version

Summary of OsREG624 (All List)

OrganismOryza sativa  
IDOsREG624  
SequenceGGACGGCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count2580  

Entry Sequences (2580 entries)

LocusGene modelSequenceDescription
Os01g0134700AK111442CGGACGGCCCalmodulin binding protein-like family protein. 
J065141F12CGGACGGCCNONE 
J065156K22CGGACGGCCNONE 
J065160A12CGGACGGCCNONE 
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0222700012-011-E01GGCCGTCCNONE 
AK068883GGCCGTCCNONE 
AK101946GGCCGTCCZinc finger, BED-type predicted domain containing protein. 
J033075C16GGCCGTCCNONE 
J043013D08GGCCGTCCNONE 
J065089G19GGCCGTCCNONE 
J065197K19GGCCGTCCNONE 
J075161L21GGCCGTCCNONE 
Os01g0238500006-086-E04GGCCGTCCGNONE 
AK067076GGCCGTCCGSimilar to Branched-chain-amino-acid aminotransferase-like protein 3, chloroplast precursor. 
AK104302GGCCGTCCGNONE 
J013093D15GGCCGTCCGNONE 
J065038O05GGCCGTCCGNONE 
J075089I20GGCCGTCCGNONE 
J075122B01GGCCGTCCGNONE 
J090086G20GGCCGTCCGNONE 
Os01g0270300006-026-A05GATCGGACGGCCNONE 
AK060365GATCGGACGGCCNONE 
AK101508GATCGGACGGCCSimilar to Cationic peroxidase isozyme 40K precursor. 
AK103467GATCGGACGGCCNONE 
J033084K19GATCGGACGGCCNONE 
J033105B06GATCGGACGGCCNONE 
J100043C10GATCGGACGGCCNONE 
Os01g0316800009-188-E08CGGACGGCCNONE 
AK058821CGGACGGCCNONE 
AK119788CGGACGGCCSimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09CGGACGGCCNONE 
J065102J21CGGACGGCCNONE 
J065173M10CGGACGGCCNONE 
J075066K08CGGACGGCCNONE 
J080302B04CGGACGGCCNONE 
J080310P14CGGACGGCCNONE 
J080311I23CGGACGGCCNONE 
J080319N12CGGACGGCCNONE 
J100024D14CGGACGGCCNONE 
J100055N12CGGACGGCCNONE 
Os01g0337600AK099595GGCCGTCCGATPase, F1 complex, gamma subunit family protein. 
AK119468GGCCGTCCGNONE 
Os01g0558500AK099982ATCGGACGGCCPWWP domain containing protein. 
J065096J12ATCGGACGGCCNONE 
Os01g0657000AK108727GGGCCGTCCProtein of unknown function DUF1070 family protein. 
Os01g0686800006-098-B12GGACGGCCCAAATNONE 
006-113-H04GGACGGCCCAAATNONE 
AK060428GGACGGCCCAAATNONE 
AK098877GGACGGCCCAAATNONE 
AK098893GGACGGCCCAAATNONE 
AK121587GGACGGCCCAAATGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGACGGCCCAAATNONE 
J013001E12GGACGGCCCAAATNONE 
J013001N15GGACGGCCCAAATNONE 
J013098G22GGACGGCCCAAATNONE 
J023004P15GGACGGCCCAAATNONE 
J023014D09GGACGGCCCAAATNONE 
J023020G09GGACGGCCCAAATNONE 
J023034A19GGACGGCCCAAATNONE 
J023050I11GGACGGCCCAAATNONE 
J023079D13GGACGGCCCAAATNONE 
J023091B11GGACGGCCCAAATNONE 
J023099M03GGACGGCCCAAATNONE 
J023101H20GGACGGCCCAAATNONE 
J023106P14GGACGGCCCAAATNONE 
J023111F19GGACGGCCCAAATNONE 
J023132C22GGACGGCCCAAATNONE 
J023139O03GGACGGCCCAAATNONE 
J023146O10GGACGGCCCAAATNONE 
J033022G16GGACGGCCCAAATNONE 
J033030C10GGACGGCCCAAATNONE 
J033032G18GGACGGCCCAAATNONE 
J033034N09GGACGGCCCAAATNONE 
J033037K24GGACGGCCCAAATNONE 
J033038B22GGACGGCCCAAATNONE 
J033061E06GGACGGCCCAAATNONE 
J033065F08GGACGGCCCAAATNONE 
J033065I24GGACGGCCCAAATNONE 
J033069L01GGACGGCCCAAATNONE 
J033086N21GGACGGCCCAAATNONE 
J033102I06GGACGGCCCAAATNONE 
J033111N07GGACGGCCCAAATNONE 
J033118K11GGACGGCCCAAATNONE 
J033125D08GGACGGCCCAAATNONE 
J033129P22GGACGGCCCAAATNONE 
J033131L12GGACGGCCCAAATNONE 
J033139D08GGACGGCCCAAATNONE 
J033141J08GGACGGCCCAAATNONE 
J043024B14GGACGGCCCAAATNONE 
J053048G19GGACGGCCCAAATNONE 
J065023B15GGACGGCCCAAATNONE 
J065082C15GGACGGCCCAAATNONE 
J065087D24GGACGGCCCAAATNONE 
J065122D11GGACGGCCCAAATNONE 
J065128P13GGACGGCCCAAATNONE 
J065149I19GGACGGCCCAAATNONE 
J065154E16GGACGGCCCAAATNONE 
J065156K21GGACGGCCCAAATNONE 
J065166H09GGACGGCCCAAATNONE 
J065169F24GGACGGCCCAAATNONE 
J065194I16GGACGGCCCAAATNONE 
J065213M20GGACGGCCCAAATNONE 
J075020F19GGACGGCCCAAATNONE 
J075051J16GGACGGCCCAAATNONE 
J075093C18GGACGGCCCAAATNONE 
J075119H02GGACGGCCCAAATNONE 
J075120J11GGACGGCCCAAATNONE 
J075173A15GGACGGCCCAAATNONE 
J080302B05GGACGGCCCAAATNONE 
J080304G10GGACGGCCCAAATNONE 
J080305E13GGACGGCCCAAATNONE 
J080315L11GGACGGCCCAAATNONE 
J090005H15GGACGGCCCAAATNONE 
J090021C24GGACGGCCCAAATNONE 
J090025H24GGACGGCCCAAATNONE 
J090025M11GGACGGCCCAAATNONE 
J090026C22GGACGGCCCAAATNONE 
J090027H15GGACGGCCCAAATNONE 
J090034B17GGACGGCCCAAATNONE 
J090045G11GGACGGCCCAAATNONE 
J090048H02GGACGGCCCAAATNONE 
J090051N04GGACGGCCCAAATNONE 
J090052I06GGACGGCCCAAATNONE 
J090054L17GGACGGCCCAAATNONE 
J090060M22GGACGGCCCAAATNONE 
J090075N17GGACGGCCCAAATNONE 
J090079K13GGACGGCCCAAATNONE 
J090086H08GGACGGCCCAAATNONE 
J090094N20GGACGGCCCAAATNONE 
J100021F03GGACGGCCCAAATNONE 
J100031M01GGACGGCCCAAATNONE 
J100033I18GGACGGCCCAAATNONE 
J100034P07GGACGGCCCAAATNONE 
J100043M16GGACGGCCCAAATNONE 
J100046J12GGACGGCCCAAATNONE 
J100055F09GGACGGCCCAAATNONE 
J100057D19GGACGGCCCAAATNONE 
J100060O10GGACGGCCCAAATNONE 
J100064G09GGACGGCCCAAATNONE 
J100077F24GGACGGCCCAAATNONE 
J100080E12GGACGGCCCAAATNONE 
J100089J04GGACGGCCCAAATNONE 
Os01g0698300AK100582GGCCGTCCZinc finger, BED-type predicted domain containing protein. 
J023105O09GGCCGTCCNONE 
J023119F15GGCCGTCCNONE 
J075007N19GGCCGTCCNONE 
J075010F10GGCCGTCCNONE 
J075032M22GGCCGTCCNONE 
J075038E01GGCCGTCCNONE 
J075064J17GGCCGTCCNONE 
J075109L20GGCCGTCCNONE 
J075131O16GGCCGTCCNONE 
J075176A17GGCCGTCCNONE 
J075178N11GGCCGTCCNONE 
J075181N15GGCCGTCCNONE 
J090060I06GGCCGTCCNONE 
J090097O21GGCCGTCCNONE 
Os01g0710800013-097-E05GGCCGTCCGNONE 
AK069973GGCCGTCCGNONE 
AK071099GGCCGTCCGConserved hypothetical protein. 
J023081K01GGCCGTCCGNONE 
J023123E16GGCCGTCCGNONE 
J033066B11GGCCGTCCGNONE 
J065144G11GGCCGTCCGNONE 
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GTCAGTGGGCCGTCCNONE 
Os01g0793900009-109-G11GGCCGTCCNONE 
009-109-G11GGCCGTCCACGTGGCNONE 
009-125-A10GGCCGTCCNONE 
009-125-A10GGCCGTCCACGTGGCNONE 
AK062811GGCCGTCCConserved hypothetical protein. 
AK062811GGCCGTCCACGTGGCConserved hypothetical protein. 
Os01g0801000AK064082ATCGGACGGCCNONE 
AK101426ATCGGACGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0801200AK111895GGCCGTCCNONE 
AK112093GGCCGTCCConserved hypothetical protein. 
J033117M02GGCCGTCCNONE 
Os01g0805200009-031-F03GGACGGCCNONE 
AK066239GGACGGCCConserved hypothetical protein. 
AK104864GGACGGCCNONE 
J013058M15GGACGGCCNONE 
J023013J10GGACGGCCNONE 
J053024C05GGACGGCCNONE 
J065078N15GGACGGCCNONE 
J065206B14GGACGGCCNONE 
J075016E22GGACGGCCNONE 
J075044O08GGACGGCCNONE 
J075157L16GGACGGCCNONE 
J080001D07GGACGGCCNONE 
J080001I05GGACGGCCNONE 
J080003N24GGACGGCCNONE 
J080005G15GGACGGCCNONE 
J080013I04GGACGGCCNONE 
J080018D01GGACGGCCNONE 
J080025E19GGACGGCCNONE 
J080027H24GGACGGCCNONE 
J080029C05GGACGGCCNONE 
J080033J18GGACGGCCNONE 
J080034N13GGACGGCCNONE 
J080037G21GGACGGCCNONE 
J080038K05GGACGGCCNONE 
J080039I17GGACGGCCNONE 
J080047F14GGACGGCCNONE 
J080047J22GGACGGCCNONE 
J080059A22GGACGGCCNONE 
J080062A12GGACGGCCNONE 
J080062K14GGACGGCCNONE 
J080068E09GGACGGCCNONE 
J080072M10GGACGGCCNONE 
J080079G07GGACGGCCNONE 
J080080F19GGACGGCCNONE 
J080081N09GGACGGCCNONE 
J080090M11GGACGGCCNONE 
J080096B11GGACGGCCNONE 
J080097D06GGACGGCCNONE 
J080097K16GGACGGCCNONE 
Os01g0817700003-108-A10GGCCGTCCNONE 
AK060836GGCCGTCCNONE 
AK065059GGCCGTCCSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I). 
J013001J10GGCCGTCCNONE 
J013047D19GGCCGTCCNONE 
J013056K09GGCCGTCCNONE 
J013068P20GGCCGTCCNONE 
J013108G18GGCCGTCCNONE 
J023007N01GGCCGTCCNONE 
J023008A22GGCCGTCCNONE 
J023010B02GGCCGTCCNONE 
J023029O13GGCCGTCCNONE 
J023064F21GGCCGTCCNONE 
J023073E22GGCCGTCCNONE 
J023143E14GGCCGTCCNONE 
J033027N20GGCCGTCCNONE 
J033032G14GGCCGTCCNONE 
J033037E03GGCCGTCCNONE 
J033057N19GGCCGTCCNONE 
J033065E16GGCCGTCCNONE 
J033066B19GGCCGTCCNONE 
J033069G01GGCCGTCCNONE 
J033071B03GGCCGTCCNONE 
J033080C12GGCCGTCCNONE 
J033081K19GGCCGTCCNONE 
J033096B19GGCCGTCCNONE 
J033101E20GGCCGTCCNONE 
J033135L21GGCCGTCCNONE 
J033139I07GGCCGTCCNONE 
J033150A21GGCCGTCCNONE 
J043036J05GGCCGTCCNONE 
J043039D03GGCCGTCCNONE 
J043039F19GGCCGTCCNONE 
J090006K04GGCCGTCCNONE 
J090017G14GGCCGTCCNONE 
J090034E23GGCCGTCCNONE 
J090039D07GGCCGTCCNONE 
J090039I09GGCCGTCCNONE 
J090044F21GGCCGTCCNONE 
J090049J12GGCCGTCCNONE 
J090053A19GGCCGTCCNONE 
J090061E23GGCCGTCCNONE 
J090079K09GGCCGTCCNONE 
J090092F21GGCCGTCCNONE 
J100022E04GGCCGTCCNONE 
J100038I01GGCCGTCCNONE 
J100066C22GGCCGTCCNONE 
J100067C11GGCCGTCCNONE 
J100073F07GGCCGTCCNONE 
J100084I24GGCCGTCCNONE 
Os01g0837600AK108007ATCGGACGGCCConserved hypothetical protein 1589, plant family protein. 
J065005C19ATCGGACGGCCNONE 
J065025H20ATCGGACGGCCNONE 
J065061E22ATCGGACGGCCNONE 
J065065F14ATCGGACGGCCNONE 
J065083O21ATCGGACGGCCNONE 
J065201G05ATCGGACGGCCNONE 
Os01g0841000009-005-A12ATCTGGGCCGTCCNONE 
AK059601ATCTGGGCCGTCCENTH/VHS domain containing protein. 
AK103342ATCTGGGCCGTCCNONE 
J023022C02ATCTGGGCCGTCCNONE 
J023030C09ATCTGGGCCGTCCNONE 
J033075D24ATCTGGGCCGTCCNONE 
J033123O16ATCTGGGCCGTCCNONE 
J033126C16ATCTGGGCCGTCCNONE 
J065120M23ATCTGGGCCGTCCNONE 
J065190I23ATCTGGGCCGTCCNONE 
J090090G01ATCTGGGCCGTCCNONE 
Os01g0856900AK107570CGGACGGCCCGGTGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03CGGACGGCCCGGTNONE 
J075028J03CGGACGGCCCGGTNONE 
J075052C05CGGACGGCCCGGTNONE 
J075199J04CGGACGGCCCGGTNONE 
J090052L20CGGACGGCCCGGTNONE 
J090075L24CGGACGGCCCGGTNONE 
Os01g0867300AK067919AATGGGCCGTCCGTCCGTCCSimilar to OSE2-like protein (Fragment). 
J013123H12AATGGGCCGTCCGTCCGTCCNONE 
J033046C11AATGGGCCGTCCGTCCGTCCNONE 
J033051I17AATGGGCCGTCCGTCCGTCCNONE 
U25283AATGGGCCGTCCGTCCGTCCNONE 
Os01g0867600AK102226CGGACGGCCCAGATSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0949200AK102412CGGACGGCCCACCANONE 
J033093A04CGGACGGCCCACCANONE 
J065053P06CGGACGGCCCACCANONE 
J100086D18CGGACGGCCCACCANONE 
Os01g0975000AK103552CGGACGGCCNONE 
AK119662CGGACGGCCProtein of unknown function DUF966 family protein. 
J033132F15CGGACGGCCNONE 
J065012J09CGGACGGCCNONE 
J065166N08CGGACGGCCNONE 
Os02g0115900AF006825CGGACGGCCNONE 
AK065743CGGACGGCCEndosperm lumenal binding protein. 
AK119653CGGACGGCCNONE 
Os02g0121100012-035-F06GGCCGTCCGATCNONE 
013-031-H05GGCCGTCCGATCNONE 
013-058-E11GGCCGTCCGATCNONE 
014-010-D01GGCCGTCCGATCNONE 
AK070711GGCCGTCCGATCConserved hypothetical protein. 
AK119758GGCCGTCCGATCNONE 
J013033G12GGCCGTCCGATCNONE 
J023007M16GGCCGTCCGATCNONE 
J023020K20GGCCGTCCGATCNONE 
J023061H10GGCCGTCCGATCNONE 
J033027H20GGCCGTCCGATCNONE 
J033051E18GGCCGTCCGATCNONE 
J090005F12GGCCGTCCGATCNONE 
J090017A20GGCCGTCCGATCNONE 
J090018G11GGCCGTCCGATCNONE 
J090062C18GGCCGTCCGATCNONE 
J100027N10GGCCGTCCGATCNONE 
J100032L14GGCCGTCCGATCNONE 
J100045C14GGCCGTCCGATCNONE 
J100061M09GGCCGTCCGATCNONE 
J100062K11GGCCGTCCGATCNONE 
J100064H11GGCCGTCCGATCNONE 
J100074H16GGCCGTCCGATCNONE 
J100082N01GGCCGTCCGATCNONE 
Os02g0148100AF216317GATCGGACGGCCNONE 
AF241166GATCGGACGGCCNONE 
AK119650GATCGGACGGCCMAP kinase MAPK2 (MAP kinase 3). 
Os02g0148500AK068931CGGACGGCCSimilar to TIMING OF CAB 1 (Fragment). 
Os02g0159200AK102507CGGACGGCCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J033095F16CGGACGGCCNONE 
J033095F24CGGACGGCCNONE 
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE 
AK060915ATCGGACGGCCCACGTNONE 
AK099194ATCGGACGGCCCACGTNONE 
AK104206ATCGGACGGCCCACGTNONE 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07ATCGGACGGCCCACGTNONE 
Os02g0220600AK061944ATCGGACGGCCGAGATElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946ATCGGACGGCCGAGATNONE 
D89802ATCGGACGGCCGAGATNONE 
J013042L22ATCGGACGGCCGAGATNONE 
J013056A14ATCGGACGGCCGAGATNONE 
J013120G13ATCGGACGGCCGAGATNONE 
J013155K19ATCGGACGGCCGAGATNONE 
J023002B10ATCGGACGGCCGAGATNONE 
J023080J19ATCGGACGGCCGAGATNONE 
J023081C08ATCGGACGGCCGAGATNONE 
J023090H05ATCGGACGGCCGAGATNONE 
J023091M07ATCGGACGGCCGAGATNONE 
J023115F09ATCGGACGGCCGAGATNONE 
J033025I23ATCGGACGGCCGAGATNONE 
J033026G12ATCGGACGGCCGAGATNONE 
J033035E15ATCGGACGGCCGAGATNONE 
J033040N13ATCGGACGGCCGAGATNONE 
J033046C17ATCGGACGGCCGAGATNONE 
J033069F02ATCGGACGGCCGAGATNONE 
J033071B16ATCGGACGGCCGAGATNONE 
J033071N22ATCGGACGGCCGAGATNONE 
J033088J02ATCGGACGGCCGAGATNONE 
J033092N24ATCGGACGGCCGAGATNONE 
J033093I09ATCGGACGGCCGAGATNONE 
J033126G06ATCGGACGGCCGAGATNONE 
J043003G15ATCGGACGGCCGAGATNONE 
J043010M11ATCGGACGGCCGAGATNONE 
J043024O20ATCGGACGGCCGAGATNONE 
J065092N03ATCGGACGGCCGAGATNONE 
J080004D17ATCGGACGGCCGAGATNONE 
J080010L09ATCGGACGGCCGAGATNONE 
J080021I11ATCGGACGGCCGAGATNONE 
J080022L01ATCGGACGGCCGAGATNONE 
J080029B01ATCGGACGGCCGAGATNONE 
J080032D11ATCGGACGGCCGAGATNONE 
J080039B11ATCGGACGGCCGAGATNONE 
J080040K17ATCGGACGGCCGAGATNONE 
J080041B21ATCGGACGGCCGAGATNONE 
J080052L24ATCGGACGGCCGAGATNONE 
J080054M12ATCGGACGGCCGAGATNONE 
J080057B15ATCGGACGGCCGAGATNONE 
J080078G15ATCGGACGGCCGAGATNONE 
J080078H06ATCGGACGGCCGAGATNONE 
J080079M03ATCGGACGGCCGAGATNONE 
J080088H16ATCGGACGGCCGAGATNONE 
J080093C11ATCGGACGGCCGAGATNONE 
J080095K09ATCGGACGGCCGAGATNONE 
J080095O20ATCGGACGGCCGAGATNONE 
J090009J19ATCGGACGGCCGAGATNONE 
J090040D04ATCGGACGGCCGAGATNONE 
J090052E14ATCGGACGGCCGAGATNONE 
J090063B14ATCGGACGGCCGAGATNONE 
J090071K04ATCGGACGGCCGAGATNONE 
J090075E12ATCGGACGGCCGAGATNONE 
J090087A06ATCGGACGGCCGAGATNONE 
J090094P03ATCGGACGGCCGAGATNONE 
J090098M14ATCGGACGGCCGAGATNONE 
Os02g0301100006-029-F04GGACGGCCNONE 
012-005-F07GGACGGCCNONE 
013-093-H10GGACGGCCNONE 
015-042-B01GGACGGCCNONE 
016-017-F09GGACGGCCNONE 
016-079-B07GGACGGCCNONE 
016-079-G03GGACGGCCNONE 
016-087-F11GGACGGCCNONE 
AK071676GGACGGCCNONE 
AK100174GGACGGCCMtN3 and saliva related transmembrane protein family protein. 
AK104411GGACGGCCNONE 
AK104467GGACGGCCNONE 
J023069G02GGACGGCCNONE 
J023108F17GGACGGCCNONE 
J033042B04GGACGGCCNONE 
J033128D06GGACGGCCNONE 
J033138I12GGACGGCCNONE 
J053064K16GGACGGCCNONE 
J065088A12GGACGGCCNONE 
J065102L08GGACGGCCNONE 
J065104L14GGACGGCCNONE 
J065117M20GGACGGCCNONE 
J065117N14GGACGGCCNONE 
J065120H23GGACGGCCNONE 
J065135F06GGACGGCCNONE 
J065138J17GGACGGCCNONE 
J065138P06GGACGGCCNONE 
J065156G16GGACGGCCNONE 
J065163M20GGACGGCCNONE 
J065176A14GGACGGCCNONE 
J065182C02GGACGGCCNONE 
J065200C05GGACGGCCNONE 
J065213J22GGACGGCCNONE 
J065217D24GGACGGCCNONE 
J075009H03GGACGGCCNONE 
J075020D10GGACGGCCNONE 
J075026L24GGACGGCCNONE 
J075028L01GGACGGCCNONE 
J075057O09GGACGGCCNONE 
J075089A20GGACGGCCNONE 
J075094J15GGACGGCCNONE 
J075103B11GGACGGCCNONE 
J075143L13GGACGGCCNONE 
J075153K15GGACGGCCNONE 
J075161P22GGACGGCCNONE 
J075166J06GGACGGCCNONE 
J075177G06GGACGGCCNONE 
J075198N06GGACGGCCNONE 
Os02g0453300006-099-D03GGACGGACGGCCNONE 
006-099-D03GGCCGTCCACGTGTCCNONE 
009-120-D02GGACGGACGGCCNONE 
009-120-D02GGCCGTCCACGTGTCCNONE 
AK071220GGACGGACGGCCNONE 
AK071220GGCCGTCCACGTGTCCNONE 
AK109380GGACGGACGGCCConserved hypothetical protein. 
AK109380GGCCGTCCACGTGTCCConserved hypothetical protein. 
J023083M17GGACGGACGGCCNONE 
J023083M17GGCCGTCCACGTGTCCNONE 
Os02g0497700011-094-A10GGCCGTCCNONE 
012-073-H02GGCCGTCCNONE 
016-056-G05GGCCGTCCNONE 
AK070143GGCCGTCCNONE 
J023041O14GGCCGTCCNONE 
J023092H01GGCCGTCCNONE 
J033048A17GGCCGTCCNONE 
J033051K21GGCCGTCCNONE 
J033122D01GGCCGTCCNONE 
J090032E23GGCCGTCCNONE 
J090055K13GGCCGTCCNONE 
Os02g0505400AK102812GGCCGTCCNONE 
AK120466GGCCGTCCExo70 exocyst complex subunit family protein. 
J013108M03GGCCGTCCNONE 
J033108L10GGCCGTCCNONE 
J065165F14GGCCGTCCNONE 
Os02g0556700AK073875GGCCGTCCGATCT-complex 11 family protein. 
Os02g0594700AK111339GGCCGTCCSimilar to Non-phototropic hypocotyl 3. 
J100037B14GGCCGTCCNONE 
J100038E24GGCCGTCCNONE 
Os02g0605600016-017-B02GGCCGTCCNONE 
AK066104GGCCGTCCLUC7 related family protein. 
J013052G16GGCCGTCCNONE 
J043022E03GGCCGTCCNONE 
J065105P10GGCCGTCCNONE 
Os02g0695800008-001-G03GGCCGTCCNONE 
009-131-A03GGCCGTCCNONE 
AK062910GGCCGTCCNONE 
Os02g0709900AB110204GGCCGTCCPrefoldin domain containing protein. 
AK109259GGCCGTCCNONE 
J013093N22GGCCGTCCNONE 
J033116F21GGCCGTCCNONE 
Os02g0733800AK121645GGACGGCCNuclear protein SET domain containing protein. 
J033058C09GGACGGCCNONE 
J065141J06GGACGGCCNONE 
Os02g0750500AK101960GGCCGTCCGATSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GGCCGTCCGATNONE 
J065054F02GGCCGTCCGATNONE 
J065124N03GGCCGTCCGATNONE 
J090001H12GGCCGTCCGATNONE 
J100057J01GGCCGTCCGATNONE 
J100062F12GGCCGTCCGATNONE 
Os02g0751300J033055P08CGGACGGCCCAGATProtein of unknown function DUF581 family protein. 
Os02g0769700AK111328GGCCGTCCProtein kinase-like domain containing protein. 
Os02g0776800AB042415GGCCGTCCGATNONE 
AK072308GGCCGTCCGATReplication protein A 70kDa. 
AK101212GGCCGTCCGATNONE 
J033031B02GGCCGTCCGATNONE 
J090004E18GGCCGTCCGATNONE 
J090084C24GGCCGTCCGATNONE 
Os02g0777800AK066978GGACGGCCSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0791800AK066282TACTGGGCCGTCCNONE 
AK099697TACTGGGCCGTCCWD-40 repeat containing protein. 
AY445625TACTGGGCCGTCCNONE 
J053065H07TACTGGGCCGTCCNONE 
J065108P05TACTGGGCCGTCCNONE 
J065154P22TACTGGGCCGTCCNONE 
J100037P04TACTGGGCCGTCCNONE 
J100068K05TACTGGGCCGTCCNONE 
Os02g0796300006-087-C02GGCCGTCCNONE 
AK061820GGCCGTCCNONE 
AK073025GGCCGTCCNONE 
AK119386GGCCGTCCSimilar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1) (BTG1 binding factor 1). 
J013033A22GGCCGTCCNONE 
J013096K18GGCCGTCCNONE 
J023072E02GGCCGTCCNONE 
J023113M08GGCCGTCCNONE 
J023149N08GGCCGTCCNONE 
Os03g0115200009-112-E09TCGGACGGCCCATGNONE 
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TCGGACGGCCCATGNONE 
J065075D17TCGGACGGCCCATGNONE 
J065108G15TCGGACGGCCCATGNONE 
J065165A16TCGGACGGCCCATGNONE 
J075015O12TCGGACGGCCCATGNONE 
J075022O06TCGGACGGCCCATGNONE 
J075031H14TCGGACGGCCCATGNONE 
J075033D10TCGGACGGCCCATGNONE 
J075070A04TCGGACGGCCCATGNONE 
J075127A05TCGGACGGCCCATGNONE 
J100070B16TCGGACGGCCCATGNONE 
Os03g0130700AK110670GGCCGTCCNONE 
Os03g0145600015-010-B10CGGACGGCCCATCTNONE 
AK106243CGGACGGCCCATCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0145900J013045K15GGACGGCCNONE 
J013051O08GGACGGCCNONE 
J065054C08GGACGGCCNONE 
J075053J16GGACGGCCNONE 
Os03g0156500011-075-F02GGCCGTCCGNONE 
012-077-G10GGCCGTCCGNONE 
AK103466GGCCGTCCGLupus La protein family protein. 
J013088H17GGCCGTCCGNONE 
J013135G21GGCCGTCCGNONE 
J033050E10GGCCGTCCGNONE 
J033050J01GGCCGTCCGNONE 
J033129N23GGCCGTCCGNONE 
J065085L16GGCCGTCCGNONE 
J065101B19GGCCGTCCGNONE 
J065167N03GGCCGTCCGNONE 
J090009O21GGCCGTCCGNONE 
J090049D11GGCCGTCCGNONE 
J100017F23GGCCGTCCGNONE 
J100040E12GGCCGTCCGNONE 
J100055O18GGCCGTCCGNONE 
J100061K08GGCCGTCCGNONE 
J100072M05GGCCGTCCGNONE 
J100077B08GGCCGTCCGNONE 
J100086G03GGCCGTCCGNONE 
Os03g0168200AK099530GGACGGCCCGGTConserved hypothetical protein. 
Os03g0184700AB104466GGCCGTCCNONE 
AF140487GGCCGTCCOrigin recognition complex subunit 2 (Origin recognition complex2). 
J090063M04GGCCGTCCNONE 
Os03g0187700009-155-F05CCGTGGGCCGTCCGATCNONE 
J033140E21CCGTGGGCCGTCCGATCNONE 
J033142E21CCGTGGGCCGTCCGATCNONE 
J065014P17CCGTGGGCCGTCCGATCNONE 
J065083L20CCGTGGGCCGTCCGATCNONE 
J065092E08CCGTGGGCCGTCCGATCNONE 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
J075142H08CCGTGGGCCGTCCGATCNONE 
J075175K21CCGTGGGCCGTCCGATCNONE 
J090070B20CCGTGGGCCGTCCGATCNONE 
J100071M06CCGTGGGCCGTCCGATCNONE 
Os03g0197000AK071163GGACGGCCCATCGConserved hypothetical protein. 
J023079A07GGACGGCCCATCGNONE 
Os03g0200500005-016-A06AGTGGGCCGTCCNONE 
AK069251AGTGGGCCGTCC40S ribosomal protein S3a (CYC07 protein). 
AK104243AGTGGGCCGTCCNONE 
AK104699AGTGGGCCGTCCNONE 
D26060AGTGGGCCGTCCNONE 
J013024H20AGTGGGCCGTCCNONE 
J013029C14AGTGGGCCGTCCNONE 
J013035O17AGTGGGCCGTCCNONE 
J013066B11AGTGGGCCGTCCNONE 
J013066B12AGTGGGCCGTCCNONE 
J013066B13AGTGGGCCGTCCNONE 
J013152M04AGTGGGCCGTCCNONE 
J023001A03AGTGGGCCGTCCNONE 
J023013H23AGTGGGCCGTCCNONE 
J023042L07AGTGGGCCGTCCNONE 
J023081L11AGTGGGCCGTCCNONE 
J023088I23AGTGGGCCGTCCNONE 
J023092N22AGTGGGCCGTCCNONE 
J023126A20AGTGGGCCGTCCNONE 
J023139A17AGTGGGCCGTCCNONE 
J023150G12AGTGGGCCGTCCNONE 
J033026M10AGTGGGCCGTCCNONE 
J033031H24AGTGGGCCGTCCNONE 
J033036C22AGTGGGCCGTCCNONE 
J033037P08AGTGGGCCGTCCNONE 
J033045G14AGTGGGCCGTCCNONE 
J033048A13AGTGGGCCGTCCNONE 
J033048B13AGTGGGCCGTCCNONE 
J033048K11AGTGGGCCGTCCNONE 
J033066A06AGTGGGCCGTCCNONE 
J033072H01AGTGGGCCGTCCNONE 
J033082K07AGTGGGCCGTCCNONE 
J033091G20AGTGGGCCGTCCNONE 
J033095C14AGTGGGCCGTCCNONE 
J033101N24AGTGGGCCGTCCNONE 
J033105L15AGTGGGCCGTCCNONE 
J033107J18AGTGGGCCGTCCNONE 
J033112L02AGTGGGCCGTCCNONE 
J033117I17AGTGGGCCGTCCNONE 
J043003K06AGTGGGCCGTCCNONE 
J043016I20AGTGGGCCGTCCNONE 
J043021A10AGTGGGCCGTCCNONE 
J043034F14AGTGGGCCGTCCNONE 
J065002O17AGTGGGCCGTCCNONE 
J065014B14AGTGGGCCGTCCNONE 
J065054N19AGTGGGCCGTCCNONE 
J065112P18AGTGGGCCGTCCNONE 
J065121B20AGTGGGCCGTCCNONE 
J065170M08AGTGGGCCGTCCNONE 
J065194B05AGTGGGCCGTCCNONE 
J090040F01AGTGGGCCGTCCNONE 
J090078O20AGTGGGCCGTCCNONE 
J090078P21AGTGGGCCGTCCNONE 
J090084E11AGTGGGCCGTCCNONE 
J100080B11AGTGGGCCGTCCNONE 
Os03g0205500Os03g0205500CGGGCCGTCCCytochrome b5 domain containing protein. 
Os03g0227800016-033-F09GGCCGTCCGANONE 
AK063571GGCCGTCCGANONE 
AK103846GGCCGTCCGANONE 
J013028J20GGCCGTCCGANONE 
J013091I04GGCCGTCCGANONE 
J013100P18GGCCGTCCGANONE 
J013128L15GGCCGTCCGANONE 
J013153M09GGCCGTCCGANONE 
J033072J03GGCCGTCCGANONE 
J033074L07GGCCGTCCGANONE 
J033106H15GGCCGTCCGANONE 
J033148J22GGCCGTCCGANONE 
J065005B02GGCCGTCCGANONE 
J065009M20GGCCGTCCGANONE 
J065035E23GGCCGTCCGANONE 
J065039E24GGCCGTCCGANONE 
J065057P20GGCCGTCCGANONE 
J065066E10GGCCGTCCGANONE 
J065072G21GGCCGTCCGANONE 
J065076N07GGCCGTCCGANONE 
J065093G14GGCCGTCCGANONE 
J065127K10GGCCGTCCGANONE 
J065142O20GGCCGTCCGANONE 
J065165O18GGCCGTCCGANONE 
J065179O07GGCCGTCCGANONE 
J065203E15GGCCGTCCGANONE 
J080305J16GGCCGTCCGANONE 
J090008C14GGCCGTCCGANONE 
J090083E01GGCCGTCCGANONE 
J090092B02GGCCGTCCGANONE 
J090098O14GGCCGTCCGANONE 
J100042A12GGCCGTCCGANONE 
J100090K14GGCCGTCCGANONE 
Os03g0232500AK110980CGGACGGCCGTP-binding protein, HSR1-related domain containing protein. 
J100036C06CGGACGGCCNONE 
Os03g0253100AK119618GGACGGCCPhosphomevalonate kinase Erg8 family protein. 
J033052A14GGACGGCCNONE 
Os03g0275500AK065232CGGACGGCCEpsin, N-terminal domain containing protein. 
J013002H14CGGACGGCCNONE 
J013047G17CGGACGGCCNONE 
J013050M23CGGACGGCCNONE 
J013066D16CGGACGGCCNONE 
J013088C16CGGACGGCCNONE 
J023026P14CGGACGGCCNONE 
J023031E04CGGACGGCCNONE 
J023045C06CGGACGGCCNONE 
J023086K13CGGACGGCCNONE 
J023119G16CGGACGGCCNONE 
J033079G11CGGACGGCCNONE 
J033090O21CGGACGGCCNONE 
J033103H08CGGACGGCCNONE 
J033103M23CGGACGGCCNONE 
J033106J17CGGACGGCCNONE 
J033141M15CGGACGGCCNONE 
J090029G22CGGACGGCCNONE 
J090032O20CGGACGGCCNONE 
J090034P11CGGACGGCCNONE 
J090087D18CGGACGGCCNONE 
J100078E18CGGACGGCCNONE 
J100081C12CGGACGGCCNONE 
Os03g0321000AK103653GGGCCGTCCSimilar to Steroid membrane binding protein-like. 
Os03g0341100009-012-D06GGACGGCCNONE 
AK121580GGACGGCCSimilar to 60S ribosomal protein L18. 
J033037B18GGACGGCCNONE 
J053090K21GGACGGCCNONE 
J065040D12GGACGGCCNONE 
J075106P15GGACGGCCNONE 
J075117P13GGACGGCCNONE 
J075128N02GGACGGCCNONE 
J090031L12GGACGGCCNONE 
J100023E19GGACGGCCNONE 
J100033O21GGACGGCCNONE 
J100070A12GGACGGCCNONE 
J100087M20GGACGGCCNONE 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
Os03g0390600009-122-E09ATCTCGGCCGTCCGANONE 
J065165K04ATCTCGGCCGTCCGANONE 
Os03g0416200009-114-C04GGCCGTCCNONE 
009-134-H04GGCCGTCCNONE 
AK069631GGCCGTCCBRITTLE CULM1. 
AK105862GGCCGTCCNONE 
J023025J18GGCCGTCCNONE 
Os03g0574300AK072541ATCGGACGGCCHypothetical protein. 
J023134M10ATCGGACGGCCNONE 
Os03g0654700AK107417CCACGGCCGTCCGProtein of unknown function DUF1637 family protein. 
Os03g0669600009-081-F01CGGACGGCCNONE 
AK073152CGGACGGCCNONE 
AK104971CGGACGGCCHypothetical protein. 
J065166I17CGGACGGCCNONE 
Os03g0670700009-028-B03GGACGGCCGCGTGGGNONE 
009-036-H12GGACGGCCGCGTGGGNONE 
009-053-H05GGACGGCCGCGTGGGNONE 
009-126-B02GGACGGCCGCGTGGGNONE 
009-135-D07GGACGGCCGCGTGGGNONE 
009-148-A03GGACGGCCGCGTGGGNONE 
009-148-A12GGACGGCCGCGTGGGNONE 
009-152-B02GGACGGCCGCGTGGGNONE 
009-153-B06GGACGGCCGCGTGGGNONE 
009-166-G05GGACGGCCGCGTGGGNONE 
009-181-A09GGACGGCCGCGTGGGNONE 
011-061-D07GGACGGCCGCGTGGGNONE 
012-043-C04GGACGGCCGCGTGGGNONE 
013-001-A02GGACGGCCGCGTGGGNONE 
013-004-F05GGACGGCCGCGTGGGNONE 
013-008-C08GGACGGCCGCGTGGGNONE 
013-015-B09GGACGGCCGCGTGGGNONE 
013-016-G05GGACGGCCGCGTGGGNONE 
013-023-A06GGACGGCCGCGTGGGNONE 
013-023-B06GGACGGCCGCGTGGGNONE 
013-032-F09GGACGGCCGCGTGGGNONE 
013-059-C07GGACGGCCGCGTGGGNONE 
013-071-E09GGACGGCCGCGTGGGNONE 
013-073-D06GGACGGCCGCGTGGGNONE 
013-077-C02GGACGGCCGCGTGGGNONE 
013-078-B12GGACGGCCGCGTGGGNONE 
013-093-A01GGACGGCCGCGTGGGNONE 
014-002-B12GGACGGCCGCGTGGGNONE 
014-003-E08GGACGGCCGCGTGGGNONE 
014-004-D06GGACGGCCGCGTGGGNONE 
014-007-C11GGACGGCCGCGTGGGNONE 
014-007-G10GGACGGCCGCGTGGGNONE 
014-019-C04GGACGGCCGCGTGGGNONE 
014-021-F05GGACGGCCGCGTGGGNONE 
014-024-G06GGACGGCCGCGTGGGNONE 
014-027-C07GGACGGCCGCGTGGGNONE 
014-027-D03GGACGGCCGCGTGGGNONE 
014-029-E07GGACGGCCGCGTGGGNONE 
014-031-B04GGACGGCCGCGTGGGNONE 
014-033-B05GGACGGCCGCGTGGGNONE 
014-033-C03GGACGGCCGCGTGGGNONE 
014-033-C12GGACGGCCGCGTGGGNONE 
014-036-F01GGACGGCCGCGTGGGNONE 
014-037-C04GGACGGCCGCGTGGGNONE 
014-040-H02GGACGGCCGCGTGGGNONE 
014-045-H04GGACGGCCGCGTGGGNONE 
014-045-H06GGACGGCCGCGTGGGNONE 
014-052-A08GGACGGCCGCGTGGGNONE 
014-076-G01GGACGGCCGCGTGGGNONE 
014-083-F04GGACGGCCGCGTGGGNONE 
014-086-E01GGACGGCCGCGTGGGNONE 
014-091-D02GGACGGCCGCGTGGGNONE 
014-091-F05GGACGGCCGCGTGGGNONE 
014-093-E10GGACGGCCGCGTGGGNONE 
014-100-C10GGACGGCCGCGTGGGNONE 
015-011-H02GGACGGCCGCGTGGGNONE 
015-073-B03GGACGGCCGCGTGGGNONE 
AF010579GGACGGCCGCGTGGGNONE 
AK059164GGACGGCCGCGTGGGSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GGACGGCCGCGTGGGNONE 
AK119238GGACGGCCGCGTGGGNONE 
AK119242GGACGGCCGCGTGGGNONE 
J023037K17GGACGGCCGCGTGGGNONE 
J033136F11GGACGGCCGCGTGGGNONE 
J065008C13GGACGGCCGCGTGGGNONE 
J065032K18GGACGGCCGCGTGGGNONE 
J065043N10GGACGGCCGCGTGGGNONE 
J065045E06GGACGGCCGCGTGGGNONE 
J065046P21GGACGGCCGCGTGGGNONE 
J065048J17GGACGGCCGCGTGGGNONE 
J065053I23GGACGGCCGCGTGGGNONE 
J065053P03GGACGGCCGCGTGGGNONE 
J065054C13GGACGGCCGCGTGGGNONE 
J065058I17GGACGGCCGCGTGGGNONE 
J065061I12GGACGGCCGCGTGGGNONE 
J065062E09GGACGGCCGCGTGGGNONE 
J065063P04GGACGGCCGCGTGGGNONE 
J065068J07GGACGGCCGCGTGGGNONE 
J065076D02GGACGGCCGCGTGGGNONE 
J065083O07GGACGGCCGCGTGGGNONE 
J065090J02GGACGGCCGCGTGGGNONE 
J065093N08GGACGGCCGCGTGGGNONE 
J065097F02GGACGGCCGCGTGGGNONE 
J065112H17GGACGGCCGCGTGGGNONE 
J065121B01GGACGGCCGCGTGGGNONE 
J065124F12GGACGGCCGCGTGGGNONE 
J065130L03GGACGGCCGCGTGGGNONE 
J065131K05GGACGGCCGCGTGGGNONE 
J065132C06GGACGGCCGCGTGGGNONE 
J065135J18GGACGGCCGCGTGGGNONE 
J065138J22GGACGGCCGCGTGGGNONE 
J065140G21GGACGGCCGCGTGGGNONE 
J065161B19GGACGGCCGCGTGGGNONE 
J065162F22GGACGGCCGCGTGGGNONE 
J065162M09GGACGGCCGCGTGGGNONE 
J065163D03GGACGGCCGCGTGGGNONE 
J065163O21GGACGGCCGCGTGGGNONE 
J065165H11GGACGGCCGCGTGGGNONE 
J065165O16GGACGGCCGCGTGGGNONE 
J065167N06GGACGGCCGCGTGGGNONE 
J065168I08GGACGGCCGCGTGGGNONE 
J065170A14GGACGGCCGCGTGGGNONE 
J065170L03GGACGGCCGCGTGGGNONE 
J065171C08GGACGGCCGCGTGGGNONE 
J065173G11GGACGGCCGCGTGGGNONE 
J065173M09GGACGGCCGCGTGGGNONE 
J065176P07GGACGGCCGCGTGGGNONE 
J065178K24GGACGGCCGCGTGGGNONE 
J065185O12GGACGGCCGCGTGGGNONE 
J065191E02GGACGGCCGCGTGGGNONE 
J065204H10GGACGGCCGCGTGGGNONE 
J075033C23GGACGGCCGCGTGGGNONE 
J075041M21GGACGGCCGCGTGGGNONE 
J075043F13GGACGGCCGCGTGGGNONE 
J075044D02GGACGGCCGCGTGGGNONE 
J075044J15GGACGGCCGCGTGGGNONE 
J075048L07GGACGGCCGCGTGGGNONE 
J075054G12GGACGGCCGCGTGGGNONE 
J075055J10GGACGGCCGCGTGGGNONE 
J075059F09GGACGGCCGCGTGGGNONE 
J075066M23GGACGGCCGCGTGGGNONE 
J075071O09GGACGGCCGCGTGGGNONE 
J075085G23GGACGGCCGCGTGGGNONE 
J075086B21GGACGGCCGCGTGGGNONE 
J075087L18GGACGGCCGCGTGGGNONE 
J075087L21GGACGGCCGCGTGGGNONE 
J075087N14GGACGGCCGCGTGGGNONE 
J075088O13GGACGGCCGCGTGGGNONE 
J075089B06GGACGGCCGCGTGGGNONE 
J075089E20GGACGGCCGCGTGGGNONE 
J075090J01GGACGGCCGCGTGGGNONE 
J075090L05GGACGGCCGCGTGGGNONE 
J075091G05GGACGGCCGCGTGGGNONE 
J075091N06GGACGGCCGCGTGGGNONE 
J075093G08GGACGGCCGCGTGGGNONE 
J075094C13GGACGGCCGCGTGGGNONE 
J075095K01GGACGGCCGCGTGGGNONE 
J075096C02GGACGGCCGCGTGGGNONE 
J075097L16GGACGGCCGCGTGGGNONE 
J075097O10GGACGGCCGCGTGGGNONE 
J075098H24GGACGGCCGCGTGGGNONE 
J075099H02GGACGGCCGCGTGGGNONE 
J075099J11GGACGGCCGCGTGGGNONE 
J075099L08GGACGGCCGCGTGGGNONE 
J075109I11GGACGGCCGCGTGGGNONE 
J075114F03GGACGGCCGCGTGGGNONE 
J075121G07GGACGGCCGCGTGGGNONE 
J075122D23GGACGGCCGCGTGGGNONE 
J075132O07GGACGGCCGCGTGGGNONE 
J075141L21GGACGGCCGCGTGGGNONE 
J075142I08GGACGGCCGCGTGGGNONE 
J075145A06GGACGGCCGCGTGGGNONE 
J075147J15GGACGGCCGCGTGGGNONE 
J075150B09GGACGGCCGCGTGGGNONE 
J075151E07GGACGGCCGCGTGGGNONE 
J075161M16GGACGGCCGCGTGGGNONE 
J075190I16GGACGGCCGCGTGGGNONE 
J075192L05GGACGGCCGCGTGGGNONE 
J075192O03GGACGGCCGCGTGGGNONE 
J075192O08GGACGGCCGCGTGGGNONE 
J075193L12GGACGGCCGCGTGGGNONE 
J080001M24GGACGGCCGCGTGGGNONE 
J080004E20GGACGGCCGCGTGGGNONE 
J080005K15GGACGGCCGCGTGGGNONE 
J080005L05GGACGGCCGCGTGGGNONE 
J080014P20GGACGGCCGCGTGGGNONE 
J080029D12GGACGGCCGCGTGGGNONE 
J080030H09GGACGGCCGCGTGGGNONE 
J080039G05GGACGGCCGCGTGGGNONE 
J080040E18GGACGGCCGCGTGGGNONE 
J080041B02GGACGGCCGCGTGGGNONE 
J080041E06GGACGGCCGCGTGGGNONE 
J080041G05GGACGGCCGCGTGGGNONE 
J080041G24GGACGGCCGCGTGGGNONE 
J080041H07GGACGGCCGCGTGGGNONE 
J080041K03GGACGGCCGCGTGGGNONE 
J080047G01GGACGGCCGCGTGGGNONE 
J080052E07GGACGGCCGCGTGGGNONE 
J080053B15GGACGGCCGCGTGGGNONE 
J080053N01GGACGGCCGCGTGGGNONE 
J080054I01GGACGGCCGCGTGGGNONE 
J080054N02GGACGGCCGCGTGGGNONE 
J080063P03GGACGGCCGCGTGGGNONE 
J080064E13GGACGGCCGCGTGGGNONE 
J080064G13GGACGGCCGCGTGGGNONE 
J080065F02GGACGGCCGCGTGGGNONE 
J080065G03GGACGGCCGCGTGGGNONE 
J080065K17GGACGGCCGCGTGGGNONE 
J080067D06GGACGGCCGCGTGGGNONE 
J080067H23GGACGGCCGCGTGGGNONE 
J080067M15GGACGGCCGCGTGGGNONE 
J080068B20GGACGGCCGCGTGGGNONE 
J080068G24GGACGGCCGCGTGGGNONE 
J080072K19GGACGGCCGCGTGGGNONE 
J080076I24GGACGGCCGCGTGGGNONE 
J080092F05GGACGGCCGCGTGGGNONE 
J080092K14GGACGGCCGCGTGGGNONE 
J080092N22GGACGGCCGCGTGGGNONE 
J080093K02GGACGGCCGCGTGGGNONE 
J080094C08GGACGGCCGCGTGGGNONE 
J080094E09GGACGGCCGCGTGGGNONE 
J080094E20GGACGGCCGCGTGGGNONE 
J080094G08GGACGGCCGCGTGGGNONE 
J080094H18GGACGGCCGCGTGGGNONE 
J080094P22GGACGGCCGCGTGGGNONE 
J080095J23GGACGGCCGCGTGGGNONE 
J080096F14GGACGGCCGCGTGGGNONE 
J080097A21GGACGGCCGCGTGGGNONE 
J080097I07GGACGGCCGCGTGGGNONE 
J080097J02GGACGGCCGCGTGGGNONE 
J080097K01GGACGGCCGCGTGGGNONE 
J080097K03GGACGGCCGCGTGGGNONE 
J080305H18GGACGGCCGCGTGGGNONE 
J080306G01GGACGGCCGCGTGGGNONE 
J080306O08GGACGGCCGCGTGGGNONE 
J080311I01GGACGGCCGCGTGGGNONE 
J080315N24GGACGGCCGCGTGGGNONE 
J090003K21GGACGGCCGCGTGGGNONE 
J090008C20GGACGGCCGCGTGGGNONE 
J090008K19GGACGGCCGCGTGGGNONE 
J090008P13GGACGGCCGCGTGGGNONE 
J090015H22GGACGGCCGCGTGGGNONE 
J090016M01GGACGGCCGCGTGGGNONE 
J090018E13GGACGGCCGCGTGGGNONE 
J090018G03GGACGGCCGCGTGGGNONE 
J090018L17GGACGGCCGCGTGGGNONE 
J090019H11GGACGGCCGCGTGGGNONE 
J090021B19GGACGGCCGCGTGGGNONE 
J090021K02GGACGGCCGCGTGGGNONE 
J090023H15GGACGGCCGCGTGGGNONE 
J090034E03GGACGGCCGCGTGGGNONE 
J090045D16GGACGGCCGCGTGGGNONE 
J090045I06GGACGGCCGCGTGGGNONE 
J090047L09GGACGGCCGCGTGGGNONE 
J090048B05GGACGGCCGCGTGGGNONE 
J090048D11GGACGGCCGCGTGGGNONE 
J090048N11GGACGGCCGCGTGGGNONE 
J090050F20GGACGGCCGCGTGGGNONE 
J090052M20GGACGGCCGCGTGGGNONE 
J090083H03GGACGGCCGCGTGGGNONE 
J090084C12GGACGGCCGCGTGGGNONE 
J090095B05GGACGGCCGCGTGGGNONE 
J090095M18GGACGGCCGCGTGGGNONE 
J100024I22GGACGGCCGCGTGGGNONE 
J100024J12GGACGGCCGCGTGGGNONE 
J100024J22GGACGGCCGCGTGGGNONE 
J100025F07GGACGGCCGCGTGGGNONE 
J100026B13GGACGGCCGCGTGGGNONE 
J100027N03GGACGGCCGCGTGGGNONE 
J100029F14GGACGGCCGCGTGGGNONE 
J100029L20GGACGGCCGCGTGGGNONE 
J100032C22GGACGGCCGCGTGGGNONE 
J100032I08GGACGGCCGCGTGGGNONE 
J100032O05GGACGGCCGCGTGGGNONE 
J100033J24GGACGGCCGCGTGGGNONE 
J100033L12GGACGGCCGCGTGGGNONE 
J100034K06GGACGGCCGCGTGGGNONE 
J100037D09GGACGGCCGCGTGGGNONE 
J100038H02GGACGGCCGCGTGGGNONE 
J100039A12GGACGGCCGCGTGGGNONE 
J100039N12GGACGGCCGCGTGGGNONE 
J100039O21GGACGGCCGCGTGGGNONE 
J100040K05GGACGGCCGCGTGGGNONE 
J100042A02GGACGGCCGCGTGGGNONE 
J100042A17GGACGGCCGCGTGGGNONE 
J100043C15GGACGGCCGCGTGGGNONE 
J100044A17GGACGGCCGCGTGGGNONE 
J100044E18GGACGGCCGCGTGGGNONE 
J100044I11GGACGGCCGCGTGGGNONE 
J100044J15GGACGGCCGCGTGGGNONE 
J100045E23GGACGGCCGCGTGGGNONE 
J100049B18GGACGGCCGCGTGGGNONE 
J100050G04GGACGGCCGCGTGGGNONE 
J100051D06GGACGGCCGCGTGGGNONE 
J100051H20GGACGGCCGCGTGGGNONE 
J100052J01GGACGGCCGCGTGGGNONE 
J100052K07GGACGGCCGCGTGGGNONE 
J100055I01GGACGGCCGCGTGGGNONE 
J100057D02GGACGGCCGCGTGGGNONE 
J100059G14GGACGGCCGCGTGGGNONE 
J100059G21GGACGGCCGCGTGGGNONE 
J100059H03GGACGGCCGCGTGGGNONE 
J100059H15GGACGGCCGCGTGGGNONE 
J100063E13GGACGGCCGCGTGGGNONE 
J100063M02GGACGGCCGCGTGGGNONE 
J100064B17GGACGGCCGCGTGGGNONE 
J100064F11GGACGGCCGCGTGGGNONE 
J100066G12GGACGGCCGCGTGGGNONE 
J100066H09GGACGGCCGCGTGGGNONE 
J100068B12GGACGGCCGCGTGGGNONE 
J100068L16GGACGGCCGCGTGGGNONE 
J100068M23GGACGGCCGCGTGGGNONE 
J100069A02GGACGGCCGCGTGGGNONE 
J100069D07GGACGGCCGCGTGGGNONE 
J100069M13GGACGGCCGCGTGGGNONE 
J100070C07GGACGGCCGCGTGGGNONE 
J100070J11GGACGGCCGCGTGGGNONE 
J100070L20GGACGGCCGCGTGGGNONE 
J100071H10GGACGGCCGCGTGGGNONE 
J100072L14GGACGGCCGCGTGGGNONE 
J100072N12GGACGGCCGCGTGGGNONE 
J100073A21GGACGGCCGCGTGGGNONE 
J100074K17GGACGGCCGCGTGGGNONE 
J100074M04GGACGGCCGCGTGGGNONE 
J100075F11GGACGGCCGCGTGGGNONE 
J100076E23GGACGGCCGCGTGGGNONE 
J100076G03GGACGGCCGCGTGGGNONE 
J100077K01GGACGGCCGCGTGGGNONE 
J100077N23GGACGGCCGCGTGGGNONE 
J100079H17GGACGGCCGCGTGGGNONE 
J100081N01GGACGGCCGCGTGGGNONE 
J100082E04GGACGGCCGCGTGGGNONE 
J100082K11GGACGGCCGCGTGGGNONE 
J100085H23GGACGGCCGCGTGGGNONE 
J100086O18GGACGGCCGCGTGGGNONE 
J100087F21GGACGGCCGCGTGGGNONE 
J100088E02GGACGGCCGCGTGGGNONE 
J100088F08GGACGGCCGCGTGGGNONE 
J100088G24GGACGGCCGCGTGGGNONE 
J100088K20GGACGGCCGCGTGGGNONE 
J100089B19GGACGGCCGCGTGGGNONE 
J100089K22GGACGGCCGCGTGGGNONE 
J100089N22GGACGGCCGCGTGGGNONE 
J100089O17GGACGGCCGCGTGGGNONE 
J100090N05GGACGGCCGCGTGGGNONE 
Os03g0684400AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
J080302F19GATCGGACGGCCCACGCNONE 
J080303J23GATCGGACGGCCCACGCNONE 
J080303K16GATCGGACGGCCCACGCNONE 
J080306B15GATCGGACGGCCCACGCNONE 
J080309C02GATCGGACGGCCCACGCNONE 
J080312F13GATCGGACGGCCCACGCNONE 
J080312M04GATCGGACGGCCCACGCNONE 
J080315L20GATCGGACGGCCCACGCNONE 
Os03g0743200J065049G14CGGACGGCCNONE 
J065158O18CGGACGGCCNONE 
Os03g0751100AK102404CGGACGGCCSimilar to Isp4 protein-like. 
Os03g0789800AK067287GGCCGTCCGNONE 
AK120138GGCCGTCCGHypothetical protein. 
J013027L14GGCCGTCCGNONE 
J065093P21GGCCGTCCGNONE 
J065173F10GGCCGTCCGNONE 
J065211G18GGCCGTCCGNONE 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0822800AK069263GGCCGTCCGATCNONE 
AK099592GGCCGTCCGATCSimilar to Chaperone protein dnaJ 1. 
J013043N03GGCCGTCCGATCNONE 
Os03g0844900AK100284GGACGGCCRNA binding S1 domain containing protein. 
J023075D13GGACGGCCNONE 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0270200006-099-F09ATCGGACGGCCNONE 
AK061854ATCGGACGGCCProtein of unknown function UPF0172 family protein. 
AK099002ATCGGACGGCCNONE 
J013110N19ATCGGACGGCCNONE 
J075054J19ATCGGACGGCCNONE 
Os04g0585100012-055-B08GGACGGCCCATGANONE 
AK105286GGACGGCCCATGAZinc finger, DHHC-type domain containing protein. 
Os04g0599900AK067675GGCCGTCCNONE 
AK121748GGCCGTCCSimilar to ENTH1 protein (Fragment). 
Os04g0602800AK100925GGCCGTCCGATCSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE 
Os04g0644100AK106954CGGACGGCCCAGATSterile alpha motif homology domain containing protein. 
Os04g0654700006-097-D06AATTGGGCCGTCCNONE 
013-016-H01AATTGGGCCGTCCNONE 
AB055495AATTGGGCCGTCCNONE 
AF072849AATTGGGCCGTCCNONE 
AK062107AATTGGGCCGTCCNONE 
AK099088AATTGGGCCGTCCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16AATTGGGCCGTCCNONE 
J013038J23AATTGGGCCGTCCNONE 
J013038L17AATTGGGCCGTCCNONE 
J013038N18AATTGGGCCGTCCNONE 
J013038O18AATTGGGCCGTCCNONE 
J013124A09AATTGGGCCGTCCNONE 
J023007N04AATTGGGCCGTCCNONE 
J033023C02AATTGGGCCGTCCNONE 
J033030M18AATTGGGCCGTCCNONE 
J033068I09AATTGGGCCGTCCNONE 
J033100E04AATTGGGCCGTCCNONE 
J065153E19AATTGGGCCGTCCNONE 
J065207I02AATTGGGCCGTCCNONE 
J075007A07AATTGGGCCGTCCNONE 
J075036M04AATTGGGCCGTCCNONE 
J075147I03AATTGGGCCGTCCNONE 
J075197L11AATTGGGCCGTCCNONE 
Os04g0663800013-021-G09GCCCGGCCGTCCNONE 
AK105321GCCCGGCCGTCCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0668700012-043-D01ATCTGGGCCGTCCNONE 
AK065237ATCTGGGCCGTCCPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
J013002G17ATCTGGGCCGTCCNONE 
J013002I02ATCTGGGCCGTCCNONE 
J013059C11ATCTGGGCCGTCCNONE 
J013059D22ATCTGGGCCGTCCNONE 
J013063G18ATCTGGGCCGTCCNONE 
J013088O04ATCTGGGCCGTCCNONE 
J013095K03ATCTGGGCCGTCCNONE 
J013096K15ATCTGGGCCGTCCNONE 
J013100O17ATCTGGGCCGTCCNONE 
J013102F10ATCTGGGCCGTCCNONE 
J013111L07ATCTGGGCCGTCCNONE 
J013127E24ATCTGGGCCGTCCNONE 
J013130A10ATCTGGGCCGTCCNONE 
J013134L13ATCTGGGCCGTCCNONE 
J023109G08ATCTGGGCCGTCCNONE 
J033022E17ATCTGGGCCGTCCNONE 
J033022N13ATCTGGGCCGTCCNONE 
J033026D04ATCTGGGCCGTCCNONE 
J033028M05ATCTGGGCCGTCCNONE 
J033037E04ATCTGGGCCGTCCNONE 
J033042D11ATCTGGGCCGTCCNONE 
J033044N20ATCTGGGCCGTCCNONE 
J033046K11ATCTGGGCCGTCCNONE 
J033046M21ATCTGGGCCGTCCNONE 
J033076E19ATCTGGGCCGTCCNONE 
J033076J24ATCTGGGCCGTCCNONE 
J033086N03ATCTGGGCCGTCCNONE 
J033095F22ATCTGGGCCGTCCNONE 
J033115F17ATCTGGGCCGTCCNONE 
J033117M06ATCTGGGCCGTCCNONE 
J033125D22ATCTGGGCCGTCCNONE 
J033129J10ATCTGGGCCGTCCNONE 
J033145E18ATCTGGGCCGTCCNONE 
J043021F24ATCTGGGCCGTCCNONE 
J053046G14ATCTGGGCCGTCCNONE 
J053090P03ATCTGGGCCGTCCNONE 
J065042N10ATCTGGGCCGTCCNONE 
J065053B13ATCTGGGCCGTCCNONE 
J065085G03ATCTGGGCCGTCCNONE 
J065173J11ATCTGGGCCGTCCNONE 
J090014M14ATCTGGGCCGTCCNONE 
J090027J07ATCTGGGCCGTCCNONE 
J090039E23ATCTGGGCCGTCCNONE 
J090051C15ATCTGGGCCGTCCNONE 
J090055H06ATCTGGGCCGTCCNONE 
J090062L03ATCTGGGCCGTCCNONE 
J100017L21ATCTGGGCCGTCCNONE 
J100024B07ATCTGGGCCGTCCNONE 
J100032G07ATCTGGGCCGTCCNONE 
J100040N09ATCTGGGCCGTCCNONE 
J100062N03ATCTGGGCCGTCCNONE 
J100078E07ATCTGGGCCGTCCNONE 
J100080E14ATCTGGGCCGTCCNONE 
J100084D07ATCTGGGCCGTCCNONE 
Os04g0677033J100048A06GGCCGTCCConserved hypothetical protein. 
Os04g0677400AK069563GGACGGCCNONE 
AK069752GGACGGCCProtein of unknown function DUF639 family protein. 
J023022G06GGACGGCCNONE 
J023030K02GGACGGCCNONE 
J023030L01GGACGGCCNONE 
Os05g0100500AK071466GATCGGACGGCCCAGGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0102000AK064690GGCCGTCCGSAM dependent carboxyl methyltransferase family protein. 
J065086M17GGCCGTCCGNONE 
J065128C12GGCCGTCCGNONE 
Os05g0161500AK058438GGACGGCCDNA polymerase III clamp loader subunit, C-terminal domain containing protein. 
Os05g0173500012-044-H03GGCCGTCCNONE 
AK103535GGCCGTCCNONE 
AK105434GGCCGTCCConserved hypothetical protein. 
J023014F19GGCCGTCCNONE 
J033064J08GGCCGTCCNONE 
J033132B04GGCCGTCCNONE 
J033133C01GGCCGTCCNONE 
J100090A17GGCCGTCCNONE 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0312500AK069307GGCCGTCCReticulon family protein. 
J023075D16GGCCGTCCNONE 
J023097K08GGCCGTCCNONE 
Os05g0328000AK107977GATCGGACGGCCConserved hypothetical protein. 
AK107977GGCCGTCCGATCConserved hypothetical protein. 
J065005I02GATCGGACGGCCNONE 
J065005I02GGCCGTCCGATCNONE 
J065049M05GATCGGACGGCCNONE 
J065049M05GGCCGTCCGATCNONE 
J080005F01GATCGGACGGCCNONE 
J080005F01GGCCGTCCGATCNONE 
J080005H15GATCGGACGGCCNONE 
J080005H15GGCCGTCCGATCNONE 
J080005K23GATCGGACGGCCNONE 
J080005K23GGCCGTCCGATCNONE 
J080007O03GATCGGACGGCCNONE 
J080007O03GGCCGTCCGATCNONE 
J080013H09GATCGGACGGCCNONE 
J080013H09GGCCGTCCGATCNONE 
J080024C02GATCGGACGGCCNONE 
J080024C02GGCCGTCCGATCNONE 
J080026M22GATCGGACGGCCNONE 
J080026M22GGCCGTCCGATCNONE 
J080029K21GATCGGACGGCCNONE 
J080029K21GGCCGTCCGATCNONE 
J080032K04GATCGGACGGCCNONE 
J080032K04GGCCGTCCGATCNONE 
J080034M16GATCGGACGGCCNONE 
J080034M16GGCCGTCCGATCNONE 
J080037G11GATCGGACGGCCNONE 
J080037G11GGCCGTCCGATCNONE 
J080040L01GATCGGACGGCCNONE 
J080040L01GGCCGTCCGATCNONE 
J080041D13GATCGGACGGCCNONE 
J080041D13GGCCGTCCGATCNONE 
J080043G20GATCGGACGGCCNONE 
J080043G20GGCCGTCCGATCNONE 
J080046H17GATCGGACGGCCNONE 
J080046H17GGCCGTCCGATCNONE 
J080048A05GATCGGACGGCCNONE 
J080048A05GGCCGTCCGATCNONE 
J080064C21GATCGGACGGCCNONE 
J080064C21GGCCGTCCGATCNONE 
J080067E15GATCGGACGGCCNONE 
J080067E15GGCCGTCCGATCNONE 
J080071P05GATCGGACGGCCNONE 
J080071P05GGCCGTCCGATCNONE 
J080074H16GATCGGACGGCCNONE 
J080074H16GGCCGTCCGATCNONE 
J080076A18GATCGGACGGCCNONE 
J080076A18GGCCGTCCGATCNONE 
J080076D20GATCGGACGGCCNONE 
J080076D20GGCCGTCCGATCNONE 
J080077J15GATCGGACGGCCNONE 
J080077J15GGCCGTCCGATCNONE 
J080085J11GATCGGACGGCCNONE 
J080085J11GGCCGTCCGATCNONE 
J080086E08GATCGGACGGCCNONE 
J080086E08GGCCGTCCGATCNONE 
J080088I23GATCGGACGGCCNONE 
J080088I23GGCCGTCCGATCNONE 
J080088I24GATCGGACGGCCNONE 
J080088I24GGCCGTCCGATCNONE 
J080089D05GATCGGACGGCCNONE 
J080089D05GGCCGTCCGATCNONE 
J080093B04GATCGGACGGCCNONE 
J080093B04GGCCGTCCGATCNONE 
J080093D07GATCGGACGGCCNONE 
J080093D07GGCCGTCCGATCNONE 
J080094A09GATCGGACGGCCNONE 
J080094A09GGCCGTCCGATCNONE 
J080096I12GATCGGACGGCCNONE 
J080096I12GGCCGTCCGATCNONE 
J080097L23GATCGGACGGCCNONE 
J080097L23GGCCGTCCGATCNONE 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0399300AK108949GGCCGTCCNONE 
Os05g0400700009-099-F02GGACGGCCNONE 
AK072739GGACGGCCSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC 2.7.7.6) (RNA polymerase II subunit 5). 
AK103913GGACGGCCNONE 
J023138C10GGACGGCCNONE 
Os05g0406800AK062566GGACGGCCNONE 
AK099640GGACGGCCLeucine rich repeat, N-terminal domain containing protein. 
J013060B14GGACGGCCNONE 
J090013F14GGACGGCCNONE 
J090062E13GGACGGCCNONE 
J090063D09GGACGGCCNONE 
J090075H10GGACGGCCNONE 
J090096E22GGACGGCCNONE 
Os05g0435700AK069677GGACGGCCSimilar to (3R)-hydroxymyristoyl-[acyl carrier protein] dehydratase (EC 4.2.1.-) ((3R)-hydroxymyristoyl ACP dehydrase). 
Os05g0455200AK063788GGACGGCCNONE 
Os05g0480700AK100850AACTGGGCCGTCCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AACTGGGCCGTCCNONE 
Os05g0498800AK109212GGCCGTCCNONE 
Os05g0522500AF372831GGCCGTCCNONE 
AK065207GGCCGTCCSimilar to Hexokinase 1 (EC 2.7.1.1). 
J013002F14GGCCGTCCNONE 
J013059E21GGCCGTCCNONE 
J023039E02GGCCGTCCNONE 
J023061P10GGCCGTCCNONE 
J023093D12GGCCGTCCNONE 
J023093H05GGCCGTCCNONE 
J033052F21GGCCGTCCNONE 
J043012F23GGCCGTCCNONE 
Os05g0547850009-102-F03CGGATCGGACGGCCNONE 
013-076-H08CGGATCGGACGGCCNONE 
AK058330CGGATCGGACGGCCNONE 
AK122158CGGATCGGACGGCCDNA-binding TFAR19-related protein family protein. 
AY626826CGGATCGGACGGCCNONE 
J043012O19CGGATCGGACGGCCNONE 
J043038O15CGGATCGGACGGCCNONE 
J053094L06CGGATCGGACGGCCNONE 
Os05g0586600AB096011GGCCGTCCGATPlastid sigma factor SIG5. 
AB096071GGCCGTCCGATNONE 
AK105697GGCCGTCCGATNONE 
Os05g0597100011-044-C10ATCGGACGGCCNONE 
011-044-C10GGACGGCCCAGCNONE 
AF255711ATCGGACGGCCNONE 
AF255711GGACGGCCCAGCNONE 
AK072845ATCGGACGGCCSimilar to Nucleolar histone deacetylase HD2-p39. 
AK072845GGACGGCCCAGCSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16ATCGGACGGCCNONE 
J023050H16GGACGGCCCAGCNONE 
J023135M22ATCGGACGGCCNONE 
J023135M22GGACGGCCCAGCNONE 
J023141B21ATCGGACGGCCNONE 
J023141B21GGACGGCCCAGCNONE 
J023142J09ATCGGACGGCCNONE 
J023142J09GGACGGCCCAGCNONE 
J033025E09ATCGGACGGCCNONE 
J033025E09GGACGGCCCAGCNONE 
J033111A20ATCGGACGGCCNONE 
J033111A20GGACGGCCCAGCNONE 
J033126I01ATCGGACGGCCNONE 
J033126I01GGACGGCCCAGCNONE 
Os06g0105900AK072638CCATGGGCCGTCCGConserved hypothetical protein. 
Os06g0152400AK064640ATCTGGGCCGTCCSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
J075086I24ATCTGGGCCGTCCNONE 
J075127E23ATCTGGGCCGTCCNONE 
J075157B19ATCTGGGCCGTCCNONE 
J090038E06ATCTGGGCCGTCCNONE 
Os06g0192000AK106844GGACGGCCConserved hypothetical protein. 
Os06g0264500AK120596CGGACGGCCTGF-beta receptor, type I/II extracellular region family protein. 
Os06g0571400011-027-C01ATCTCGGCCGTCCNONE 
011-027-C01CGGACGGCCNONE 
013-005-G03ATCTCGGCCGTCCNONE 
013-005-G03CGGACGGCCNONE 
015-053-G02ATCTCGGCCGTCCNONE 
015-053-G02CGGACGGCCNONE 
016-077-A05ATCTCGGCCGTCCNONE 
016-077-A05CGGACGGCCNONE 
AK068226ATCTCGGCCGTCCSimilar to Elongation factor 1 gamma-like protein (Fragment). 
AK068226CGGACGGCCSimilar to Elongation factor 1 gamma-like protein (Fragment). 
AK103928ATCTCGGCCGTCCNONE 
AK103928CGGACGGCCNONE 
AK104931ATCTCGGCCGTCCNONE 
AK104931CGGACGGCCNONE 
AY224444ATCTCGGCCGTCCNONE 
AY224444CGGACGGCCNONE 
J013044F14ATCTCGGCCGTCCNONE 
J013044F14CGGACGGCCNONE 
J013092L16ATCTCGGCCGTCCNONE 
J013092L16CGGACGGCCNONE 
J033028B03ATCTCGGCCGTCCNONE 
J033028B03CGGACGGCCNONE 
J033048B03ATCTCGGCCGTCCNONE 
J033048B03CGGACGGCCNONE 
J033065D21ATCTCGGCCGTCCNONE 
J033065D21CGGACGGCCNONE 
J033087A07ATCTCGGCCGTCCNONE 
J033087A07CGGACGGCCNONE 
J033108N12ATCTCGGCCGTCCNONE 
J033108N12CGGACGGCCNONE 
J033111G07ATCTCGGCCGTCCNONE 
J033111G07CGGACGGCCNONE 
J043009P12ATCTCGGCCGTCCNONE 
J043009P12CGGACGGCCNONE 
J075079P19ATCTCGGCCGTCCNONE 
J075079P19CGGACGGCCNONE 
J090056J24ATCTCGGCCGTCCNONE 
J090056J24CGGACGGCCNONE 
J090071D10ATCTCGGCCGTCCNONE 
J090071D10CGGACGGCCNONE 
Os06g0650100009-016-C02GGCCGTCCNONE 
AK062354GGCCGTCCSimilar to Polyubiquitin gene (Fragment). 
Os06g0677400AK064044GGACGGCCHydroxyacid dehydrogenase/reductase family protein. 
Os06g0702800009-039-E05GGACGGCCCATGANONE 
AK073948GGACGGCCCATGAHypothetical protein. 
J023108K23GGACGGCCCATGANONE 
J033072H04GGACGGCCCATGANONE 
J065008G05GGACGGCCCATGANONE 
J065128J12GGACGGCCCATGANONE 
J065131A01GGACGGCCCATGANONE 
J065173B12GGACGGCCCATGANONE 
Os06g0726400AF136268GGCCGTCCACGTGGCNONE 
AK065121GGCCGTCCACGTGGCNONE 
AK119436GGCCGTCCACGTGGCBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332GGCCGTCCACGTGGCNONE 
AY302112GGCCGTCCACGTGGCNONE 
D10752GGCCGTCCACGTGGCNONE 
D11082GGCCGTCCACGTGGCNONE 
J013031L12GGCCGTCCACGTGGCNONE 
J013042M09GGCCGTCCACGTGGCNONE 
J013058E01GGCCGTCCACGTGGCNONE 
J013058O09GGCCGTCCACGTGGCNONE 
J013063J17GGCCGTCCACGTGGCNONE 
J013066I24GGCCGTCCACGTGGCNONE 
J013069F17GGCCGTCCACGTGGCNONE 
J013106E01GGCCGTCCACGTGGCNONE 
J013118D19GGCCGTCCACGTGGCNONE 
J013162M11GGCCGTCCACGTGGCNONE 
J023028B19GGCCGTCCACGTGGCNONE 
J023031A13GGCCGTCCACGTGGCNONE 
J023047H18GGCCGTCCACGTGGCNONE 
J023059N10GGCCGTCCACGTGGCNONE 
J023104N22GGCCGTCCACGTGGCNONE 
J033025J03GGCCGTCCACGTGGCNONE 
J033045B05GGCCGTCCACGTGGCNONE 
J033067M08GGCCGTCCACGTGGCNONE 
J033113D04GGCCGTCCACGTGGCNONE 
J043003D11GGCCGTCCACGTGGCNONE 
J043009O20GGCCGTCCACGTGGCNONE 
J043016P06GGCCGTCCACGTGGCNONE 
J043017C21GGCCGTCCACGTGGCNONE 
J043017J20GGCCGTCCACGTGGCNONE 
J043021P15GGCCGTCCACGTGGCNONE 
J043026I22GGCCGTCCACGTGGCNONE 
J043032L15GGCCGTCCACGTGGCNONE 
J043034G14GGCCGTCCACGTGGCNONE 
J043039L16GGCCGTCCACGTGGCNONE 
J075003D02GGCCGTCCACGTGGCNONE 
J075003O22GGCCGTCCACGTGGCNONE 
J075005I24GGCCGTCCACGTGGCNONE 
J075006N09GGCCGTCCACGTGGCNONE 
J075011A22GGCCGTCCACGTGGCNONE 
J075012K24GGCCGTCCACGTGGCNONE 
J075017D01GGCCGTCCACGTGGCNONE 
J075017I23GGCCGTCCACGTGGCNONE 
J075023D17GGCCGTCCACGTGGCNONE 
J075024B03GGCCGTCCACGTGGCNONE 
J075025H05GGCCGTCCACGTGGCNONE 
J075031D19GGCCGTCCACGTGGCNONE 
J075034B02GGCCGTCCACGTGGCNONE 
J075035C02GGCCGTCCACGTGGCNONE 
J075037J12GGCCGTCCACGTGGCNONE 
J075038M11GGCCGTCCACGTGGCNONE 
J075039J17GGCCGTCCACGTGGCNONE 
J075042P10GGCCGTCCACGTGGCNONE 
J075046J20GGCCGTCCACGTGGCNONE 
J075047F21GGCCGTCCACGTGGCNONE 
J075053E05GGCCGTCCACGTGGCNONE 
J075054D11GGCCGTCCACGTGGCNONE 
J075054K06GGCCGTCCACGTGGCNONE 
J075059E15GGCCGTCCACGTGGCNONE 
J075061O04GGCCGTCCACGTGGCNONE 
J075062I20GGCCGTCCACGTGGCNONE 
J075066I12GGCCGTCCACGTGGCNONE 
J075066L06GGCCGTCCACGTGGCNONE 
J075071H12GGCCGTCCACGTGGCNONE 
J075071N19GGCCGTCCACGTGGCNONE 
J075074K01GGCCGTCCACGTGGCNONE 
J075077H22GGCCGTCCACGTGGCNONE 
J075083H18GGCCGTCCACGTGGCNONE 
J075085F04GGCCGTCCACGTGGCNONE 
J075085K09GGCCGTCCACGTGGCNONE 
J075086C06GGCCGTCCACGTGGCNONE 
J075086E06GGCCGTCCACGTGGCNONE 
J075087A15GGCCGTCCACGTGGCNONE 
J075090N02GGCCGTCCACGTGGCNONE 
J075090N22GGCCGTCCACGTGGCNONE 
J075091C04GGCCGTCCACGTGGCNONE 
J075091G16GGCCGTCCACGTGGCNONE 
J075097E04GGCCGTCCACGTGGCNONE 
J075099E04GGCCGTCCACGTGGCNONE 
J075102P22GGCCGTCCACGTGGCNONE 
J075109B08GGCCGTCCACGTGGCNONE 
J075109J02GGCCGTCCACGTGGCNONE 
J075115I12GGCCGTCCACGTGGCNONE 
J075117E17GGCCGTCCACGTGGCNONE 
J075123C07GGCCGTCCACGTGGCNONE 
J075124N05GGCCGTCCACGTGGCNONE 
J075125E12GGCCGTCCACGTGGCNONE 
J075126B11GGCCGTCCACGTGGCNONE 
J075129E14GGCCGTCCACGTGGCNONE 
J075130N15GGCCGTCCACGTGGCNONE 
J075131I07GGCCGTCCACGTGGCNONE 
J075141B13GGCCGTCCACGTGGCNONE 
J075141B20GGCCGTCCACGTGGCNONE 
J075144D23GGCCGTCCACGTGGCNONE 
J075144N01GGCCGTCCACGTGGCNONE 
J075147M24GGCCGTCCACGTGGCNONE 
J075148L16GGCCGTCCACGTGGCNONE 
J075151A22GGCCGTCCACGTGGCNONE 
J075151D03GGCCGTCCACGTGGCNONE 
J075151D04GGCCGTCCACGTGGCNONE 
J075153E23GGCCGTCCACGTGGCNONE 
J075156D02GGCCGTCCACGTGGCNONE 
J075156P05GGCCGTCCACGTGGCNONE 
J075162E23GGCCGTCCACGTGGCNONE 
J075165J22GGCCGTCCACGTGGCNONE 
J075166A06GGCCGTCCACGTGGCNONE 
J075168H13GGCCGTCCACGTGGCNONE 
J075170D04GGCCGTCCACGTGGCNONE 
J075171C19GGCCGTCCACGTGGCNONE 
J075173B12GGCCGTCCACGTGGCNONE 
J075173M23GGCCGTCCACGTGGCNONE 
J075174C03GGCCGTCCACGTGGCNONE 
J075185O11GGCCGTCCACGTGGCNONE 
J075186G21GGCCGTCCACGTGGCNONE 
J075187D06GGCCGTCCACGTGGCNONE 
J075195G21GGCCGTCCACGTGGCNONE 
J090003D18GGCCGTCCACGTGGCNONE 
J090005I12GGCCGTCCACGTGGCNONE 
J090007D15GGCCGTCCACGTGGCNONE 
J090007G20GGCCGTCCACGTGGCNONE 
J090014G13GGCCGTCCACGTGGCNONE 
J090014L08GGCCGTCCACGTGGCNONE 
J090016J03GGCCGTCCACGTGGCNONE 
J090023P22GGCCGTCCACGTGGCNONE 
J090025C19GGCCGTCCACGTGGCNONE 
J090028F11GGCCGTCCACGTGGCNONE 
J090028G01GGCCGTCCACGTGGCNONE 
J090028H02GGCCGTCCACGTGGCNONE 
J090037I11GGCCGTCCACGTGGCNONE 
J090040F21GGCCGTCCACGTGGCNONE 
J090040N24GGCCGTCCACGTGGCNONE 
J090044M12GGCCGTCCACGTGGCNONE 
J090045B13GGCCGTCCACGTGGCNONE 
J090045M22GGCCGTCCACGTGGCNONE 
J090048C10GGCCGTCCACGTGGCNONE 
J090051J02GGCCGTCCACGTGGCNONE 
J090058O15GGCCGTCCACGTGGCNONE 
J090062F11GGCCGTCCACGTGGCNONE 
J090067D23GGCCGTCCACGTGGCNONE 
J090069G15GGCCGTCCACGTGGCNONE 
J090072I06GGCCGTCCACGTGGCNONE 
J090073H18GGCCGTCCACGTGGCNONE 
J090073L01GGCCGTCCACGTGGCNONE 
J090075O21GGCCGTCCACGTGGCNONE 
J090084K24GGCCGTCCACGTGGCNONE 
J090087P11GGCCGTCCACGTGGCNONE 
J090092B17GGCCGTCCACGTGGCNONE 
J100042H08GGCCGTCCACGTGGCNONE 
Os07g0101500AK059667CGGGCCGTCCNONE 
AK071749CGGGCCGTCCSimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07CGGGCCGTCCNONE 
J065050F03CGGGCCGTCCNONE 
J090015C05CGGGCCGTCCNONE 
J090045C11CGGGCCGTCCNONE 
Os07g0121500J100066O17ATCTCGGCCGTCCNONE 
Os07g0142900003-001-H01ATTTGGGCCGTCCNONE 
AK060737ATTTGGGCCGTCCAldo/keto reductase family protein. 
AK064848ATTTGGGCCGTCCNONE 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319GATCGGACGGCCCAGATNONE 
Os07g0507300015-011-B09GGCCGTCCNONE 
AK102538GGCCGTCCSimilar to GCK-like kinase MIK. 
AK106514GGCCGTCCNONE 
J033033M12GGCCGTCCNONE 
J033044C06GGCCGTCCNONE 
J033129B15GGCCGTCCNONE 
Os07g0563700AK121078GGACGGCCCAGATIKI3 family protein. 
Os07g0586000AK069212ATCGGACGGCCCConserved hypothetical protein. 
Os07g0606600AK111621CGGACGGCCNONE 
AK112118CGGACGGCCSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22CGGACGGCCNONE 
Os07g0681500AK103662GATCGGACGGCCCAGATNONE 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os08g0104600005-006-A07GGACGGCCNONE 
006-083-A08GGACGGCCNONE 
009-022-C08GGACGGCCNONE 
009-027-A01GGACGGCCNONE 
009-030-E07GGACGGCCNONE 
009-042-H08GGACGGCCNONE 
009-048-E08GGACGGCCNONE 
009-051-F07GGACGGCCNONE 
009-051-H06GGACGGCCNONE 
009-054-E02GGACGGCCNONE 
009-084-D01GGACGGCCNONE 
009-089-A03GGACGGCCNONE 
009-105-H12GGACGGCCNONE 
009-109-D02GGACGGCCNONE 
009-110-H12GGACGGCCNONE 
009-117-A05GGACGGCCNONE 
009-117-C08GGACGGCCNONE 
009-118-F09GGACGGCCNONE 
009-119-E03GGACGGCCNONE 
009-122-G10GGACGGCCNONE 
009-125-H06GGACGGCCNONE 
009-126-A06GGACGGCCNONE 
009-127-H02GGACGGCCNONE 
009-128-B09GGACGGCCNONE 
009-129-B09GGACGGCCNONE 
009-130-D05GGACGGCCNONE 
009-130-D08GGACGGCCNONE 
009-139-D08GGACGGCCNONE 
009-149-D07GGACGGCCNONE 
009-150-C04GGACGGCCNONE 
009-154-E03GGACGGCCNONE 
009-155-C06GGACGGCCNONE 
009-165-B08GGACGGCCNONE 
009-167-C06GGACGGCCNONE 
009-181-H11GGACGGCCNONE 
009-191-F03GGACGGCCNONE 
009-192-C06GGACGGCCNONE 
009-195-F03GGACGGCCNONE 
009-196-G08GGACGGCCNONE 
009-197-D08GGACGGCCNONE 
014-052-E10GGACGGCCNONE 
AF010320GGACGGCCNONE 
AK061654GGACGGCCNONE 
AK119206GGACGGCCNONE 
AK119709GGACGGCCNONE 
AK120393GGACGGCCFerredoxin I, chloroplast precursor (Anti-disease protein 1). 
AY072818GGACGGCCNONE 
D30763GGACGGCCNONE 
J013043A04GGACGGCCNONE 
J013058K06GGACGGCCNONE 
J013059G01GGACGGCCNONE 
J013067N20GGACGGCCNONE 
J013074D04GGACGGCCNONE 
J013075A06GGACGGCCNONE 
J013093N12GGACGGCCNONE 
J013094P22GGACGGCCNONE 
J013119N05GGACGGCCNONE 
J013120G18GGACGGCCNONE 
J013129G02GGACGGCCNONE 
J013129P10GGACGGCCNONE 
J013159F22GGACGGCCNONE 
J013160D20GGACGGCCNONE 
J013160E23GGACGGCCNONE 
J023034F18GGACGGCCNONE 
J023048F04GGACGGCCNONE 
J023048O08GGACGGCCNONE 
J023049B18GGACGGCCNONE 
J023061A17GGACGGCCNONE 
J023072A03GGACGGCCNONE 
J023085A16GGACGGCCNONE 
J023087L09GGACGGCCNONE 
J043012O13GGACGGCCNONE 
J065038A14GGACGGCCNONE 
J065187M18GGACGGCCNONE 
J065205M17GGACGGCCNONE 
J080301G10GGACGGCCNONE 
J080311I12GGACGGCCNONE 
J080311O19GGACGGCCNONE 
J080312C16GGACGGCCNONE 
J080317L04GGACGGCCNONE 
J090027H09GGACGGCCNONE 
J090053F07GGACGGCCNONE 
J090055C23GGACGGCCNONE 
J090071A18GGACGGCCNONE 
J090084O10GGACGGCCNONE 
J090091C23GGACGGCCNONE 
J090093J04GGACGGCCNONE 
J100061N06GGACGGCCNONE 
J100070P06GGACGGCCNONE 
J100074K15GGACGGCCNONE 
Os08g0187700AK099689GATCGGACGGCCGAGAGCCCATCARegulation of nuclear pre-mRNA protein domain containing protein. 
Os08g0192800AK059490ATCTGGGCCGTCCGATCNONE 
AK101678ATCTGGGCCGTCCGATCNONE 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
J080039B22ATCTGGGCCGTCCGATCNONE 
J080039I23ATCTGGGCCGTCCGATCNONE 
J080074D19ATCTGGGCCGTCCGATCNONE 
J080086N13ATCTGGGCCGTCCGATCNONE 
Os08g0224200AK101331CGGACGGCCCGGTSimilar to Ythdf2-prov protein. 
Os08g0234400J065186B17GGCCGTCCACGTGGCCCAGCConserved hypothetical protein. 
Os08g0270900AK108117GGACGGCCConserved hypothetical protein. 
Os08g0290500004-010-C07GGCCGTCCACGTGTCCNONE 
009-111-A08GGCCGTCCACGTGTCCNONE 
011-046-F10GGCCGTCCACGTGTCCNONE 
AK066894GGCCGTCCACGTGTCCNONE 
AK067122GGCCGTCCACGTGTCCNONE 
AK102868GGCCGTCCACGTGTCCSimilar to AF-10 protein. 
J013089O21GGCCGTCCACGTGTCCNONE 
J033072D17GGCCGTCCACGTGTCCNONE 
J033095M14GGCCGTCCACGTGTCCNONE 
J033111N23GGCCGTCCACGTGTCCNONE 
J043024M17GGCCGTCCACGTGTCCNONE 
J065176I24GGCCGTCCACGTGTCCNONE 
J090035C05GGCCGTCCACGTGTCCNONE 
Os08g0299000AK061379CGGACGGCCNONE 
AK099389CGGACGGCCNONE 
AK101640CGGACGGCCProtein of unknown function DUF52 domain containing protein. 
J013100G13CGGACGGCCNONE 
J013153N09CGGACGGCCNONE 
J023097N06CGGACGGCCNONE 
J023123C12CGGACGGCCNONE 
J033088G14CGGACGGCCNONE 
J065033G10CGGACGGCCNONE 
J065128B01CGGACGGCCNONE 
J100085I01CGGACGGCCNONE 
Os08g0425000AK105302GCCGGGCCGTCCConserved hypothetical protein. 
Os08g0435900003-113-D09GGCCGTCCGATCNONE 
003-131-A04GGCCGTCCGATCNONE 
006-021-D09GGCCGTCCGATCNONE 
006-023-F09GGCCGTCCGATCNONE 
006-024-H07GGCCGTCCGATCNONE 
006-025-F06GGCCGTCCGATCNONE 
006-025-H01GGCCGTCCGATCNONE 
006-025-H10GGCCGTCCGATCNONE 
006-026-A07GGCCGTCCGATCNONE 
006-026-E01GGCCGTCCGATCNONE 
006-026-F04GGCCGTCCGATCNONE 
006-027-A01GGCCGTCCGATCNONE 
006-029-H01GGCCGTCCGATCNONE 
006-030-D02GGCCGTCCGATCNONE 
006-032-C03GGCCGTCCGATCNONE 
006-034-C02GGCCGTCCGATCNONE 
006-035-H10GGCCGTCCGATCNONE 
006-039-C01GGCCGTCCGATCNONE 
006-039-H08GGCCGTCCGATCNONE 
006-040-D09GGCCGTCCGATCNONE 
006-040-F05GGCCGTCCGATCNONE 
006-044-D04GGCCGTCCGATCNONE 
006-044-F09GGCCGTCCGATCNONE 
006-044-G05GGCCGTCCGATCNONE 
006-045-C06GGCCGTCCGATCNONE 
006-046-B04GGCCGTCCGATCNONE 
006-047-D03GGCCGTCCGATCNONE 
006-048-C10GGCCGTCCGATCNONE 
006-048-D10GGCCGTCCGATCNONE 
006-050-H01GGCCGTCCGATCNONE 
006-051-D12GGCCGTCCGATCNONE 
006-053-B05GGCCGTCCGATCNONE 
006-054-B12GGCCGTCCGATCNONE 
006-054-E05GGCCGTCCGATCNONE 
006-054-H06GGCCGTCCGATCNONE 
006-056-H02GGCCGTCCGATCNONE 
006-059-A07GGCCGTCCGATCNONE 
006-059-G02GGCCGTCCGATCNONE 
006-059-G12GGCCGTCCGATCNONE 
006-061-F01GGCCGTCCGATCNONE 
006-061-H10GGCCGTCCGATCNONE 
006-063-B02GGCCGTCCGATCNONE 
006-064-H12GGCCGTCCGATCNONE 
006-068-D06GGCCGTCCGATCNONE 
006-071-H08GGCCGTCCGATCNONE 
006-072-E10GGCCGTCCGATCNONE 
006-074-C06GGCCGTCCGATCNONE 
006-074-D12GGCCGTCCGATCNONE 
006-076-H06GGCCGTCCGATCNONE 
006-077-E04GGCCGTCCGATCNONE 
006-081-H01GGCCGTCCGATCNONE 
006-082-E11GGCCGTCCGATCNONE 
006-083-G10GGCCGTCCGATCNONE 
006-084-B05GGCCGTCCGATCNONE 
006-085-C06GGCCGTCCGATCNONE 
006-088-C04GGCCGTCCGATCNONE 
006-088-F11GGCCGTCCGATCNONE 
006-088-H11GGCCGTCCGATCNONE 
006-090-F06GGCCGTCCGATCNONE 
006-091-B01GGCCGTCCGATCNONE 
006-091-C10GGCCGTCCGATCNONE 
006-091-G11GGCCGTCCGATCNONE 
006-092-A11GGCCGTCCGATCNONE 
006-092-F10GGCCGTCCGATCNONE 
006-093-D01GGCCGTCCGATCNONE 
006-093-E11GGCCGTCCGATCNONE 
006-095-F09GGCCGTCCGATCNONE 
006-096-B05GGCCGTCCGATCNONE 
006-096-B06GGCCGTCCGATCNONE 
006-096-B11GGCCGTCCGATCNONE 
006-099-E04GGCCGTCCGATCNONE 
006-100-A01GGCCGTCCGATCNONE 
006-100-E04GGCCGTCCGATCNONE 
006-104-B09GGCCGTCCGATCNONE 
006-106-A09GGCCGTCCGATCNONE 
006-107-C07GGCCGTCCGATCNONE 
006-107-H03GGCCGTCCGATCNONE 
006-109-B12GGCCGTCCGATCNONE 
006-109-F10GGCCGTCCGATCNONE 
006-110-C10GGCCGTCCGATCNONE 
006-110-E09GGCCGTCCGATCNONE 
006-114-H07GGCCGTCCGATCNONE 
006-115-A06GGCCGTCCGATCNONE 
006-115-A12GGCCGTCCGATCNONE 
006-115-C10GGCCGTCCGATCNONE 
006-115-D10GGCCGTCCGATCNONE 
006-116-D02GGCCGTCCGATCNONE 
006-117-C11GGCCGTCCGATCNONE 
006-119-H09GGCCGTCCGATCNONE 
009-008-B04GGCCGTCCGATCNONE 
009-021-A04GGCCGTCCGATCNONE 
009-026-H09GGCCGTCCGATCNONE 
009-027-D10GGCCGTCCGATCNONE 
009-030-B11GGCCGTCCGATCNONE 
009-040-E08GGCCGTCCGATCNONE 
009-049-E10GGCCGTCCGATCNONE 
009-058-C12GGCCGTCCGATCNONE 
009-061-G01GGCCGTCCGATCNONE 
009-079-G09GGCCGTCCGATCNONE 
009-081-F08GGCCGTCCGATCNONE 
009-096-F04GGCCGTCCGATCNONE 
009-103-D05GGCCGTCCGATCNONE 
009-119-F08GGCCGTCCGATCNONE 
009-123-B02GGCCGTCCGATCNONE 
009-128-H11GGCCGTCCGATCNONE 
009-131-B06GGCCGTCCGATCNONE 
009-142-H06GGCCGTCCGATCNONE 
009-156-C01GGCCGTCCGATCNONE 
009-165-D02GGCCGTCCGATCNONE 
009-168-G10GGCCGTCCGATCNONE 
009-175-F03GGCCGTCCGATCNONE 
009-178-E06GGCCGTCCGATCNONE 
009-179-G04GGCCGTCCGATCNONE 
009-181-C10GGCCGTCCGATCNONE 
009-182-D09GGCCGTCCGATCNONE 
009-183-D07GGCCGTCCGATCNONE 
AF094775GGCCGTCCGATCNONE 
AK060222GGCCGTCCGATCSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
AK067712GGCCGTCCGATCNONE 
AK067809GGCCGTCCGATCNONE 
AK103921GGCCGTCCGATCNONE 
AK104416GGCCGTCCGATCNONE 
AK104499GGCCGTCCGATCNONE 
AY445626GGCCGTCCGATCNONE 
J013120H04GGCCGTCCGATCNONE 
J013121A03GGCCGTCCGATCNONE 
J013127D22GGCCGTCCGATCNONE 
J023088A04GGCCGTCCGATCNONE 
J023132O20GGCCGTCCGATCNONE 
J053026I18GGCCGTCCGATCNONE 
J053032G14GGCCGTCCGATCNONE 
J053055E21GGCCGTCCGATCNONE 
J053070F24GGCCGTCCGATCNONE 
J065034E08GGCCGTCCGATCNONE 
J065085O17GGCCGTCCGATCNONE 
J065156H20GGCCGTCCGATCNONE 
J065171C21GGCCGTCCGATCNONE 
J065173A20GGCCGTCCGATCNONE 
J065173C02GGCCGTCCGATCNONE 
J065182N01GGCCGTCCGATCNONE 
J075001K11GGCCGTCCGATCNONE 
J075002K18GGCCGTCCGATCNONE 
J075005P06GGCCGTCCGATCNONE 
J075006P21GGCCGTCCGATCNONE 
J075008G02GGCCGTCCGATCNONE 
J075009D08GGCCGTCCGATCNONE 
J075013D09GGCCGTCCGATCNONE 
J075013D15GGCCGTCCGATCNONE 
J075016F05GGCCGTCCGATCNONE 
J075016F18GGCCGTCCGATCNONE 
J075016K07GGCCGTCCGATCNONE 
J075016M08GGCCGTCCGATCNONE 
J075021G21GGCCGTCCGATCNONE 
J075025G06GGCCGTCCGATCNONE 
J075029M11GGCCGTCCGATCNONE 
J075035E01GGCCGTCCGATCNONE 
J075038M21GGCCGTCCGATCNONE 
J075039G20GGCCGTCCGATCNONE 
J075040K18GGCCGTCCGATCNONE 
J075041G13GGCCGTCCGATCNONE 
J075042O03GGCCGTCCGATCNONE 
J075047C01GGCCGTCCGATCNONE 
J075047M08GGCCGTCCGATCNONE 
J075052L02GGCCGTCCGATCNONE 
J075055E24GGCCGTCCGATCNONE 
J075056F22GGCCGTCCGATCNONE 
J075068B12GGCCGTCCGATCNONE 
J075068D01GGCCGTCCGATCNONE 
J075069H19GGCCGTCCGATCNONE 
J075071J21GGCCGTCCGATCNONE 
J075072O06GGCCGTCCGATCNONE 
J075075J05GGCCGTCCGATCNONE 
J075079E21GGCCGTCCGATCNONE 
J075079H05GGCCGTCCGATCNONE 
J075081L10GGCCGTCCGATCNONE 
J075087D17GGCCGTCCGATCNONE 
J075088B07GGCCGTCCGATCNONE 
J075088D22GGCCGTCCGATCNONE 
J075090E03GGCCGTCCGATCNONE 
J075095L09GGCCGTCCGATCNONE 
J075098G08GGCCGTCCGATCNONE 
J075099M10GGCCGTCCGATCNONE 
J075101D01GGCCGTCCGATCNONE 
J075102H24GGCCGTCCGATCNONE 
J075103A05GGCCGTCCGATCNONE 
J075106A15GGCCGTCCGATCNONE 
J075106L10GGCCGTCCGATCNONE 
J075108H11GGCCGTCCGATCNONE 
J075110D12GGCCGTCCGATCNONE 
J075114A06GGCCGTCCGATCNONE 
J075116G16GGCCGTCCGATCNONE 
J075118B13GGCCGTCCGATCNONE 
J075119C20GGCCGTCCGATCNONE 
J075122F24GGCCGTCCGATCNONE 
J075129D14GGCCGTCCGATCNONE 
J075132L06GGCCGTCCGATCNONE 
J075133E22GGCCGTCCGATCNONE 
J075140L09GGCCGTCCGATCNONE 
J075140L24GGCCGTCCGATCNONE 
J075146J17GGCCGTCCGATCNONE 
J075148A09GGCCGTCCGATCNONE 
J075152D01GGCCGTCCGATCNONE 
J075153L22GGCCGTCCGATCNONE 
J075156B08GGCCGTCCGATCNONE 
J075158D24GGCCGTCCGATCNONE 
J075158H14GGCCGTCCGATCNONE 
J075167M07GGCCGTCCGATCNONE 
J075172F21GGCCGTCCGATCNONE 
J075175J15GGCCGTCCGATCNONE 
J075183C13GGCCGTCCGATCNONE 
J075190A08GGCCGTCCGATCNONE 
J075190E08GGCCGTCCGATCNONE 
J075190H21GGCCGTCCGATCNONE 
J075194C13GGCCGTCCGATCNONE 
J075195E18GGCCGTCCGATCNONE 
J075197H09GGCCGTCCGATCNONE 
J075199J01GGCCGTCCGATCNONE 
J080310L13GGCCGTCCGATCNONE 
J080311F02GGCCGTCCGATCNONE 
J080311H17GGCCGTCCGATCNONE 
J080315M04GGCCGTCCGATCNONE 
J080316A09GGCCGTCCGATCNONE 
J080319D20GGCCGTCCGATCNONE 
J080319L04GGCCGTCCGATCNONE 
J090002C14GGCCGTCCGATCNONE 
J090031P04GGCCGTCCGATCNONE 
J090050E09GGCCGTCCGATCNONE 
J100048H01GGCCGTCCGATCNONE 
J100089C18GGCCGTCCGATCNONE 
Os08g0561700006-031-C10GGACGGCCNONE 
006-032-H01GGACGGCCNONE 
006-034-C07GGACGGCCNONE 
006-045-D02GGACGGCCNONE 
006-055-G12GGACGGCCNONE 
006-057-B02GGACGGCCNONE 
006-068-E11GGACGGCCNONE 
006-080-D02GGACGGCCNONE 
006-090-G07GGACGGCCNONE 
006-105-E11GGACGGCCNONE 
006-106-F06GGACGGCCNONE 
009-149-C08GGACGGCCNONE 
014-099-A06GGACGGCCNONE 
AK059841GGACGGCCSuperoxide dismutase [Cu-Zn], chloroplast precursor (EC 1.15.1.1). 
AK068627GGACGGCCNONE 
AK104013GGACGGCCNONE 
AK104240GGACGGCCNONE 
D85239GGACGGCCNONE 
J013154J21GGACGGCCNONE 
J090081C20GGACGGCCNONE 
J100040J21GGACGGCCNONE 
Os09g0281800AK105291GGACGGCCCAGATConserved hypothetical protein. 
Os09g0322000AK102510GGCCGTCCNONE 
J033095G20GGCCGTCCNONE 
J080047F09GGCCGTCCNONE 
J080049H12GGCCGTCCNONE 
J080052H10GGCCGTCCNONE 
J080064K23GGCCGTCCNONE 
Os09g0325700011-041-G03GGACGGCCCGGANONE 
AK063334GGACGGCCCGGASimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24GGACGGCCCGGANONE 
Os09g0381100AK064905GGACGGCCNONE 
AK121778GGACGGCCXanthine/uracil/vitamin C permease family protein. 
J013000L20GGACGGCCNONE 
J033113A02GGACGGCCNONE 
J090050N04GGACGGCCNONE 
Os09g0434200AK062015GGACGGCCCAGTANONE 
AK103447GGACGGCCCAGTAZinc finger, RING-type domain containing protein. 
Os09g0465500AK109671ACACGTGGCCGTCCConserved hypothetical protein. 
Os09g0467700AK061600GGGCCGTCCGATCConserved hypothetical protein. 
Os09g0468900AK120990GCTGGGCCGTCCConserved hypothetical protein. 
J013123P13GCTGGGCCGTCCNONE 
J023013I09GCTGGGCCGTCCNONE 
J023023G08GCTGGGCCGTCCNONE 
J023043E08GCTGGGCCGTCCNONE 
J033124D24GCTGGGCCGTCCNONE 
J065047I07GCTGGGCCGTCCNONE 
J065093C16GCTGGGCCGTCCNONE 
J090088O03GCTGGGCCGTCCNONE 
J100032M21GCTGGGCCGTCCNONE 
Os09g0477700AK121644GGCCGTCCConserved hypothetical protein. 
Os09g0480600AK107853ATCTGGGCCGTCCHypothetical protein. 
Os09g0482660AK106911GGACGGCCSimilar to Subtilisin-type protease. 
Os09g0559800AK071542GTTGGGCCTGGACGGCCCATGGSimilar to Transporter-like protein. 
J013063N24GTTGGGCCTGGACGGCCCATGGNONE 
Os11g0557700AK071694ATCTCGGCCGTCCNONE 
AK107593ATCTCGGCCGTCCSAM (and some other nucleotide) binding motif domain containing protein. 
J023108E23ATCTCGGCCGTCCNONE 
Os11g0586300AK072257GGACGGCCCAAATConserved hypothetical protein. 
Os11g0620400AK068224ATCGGACGGCCCACGTNONE 
AK120270ATCGGACGGCCCACGTConserved hypothetical protein. 
Os11g0660500009-031-D10ATCTGGGCCGTCCNONE 
009-031-D10GATCGGACGGCCNONE 
009-100-G09ATCTGGGCCGTCCNONE 
009-100-G09GATCGGACGGCCNONE 
009-162-G10ATCTGGGCCGTCCNONE 
009-162-G10GATCGGACGGCCNONE 
009-183-H11ATCTGGGCCGTCCNONE 
009-183-H11GATCGGACGGCCNONE 
013-010-B11ATCTGGGCCGTCCNONE 
013-010-B11GATCGGACGGCCNONE 
013-050-A05ATCTGGGCCGTCCNONE 
013-050-A05GATCGGACGGCCNONE 
013-070-E10ATCTGGGCCGTCCNONE 
013-070-E10GATCGGACGGCCNONE 
AK105453ATCTGGGCCGTCCSimilar to Translationally controlled tumor protein (Fragment). 
AK105453GATCGGACGGCCSimilar to Translationally controlled tumor protein (Fragment). 
D12626ATCTGGGCCGTCCNONE 
D12626GATCGGACGGCCNONE 
J013128M15ATCTGGGCCGTCCNONE 
J013128M15GATCGGACGGCCNONE 
J023004I19ATCTGGGCCGTCCNONE 
J023004I19GATCGGACGGCCNONE 
J033114F08ATCTGGGCCGTCCNONE 
J033114F08GATCGGACGGCCNONE 
J033147I20ATCTGGGCCGTCCNONE 
J033147I20GATCGGACGGCCNONE 
J065031M04ATCTGGGCCGTCCNONE 
J065031M04GATCGGACGGCCNONE 
J065033J03ATCTGGGCCGTCCNONE 
J065033J03GATCGGACGGCCNONE 
J065038E01ATCTGGGCCGTCCNONE 
J065038E01GATCGGACGGCCNONE 
J065048O06ATCTGGGCCGTCCNONE 
J065048O06GATCGGACGGCCNONE 
J065054E01ATCTGGGCCGTCCNONE 
J065054E01GATCGGACGGCCNONE 
J065075N08ATCTGGGCCGTCCNONE 
J065075N08GATCGGACGGCCNONE 
J065080C07ATCTGGGCCGTCCNONE 
J065080C07GATCGGACGGCCNONE 
J065096A12ATCTGGGCCGTCCNONE 
J065096A12GATCGGACGGCCNONE 
J065115P22ATCTGGGCCGTCCNONE 
J065115P22GATCGGACGGCCNONE 
J065122I21ATCTGGGCCGTCCNONE 
J065122I21GATCGGACGGCCNONE 
J065127A13ATCTGGGCCGTCCNONE 
J065127A13GATCGGACGGCCNONE 
J065158B06ATCTGGGCCGTCCNONE 
J065158B06GATCGGACGGCCNONE 
J065162E04ATCTGGGCCGTCCNONE 
J065162E04GATCGGACGGCCNONE 
J065162E05ATCTGGGCCGTCCNONE 
J065162E05GATCGGACGGCCNONE 
J065163L06ATCTGGGCCGTCCNONE 
J065163L06GATCGGACGGCCNONE 
J065177B16ATCTGGGCCGTCCNONE 
J065177B16GATCGGACGGCCNONE 
J065181M15ATCTGGGCCGTCCNONE 
J065181M15GATCGGACGGCCNONE 
J065201G15ATCTGGGCCGTCCNONE 
J065201G15GATCGGACGGCCNONE 
J065202J06ATCTGGGCCGTCCNONE 
J065202J06GATCGGACGGCCNONE 
J075002B19ATCTGGGCCGTCCNONE 
J075002B19GATCGGACGGCCNONE 
J075008G19ATCTGGGCCGTCCNONE 
J075008G19GATCGGACGGCCNONE 
J075010P05ATCTGGGCCGTCCNONE 
J075010P05GATCGGACGGCCNONE 
J075018H23ATCTGGGCCGTCCNONE 
J075018H23GATCGGACGGCCNONE 
J075051E18ATCTGGGCCGTCCNONE 
J075051E18GATCGGACGGCCNONE 
J075053C24ATCTGGGCCGTCCNONE 
J075053C24GATCGGACGGCCNONE 
J075077B06ATCTGGGCCGTCCNONE 
J075077B06GATCGGACGGCCNONE 
J075080B11ATCTGGGCCGTCCNONE 
J075080B11GATCGGACGGCCNONE 
J075083M04ATCTGGGCCGTCCNONE 
J075083M04GATCGGACGGCCNONE 
J075085H01ATCTGGGCCGTCCNONE 
J075085H01GATCGGACGGCCNONE 
J075109E11ATCTGGGCCGTCCNONE 
J075109E11GATCGGACGGCCNONE 
J075111O09ATCTGGGCCGTCCNONE 
J075111O09GATCGGACGGCCNONE 
J075130D13ATCTGGGCCGTCCNONE 
J075130D13GATCGGACGGCCNONE 
J075132H13ATCTGGGCCGTCCNONE 
J075132H13GATCGGACGGCCNONE 
J075147H19ATCTGGGCCGTCCNONE 
J075147H19GATCGGACGGCCNONE 
J075148J01ATCTGGGCCGTCCNONE 
J075148J01GATCGGACGGCCNONE 
J075159A18ATCTGGGCCGTCCNONE 
J075159A18GATCGGACGGCCNONE 
J075166F03ATCTGGGCCGTCCNONE 
J075166F03GATCGGACGGCCNONE 
J075191F09ATCTGGGCCGTCCNONE 
J075191F09GATCGGACGGCCNONE 
J075192K09ATCTGGGCCGTCCNONE 
J075192K09GATCGGACGGCCNONE 
J080006P15ATCTGGGCCGTCCNONE 
J080006P15GATCGGACGGCCNONE 
J080013J18ATCTGGGCCGTCCNONE 
J080013J18GATCGGACGGCCNONE 
J080023O06ATCTGGGCCGTCCNONE 
J080023O06GATCGGACGGCCNONE 
J080024I17ATCTGGGCCGTCCNONE 
J080024I17GATCGGACGGCCNONE 
J080029P03ATCTGGGCCGTCCNONE 
J080029P03GATCGGACGGCCNONE 
J080030C14ATCTGGGCCGTCCNONE 
J080030C14GATCGGACGGCCNONE 
J080038K15ATCTGGGCCGTCCNONE 
J080038K15GATCGGACGGCCNONE 
J080042I15ATCTGGGCCGTCCNONE 
J080042I15GATCGGACGGCCNONE 
J080053L07ATCTGGGCCGTCCNONE 
J080053L07GATCGGACGGCCNONE 
J080061H12ATCTGGGCCGTCCNONE 
J080061H12GATCGGACGGCCNONE 
J080064H24ATCTGGGCCGTCCNONE 
J080064H24GATCGGACGGCCNONE 
J080066J20ATCTGGGCCGTCCNONE 
J080066J20GATCGGACGGCCNONE 
J080074N07ATCTGGGCCGTCCNONE 
J080074N07GATCGGACGGCCNONE 
J080079F16ATCTGGGCCGTCCNONE 
J080079F16GATCGGACGGCCNONE 
J080079O07ATCTGGGCCGTCCNONE 
J080079O07GATCGGACGGCCNONE 
J080092E15ATCTGGGCCGTCCNONE 
J080092E15GATCGGACGGCCNONE 
J080301F19ATCTGGGCCGTCCNONE 
J080301F19GATCGGACGGCCNONE 
J080302O21ATCTGGGCCGTCCNONE 
J080302O21GATCGGACGGCCNONE 
J080306L02ATCTGGGCCGTCCNONE 
J080306L02GATCGGACGGCCNONE 
J080307F16ATCTGGGCCGTCCNONE 
J080307F16GATCGGACGGCCNONE 
J080307G01ATCTGGGCCGTCCNONE 
J080307G01GATCGGACGGCCNONE 
J080307K01ATCTGGGCCGTCCNONE 
J080307K01GATCGGACGGCCNONE 
J080309O22ATCTGGGCCGTCCNONE 
J080309O22GATCGGACGGCCNONE 
J080311E17ATCTGGGCCGTCCNONE 
J080311E17GATCGGACGGCCNONE 
J080311N08ATCTGGGCCGTCCNONE 
J080311N08GATCGGACGGCCNONE 
J080312O12ATCTGGGCCGTCCNONE 
J080312O12GATCGGACGGCCNONE 
J080315C08ATCTGGGCCGTCCNONE 
J080315C08GATCGGACGGCCNONE 
J080316D07ATCTGGGCCGTCCNONE 
J080316D07GATCGGACGGCCNONE 
J080318C17ATCTGGGCCGTCCNONE 
J080318C17GATCGGACGGCCNONE 
J090004B08ATCTGGGCCGTCCNONE 
J090004B08GATCGGACGGCCNONE 
J090009K02ATCTGGGCCGTCCNONE 
J090009K02GATCGGACGGCCNONE 
J090025O15ATCTGGGCCGTCCNONE 
J090025O15GATCGGACGGCCNONE 
J090026L03ATCTGGGCCGTCCNONE 
J090026L03GATCGGACGGCCNONE 
J090036P17ATCTGGGCCGTCCNONE 
J090036P17GATCGGACGGCCNONE 
J090047A21ATCTGGGCCGTCCNONE 
J090047A21GATCGGACGGCCNONE 
J090053O03ATCTGGGCCGTCCNONE 
J090053O03GATCGGACGGCCNONE 
J090059C04ATCTGGGCCGTCCNONE 
J090059C04GATCGGACGGCCNONE 
J090062O21ATCTGGGCCGTCCNONE 
J090062O21GATCGGACGGCCNONE 
J090064M11ATCTGGGCCGTCCNONE 
J090064M11GATCGGACGGCCNONE 
J090070C14ATCTGGGCCGTCCNONE 
J090070C14GATCGGACGGCCNONE 
J090075I03ATCTGGGCCGTCCNONE 
J090075I03GATCGGACGGCCNONE 
J090081G22ATCTGGGCCGTCCNONE 
J090081G22GATCGGACGGCCNONE 
J090083E18ATCTGGGCCGTCCNONE 
J090083E18GATCGGACGGCCNONE 
J090084A05ATCTGGGCCGTCCNONE 
J090084A05GATCGGACGGCCNONE 
J100019L11ATCTGGGCCGTCCNONE 
J100019L11GATCGGACGGCCNONE 
J100022D16ATCTGGGCCGTCCNONE 
J100022D16GATCGGACGGCCNONE 
J100042F09ATCTGGGCCGTCCNONE 
J100042F09GATCGGACGGCCNONE 
J100051J12ATCTGGGCCGTCCNONE 
J100051J12GATCGGACGGCCNONE 
J100065G21ATCTGGGCCGTCCNONE 
J100065G21GATCGGACGGCCNONE 
J100066D08ATCTGGGCCGTCCNONE 
J100066D08GATCGGACGGCCNONE 
J100069H04ATCTGGGCCGTCCNONE 
J100069H04GATCGGACGGCCNONE 
J100078I16ATCTGGGCCGTCCNONE 
J100078I16GATCGGACGGCCNONE 
J100090D15ATCTGGGCCGTCCNONE 
J100090D15GATCGGACGGCCNONE 
Os12g0153500AK070276GGCCGTCCCarbonic anhydrase, eukaryotic family protein. 
Os12g0175700AK069143ATCCGACGGCCGTCCAAGCCCACCCGNonaspanin (TM9SF) family protein. 
Os12g0535400004-008-H02GGCCGTCCACGTGTCCNONE 
AK065318GGCCGTCCACGTGTCCHypothetical protein. 
J013002P10GGCCGTCCACGTGTCCNONE 
Os12g0562100AK064831GATCGGACGGCCConserved hypothetical protein. 
AK065844GATCGGACGGCCNONE 
J013000F11GATCGGACGGCCNONE 
Os12g0578200AK105512GGCCGTCCSimilar to Chorismate mutase, chloroplast precursor (EC 5.4.99.5) (CM-1). 
Os12g0588900AK069966GGACGGCCCAGGConserved hypothetical protein. 
J023038A10GGACGGCCCAGGNONE 
J065061J23GGACGGCCCAGGNONE 
J065176O08GGACGGCCCAGGNONE 
J075143K13GGACGGCCCAGGNONE 
Os12g0620400015-008-B10GGCCGTCCNONE 
AK059006GGCCGTCCNONE 
AK059973GGCCGTCCNONE 
AK063843GGCCGTCCMethyl-CpG binding domain containing protein. 
AK072503GGCCGTCCNONE 
AK072934GGCCGTCCNONE 
J023126H05GGCCGTCCNONE 
J023131G11GGCCGTCCNONE 
J023146E17GGCCGTCCNONE 
J033064P08GGCCGTCCNONE 
J033095L07GGCCGTCCNONE 
J065101N06GGCCGTCCNONE 
J065186F11GGCCGTCCNONE 
J065215J15GGCCGTCCNONE 
J080049H05GGCCGTCCNONE 
J080059L05GGCCGTCCNONE 
J080061M17GGCCGTCCNONE 
J080063D16GGCCGTCCNONE 
J090012D01GGCCGTCCNONE 
J090023D20GGCCGTCCNONE 
J090040A09GGCCGTCCNONE 
J090044K08GGCCGTCCNONE 
J100019H03GGCCGTCCNONE 
J100054N04GGCCGTCCNONE 
Os12g0625000006-117-H03GGCCGTCCNONE 
AF073695GGCCGTCCNONE 
AK061993GGCCGTCCNONE 
AK099598GGCCGTCCCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 
Os12g0632000AF010580GGACGGCCNONE 
AJ002893GGACGGCCSimilar to Glycine-rich RNA-binding protein 1 (Fragment). 
J065001J09GGACGGCCNONE 
J065002D04GGACGGCCNONE 
J065041I19GGACGGCCNONE 
J065051I02GGACGGCCNONE 
J065054G12GGACGGCCNONE 
J065061A03GGACGGCCNONE 
J065061B03GGACGGCCNONE 
J065062D24GGACGGCCNONE 
J065079O14GGACGGCCNONE 
J065083P21GGACGGCCNONE 
J065098H21GGACGGCCNONE 
J065101F01GGACGGCCNONE 
J065102M05GGACGGCCNONE 
J065121E24GGACGGCCNONE 
J065138P03GGACGGCCNONE 
J065161B22GGACGGCCNONE 
J065163E13GGACGGCCNONE 
J065165D14GGACGGCCNONE 
J065169J17GGACGGCCNONE 
J065191B15GGACGGCCNONE 
J065197C23GGACGGCCNONE 
J075002C02GGACGGCCNONE 
J075003D03GGACGGCCNONE 
J075003M01GGACGGCCNONE 
J075011J11GGACGGCCNONE 
J075013I09GGACGGCCNONE 
J075013P21GGACGGCCNONE 
J075020D15GGACGGCCNONE 
J075020L10GGACGGCCNONE 
J075025P14GGACGGCCNONE 
J075031G13GGACGGCCNONE 
J075044J01GGACGGCCNONE 
J075048K03GGACGGCCNONE 
J075081H02GGACGGCCNONE 
J075081M24GGACGGCCNONE 
J075093H13GGACGGCCNONE 
J075096I02GGACGGCCNONE 
J075096K17GGACGGCCNONE 
J075097I08GGACGGCCNONE 
J075097L19GGACGGCCNONE 
J075098K03GGACGGCCNONE 
J075099L15GGACGGCCNONE 
J075118E23GGACGGCCNONE 
J075118H23GGACGGCCNONE 
J075118J24GGACGGCCNONE 
J075127N03GGACGGCCNONE 
J075142H14GGACGGCCNONE 
J075146D17GGACGGCCNONE 
J075156K21GGACGGCCNONE 
J080016A22GGACGGCCNONE 
J080016B03GGACGGCCNONE 
J080040H01GGACGGCCNONE 
J080068A22GGACGGCCNONE 
J080068G23GGACGGCCNONE 
J080071M07GGACGGCCNONE 
J080072C22GGACGGCCNONE 
J080092L23GGACGGCCNONE 
J080094M23GGACGGCCNONE 
J080094P05GGACGGCCNONE 
J080304H19GGACGGCCNONE 
J090045K01GGACGGCCNONE 
J090051E23GGACGGCCNONE 
J090084I02GGACGGCCNONE 
J100024B13GGACGGCCNONE 
J100024H16GGACGGCCNONE 
J100025F08GGACGGCCNONE 
J100026C20GGACGGCCNONE 
J100026J20GGACGGCCNONE 
J100026J24GGACGGCCNONE 
J100026K14GGACGGCCNONE 
J100026M15GGACGGCCNONE 
J100027A21GGACGGCCNONE 
J100027C08GGACGGCCNONE 
J100027D04GGACGGCCNONE 
J100027F17GGACGGCCNONE 
J100027G08GGACGGCCNONE 
J100027H22GGACGGCCNONE 
J100027N15GGACGGCCNONE 
J100028F01GGACGGCCNONE 
J100028J11GGACGGCCNONE 
J100029B19GGACGGCCNONE 
J100029C17GGACGGCCNONE 
J100029K13GGACGGCCNONE 
J100029N17GGACGGCCNONE 
J100030A16GGACGGCCNONE 
J100030F13GGACGGCCNONE 
J100030M17GGACGGCCNONE 
J100030N04GGACGGCCNONE 
J100030N09GGACGGCCNONE 
J100031F16GGACGGCCNONE 
J100031I07GGACGGCCNONE 
J100031K06GGACGGCCNONE 
J100031K09GGACGGCCNONE 
J100032E01GGACGGCCNONE 
J100032F13GGACGGCCNONE 
J100032I20GGACGGCCNONE 
J100032N21GGACGGCCNONE 
J100032O06GGACGGCCNONE 
J100033E08GGACGGCCNONE 
J100033M19GGACGGCCNONE 
J100033M22GGACGGCCNONE 
J100034B22GGACGGCCNONE 
J100034H08GGACGGCCNONE 
J100034K22GGACGGCCNONE 
J100034N04GGACGGCCNONE 
J100034P17GGACGGCCNONE 
J100035K22GGACGGCCNONE 
J100035L11GGACGGCCNONE 
J100035N24GGACGGCCNONE 
J100036L18GGACGGCCNONE 
J100037B01GGACGGCCNONE 
J100037F04GGACGGCCNONE 
J100037H23GGACGGCCNONE 
J100037L18GGACGGCCNONE 
J100038B05GGACGGCCNONE 
J100038F13GGACGGCCNONE 
J100038K04GGACGGCCNONE 
J100039G20GGACGGCCNONE 
J100040G09GGACGGCCNONE 
J100041A11GGACGGCCNONE 
J100041B22GGACGGCCNONE 
J100041K06GGACGGCCNONE 
J100041O09GGACGGCCNONE 
J100042A20GGACGGCCNONE 
J100042C07GGACGGCCNONE 
J100042I02GGACGGCCNONE 
J100042K03GGACGGCCNONE 
J100043C18GGACGGCCNONE 
J100043D20GGACGGCCNONE 
J100043F08GGACGGCCNONE 
J100043G23GGACGGCCNONE 
J100043H22GGACGGCCNONE 
J100043I23GGACGGCCNONE 
J100043K11GGACGGCCNONE 
J100043P03GGACGGCCNONE 
J100044C01GGACGGCCNONE 
J100044F02GGACGGCCNONE 
J100044L10GGACGGCCNONE 
J100045A13GGACGGCCNONE 
J100045D16GGACGGCCNONE 
J100045D23GGACGGCCNONE 
J100045F09GGACGGCCNONE 
J100045H22GGACGGCCNONE 
J100045O07GGACGGCCNONE 
J100046J15GGACGGCCNONE 
J100046K14GGACGGCCNONE 
J100046L15GGACGGCCNONE 
J100047L23GGACGGCCNONE 
J100047P05GGACGGCCNONE 
J100048A20GGACGGCCNONE 
J100048C22GGACGGCCNONE 
J100048G17GGACGGCCNONE 
J100048J20GGACGGCCNONE 
J100048K18GGACGGCCNONE 
J100048L22GGACGGCCNONE 
J100048O22GGACGGCCNONE 
J100049F18GGACGGCCNONE 
J100049M03GGACGGCCNONE 
J100050C20GGACGGCCNONE 
J100050G14GGACGGCCNONE 
J100050O10GGACGGCCNONE 
J100051E09GGACGGCCNONE 
J100051F20GGACGGCCNONE 
J100051I22GGACGGCCNONE 
J100051J11GGACGGCCNONE 
J100051J17GGACGGCCNONE 
J100052A04GGACGGCCNONE 
J100052E01GGACGGCCNONE 
J100052E13GGACGGCCNONE 
J100054A10GGACGGCCNONE 
J100054B08GGACGGCCNONE 
J100054B12GGACGGCCNONE 
J100054F05GGACGGCCNONE 
J100054I16GGACGGCCNONE 
J100054L18GGACGGCCNONE 
J100055A03GGACGGCCNONE 
J100055K11GGACGGCCNONE 
J100056I06GGACGGCCNONE 
J100056I16GGACGGCCNONE 
J100056M20GGACGGCCNONE 
J100057D04GGACGGCCNONE 
J100057E15GGACGGCCNONE 
J100057G07GGACGGCCNONE 
J100057H22GGACGGCCNONE 
J100058H07GGACGGCCNONE 
J100058M11GGACGGCCNONE 
J100058M20GGACGGCCNONE 
J100058N04GGACGGCCNONE 
J100058N16GGACGGCCNONE 
J100058O11GGACGGCCNONE 
J100059A20GGACGGCCNONE 
J100059E05GGACGGCCNONE 
J100059K17GGACGGCCNONE 
J100059M07GGACGGCCNONE 
J100060A07GGACGGCCNONE 
J100060G24GGACGGCCNONE 
J100060I15GGACGGCCNONE 
J100060M15GGACGGCCNONE 
J100060M20GGACGGCCNONE 
J100060N23GGACGGCCNONE 
J100061H20GGACGGCCNONE 
J100062C04GGACGGCCNONE 
J100062C22GGACGGCCNONE 
J100062F20GGACGGCCNONE 
J100062G08GGACGGCCNONE 
J100062H17GGACGGCCNONE 
J100062I05GGACGGCCNONE 
J100062L21GGACGGCCNONE 
J100062O04GGACGGCCNONE 
J100063B10GGACGGCCNONE 
J100063C01GGACGGCCNONE 
J100063D11GGACGGCCNONE 
J100064B18GGACGGCCNONE 
J100064G01GGACGGCCNONE 
J100064K07GGACGGCCNONE 
J100064L09GGACGGCCNONE 
J100064M13GGACGGCCNONE 
J100064O10GGACGGCCNONE 
J100065J24GGACGGCCNONE 
J100065N15GGACGGCCNONE 
J100066E13GGACGGCCNONE 
J100066G16GGACGGCCNONE 
J100066J03GGACGGCCNONE 
J100066K06GGACGGCCNONE 
J100066P15GGACGGCCNONE 
J100067D12GGACGGCCNONE 
J100067G04GGACGGCCNONE 
J100067G18GGACGGCCNONE 
J100067I18GGACGGCCNONE 
J100067K04GGACGGCCNONE 
J100068C21GGACGGCCNONE 
J100068D08GGACGGCCNONE 
J100068G17GGACGGCCNONE 
J100068H09GGACGGCCNONE 
J100069F05GGACGGCCNONE 
J100069I20GGACGGCCNONE 
J100069J05GGACGGCCNONE 
J100070D16GGACGGCCNONE 
J100070I09GGACGGCCNONE 
J100070K06GGACGGCCNONE 
J100071G09GGACGGCCNONE 
J100071H20GGACGGCCNONE 
J100071K07GGACGGCCNONE 
J100071L03GGACGGCCNONE 
J100071L13GGACGGCCNONE 
J100072A11GGACGGCCNONE 
J100072C19GGACGGCCNONE 
J100072E13GGACGGCCNONE 
J100072E16GGACGGCCNONE 
J100072M06GGACGGCCNONE 
J100072O10GGACGGCCNONE 
J100073E05GGACGGCCNONE 
J100073L14GGACGGCCNONE 
J100073N05GGACGGCCNONE 
J100074I04GGACGGCCNONE 
J100074K21GGACGGCCNONE 
J100074L22GGACGGCCNONE 
J100074N07GGACGGCCNONE 
J100075F18GGACGGCCNONE 
J100075H14GGACGGCCNONE 
J100075I03GGACGGCCNONE 
J100075K02GGACGGCCNONE 
J100075K11GGACGGCCNONE 
J100075K16GGACGGCCNONE 
J100075N08GGACGGCCNONE 
J100076A03GGACGGCCNONE 
J100076C05GGACGGCCNONE 
J100076I24GGACGGCCNONE 
J100077H07GGACGGCCNONE 
J100077P09GGACGGCCNONE 
J100078C15GGACGGCCNONE 
J100078J15GGACGGCCNONE 
J100078K02GGACGGCCNONE 
J100078K23GGACGGCCNONE 
J100078M11GGACGGCCNONE 
J100079E21GGACGGCCNONE 
J100079F03GGACGGCCNONE 
J100079K13GGACGGCCNONE 
J100081L17GGACGGCCNONE 
J100081P09GGACGGCCNONE 
J100082D14GGACGGCCNONE 
J100083E07GGACGGCCNONE 
J100083H07GGACGGCCNONE 
J100084B12GGACGGCCNONE 
J100084C20GGACGGCCNONE 
J100084D21GGACGGCCNONE 
J100084L21GGACGGCCNONE 
J100085I10GGACGGCCNONE 
J100085L22GGACGGCCNONE 
J100085M20GGACGGCCNONE 
J100086G15GGACGGCCNONE 
J100086N03GGACGGCCNONE 
J100087E11GGACGGCCNONE 
J100087I01GGACGGCCNONE 
J100088C17GGACGGCCNONE 
J100088N20GGACGGCCNONE 
J100089I18GGACGGCCNONE 
J100089M13GGACGGCCNONE 
J100090E17GGACGGCCNONE 
J100090J19GGACGGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.