAT6). 
J023064I03GTCCGTCCNONE 
J065034O14GTCCGTCCNONE 
J065044N19GTCCGTCCNONE 
J065185C21GTCCGTCCNONE 
J075095J08GTCCGTCCNONE 
J075155C01GTCCGTCCNONE 
J090044N03GTCCGTCCNONE 
J100062C08GTCCGTCCNONE 
Os01g0867300AK067919AATGGGCCGTCCGTCCGTCCSimilar to OSE2-like protein (Fragment). 
J013123H12AATGGGCCGTCCGTCCGTCCNONE 
J033046C11AATGGGCCGTCCGTCCGTCCNONE 
J033051I17AATGGGCCGTCCGTCCGTCCNONE 
U25283AATGGGCCGTCCGTCCGTCCNONE 
Os01g0905200016-016-H09GTCCGTCCNONE 
AK060538GTCCGTCCExo70 exocyst complex subunit family protein. 
AK067779GTCCGTCCNONE 
J053045O11GTCCGTCCNONE 
J053047M17GTCCGTCCNONE 
J053050B02GTCCGTCCNONE 
J053091O22GTCCGTCCNONE 
J075092P19GTCCGTCCNONE 
J075092P20GTCCGTCCNONE 
J075145A18GTCCGTCCNONE 
J090083K23GTCCGTCCNONE 
J100032L20GTCCGTCCNONE 
J100049K20GTCCGTCCNONE 
J100054C09GTCCGTCCNONE 
J100061D13GTCCGTCCNONE 
J100063F05GTCCGTCCNONE 
J100071G21GTCCGTCCNONE 
J100078A12GTCCGTCCNONE 
Os01g0913300AK100698CGGACGGACTGF-beta receptor, type I/II extracellular region family protein. 
J023030J07CGGACGGACNONE 
J023102B09CGGACGGACNONE 
J023102N03CGGACGGACNONE 
J023114K11CGGACGGACNONE 
J023140A21CGGACGGACNONE 
J043017F23CGGACGGACNONE 
J075058O15CGGACGGACNONE 
Os01g0973500AK069546GTCCGTCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os02g0142060J065137N15GAGACGTGAGGGACGGACSynapsin family protein. 
Os02g0229200Os02g0229200GTCCGTCCGNONE 
Os02g0324700006-086-H07GTCCGTCCNONE 
006-106-G09GTCCGTCCNONE 
AK060405GTCCGTCCConserved hypothetical protein. 
AK104437GTCCGTCCNONE 
Os02g0453300006-099-D03GGACGGACGGCCNONE 
009-120-D02GGACGGACGGCCNONE 
AK071220GGACGGACGGCCNONE 
AK109380GGACGGACGGCCConserved hypothetical protein. 
J023083M17GGACGGACGGCCNONE 
Os02g0459400009-011-H02GTCCGTCCNONE 
AK062336GTCCGTCCConserved hypothetical protein. 
Os02g0572200AK109591TCCGTCCGTCCGTCCGTCCSimilar to RING-H2 finger protein ATL3I (YGHL1-C3HC4 RING fusion protein). 
Os02g0574900AK073087GTCCGTCCCyclin-like F-box domain containing protein. 
J033023M04GTCCGTCCNONE 
J033117N08GTCCGTCCNONE 
J075008F16GTCCGTCCNONE 
J075075I19GTCCGTCCNONE 
J075079A06GTCCGTCCNONE 
J075086I07GTCCGTCCNONE 
J075088F13GTCCGTCCNONE 
J075093D04GTCCGTCCNONE 
J075163C10GTCCGTCCNONE 
Os02g0581200009-046-F03GTCCGTCCNONE 
AK062477GTCCGTCCConserved hypothetical protein. 
J100073E13GTCCGTCCNONE 
Os02g0601800AB060276GTCCGTCCGATCNONE 
AK099539GTCCGTCCGATCNONE 
AK101873GTCCGTCCGATCBromodomain containing protein. 
AK106801GTCCGTCCGATCNONE 
AK121758GTCCGTCCGATCNONE 
AK121891GTCCGTCCGATCNONE 
J013059H01GTCCGTCCGATCNONE 
J013092F08GTCCGTCCGATCNONE 
J013146J04GTCCGTCCGATCNONE 
J023001K12GTCCGTCCGATCNONE 
J023002H16GTCCGTCCGATCNONE 
J023013B10GTCCGTCCGATCNONE 
J023081I22GTCCGTCCGATCNONE 
J023084K19GTCCGTCCGATCNONE 
J023150E24GTCCGTCCGATCNONE 
J033023B18GTCCGTCCGATCNONE 
J033025F18GTCCGTCCGATCNONE 
J033048P08GTCCGTCCGATCNONE 
J033060M24GTCCGTCCGATCNONE 
J033070G06GTCCGTCCGATCNONE 
J033088P12GTCCGTCCGATCNONE 
J033105C13GTCCGTCCGATCNONE 
J043009N18GTCCGTCCGATCNONE 
J065103G21GTCCGTCCGATCNONE 
J075039H15GTCCGTCCGATCNONE 
J090014K10GTCCGTCCGATCNONE 
J090022N02GTCCGTCCGATCNONE 
J090033F18GTCCGTCCGATCNONE 
J090033I04GTCCGTCCGATCNONE 
J090041F11GTCCGTCCGATCNONE 
J090045P20GTCCGTCCGATCNONE 
J090054B01GTCCGTCCGATCNONE 
J090055M12GTCCGTCCGATCNONE 
J090071K09GTCCGTCCGATCNONE 
J090098O16GTCCGTCCGATCNONE 
J090099P15GTCCGTCCGATCNONE 
J100050I16GTCCGTCCGATCNONE 
Os02g0631000AK068667GTCCGTCCConserved hypothetical protein. 
J013159L03GTCCGTCCNONE 
J023119O20GTCCGTCCNONE 
J090098N20GTCCGTCCNONE 
Os02g0634700AK071869GGACGGACNONE 
J013129B13GGACGGACNONE 
J013134D24GGACGGACNONE 
Os02g0643000009-051-D01GTCCGTCCGNONE 
AK073818GTCCGTCCGSimilar to VAP27. 
J023068D06GTCCGTCCGNONE 
J033068O06GTCCGTCCGNONE 
J075019O08GTCCGTCCGNONE 
J075140B16GTCCGTCCGNONE 
J100036D07GTCCGTCCGNONE 
J100067I05GTCCGTCCGNONE 
J100070D07GTCCGTCCGNONE 
Os02g0681100AK100584GTCCGTCCGProtein of unknown function DUF604 family protein. 
J023106A15GTCCGTCCGNONE 
Os02g0697600011-021-B01GCCGTCCGTCCGNONE 
AK121757GCCGTCCGTCCGAAA ATPase domain containing protein. 
Os02g0751300J033055P08GTCCGTCCGProtein of unknown function DUF581 family protein. 
Os02g0827900AK099911GTCCGTCCSimilar to Signal peptidase 18 subunit (Fragment). 
Os02g0833900003-009-D08GTCCGTCCGNONE 
006-021-A06GTCCGTCCGNONE 
006-021-C05GTCCGTCCGNONE 
006-026-E10GTCCGTCCGNONE 
006-030-E06GTCCGTCCGNONE 
006-057-B10GTCCGTCCGNONE 
006-063-H09GTCCGTCCGNONE 
006-068-H02GTCCGTCCGNONE 
006-074-H10GTCCGTCCGNONE 
006-077-F08GTCCGTCCGNONE 
006-078-F01GTCCGTCCGNONE 
006-079-A12GTCCGTCCGNONE 
006-086-F02GTCCGTCCGNONE 
006-086-G01GTCCGTCCGNONE 
006-101-A03GTCCGTCCGNONE 
006-108-C11GTCCGTCCGNONE 
006-113-G12GTCCGTCCGNONE 
006-117-F12GTCCGTCCGNONE 
006-119-D10GTCCGTCCGNONE 
006-119-F09GTCCGTCCGNONE 
009-106-G05GTCCGTCCGNONE 
009-126-B08GTCCGTCCGNONE 
009-166-F06GTCCGTCCGNONE 
AK060083GTCCGTCCGNONE 
AK099584GTCCGTCCGNONE 
AK106092GTCCGTCCGNONE 
AK106171GTCCGTCCGSimilar to Peroxidase 64 precursor (EC 1.11.1.7) (Atperox P64) (PRXR4) (ATP17a). 
J013042D08GTCCGTCCGNONE 
J013042E08GTCCGTCCGNONE 
J075002G19GTCCGTCCGNONE 
J075030K18GTCCGTCCGNONE 
J075065P19GTCCGTCCGNONE 
J075091B17GTCCGTCCGNONE 
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein. 
Os03g0143700AK066360GTCCGTCCConserved hypothetical protein. 
J013066M09GTCCGTCCNONE 
J023087N24GTCCGTCCNONE 
Os03g0181100AK067971GTCCGTCCNONE 
AK120087GTCCGTCCZIM domain containing protein. 
J013123K19GTCCGTCCNONE 
J100077H14GTCCGTCCNONE 
Os03g0221800J033108G24GTCCGTCCGConserved hypothetical protein. 
Os03g0227000AK068454GTCCGTCCSimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0234200AK059011GGACGGACNONE 
Os03g0236200AK071556TCCGTCCGTCCSimilar to Glutamate decarboxylase isozyme 3 (EC 4.1.1.15). 
AY187941TCCGTCCGTCCNONE 
J023101A16TCCGTCCGTCCNONE 
J033136E06TCCGTCCGTCCNONE 
J043036C21TCCGTCCGTCCNONE 
J100061E24TCCGTCCGTCCNONE 
J100090A06TCCGTCCGTCCNONE 
Os03g0243300013-024-B05GGACGGACGTGGGCCGAANONE 
AB010740GGACGGACGTGGGCCGAANONE 
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein). 
AK073601GGACGGACGTGGGCCGAANONE 
J023010M13GGACGGACGTGGGCCGAANONE 
J023030M11GGACGGACGTGGGCCGAANONE 
J023066I02GGACGGACGTGGGCCGAANONE 
J023080H21GGACGGACGTGGGCCGAANONE 
J023123O15GGACGGACGTGGGCCGAANONE 
J033029N24GGACGGACGTGGGCCGAANONE 
J033031G18GGACGGACGTGGGCCGAANONE 
J033046D23GGACGGACGTGGGCCGAANONE 
J033046P11GGACGGACGTGGGCCGAANONE 
J033079C14GGACGGACGTGGGCCGAANONE 
J033125G12GGACGGACGTGGGCCGAANONE 
J033133I21GGACGGACGTGGGCCGAANONE 
J033141F22GGACGGACGTGGGCCGAANONE 
J065035O21GGACGGACGTGGGCCGAANONE 
J090008P15GGACGGACGTGGGCCGAANONE 
J090033F15GGACGGACGTGGGCCGAANONE 
J090059A16GGACGGACGTGGGCCGAANONE 
J090080N01GGACGGACGTGGGCCGAANONE 
J100022C16GGACGGACGTGGGCCGAANONE 
J100023K05GGACGGACGTGGGCCGAANONE 
J100043B19GGACGGACGTGGGCCGAANONE 
J100046G11GGACGGACGTGGGCCGAANONE 
J100049L11GGACGGACGTGGGCCGAANONE 
J100054M01GGACGGACGTGGGCCGAANONE 
J100068G15GGACGGACGTGGGCCGAANONE 
J100085A18GGACGGACGTGGGCCGAANONE 
Os03g0243350J065025D24TTCGGCCCACGTCCGTCCNONE 
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein. 
J065064E08TTCGGCCCACGTCCGTCCNONE 
Os03g0330300AK060756GTCCGTCCGViral attachment protein, fibre shaft repeat containing protein. 
AK072405GTCCGTCCGNONE 
J013043H13GTCCGTCCGNONE 
J013097M19GTCCGTCCGNONE 
J023080M15GTCCGTCCGNONE 
Os03g0346500009-180-F12GTCCGTCCNONE 
AK063139GTCCGTCCHypothetical protein. 
Os03g0577200006-030-H11GGACGGACGGATCGGNONE 
AK061735GGACGGACGGATCGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953GGACGGACGGATCGGNONE 
AK099558GGACGGACGGATCGGNONE 
AK104547GGACGGACGGATCGGNONE 
J013034B14GGACGGACGGATCGGNONE 
J013066J17GGACGGACGGATCGGNONE 
J090033N14GGACGGACGGATCGGNONE 
Os03g0648300AK067192GTGGGTCCGTCCGAIQ calmodulin-binding region domain containing protein. 
J013098A04GTGGGTCCGTCCGANONE 
J075149P13GTGGGTCCGTCCGANONE 
J100044P16GTGGGTCCGTCCGANONE 
J100053G19GTGGGTCCGTCCGANONE 
Os03g0675300015-081-H08GTCCGTCCNONE 
AK106417GTCCGTCCAntihaemostatic protein domain containing protein. 
Os03g0685000009-031-F08GTCCGTCCNONE 
AK059896GTCCGTCCSimilar to Ferredoxin. 
AK098989GTCCGTCCNONE 
AK099303GTCCGTCCNONE 
J065041E14GTCCGTCCNONE 
J065085G22GTCCGTCCNONE 
Os03g0710000006-023-G11ATCGGACGGACNONE 
006-050-E05ATCGGACGGACNONE 
AK060065ATCGGACGGACProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK099364ATCGGACGGACNONE 
AK104418ATCGGACGGACNONE 
J033051P12ATCGGACGGACNONE 
J065046L09ATCGGACGGACNONE 
J075021F06ATCGGACGGACNONE 
J075106P12ATCGGACGGACNONE 
Os03g0750400AK109888CGGACGGACConserved hypothetical protein. 
Os03g0756800009-100-H11GGACGGACNONE 
AK120423GGACGGACProtein of unknown function UPF0139 family protein. 
J013095D02GGACGGACNONE 
J023091G12GGACGGACNONE 
J065207J17GGACGGACNONE 
J100067G13GGACGGACNONE 
J100089L11GGACGGACNONE 
Os03g0764600AK105625GGACGGACHomeodomain-like containing protein. 
Os03g0843400009-195-F11GTCCGTCCNONE 
AK061198GTCCGTCCSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076GTCCGTCCNONE 
Os04g0278000AK120988GTCCGTCCSimilar to PRLI-interacting factor G (Fragment). 
Os04g0310500009-023-G03GTCCGTCCGNONE 
AK063780GTCCGTCCGMitochondrial ribosome domain containing protein. 
AK121249GTCCGTCCGNONE 
AK121577GTCCGTCCGNONE 
J033036J18GTCCGTCCGNONE 
J043021B05GTCCGTCCGNONE 
J065197G04GTCCGTCCGNONE 
J065219F13GTCCGTCCGNONE 
J075156N05GTCCGTCCGNONE 
J090027C15GTCCGTCCGNONE 
J090083G24GTCCGTCCGNONE 
J100080D14GTCCGTCCGNONE 
Os04g0372700009-110-D07GTCCGTCCNONE 
AK062814GTCCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065021E21GTCCGTCCNONE 
J065099E23GTCCGTCCNONE 
J065120F10GTCCGTCCNONE 
J065165P14GTCCGTCCNONE 
J065208L18GTCCGTCCNONE 
Os04g0443000011-022-G04GGACGGACNONE 
AK100533GGACGGACFAR1 domain containing protein. 
J023101L24GGACGGACNONE 
Os04g0496400011-042-H11ATCGGACGGACNONE 
AK111787ATCGGACGGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY224465ATCGGACGGACNONE 
J033106N02ATCGGACGGACNONE 
J043026P11ATCGGACGGACNONE 
J065134J18ATCGGACGGACNONE 
Os04g0611800AY347876GTCCGTCCNONE 
AY347877GTCCGTCCTerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
AY347878GTCCGTCCNONE 
J065026D21GTCCGTCCNONE 
J065065G04GTCCGTCCNONE 
J065113B11GTCCGTCCNONE 
J065139F13GTCCGTCCNONE 
Os04g0685900011-039-F07GTCCGTCCGNONE 
014-008-A05GTCCGTCCGNONE 
AK063635GTCCGTCCGNONE 
AK121964GTCCGTCCGSimilar to Receptor-like protein kinase-like protein (Fragment). 
AY224496GTCCGTCCGNONE 
J023069A12GTCCGTCCGNONE 
J033051A19GTCCGTCCGNONE 
J033108C14GTCCGTCCGNONE 
J033136K02GTCCGTCCGNONE 
J090011H21GTCCGTCCGNONE 
J090033G17GTCCGTCCGNONE 
J090065H01GTCCGTCCGNONE 
J090085I19GTCCGTCCGNONE 
J090087F05GTCCGTCCGNONE 
J100051J24GTCCGTCCGNONE 
Os04g0692600006-056-F05GTCCGTCCGNONE 
006-074-F09GTCCGTCCGNONE 
006-078-B07GTCCGTCCGNONE 
006-081-H09GTCCGTCCGNONE 
006-111-A10GTCCGTCCGNONE 
AK070001GTCCGTCCGNONE 
AK105888GTCCGTCCGNONE 
AK105982GTCCGTCCGConserved hypothetical protein. 
Os05g0112101J065141G20GTCCGTCCEpsin, N-terminal domain containing protein. 
Os05g0127300AK106429CCGATCCGACGCGTCCGTCCGNONE 
AK121766CCGATCCGACGCGTCCGTCCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CCGATCCGACGCGTCCGTCCGNONE 
J100041J04CCGATCCGACGCGTCCGTCCGNONE 
Os05g0214100AK100400GTCCGTCCGATCSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
AK107105GTCCGTCCGATCNONE 
J013073B12GTCCGTCCGATCNONE 
J013093B07GTCCGTCCGATCNONE 
J023086N14GTCCGTCCGATCNONE 
J065143B06GTCCGTCCGATCNONE 
J090009B02GTCCGTCCGATCNONE 
J090075A13GTCCGTCCGATCNONE 
Os05g0247800AK073843GTCCGTCCGlycoside hydrolase, family 18 protein. 
J033068H05GTCCGTCCNONE 
Os05g0323900006-105-F01GGACGGACACGTNONE 
009-161-D06GGACGGACACGTNONE 
AK070528GGACGGACACGTManganese-superoxide dismutase precursor (EC 1.15.1.1). 
AK104030GGACGGACACGTNONE 
AK104160GGACGGACACGTNONE 
AK119904GGACGGACACGTNONE 
J023060D13GGACGGACACGTNONE 
J033057E10GGACGGACACGTNONE 
J043034F19GGACGGACACGTNONE 
J053099K12GGACGGACACGTNONE 
J065022N03GGACGGACACGTNONE 
J065035G13GGACGGACACGTNONE 
J065059M24GGACGGACACGTNONE 
J065059N23GGACGGACACGTNONE 
J065073I02GGACGGACACGTNONE 
J065095L15GGACGGACACGTNONE 
J065104I24GGACGGACACGTNONE 
J065104J24GGACGGACACGTNONE 
J065112L13GGACGGACACGTNONE 
J065114J24GGACGGACACGTNONE 
J065120J16GGACGGACACGTNONE 
J065141I09GGACGGACACGTNONE 
J065165E17GGACGGACACGTNONE 
J065170C14GGACGGACACGTNONE 
J065182I05GGACGGACACGTNONE 
J065191K20GGACGGACACGTNONE 
J065205L14GGACGGACACGTNONE 
J075017M10GGACGGACACGTNONE 
J075019O04GGACGGACACGTNONE 
J075019O15GGACGGACACGTNONE 
J075032E07GGACGGACACGTNONE 
J075042D13GGACGGACACGTNONE 
J075054J07GGACGGACACGTNONE 
J075089O11GGACGGACACGTNONE 
J075104G09GGACGGACACGTNONE 
J075150N03GGACGGACACGTNONE 
J075187A09GGACGGACACGTNONE 
J075187D04GGACGGACACGTNONE 
J090006G06GGACGGACACGTNONE 
J090045C09GGACGGACACGTNONE 
J090083D13GGACGGACACGTNONE 
J090084B13GGACGGACACGTNONE 
J100021H22GGACGGACACGTNONE 
J100034A15GGACGGACACGTNONE 
J100041N15GGACGGACACGTNONE 
J100042D05GGACGGACACGTNONE 
J100042D08GGACGGACACGTNONE 
J100059P21GGACGGACACGTNONE 
L19436GGACGGACACGTNONE 
L34038GGACGGACACGTNONE 
Os05g0497625Os05g0497625GGACGGACGGAConserved hypothetical protein. 
Os05g0528200009-146-C01GGACGGACNONE 
AK062985GGACGGACSimilar to 50S ribosomal protein L20. 
Os05g0535900AK101539GGACGGACNONE 
AK101555GGACGGACIQ calmodulin-binding region domain containing protein. 
J013047J05GGACGGACNONE 
Os05g0592300AK068520GCCGTCCGTCCGProtein of unknown function DUF1637 family protein. 
Os06g0115800AK069560GGACGGACNONE 
J023010G24GGACGGACNONE 
J023020P18GGACGGACNONE 
J023113J03GGACGGACNONE 
Os06g0220600AK058664GCCGTCCGTCCGTCCConserved hypothetical protein. 
J075096L21GCCGTCCGTCCGTCCNONE 
Os06g0223300AK111776GTCCGTCCSimilar to TDR8 protein. 
J023075K19GTCCGTCCNONE 
Os06g0307900AK119309GTCCGTCCProtein of unknown function DUF1618 domain containing protein. 
AK120750GTCCGTCCNONE 
J023004O19GTCCGTCCNONE 
J033022G01GTCCGTCCNONE 
Os06g0554800009-111-A09GGACGGACNONE 
AK058448GGACGGACNONE 
J023084H11GGACGGACNONE 
J080001H20GGACGGACNONE 
J080004P08GGACGGACNONE 
J080009C09GGACGGACNONE 
J080011A14GGACGGACNONE 
J080017C13GGACGGACNONE 
J080017H16GGACGGACNONE 
J080023O11GGACGGACNONE 
J080033J16GGACGGACNONE 
J080034I04GGACGGACNONE 
J080036M22GGACGGACNONE 
J080054N22GGACGGACNONE 
J080066K16GGACGGACNONE 
J080075N17GGACGGACNONE 
J080081L05GGACGGACNONE 
J080085P10GGACGGACNONE 
J080090M07GGACGGACNONE 
Os06g0676700009-185-F09GTCCGTCCGTCCNONE 
AK063175GTCCGTCCGTCCNONE 
AK105449GTCCGTCCGTCCSimilar to High pI alpha-glucosidase. 
AK121588GTCCGTCCGTCCNONE 
Os07g0272400AK102876GTCCGTCCGProtein of unknown function DUF500 family protein. 
Os07g0496200AK064866GTCCGTCCNONE 
AK065801GTCCGTCCSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0496900AK067389ATCGGACGGACNONE 
AK072937ATCGGACGGACConserved hypothetical protein. 
J065168M03ATCGGACGGACNONE 
J075020A18ATCGGACGGACNONE 
J075066N15ATCGGACGGACNONE 
J075108D15ATCGGACGGACNONE 
J075108L16ATCGGACGGACNONE 
J075145K18ATCGGACGGACNONE 
J075197M19ATCGGACGGACNONE 
J090050G21ATCGGACGGACNONE 
J090099P10ATCGGACGGACNONE 
Os07g0589000AK069813GGACGGACLateral organ boundaries, LOB domain containing protein. 
J023030F23GGACGGACNONE 
J065165H21GGACGGACNONE 
J065193G01GGACGGACNONE 
J075093F03GGACGGACNONE 
Os07g0643000Os07g0643000GGACGGACEsterase/lipase/thioesterase domain containing protein. 
Os08g0122700AK111089GGACGGACCCACGTGTCConserved hypothetical protein. 
Os08g0532300009-122-A05GTCCGTCCCACGCGNONE 
009-129-H05GTCCGTCCCACGCGNONE 
AB011262GTCCGTCCCACGCGNONE 
AK065141GTCCGTCCCACGCGNONE 
AK119730GTCCGTCCCACGCGSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14GTCCGTCCCACGCGNONE 
J013042K23GTCCGTCCCACGCGNONE 
J023057J08GTCCGTCCCACGCGNONE 
J023057N10GTCCGTCCCACGCGNONE 
J023113C21GTCCGTCCCACGCGNONE 
J053054E03GTCCGTCCCACGCGNONE 
J053062B07GTCCGTCCCACGCGNONE 
J053075O17GTCCGTCCCACGCGNONE 
J053075P09GTCCGTCCCACGCGNONE 
J065024H05GTCCGTCCCACGCGNONE 
J065049F22GTCCGTCCCACGCGNONE 
J065063L03GTCCGTCCCACGCGNONE 
J065102O07GTCCGTCCCACGCGNONE 
J065104M12GTCCGTCCCACGCGNONE 
J065119E04GTCCGTCCCACGCGNONE 
J065153E10GTCCGTCCCACGCGNONE 
J065168M24GTCCGTCCCACGCGNONE 
J065173I10GTCCGTCCCACGCGNONE 
J065181L04GTCCGTCCCACGCGNONE 
J065184I18GTCCGTCCCACGCGNONE 
J065203M15GTCCGTCCCACGCGNONE 
J075004C21GTCCGTCCCACGCGNONE 
J075047B11GTCCGTCCCACGCGNONE 
J075055F18GTCCGTCCCACGCGNONE 
J075065G09GTCCGTCCCACGCGNONE 
J075094O14GTCCGTCCCACGCGNONE 
J075143C22GTCCGTCCCACGCGNONE 
J075153K18GTCCGTCCCACGCGNONE 
J075164N10GTCCGTCCCACGCGNONE 
J075197C11GTCCGTCCCACGCGNONE 
J080001A01GTCCGTCCCACGCGNONE 
J080003B11GTCCGTCCCACGCGNONE 
J080006G17GTCCGTCCCACGCGNONE 
J080007J06GTCCGTCCCACGCGNONE 
J080010H12GTCCGTCCCACGCGNONE 
J080014I01GTCCGTCCCACGCGNONE 
J080015C16GTCCGTCCCACGCGNONE 
J080016P19GTCCGTCCCACGCGNONE 
J080020G24GTCCGTCCCACGCGNONE 
J080021E12GTCCGTCCCACGCGNONE 
J080023I11GTCCGTCCCACGCGNONE 
J080024H24GTCCGTCCCACGCGNONE 
J080025G18GTCCGTCCCACGCGNONE 
J080028H08GTCCGTCCCACGCGNONE 
J080030G08GTCCGTCCCACGCGNONE 
J080031H20GTCCGTCCCACGCGNONE 
J080034C20GTCCGTCCCACGCGNONE 
J080040H13GTCCGTCCCACGCGNONE 
J080044M04GTCCGTCCCACGCGNONE 
J080047D02GTCCGTCCCACGCGNONE 
J080049D17GTCCGTCCCACGCGNONE 
J080049J17GTCCGTCCCACGCGNONE 
J080050A05GTCCGTCCCACGCGNONE 
J080051C11GTCCGTCCCACGCGNONE 
J080051K06GTCCGTCCCACGCGNONE 
J080053A07GTCCGTCCCACGCGNONE 
J080053I08GTCCGTCCCACGCGNONE 
J080056L12GTCCGTCCCACGCGNONE 
J080061I19GTCCGTCCCACGCGNONE 
J080075G09GTCCGTCCCACGCGNONE 
J080078C23GTCCGTCCCACGCGNONE 
J080080I21GTCCGTCCCACGCGNONE 
J080084F04GTCCGTCCCACGCGNONE 
J080085K16GTCCGTCCCACGCGNONE 
J080097A12GTCCGTCCCACGCGNONE 
J080097N01GTCCGTCCCACGCGNONE 
J090027L10GTCCGTCCCACGCGNONE 
J100034N17GTCCGTCCCACGCGNONE 
Os09g0267400AK070630GGACGGACHarpin-induced 1 domain containing protein. 
J023058P10GGACGGACNONE 
J023077O18GGACGGACNONE 
J023100N12GGACGGACNONE 
Os09g0281800AK105291GGACGGACConserved hypothetical protein. 
Os09g0296800AK066997CGCCACGTGTCCGTCCCACCChlorophyll A-B binding protein family protein. 
Os09g0380400009-200-D01CACCGCACGGACGGACNONE 
AK063909CACCGCACGGACGGACNONE 
AK072517CACCGCACGGACGGACConserved hypothetical protein. 
AK073073CACCGCACGGACGGACNONE 
J065205F20CACCGCACGGACGGACNONE 
J100036D22CACCGCACGGACGGACNONE 
J100047M01CACCGCACGGACGGACNONE 
J100071G04CACCGCACGGACGGACNONE 
Os09g0418000006-022-F01GTCCGTCCNONE 
006-038-G10GTCCGTCCNONE 
006-089-G04GTCCGTCCNONE 
006-098-F07GTCCGTCCNONE 
AK061220GTCCGTCCNONE 
AK061493GTCCGTCCNONE 
AK100881GTCCGTCCNONE 
AK119760GTCCGTCCProtein kinase-like domain containing protein. 
J023127H10GTCCGTCCNONE 
J033122J01GTCCGTCCNONE 
J065162D08GTCCGTCCNONE 
J065214P03GTCCGTCCNONE 
J090009B17GTCCGTCCNONE 
J090093C21GTCCGTCCNONE 
J100067C01GTCCGTCCNONE 
J100067P06GTCCGTCCNONE 
Os09g0464000AK060777CGGACGGACNONE 
AK069530CGGACGGACSimilar to Carbonate dehydratase-like protein. 
Os09g0482740006-098-F12GTCCGTCCACGTGTNONE 
AK061852GTCCGTCCACGTGTProtein of unknown function DUF1664 family protein. 
J013032I17GTCCGTCCACGTGTNONE 
J013119L22GTCCGTCCACGTGTNONE 
J065114C06GTCCGTCCACGTGTNONE 
J090059O06GTCCGTCCACGTGTNONE 
J090062K09GTCCGTCCACGTGTNONE 
J100031O03GTCCGTCCACGTGTNONE 
J100038P06GTCCGTCCACGTGTNONE 
J100051M18GTCCGTCCACGTGTNONE 
J100075H20GTCCGTCCACGTGTNONE 
J100077O11GTCCGTCCACGTGTNONE 
Os09g0534800009-128-G09TCAGCCCAGTCGGACGGACNONE 
AF464908TCAGCCCAGTCGGACGGACNONE 
AK068941TCAGCCCAGTCGGACGGACTranscription initiation factor IIB (General transcription factor TFIIB). 
J013170A08TCAGCCCAGTCGGACGGACNONE 
J023123L05TCAGCCCAGTCGGACGGACNONE 
J043020O05TCAGCCCAGTCGGACGGACNONE 
Os09g0547200016-021-H03GTCCGTCCGTGTGGCNONE 
AK073078GTCCGTCCGTGTGGCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984GTCCGTCCGTGTGGCNONE 
J065005L05GTCCGTCCGTGTGGCNONE 
J065039C06GTCCGTCCGTGTGGCNONE 
J065116H17GTCCGTCCGTGTGGCNONE 
J100046A17GTCCGTCCGTGTGGCNONE 
Os09g0558100009-028-D03GTCCGTCCNONE 
014-011-A04GTCCGTCCNONE 
AB030211GTCCGTCCSimilar to Low-temperature induced protein lt101.2. 
AK062410GTCCGTCCNONE 
J065006B17GTCCGTCCNONE 
J065067M15GTCCGTCCNONE 
J065075E19GTCCGTCCNONE 
J075011G16GTCCGTCCNONE 
J075015L22GTCCGTCCNONE 
J075035O11GTCCGTCCNONE 
J075072E15GTCCGTCCNONE 
J075100O22GTCCGTCCNONE 
Os09g0558200016-083-C09GGACGGACGGANONE 
AK068834GGACGGACGGANONE 
AK103673GGACGGACGGAHomeodomain-like containing protein. 
J013159M18GGACGGACGGANONE 
J065022I04GGACGGACGGANONE 
J065089B19GGACGGACGGANONE 
Os11g0267400AK069552CGGACGGACSimilar to ClpC. 
AK100126CGGACGGACNONE 
Os11g0678200AK108189GGACGGACConserved hypothetical protein. 
J090011I09GGACGGACNONE 
J090040A10GGACGGACNONE 
Os12g0170100AK120125GGACGGACSimilar to DNA-binding protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.