version

Summary of OsREG625 (All List)

OrganismOryza sativa  
IDOsREG625  
SequenceGGCCCAAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3484  

Entry Sequences (3484 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422CTGGCCCAAATPeptidyl-tRNA hydrolase family protein. 
Os01g0147200016-005-F02ATTTGGGCCGGANONE 
AK106463ATTTGGGCCGGANONE 
AK121921ATTTGGGCCGGAIWS1, C-terminal family protein. 
J033098O16ATTTGGGCCGGANONE 
J033106E16ATTTGGGCCGGANONE 
J043026D12ATTTGGGCCGGANONE 
J065070B04ATTTGGGCCGGANONE 
J065162L03ATTTGGGCCGGANONE 
J065166F01ATTTGGGCCGGANONE 
J075030A13ATTTGGGCCGGANONE 
J075093O12ATTTGGGCCGGANONE 
J075106K15ATTTGGGCCGGANONE 
J075107F20ATTTGGGCCGGANONE 
J090031F21ATTTGGGCCGGANONE 
J090079E17ATTTGGGCCGGANONE 
Os01g0184800AK073377GAGGCCCAAAAPhosducin family protein. 
AK102544GAGGCCCAAAANONE 
J023047L21GAGGCCCAAAANONE 
J023135I09GAGGCCCAAAANONE 
J033028G17GAGGCCCAAAANONE 
J065164L07GAGGCCCAAAANONE 
J065193F22GAGGCCCAAAANONE 
J075035I10GAGGCCCAAAANONE 
J075168H15GAGGCCCAAAANONE 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0219500AK106863TTTTGGGCCGTTNONE 
AK109524TTTTGGGCCGTTPlant lipid transfer protein/Par allergen family protein. 
J075053J18TTTTGGGCCGTTNONE 
J080023G09TTTTGGGCCGTTNONE 
J080051F19TTTTGGGCCGTTNONE 
J080085H15TTTTGGGCCGTTNONE 
Os01g0222700012-011-E01GTTTGGGCCGACCGTTGNONE 
AK068883GTTTGGGCCGACCGTTGNONE 
AK101946GTTTGGGCCGACCGTTGZinc finger, BED-type predicted domain containing protein. 
J033075C16GTTTGGGCCGACCGTTGNONE 
J043013D08GTTTGGGCCGACCGTTGNONE 
J065089G19GTTTGGGCCGACCGTTGNONE 
J065197K19GTTTGGGCCGACCGTTGNONE 
J075161L21GTTTGGGCCGACCGTTGNONE 
Os01g0233500AB024986TAGGCCCAAAANONE 
AK063476TAGGCCCAAAACyclin. 
Os01g0235500AK121404GTGGCCCAAAConserved hypothetical protein. 
J023043C04GTGGCCCAAANONE 
J023059J21GTGGCCCAAANONE 
J023110N17GTGGCCCAAANONE 
J023132B02GTGGCCCAAANONE 
J023134M19GTGGCCCAAANONE 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0250600J075046P13AAGGCCCAAAANONE 
Os01g0269100011-080-F08AAGGCCCAAACNONE 
AK067610AAGGCCCAAACSimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18AAGGCCCAAACNONE 
J013112F12AAGGCCCAAACNONE 
J023002M17AAGGCCCAAACNONE 
J023022J24AAGGCCCAAACNONE 
J033050A10AAGGCCCAAACNONE 
J033091A17AAGGCCCAAACNONE 
J033123E17AAGGCCCAAACNONE 
J033143H04AAGGCCCAAACNONE 
J043005H18AAGGCCCAAACNONE 
J075038A05AAGGCCCAAACNONE 
J075091K23AAGGCCCAAACNONE 
J075118O05AAGGCCCAAACNONE 
J075195P17AAGGCCCAAACNONE 
J090027J21AAGGCCCAAACNONE 
J100024I09AAGGCCCAAACNONE 
J100032D15AAGGCCCAAACNONE 
J100071I02AAGGCCCAAACNONE 
J100080E01AAGGCCCAAACNONE 
J100086A08AAGGCCCAAACNONE 
Os01g0279700AK067683TTTGGGCCGANONE 
AK100107TTTGGGCCGAMajor facilitator superfamily protein. 
J023004N09TTTGGGCCGANONE 
J075019L14TTTGGGCCGANONE 
J075187F21TTTGGGCCGANONE 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
AK107814TGCGGCCCAAAASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
J065112H10TGCGGCCCAAAANONE 
Os01g0303100009-049-H10TTTTGGGCCTANONE 
AK062603TTTTGGGCCTASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0303800006-024-G06TGCGGCCCAAANONE 
006-025-F12TGCGGCCCAAANONE 
006-085-E12TGCGGCCCAAANONE 
006-092-F12TGCGGCCCAAANONE 
AK060078TGCGGCCCAAAUniversal stress protein (Usp) family protein. 
AK121626TGCGGCCCAAANONE 
J023044K21TGCGGCCCAAANONE 
J023069K09TGCGGCCCAAANONE 
J023091A17TGCGGCCCAAANONE 
J033048C05TGCGGCCCAAANONE 
J033126M13TGCGGCCCAAANONE 
J065040E06TGCGGCCCAAANONE 
J065060D14TGCGGCCCAAANONE 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
AK104939TTTTGGGCCCACCACNONE 
J033044B03TTTTGGGCCCACCACNONE 
J033060E12TTTTGGGCCCACCACNONE 
J043037E21TTTTGGGCCCACCACNONE 
J065019O18TTTTGGGCCCACCACNONE 
J065025P22TTTTGGGCCCACCACNONE 
J065042P06TTTTGGGCCCACCACNONE 
J065074C19TTTTGGGCCCACCACNONE 
J065074E13TTTTGGGCCCACCACNONE 
J065094E05TTTTGGGCCCACCACNONE 
J065108N08TTTTGGGCCCACCACNONE 
J065134L13TTTTGGGCCCACCACNONE 
J065152N24TTTTGGGCCCACCACNONE 
J065162N24TTTTGGGCCCACCACNONE 
J065170P16TTTTGGGCCCACCACNONE 
J065177M20TTTTGGGCCCACCACNONE 
J065187N01TTTTGGGCCCACCACNONE 
J075012N12TTTTGGGCCCACCACNONE 
J075046C17TTTTGGGCCCACCACNONE 
J075055N06TTTTGGGCCCACCACNONE 
J075141H03TTTTGGGCCCACCACNONE 
J075150M11TTTTGGGCCCACCACNONE 
J090005B16TTTTGGGCCCACCACNONE 
J090079L11TTTTGGGCCCACCACNONE 
J100039F16TTTTGGGCCCACCACNONE 
Os01g0327600AK120216ATTTGGGCCTGANONE 
AK121799ATTTGGGCCTGAConserved hypothetical protein. 
J065081I07ATTTGGGCCTGANONE 
J065082D04ATTTGGGCCTGANONE 
J065082G10ATTTGGGCCTGANONE 
J065085G24ATTTGGGCCTGANONE 
J065105J24ATTTGGGCCTGANONE 
J065128D18ATTTGGGCCTGANONE 
J065155D13ATTTGGGCCTGANONE 
J065200C11ATTTGGGCCTGANONE 
Os01g0331900013-026-D04GTTTGGGCCAANONE 
AK064784GTTTGGGCCAANONE 
AK121761GTTTGGGCCAAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTTTGGGCCAANONE 
J033090D07GTTTGGGCCAANONE 
J090006L21GTTTGGGCCAANONE 
Os01g0391100AK108533TCTGGCCCAAANONE 
AK121200TCTGGCCCAAASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
J023042H11TCTGGCCCAAANONE 
J023087I02TCTGGCCCAAANONE 
J065099C01TCTGGCCCAAANONE 
Os01g0530366J075001P06CTCGGCCCAAAANONE 
J075006K21CTCGGCCCAAAARNA polymerase Rbp10 domain containing protein. 
J075030G13CTCGGCCCAAAANONE 
Os01g0533900AK101194GAGGCCCAAACSimilar to Multidrug resistance protein 1 homolog. 
AK101194TAGGCCCAAAASimilar to Multidrug resistance protein 1 homolog. 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0571200014-074-A10ATTTGGGCCTANONE 
AK121299ATTTGGGCCTASimilar to Ribosomal protein L34. 
J023110L12ATTTGGGCCTANONE 
Os01g0585400AK103584TCATGGGCCCAAATConserved hypothetical protein. 
J033133B01TCATGGGCCCAAATNONE 
Os01g0616600009-171-H09ATTTGGGCCGCANONE 
011-005-G09ATTTGGGCCGCANONE 
012-089-C03ATTTGGGCCGCANONE 
AK063911ATTTGGGCCGCAProtein prenyltransferase domain containing protein. 
AK101490ATTTGGGCCGCANONE 
Os01g0621600AK100122ATTTGGGCCAGProtein of unknown function DUF1221 domain containing protein. 
Os01g0621700AK108938AAGGCCCAAAMyosin tail 2 domain containing protein. 
AK108938AATTGGGCCCAAAMyosin tail 2 domain containing protein. 
J100033P13AAGGCCCAAANONE 
J100033P13AATTGGGCCCAAANONE 
Os01g0623500AK066142TTTTGGGCCAAAAA ATPase domain containing protein. 
J013055O07TTTTGGGCCAANONE 
J053069D06TTTTGGGCCAANONE 
J053095J11TTTTGGGCCAANONE 
J065106D24TTTTGGGCCAANONE 
J065134H18TTTTGGGCCAANONE 
J075066D09TTTTGGGCCAANONE 
J090004M17TTTTGGGCCAANONE 
J100039L05TTTTGGGCCAANONE 
J100042E15TTTTGGGCCAANONE 
J100043B18TTTTGGGCCAANONE 
J100057L11TTTTGGGCCAANONE 
J100067C24TTTTGGGCCAANONE 
J100073H01TTTTGGGCCAANONE 
J100081J21TTTTGGGCCAANONE 
Os01g0626300016-070-G04TTTTGGGCCCATCANONE 
AK122071TTTTGGGCCCATCASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04TTTTGGGCCCATCANONE 
J033117J08TTTTGGGCCCATCANONE 
J065007O12TTTTGGGCCCATCANONE 
J065020K12TTTTGGGCCCATCANONE 
J065142D24TTTTGGGCCCATCANONE 
J065157K19TTTTGGGCCCATCANONE 
J080307H19TTTTGGGCCCATCANONE 
J080311D16TTTTGGGCCCATCANONE 
J080316C12TTTTGGGCCCATCANONE 
J080316E03TTTTGGGCCCATCANONE 
J100033K16TTTTGGGCCCATCANONE 
J100042J21TTTTGGGCCCATCANONE 
J100051E06TTTTGGGCCCATCANONE 
J100071E22TTTTGGGCCCATCANONE 
Os01g0642900009-109-F01GAGGCCCAAAANONE 
009-109-F01TCGGCCCAAANONE 
AK063836GAGGCCCAAAASingle-strand binding protein/Primosomal replication protein n family protein. 
AK063836TCGGCCCAAASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560GAGGCCCAAAANONE 
AK073560TCGGCCCAAANONE 
J033043K18GAGGCCCAAAANONE 
J033043K18TCGGCCCAAANONE 
J100023C05GAGGCCCAAAANONE 
J100023C05TCGGCCCAAANONE 
J100038C15GAGGCCCAAAANONE 
J100038C15TCGGCCCAAANONE 
J100039C23GAGGCCCAAAANONE 
J100039C23TCGGCCCAAANONE 
Os01g0680400AK067914CCCGGCCCAAAATAFII28-like protein family protein. 
J065039K13CCCGGCCCAAAANONE 
J065042K22CCCGGCCCAAAANONE 
J080016E23CCCGGCCCAAAANONE 
J080064E22CCCGGCCCAAAANONE 
Os01g0681100016-048-E04TTTTGGGCCTTGNONE 
AK072230TTTTGGGCCTTGSimilar to Dynamin-related protein 1B (Dynamin-like protein B). 
J023002D21TTTTGGGCCTTGNONE 
J033136O22TTTTGGGCCTTGNONE 
Os01g0686800006-098-B12GGACGGCCCAAATNONE 
006-113-H04GGACGGCCCAAATNONE 
AK060428GGACGGCCCAAATNONE 
AK098877GGACGGCCCAAATNONE 
AK098893GGACGGCCCAAATNONE 
AK121587GGACGGCCCAAATGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGACGGCCCAAATNONE 
J013001E12GGACGGCCCAAATNONE 
J013001N15GGACGGCCCAAATNONE 
J013098G22GGACGGCCCAAATNONE 
J023004P15GGACGGCCCAAATNONE 
J023014D09GGACGGCCCAAATNONE 
J023020G09GGACGGCCCAAATNONE 
J023034A19GGACGGCCCAAATNONE 
J023050I11GGACGGCCCAAATNONE 
J023079D13GGACGGCCCAAATNONE 
J023091B11GGACGGCCCAAATNONE 
J023099M03GGACGGCCCAAATNONE 
J023101H20GGACGGCCCAAATNONE 
J023106P14GGACGGCCCAAATNONE 
J023111F19GGACGGCCCAAATNONE 
J023132C22GGACGGCCCAAATNONE 
J023139O03GGACGGCCCAAATNONE 
J023146O10GGACGGCCCAAATNONE 
J033022G16GGACGGCCCAAATNONE 
J033030C10GGACGGCCCAAATNONE 
J033032G18GGACGGCCCAAATNONE 
J033034N09GGACGGCCCAAATNONE 
J033037K24GGACGGCCCAAATNONE 
J033038B22GGACGGCCCAAATNONE 
J033061E06GGACGGCCCAAATNONE 
J033065F08GGACGGCCCAAATNONE 
J033065I24GGACGGCCCAAATNONE 
J033069L01GGACGGCCCAAATNONE 
J033086N21GGACGGCCCAAATNONE 
J033102I06GGACGGCCCAAATNONE 
J033111N07GGACGGCCCAAATNONE 
J033118K11GGACGGCCCAAATNONE 
J033125D08GGACGGCCCAAATNONE 
J033129P22GGACGGCCCAAATNONE 
J033131L12GGACGGCCCAAATNONE 
J033139D08GGACGGCCCAAATNONE 
J033141J08GGACGGCCCAAATNONE 
J043024B14GGACGGCCCAAATNONE 
J053048G19GGACGGCCCAAATNONE 
J065023B15GGACGGCCCAAATNONE 
J065082C15GGACGGCCCAAATNONE 
J065087D24GGACGGCCCAAATNONE 
J065122D11GGACGGCCCAAATNONE 
J065128P13GGACGGCCCAAATNONE 
J065149I19GGACGGCCCAAATNONE 
J065154E16GGACGGCCCAAATNONE 
J065156K21GGACGGCCCAAATNONE 
J065166H09GGACGGCCCAAATNONE 
J065169F24GGACGGCCCAAATNONE 
J065194I16GGACGGCCCAAATNONE 
J065213M20GGACGGCCCAAATNONE 
J075020F19GGACGGCCCAAATNONE 
J075051J16GGACGGCCCAAATNONE 
J075093C18GGACGGCCCAAATNONE 
J075119H02GGACGGCCCAAATNONE 
J075120J11GGACGGCCCAAATNONE 
J075173A15GGACGGCCCAAATNONE 
J080302B05GGACGGCCCAAATNONE 
J080304G10GGACGGCCCAAATNONE 
J080305E13GGACGGCCCAAATNONE 
J080315L11GGACGGCCCAAATNONE 
J090005H15GGACGGCCCAAATNONE 
J090021C24GGACGGCCCAAATNONE 
J090025H24GGACGGCCCAAATNONE 
J090025M11GGACGGCCCAAATNONE 
J090026C22GGACGGCCCAAATNONE 
J090027H15GGACGGCCCAAATNONE 
J090034B17GGACGGCCCAAATNONE 
J090045G11GGACGGCCCAAATNONE 
J090048H02GGACGGCCCAAATNONE 
J090051N04GGACGGCCCAAATNONE 
J090052I06GGACGGCCCAAATNONE 
J090054L17GGACGGCCCAAATNONE 
J090060M22GGACGGCCCAAATNONE 
J090075N17GGACGGCCCAAATNONE 
J090079K13GGACGGCCCAAATNONE 
J090086H08GGACGGCCCAAATNONE 
J090094N20GGACGGCCCAAATNONE 
J100021F03GGACGGCCCAAATNONE 
J100031M01GGACGGCCCAAATNONE 
J100033I18GGACGGCCCAAATNONE 
J100034P07GGACGGCCCAAATNONE 
J100043M16GGACGGCCCAAATNONE 
J100046J12GGACGGCCCAAATNONE 
J100055F09GGACGGCCCAAATNONE 
J100057D19GGACGGCCCAAATNONE 
J100060O10GGACGGCCCAAATNONE 
J100064G09GGACGGCCCAAATNONE 
J100077F24GGACGGCCCAAATNONE 
J100080E12GGACGGCCCAAATNONE 
J100089J04GGACGGCCCAAATNONE 
Os01g0695200015-090-F01GAGGCCCAAAANONE 
AK064145GAGGCCCAAAAProtein of unknown function DUF266, plant family protein. 
J065163N10GAGGCCCAAAANONE 
J100051F21GAGGCCCAAAANONE 
Os01g0707300AK059962ATTTGGGCCATNONE 
AK104463ATTTGGGCCATSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0710800013-097-E05TTTTGGGCCTTAGGCCCATATNONE 
AK069973TTTTGGGCCTTAGGCCCATATNONE 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
J023081K01TTTTGGGCCTTAGGCCCATATNONE 
J023123E16TTTTGGGCCTTAGGCCCATATNONE 
J033066B11TTTTGGGCCTTAGGCCCATATNONE 
J065144G11TTTTGGGCCTTAGGCCCATATNONE 
Os01g0737900012-087-D12ATTTGGGCCTANONE 
AK072600ATTTGGGCCTAProtein prenyltransferase domain containing protein. 
J023006E12ATTTGGGCCTANONE 
J023130A18ATTTGGGCCTANONE 
J023134O05ATTTGGGCCTANONE 
Os01g0738600AK073479GAGGCCCAAACENTH/VHS domain containing protein. 
AK120616GAGGCCCAAACNONE 
J013046M12GAGGCCCAAACNONE 
J013152B11GAGGCCCAAACNONE 
J023007A09GAGGCCCAAACNONE 
J023007N03GAGGCCCAAACNONE 
J023042A01GAGGCCCAAACNONE 
J023059P06GAGGCCCAAACNONE 
J023113A05GAGGCCCAAACNONE 
J033044K11GAGGCCCAAACNONE 
J033082E04GAGGCCCAAACNONE 
J090033B13GAGGCCCAAACNONE 
J090062H08GAGGCCCAAACNONE 
J100086G23GAGGCCCAAACNONE 
Os01g0764600AK060621GTTTGGGCCGAGAFosfomycin resistance kinase FomA family protein. 
J013111L18GTTTGGGCCGAGANONE 
J013134N08GTTTGGGCCGAGANONE 
Os01g0765000AK101905TTTTGGGCCGASimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0773200015-072-C12CCAGGCCCAAATAGGCCCAGTNONE 
Os01g0773500009-029-F02TCCGGCCCAAATNONE 
AK062417TCCGGCCCAAATConserved hypothetical protein. 
Os01g0788900AK073287GCGGCCCAAACNONE 
Os01g0810000AK102143AGGGCCCAAACNONE 
AK120752AGGGCCCAAACUtp11 family protein. 
J023006E09AGGGCCCAAACNONE 
J033086A13AGGGCCCAAACNONE 
J033133K07AGGGCCCAAACNONE 
J065066L16AGGGCCCAAACNONE 
J065161C01AGGGCCCAAACNONE 
J100027D18AGGGCCCAAACNONE 
J100063J12AGGGCCCAAACNONE 
Os01g0836400AK068741TTGTGGGCCCAAACNONE 
AK073540TTGTGGGCCCAAACSAC3/GANP family protein. 
J023019D11TTGTGGGCCCAAACNONE 
J023139O22TTGTGGGCCCAAACNONE 
J033042J20TTGTGGGCCCAAACNONE 
J033046M18TTGTGGGCCCAAACNONE 
J033124J09TTGTGGGCCCAAACNONE 
J090015E05TTGTGGGCCCAAACNONE 
J090076J09TTGTGGGCCCAAACNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0872700AK066633CTCGGCCCAAAANONE 
AK100381CTCGGCCCAAAAPutative 5-3 exonuclease domain containing protein. 
J013028K13CTCGGCCCAAAANONE 
J013038C19CTCGGCCCAAAANONE 
J023024P16CTCGGCCCAAAANONE 
J023074N21CTCGGCCCAAAANONE 
J023085E21CTCGGCCCAAAANONE 
J033034K14CTCGGCCCAAAANONE 
J033044N04CTCGGCCCAAAANONE 
J033052O10CTCGGCCCAAAANONE 
J033087J09CTCGGCCCAAAANONE 
J033129L17CTCGGCCCAAAANONE 
J033143O07CTCGGCCCAAAANONE 
J065014M22CTCGGCCCAAAANONE 
J065025H10CTCGGCCCAAAANONE 
J065051H21CTCGGCCCAAAANONE 
J065123E05CTCGGCCCAAAANONE 
J065181P03CTCGGCCCAAAANONE 
J100064B21CTCGGCCCAAAANONE 
Os01g0881100AK109822GCGGCCCAAACGGCCEpsin, N-terminal domain containing protein. 
Os01g0888800AK070163TACGGCCCAAAAConserved hypothetical protein. 
J065181H02TACGGCCCAAAANONE 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
Os01g0891400J065077E24TTGGCCCAAAAConserved hypothetical protein. 
J065077E24TTTTGGGCCGAAConserved hypothetical protein. 
J065206I07TTGGCCCAAAANONE 
J065206I07TTTTGGGCCGAANONE 
Os01g0894700009-177-F04GCGGCCCAAACNONE 
AK067623GCGGCCCAAACConserved hypothetical protein. 
AK104876GCGGCCCAAACNONE 
J013095G01GCGGCCCAAACNONE 
J013108L20GCGGCCCAAACNONE 
J013120P13GCGGCCCAAACNONE 
Os01g0908800AK065889ATTTGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0917400AK111958GTTTGGGCCTANONE 
Os01g0920200AK120182AAACGGCCCAAAASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14AAACGGCCCAAAANONE 
J013063O14AAACGGCCCAAAANONE 
J023023D20AAACGGCCCAAAANONE 
J075121J02AAACGGCCCAAAANONE 
Os01g0937300AK062872TTTTGGGCCTANONE 
J033136K12TTTTGGGCCTANONE 
J053048E20TTTTGGGCCTANONE 
J053088K08TTTTGGGCCTANONE 
J065011G23TTTTGGGCCTANONE 
J065202J09TTTTGGGCCTANONE 
Os01g0939100AK070064GTTTGGGCCGTASimilar to Calmodulin-stimulated calcium-ATPase. 
Os01g0959900AK058375TTGGCCCAAAAConserved hypothetical protein. 
AK066497TTGGCCCAAAANONE 
Os01g0960800AK073977TTTGGGCCGAAProtein Transporter, Pam16 family protein. 
AY313247TTTGGGCCGAANONE 
J033075P16TTTGGGCCGAANONE 
J065051H06TTTGGGCCGAANONE 
J065167L02TTTGGGCCGAANONE 
J090083C22TTTGGGCCGAANONE 
Os01g0965400006-063-H08TTGGCCCAAAANONE 
011-037-A03TTGGCCCAAAANONE 
AK069647TTGGCCCAAAASimilar to Uridylate kinase (EC 2.7.4.-) (UK) (Uridine monophosphate kinase) (UMP kinase). 
AK104789TTGGCCCAAAANONE 
J013072N21TTGGCCCAAAANONE 
J023027E20TTGGCCCAAAANONE 
J023075O12TTGGCCCAAAANONE 
J033111H12TTGGCCCAAAANONE 
J080001F12TTGGCCCAAAANONE 
J080004J12TTGGCCCAAAANONE 
J080005N15TTGGCCCAAAANONE 
J080008D06TTGGCCCAAAANONE 
J080010I10TTGGCCCAAAANONE 
J080011D19TTGGCCCAAAANONE 
J080015G04TTGGCCCAAAANONE 
J080018O05TTGGCCCAAAANONE 
J080024K13TTGGCCCAAAANONE 
J080026M08TTGGCCCAAAANONE 
J080027H22TTGGCCCAAAANONE 
J080027L18TTGGCCCAAAANONE 
J080029C13TTGGCCCAAAANONE 
J080030A02TTGGCCCAAAANONE 
J080031C10TTGGCCCAAAANONE 
J080038L14TTGGCCCAAAANONE 
J080039B17TTGGCCCAAAANONE 
J080041C13TTGGCCCAAAANONE 
J080042A06TTGGCCCAAAANONE 
J080043L15TTGGCCCAAAANONE 
J080047C08TTGGCCCAAAANONE 
J080049C07TTGGCCCAAAANONE 
J080051M10TTGGCCCAAAANONE 
J080053F03TTGGCCCAAAANONE 
J080054B13TTGGCCCAAAANONE 
J080063K02TTGGCCCAAAANONE 
J080064L04TTGGCCCAAAANONE 
J080071B19TTGGCCCAAAANONE 
J080071M13TTGGCCCAAAANONE 
J080083P09TTGGCCCAAAANONE 
J080088G09TTGGCCCAAAANONE 
J080089I16TTGGCCCAAAANONE 
J080092E23TTGGCCCAAAANONE 
J080093B19TTGGCCCAAAANONE 
J080097H14TTGGCCCAAAANONE 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os01g0971600AK070366GTTTGGGCCGAGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
AK070366GTTTGGGCCTTGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os02g0101500012-006-E03ATTTGGGCCCCNONE 
013-006-A02ATTTGGGCCCCNONE 
013-011-F03ATTTGGGCCCCNONE 
AK067642ATTTGGGCCCCNONE 
AK072105ATTTGGGCCCCSimilar to NADH-dependent hydroxypyruvate reductase (EC 1.1.1.29) (Fragment). 
J013027G04ATTTGGGCCCCNONE 
J013034P10ATTTGGGCCCCNONE 
J013039D15ATTTGGGCCCCNONE 
J013048P14ATTTGGGCCCCNONE 
J013050O03ATTTGGGCCCCNONE 
J013056H19ATTTGGGCCCCNONE 
J013071D11ATTTGGGCCCCNONE 
J013097D17ATTTGGGCCCCNONE 
J013104F13ATTTGGGCCCCNONE 
J013108J23ATTTGGGCCCCNONE 
J013119J12ATTTGGGCCCCNONE 
J013122N16ATTTGGGCCCCNONE 
J013146M24ATTTGGGCCCCNONE 
J013149E16ATTTGGGCCCCNONE 
J013157E04ATTTGGGCCCCNONE 
J023012P06ATTTGGGCCCCNONE 
J023050C21ATTTGGGCCCCNONE 
J023107F18ATTTGGGCCCCNONE 
J023110B19ATTTGGGCCCCNONE 
J023111H01ATTTGGGCCCCNONE 
J023148P04ATTTGGGCCCCNONE 
J043009E13ATTTGGGCCCCNONE 
J043009H22ATTTGGGCCCCNONE 
J065007D17ATTTGGGCCCCNONE 
J065038K16ATTTGGGCCCCNONE 
J065042A01ATTTGGGCCCCNONE 
J065075C20ATTTGGGCCCCNONE 
J065091I04ATTTGGGCCCCNONE 
J065131A03ATTTGGGCCCCNONE 
J075152O18ATTTGGGCCCCNONE 
J075152P17ATTTGGGCCCCNONE 
J080001F06ATTTGGGCCCCNONE 
J080002H09ATTTGGGCCCCNONE 
J080004L23ATTTGGGCCCCNONE 
J080005H18ATTTGGGCCCCNONE 
J080010D22ATTTGGGCCCCNONE 
J080010G17ATTTGGGCCCCNONE 
J080013E07ATTTGGGCCCCNONE 
J080013P18ATTTGGGCCCCNONE 
J080015D22ATTTGGGCCCCNONE 
J080025H24ATTTGGGCCCCNONE 
J080026O03ATTTGGGCCCCNONE 
J080036J01ATTTGGGCCCCNONE 
J080036L03ATTTGGGCCCCNONE 
J080037O13ATTTGGGCCCCNONE 
J080041D10ATTTGGGCCCCNONE 
J080045J04ATTTGGGCCCCNONE 
J080046J06ATTTGGGCCCCNONE 
J080048G16ATTTGGGCCCCNONE 
J080048I21ATTTGGGCCCCNONE 
J080056F16ATTTGGGCCCCNONE 
J080056L16ATTTGGGCCCCNONE 
J080057C02ATTTGGGCCCCNONE 
J080058D03ATTTGGGCCCCNONE 
J080061B19ATTTGGGCCCCNONE 
J080061E16ATTTGGGCCCCNONE 
J080061L22ATTTGGGCCCCNONE 
J080062P08ATTTGGGCCCCNONE 
J080067C01ATTTGGGCCCCNONE 
J080067G13ATTTGGGCCCCNONE 
J080068F20ATTTGGGCCCCNONE 
J080072H15ATTTGGGCCCCNONE 
J080072P12ATTTGGGCCCCNONE 
J080079O21ATTTGGGCCCCNONE 
J080081J15ATTTGGGCCCCNONE 
J080081K02ATTTGGGCCCCNONE 
J080085O11ATTTGGGCCCCNONE 
J080086N15ATTTGGGCCCCNONE 
J080087E22ATTTGGGCCCCNONE 
J080087O15ATTTGGGCCCCNONE 
J080091D07ATTTGGGCCCCNONE 
J080091J02ATTTGGGCCCCNONE 
J080091L21ATTTGGGCCCCNONE 
J080093B13ATTTGGGCCCCNONE 
J100069F01ATTTGGGCCCCNONE 
J100086B08ATTTGGGCCCCNONE 
Os02g0102700006-096-A07GTTTGGGCCTTNONE 
006-096-A07TAGGCCCAAATNONE 
AK061193GTTTGGGCCTTSimilar to AGL157Cp. 
AK061193TAGGCCCAAATSimilar to AGL157Cp. 
AK061558GTTTGGGCCTTNONE 
AK061558TAGGCCCAAATNONE 
AK103689GTTTGGGCCTTNONE 
AK103689TAGGCCCAAATNONE 
J023128B06GTTTGGGCCTTNONE 
J023128B06TAGGCCCAAATNONE 
J033136G21GTTTGGGCCTTNONE 
J033136G21TAGGCCCAAATNONE 
J053084F10GTTTGGGCCTTNONE 
J053084F10TAGGCCCAAATNONE 
J053089D12GTTTGGGCCTTNONE 
J053089D12TAGGCCCAAATNONE 
J075149B12GTTTGGGCCTTNONE 
J075149B12TAGGCCCAAATNONE 
J075165L17GTTTGGGCCTTNONE 
J075165L17TAGGCCCAAATNONE 
Os02g0116400AK072347CTGGCCCAAATOligopeptide transporter OPT superfamily protein. 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0119700AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0133800006-092-D12TCGGCCCAAAANONE 
006-111-G01TCGGCCCAAAANONE 
AK103646TCGGCCCAAAANONE 
AK109376TCGGCCCAAAAProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886TCGGCCCAAAANONE 
J033135B19TCGGCCCAAAANONE 
J065200F01TCGGCCCAAAANONE 
J065213J11TCGGCCCAAAANONE 
J075031N16TCGGCCCAAAANONE 
J075032N17TCGGCCCAAAANONE 
J075047P04TCGGCCCAAAANONE 
J075063D01TCGGCCCAAAANONE 
J075105F23TCGGCCCAAAANONE 
J075121E16TCGGCCCAAAANONE 
J075176F10TCGGCCCAAAANONE 
J075182M16TCGGCCCAAAANONE 
J075190E09TCGGCCCAAAANONE 
J075191B14TCGGCCCAAAANONE 
J100055J24TCGGCCCAAAANONE 
J100066H24TCGGCCCAAAANONE 
J100073N01TCGGCCCAAAANONE 
Os02g0146700AK105609TTTTGGGCCACSimilar to PSMD2 subunit (Fragment). 
AK119490TTTTGGGCCACNONE 
AK121963TTTTGGGCCACNONE 
Os02g0176400009-099-H11AGCCCAACCAGGGCCCAAATNONE 
AK062746AGCCCAACCAGGGCCCAAATProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0186700AK064492GAGGCCCAAATConserved hypothetical protein. 
J065210K09GAGGCCCAAATNONE 
J075006A17GAGGCCCAAATNONE 
J075108C18GAGGCCCAAATNONE 
J075153E08GAGGCCCAAATNONE 
Os02g0188500AK102004AAACGGCCCAAAANONE 
AK106917AAACGGCCCAAAAUbiquitin domain containing protein. 
J090039N13AAACGGCCCAAAANONE 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075001E02TTTTGGGCCCAACCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117E23TTTTGGGCCCAACCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23TTTTGGGCCCAACCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12TTTTGGGCCCAACCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10TTTTGGGCCCAACCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15TTTTGGGCCCAACCNONE 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0219200016-016-C03GTTTGGGCCGANONE 
AK059059GTTTGGGCCGASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0241100Os02g0241100TTCGGCCCAAAAProtein kinase-like domain containing protein. 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0304800Os02g0304800GGCCCGGCCCAAATProtein prenyltransferase domain containing protein. 
Os02g0312700AK072956CACGGCCCAAAGTCCCACCATP11 family protein. 
AK102909CACGGCCCAAAGTCCCACCNONE 
J065017G18CACGGCCCAAAGTCCCACCNONE 
J075066A05CACGGCCCAAAGTCCCACCNONE 
Os02g0317800J033050F18TTTTGGGCCCAAGNONE 
J075032I21TTTTGGGCCCAAGNONE 
J075108K06TTTTGGGCCCAAGNONE 
J075120B04TTTTGGGCCCAAGNONE 
J080315C12TTTTGGGCCCAAGConserved hypothetical protein. 
J100056L07TTTTGGGCCCAAGNONE 
Os02g0497700011-094-A10AAGGCCCAAAANONE 
012-073-H02AAGGCCCAAAANONE 
016-056-G05AAGGCCCAAAANONE 
AK070143AAGGCCCAAAANONE 
J023041O14AAGGCCCAAAANONE 
J023092H01AAGGCCCAAAANONE 
J033048A17AAGGCCCAAAANONE 
J033051K21AAGGCCCAAAANONE 
J033122D01AAGGCCCAAAANONE 
J090032E23AAGGCCCAAAANONE 
J090055K13AAGGCCCAAAANONE 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
Os02g0525400011-008-B01CAGGCCCAAANONE 
AK065368CAGGCCCAAASimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13CAGGCCCAAANONE 
J033046H10CAGGCCCAAANONE 
Os02g0525900003-101-C07CTGGCCCAAANONE 
AK060822CTGGCCCAAANONE 
J013038N07CTGGCCCAAANONE 
J013058P13CTGGCCCAAANONE 
J013070M20CTGGCCCAAANONE 
J013074B15CTGGCCCAAANONE 
J013123G17CTGGCCCAAANONE 
J013132H12CTGGCCCAAANONE 
J013160H21CTGGCCCAAANONE 
J023013O04CTGGCCCAAANONE 
J023066L21CTGGCCCAAANONE 
J023089C06CTGGCCCAAANONE 
J023091H21CTGGCCCAAANONE 
J023128K04CTGGCCCAAANONE 
J033027I17CTGGCCCAAANONE 
J033042N22CTGGCCCAAANONE 
J033055J03CTGGCCCAAANONE 
J033071C12CTGGCCCAAANONE 
J033074A19CTGGCCCAAANONE 
J033112A11CTGGCCCAAANONE 
J033118D15CTGGCCCAAANONE 
J033121K15CTGGCCCAAANONE 
J090010F18CTGGCCCAAANONE 
J090020A15CTGGCCCAAANONE 
J090033P12CTGGCCCAAANONE 
J090050E21CTGGCCCAAANONE 
J090070G22CTGGCCCAAANONE 
J090090E04CTGGCCCAAANONE 
J100026L11CTGGCCCAAANONE 
J100036N10CTGGCCCAAANONE 
J100041H24CTGGCCCAAANONE 
Os02g0533800009-149-F12GAGGCCCAAACNONE 
013-058-H02GAGGCCCAAACNONE 
014-017-G07GAGGCCCAAACNONE 
014-028-F04GAGGCCCAAACNONE 
014-050-G04GAGGCCCAAACNONE 
014-095-F04GAGGCCCAAACNONE 
014-099-C08GAGGCCCAAACNONE 
016-046-F05GAGGCCCAAACNONE 
AK121139GAGGCCCAAACConserved hypothetical protein. 
J013104A14GAGGCCCAAACNONE 
J023077F13GAGGCCCAAACNONE 
J023145I11GAGGCCCAAACNONE 
J065033D14GAGGCCCAAACNONE 
J065079I15GAGGCCCAAACNONE 
J065104E21GAGGCCCAAACNONE 
J065128E06GAGGCCCAAACNONE 
J065174F07GAGGCCCAAACNONE 
J065195B12GAGGCCCAAACNONE 
J065207B12GAGGCCCAAACNONE 
J080304M24GAGGCCCAAACNONE 
J090040A13GAGGCCCAAACNONE 
J090054B18GAGGCCCAAACNONE 
J100037A06GAGGCCCAAACNONE 
J100042F24GAGGCCCAAACNONE 
J100043N23GAGGCCCAAACNONE 
J100044H14GAGGCCCAAACNONE 
J100056K24GAGGCCCAAACNONE 
J100063O22GAGGCCCAAACNONE 
J100071G05GAGGCCCAAACNONE 
J100078G15GAGGCCCAAACNONE 
Os02g0533900AB062681GTTTGGGCCTCNONE 
AK061722GTTTGGGCCTCNONE 
AK106147GTTTGGGCCTCNONE 
AK121892GTTTGGGCCTCSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0543000009-061-H02GAGGCCCAAACNONE 
009-123-H02GAGGCCCAAACNONE 
009-192-D09GAGGCCCAAACNONE 
009-197-F06GAGGCCCAAACNONE 
AK060261GAGGCCCAAACNONE 
AK062319GAGGCCCAAACABA/WDS induced protein family protein. 
AK062880GAGGCCCAAACNONE 
AK063217GAGGCCCAAACNONE 
AK066415GAGGCCCAAACNONE 
J065084L15GAGGCCCAAACNONE 
J065207N17GAGGCCCAAACNONE 
J075088J03GAGGCCCAAACNONE 
J100024G08GAGGCCCAAACNONE 
J100027P19GAGGCCCAAACNONE 
J100052E02GAGGCCCAAACNONE 
J100055B02GAGGCCCAAACNONE 
Os02g0567000AK068282TAGGCCCAAATConserved hypothetical protein. 
J075034A17TAGGCCCAAATNONE 
J075129I09TAGGCCCAAATNONE 
Os02g0578400Os02g0578400GAGGCCCAAATPhotosystem II oxygen evolving complex protein PsbQ family protein. 
Os02g0580900AK120486GTGGCCCAAAATGF-beta receptor, type I/II extracellular region family protein. 
J100082N03GTGGCCCAAAANONE 
Os02g0595400AK069935CTGGCCCAAATConserved hypothetical protein. 
AK099175CTGGCCCAAATNONE 
AK103993CTGGCCCAAATNONE 
J065021M23CTGGCCCAAATNONE 
J065021M24CTGGCCCAAATNONE 
J065205M09CTGGCCCAAATNONE 
J100082C06CTGGCCCAAATNONE 
Os02g0595700006-057-E01TCTGGCCCAAACNONE 
006-082-F10TCTGGCCCAAACNONE 
006-087-C10TCTGGCCCAAACNONE 
006-091-H03TCTGGCCCAAACNONE 
006-094-A11TCTGGCCCAAACNONE 
AF145053TCTGGCCCAAACNONE 
AK064937TCTGGCCCAAACNONE 
AK066858TCTGGCCCAAACNONE 
AK104785TCTGGCCCAAACNONE 
AK119587TCTGGCCCAAACChloroplast translational elongation factor Tu. 
J013000P03TCTGGCCCAAACNONE 
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE 
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein. 
AK100281TAAGCCCACGTAGGCCCAAACNONE 
J023074H03TAAGCCCACGTAGGCCCAAACNONE 
J065002J16TAAGCCCACGTAGGCCCAAACNONE 
J065032I20TAAGCCCACGTAGGCCCAAACNONE 
J065076A07TAAGCCCACGTAGGCCCAAACNONE 
J065142O21TAAGCCCACGTAGGCCCAAACNONE 
J065203A03TAAGCCCACGTAGGCCCAAACNONE 
J075017F24TAAGCCCACGTAGGCCCAAACNONE 
J075017G24TAAGCCCACGTAGGCCCAAACNONE 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
Os02g0621600AK071074AAGGCCCAAATNONE 
AK108575AAGGCCCAAATConserved hypothetical protein. 
J023078O20AAGGCCCAAATNONE 
J075025M01AAGGCCCAAATNONE 
J090047L11AAGGCCCAAATNONE 
Os02g0622400005-010-C04GTTTGGGCCCTNONE 
AK061679GTTTGGGCCCTConserved hypothetical protein. 
J013058H01GTTTGGGCCCTNONE 
J013095D07GTTTGGGCCCTNONE 
J023054G05GTTTGGGCCCTNONE 
J023093A17GTTTGGGCCCTNONE 
J023146P16GTTTGGGCCCTNONE 
J033089D16GTTTGGGCCCTNONE 
J033099G12GTTTGGGCCCTNONE 
J033131N10GTTTGGGCCCTNONE 
J053073J04GTTTGGGCCCTNONE 
J053074P03GTTTGGGCCCTNONE 
J053075M06GTTTGGGCCCTNONE 
J053088K13GTTTGGGCCCTNONE 
J090039F18GTTTGGGCCCTNONE 
J090045M03GTTTGGGCCCTNONE 
Os02g0638300AK107831AGGGCCCAAAASimilar to Ferredoxin-thioredoxin reductase, variable chain (FTR-V) (Ferredoxin- thioredoxin reductase subunit A) (FTR-A). 
Os02g0679500AK067772AGGGCCCAAAASimilar to Rac GTPase activating protein 1. 
AY364311AGGGCCCAAAANONE 
Os02g0681100AK100584GTTTGGGCCATProtein of unknown function DUF604 family protein. 
J023106A15GTTTGGGCCATNONE 
Os02g0688900AK066093ATTTGGGCCATGPI transamidase subunit PIG-U family protein. 
J065007D18ATTTGGGCCATNONE 
J065040G21ATTTGGGCCATNONE 
J065103G03ATTTGGGCCATNONE 
J065175F18ATTTGGGCCATNONE 
J065202A07ATTTGGGCCATNONE 
J075006C01ATTTGGGCCATNONE 
J075178F24ATTTGGGCCATNONE 
Os02g0689200011-024-D04TAGGCCCAAANONE 
AK071254TAGGCCCAAANONE 
AK072660TAGGCCCAAAProtein of unknown function DUF250 domain containing protein. 
J023087G23TAGGCCCAAANONE 
J023134O11TAGGCCCAAANONE 
J033095E21TAGGCCCAAANONE 
J033113F12TAGGCCCAAANONE 
J033124F02TAGGCCCAAANONE 
J065070A01TAGGCCCAAANONE 
J065129C05TAGGCCCAAANONE 
J065165M19TAGGCCCAAANONE 
J090015K07TAGGCCCAAANONE 
J090066D21TAGGCCCAAANONE 
J090075M20TAGGCCCAAANONE 
Os02g0732900AK065796TTTTGGGCCATProtein of unknown function DUF794, plant family protein. 
AK104342TTTTGGGCCATNONE 
Os02g0736500AK065166GTTTGGGCCGGGCNicastrin family protein. 
J013099D16GTTTGGGCCGGGCNONE 
Os02g0740300AK067833TAAGCCCATTTTGGGCCTGAAA ATPase domain containing protein. 
Os02g0741500AK068867TCCGGCCCAAACRibbon-helix-helix domain containing protein. 
Os02g0744000AK064898TCCGGCCCAAACConserved hypothetical protein. 
AK104827TCCGGCCCAAACNONE 
J013000L12TCCGGCCCAAACNONE 
J013156N02TCCGGCCCAAACNONE 
J065001H14TCCGGCCCAAACNONE 
J065038D18TCCGGCCCAAACNONE 
J065039I18TCCGGCCCAAACNONE 
J065047C13TCCGGCCCAAACNONE 
J065053J09TCCGGCCCAAACNONE 
J065064G03TCCGGCCCAAACNONE 
J065066M05TCCGGCCCAAACNONE 
J065068O10TCCGGCCCAAACNONE 
J065090H22TCCGGCCCAAACNONE 
J065113L19TCCGGCCCAAACNONE 
J065121M02TCCGGCCCAAACNONE 
J065122K23TCCGGCCCAAACNONE 
J065138C12TCCGGCCCAAACNONE 
J065153E14TCCGGCCCAAACNONE 
J065156N12TCCGGCCCAAACNONE 
J065158L20TCCGGCCCAAACNONE 
J065166I06TCCGGCCCAAACNONE 
J065174L15TCCGGCCCAAACNONE 
J065175N03TCCGGCCCAAACNONE 
J090092C23TCCGGCCCAAACNONE 
Os02g0752300AK072544GCGGCCCAAATConserved hypothetical protein. 
J023132N16GCGGCCCAAATNONE 
J033069F17GCGGCCCAAATNONE 
Os02g0753200AK067176GTTTGGGCCCAAATConserved hypothetical protein. 
J013097D23GTTTGGGCCCAAATNONE 
J065085J01GTTTGGGCCCAAATNONE 
J065152L23GTTTGGGCCCAAATNONE 
J065162F18GTTTGGGCCCAAATNONE 
J075002K17GTTTGGGCCCAAATNONE 
J075047D24GTTTGGGCCCAAATNONE 
J075064A01GTTTGGGCCCAAATNONE 
J075075C09GTTTGGGCCCAAATNONE 
J075088M01GTTTGGGCCCAAATNONE 
J075130K03GTTTGGGCCCAAATNONE 
J075146K03GTTTGGGCCCAAATNONE 
J090049F07GTTTGGGCCCAAATNONE 
Os02g0753700009-083-H09TTGGCCCAAAANONE 
AK062661TTGGCCCAAAANONE 
AK103542TTGGCCCAAAAVQ domain containing protein. 
J100025D08TTGGCCCAAAANONE 
J100035B22TTGGCCCAAAANONE 
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE 
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE 
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE 
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE 
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE 
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE 
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE 
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE 
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE 
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE 
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE 
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE 
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE 
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE 
Os02g0767900009-154-G01TTTTGGGCCCATAANONE 
009-154-G01TTTTGGGCCCATATNONE 
009-172-H09TTTTGGGCCCATAANONE 
009-172-H09TTTTGGGCCCATATNONE 
AK099885TTTTGGGCCCATAAGlutaredoxin 2 family protein. 
AK099885TTTTGGGCCCATATGlutaredoxin 2 family protein. 
Os02g0768600006-034-F01TCTGGCCCGGCCCAAACNONE 
006-046-G07TCTGGCCCGGCCCAAACNONE 
006-054-C07TCTGGCCCGGCCCAAACNONE 
006-056-F07TCTGGCCCGGCCCAAACNONE 
006-100-C02TCTGGCCCGGCCCAAACNONE 
AK059725TCTGGCCCGGCCCAAACNONE 
AK098996TCTGGCCCGGCCCAAACNONE 
AK099120TCTGGCCCGGCCCAAACNONE 
AK104659TCTGGCCCGGCCCAAACNONE 
J065043H04TCTGGCCCGGCCCAAACNONE 
J075034N21TCTGGCCCGGCCCAAACNONE 
J075145C18TCTGGCCCGGCCCAAACNONE 
J080016H01TCTGGCCCGGCCCAAACNONE 
J080040F01TCTGGCCCGGCCCAAACNONE 
J080047L23TCTGGCCCGGCCCAAACNONE 
J080049B22TCTGGCCCGGCCCAAACNONE 
J080062J16TCTGGCCCGGCCCAAACNONE 
J080064C23TCTGGCCCGGCCCAAACNONE 
J080064L22TCTGGCCCGGCCCAAACNONE 
J080077N01TCTGGCCCGGCCCAAACNONE 
J080097G17TCTGGCCCGGCCCAAACNONE 
J100065L15TCTGGCCCGGCCCAAACNONE 
J100066K23TCTGGCCCGGCCCAAACNONE 
J100088C07TCTGGCCCGGCCCAAACNONE 
J100090H09TCTGGCCCGGCCCAAACNONE 
Os02g0777950J090078H24GTTTGGGCCCAAATConserved hypothetical protein. 
Os02g0791200AK120632TTTTGGGCCAAZinc finger, RING-type domain containing protein. 
J013153H21TTTTGGGCCAANONE 
J075179E08TTTTGGGCCAANONE 
J075181C07TTTTGGGCCAANONE 
Os02g0804300006-046-D12TTTTGGGCCTTNONE 
AK060165TTTTGGGCCTTNONE 
AK067584TTTTGGGCCTTSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TTTTGGGCCTTNONE 
J023098C22TTTTGGGCCTTNONE 
J033123P06TTTTGGGCCTTNONE 
J065060N24TTTTGGGCCTTNONE 
J065069H22TTTTGGGCCTTNONE 
J065155N20TTTTGGGCCTTNONE 
J065170K07TTTTGGGCCTTNONE 
J090033D12TTTTGGGCCTTNONE 
Os02g0814300AK111376ATTTGGGCCACCytochrome c, monohaem domain containing protein. 
AK111376GAGGCCCAAATCytochrome c, monohaem domain containing protein. 
AK111376TTTTGGGCCAGCytochrome c, monohaem domain containing protein. 
J065063I24ATTTGGGCCACNONE 
J065063I24GAGGCCCAAATNONE 
J065063I24TTTTGGGCCAGNONE 
Os02g0814800AK109850ATTTGGGCCGTGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0819700AK067374GTTTGGGCCGAAZinc finger, Zim17-type family protein. 
AK099160GTTTGGGCCGAANONE 
J100086K17GTTTGGGCCGAANONE 
Os02g0823600AK070498TCCGGCCCAAAConserved hypothetical protein. 
J065055C02TCCGGCCCAAANONE 
J065098A17TCCGGCCCAAANONE 
J065119B13TCCGGCCCAAANONE 
J065146F10TCCGGCCCAAANONE 
J065209G06TCCGGCCCAAANONE 
J080001K12TCCGGCCCAAANONE 
J080004O17TCCGGCCCAAANONE 
J080005P21TCCGGCCCAAANONE 
J080009M18TCCGGCCCAAANONE 
J080013O18TCCGGCCCAAANONE 
J080014B04TCCGGCCCAAANONE 
J080014O21TCCGGCCCAAANONE 
J080015B04TCCGGCCCAAANONE 
J080016B17TCCGGCCCAAANONE 
J080017G09TCCGGCCCAAANONE 
J080022A17TCCGGCCCAAANONE 
J080024M10TCCGGCCCAAANONE 
J080025F17TCCGGCCCAAANONE 
J080025O16TCCGGCCCAAANONE 
J080029H09TCCGGCCCAAANONE 
J080030G24TCCGGCCCAAANONE 
J080031E02TCCGGCCCAAANONE 
J080032A18TCCGGCCCAAANONE 
J080032G24TCCGGCCCAAANONE 
J080033C05TCCGGCCCAAANONE 
J080033N19TCCGGCCCAAANONE 
J080035H10TCCGGCCCAAANONE 
J080035L05TCCGGCCCAAANONE 
J080042N09TCCGGCCCAAANONE 
J080044C14TCCGGCCCAAANONE 
J080048K16TCCGGCCCAAANONE 
J080050L07TCCGGCCCAAANONE 
J080051L06TCCGGCCCAAANONE 
J080051P22TCCGGCCCAAANONE 
J080053D09TCCGGCCCAAANONE 
J080053J15TCCGGCCCAAANONE 
J080053O12TCCGGCCCAAANONE 
J080057L01TCCGGCCCAAANONE 
J080062E08TCCGGCCCAAANONE 
J080062I09TCCGGCCCAAANONE 
J080063A21TCCGGCCCAAANONE 
J080063E04TCCGGCCCAAANONE 
J080063E08TCCGGCCCAAANONE 
J080064D15TCCGGCCCAAANONE 
J080064N15TCCGGCCCAAANONE 
J080068F13TCCGGCCCAAANONE 
J080070L16TCCGGCCCAAANONE 
J080072O17TCCGGCCCAAANONE 
J080075A07TCCGGCCCAAANONE 
J080076H10TCCGGCCCAAANONE 
J080077K19TCCGGCCCAAANONE 
J080078E19TCCGGCCCAAANONE 
J080082A02TCCGGCCCAAANONE 
J080083O05TCCGGCCCAAANONE 
J080091I07TCCGGCCCAAANONE 
J080094K10TCCGGCCCAAANONE 
J080094N03TCCGGCCCAAANONE 
J080096F09TCCGGCCCAAANONE 
J080097O04TCCGGCCCAAANONE 
J090037B19TCCGGCCCAAANONE 
J100017A13TCCGGCCCAAANONE 
J100068N22TCCGGCCCAAANONE 
J100072C06TCCGGCCCAAANONE 
Os02g0824400AK121390GTTTGGGCCTTGConserved hypothetical protein. 
J023128P21GTTTGGGCCTTGNONE 
J053097O16GTTTGGGCCTTGNONE 
J065012I02GTTTGGGCCTTGNONE 
J065049C06GTTTGGGCCTTGNONE 
J065051H02GTTTGGGCCTTGNONE 
J065069A13GTTTGGGCCTTGNONE 
J065082E04GTTTGGGCCTTGNONE 
J065102N09GTTTGGGCCTTGNONE 
J065157O10GTTTGGGCCTTGNONE 
J065188N23GTTTGGGCCTTGNONE 
J065190J11GTTTGGGCCTTGNONE 
J065202M09GTTTGGGCCTTGNONE 
Os02g0824700009-023-E06ATTTGGGCCTCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18ATTTGGGCCTCNONE 
J065017H21ATTTGGGCCTCNONE 
J065052N02ATTTGGGCCTCNONE 
J065053M01ATTTGGGCCTCNONE 
J065064B14ATTTGGGCCTCNONE 
J065146K22ATTTGGGCCTCNONE 
Os02g0834700AK061331CTCGGCCCAAATNONE 
AK067965CTCGGCCCAAATSimilar to Cell division inhibitor. 
Os03g0113700AK103835CCTGGGCCGGCCCAAAASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925TTTTGGGCCGGCCCAGGProtein prenyltransferase domain containing protein. 
J013047E20TTTTGGGCCGGCCCAGGNONE 
J065026F21TTTTGGGCCGGCCCAGGNONE 
J065047B03TTTTGGGCCGGCCCAGGNONE 
J065054J12TTTTGGGCCGGCCCAGGNONE 
J065079M24TTTTGGGCCGGCCCAGGNONE 
J065093M07TTTTGGGCCGGCCCAGGNONE 
J065153F02TTTTGGGCCGGCCCAGGNONE 
J065155E21TTTTGGGCCGGCCCAGGNONE 
J065179H15TTTTGGGCCGGCCCAGGNONE 
J075019N02TTTTGGGCCGGCCCAGGNONE 
J075089E01TTTTGGGCCGGCCCAGGNONE 
J090066I18TTTTGGGCCGGCCCAGGNONE 
J090087K20TTTTGGGCCGGCCCAGGNONE 
J100079F05TTTTGGGCCGGCCCAGGNONE 
Os03g0123300003-131-G09ATGGCCCAAACNONE 
AK058595ATGGCCCAAACNONE 
AK070642ATGGCCCAAACSimilar to Cell cycle switch protein. 
J075056B01ATGGCCCAAACNONE 
Os03g0124300AK069148CCACGGCCCAAACConserved hypothetical protein. 
AK106076CCACGGCCCAAACNONE 
J023003G19CCACGGCCCAAACNONE 
Os03g0125000006-032-D09TGATGGGCCTAAGGCCCAAATNONE 
006-033-B05TGATGGGCCTAAGGCCCAAATNONE 
006-048-G06TGATGGGCCTAAGGCCCAAATNONE 
006-048-G09TGATGGGCCTAAGGCCCAAATNONE 
006-052-D09TGATGGGCCTAAGGCCCAAATNONE 
006-072-A04TGATGGGCCTAAGGCCCAAATNONE 
006-076-F12TGATGGGCCTAAGGCCCAAATNONE 
006-080-B03TGATGGGCCTAAGGCCCAAATNONE 
006-092-H03TGATGGGCCTAAGGCCCAAATNONE 
006-103-G04TGATGGGCCTAAGGCCCAAATNONE 
009-079-E01TGATGGGCCTAAGGCCCAAATNONE 
009-150-F03TGATGGGCCTAAGGCCCAAATNONE 
AF095708TGATGGGCCTAAGGCCCAAATNONE 
AK059557TGATGGGCCTAAGGCCCAAATNONE 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999TGATGGGCCTAAGGCCCAAATNONE 
AK104137TGATGGGCCTAAGGCCCAAATNONE 
J065002D07TGATGGGCCTAAGGCCCAAATNONE 
J065167E24TGATGGGCCTAAGGCCCAAATNONE 
J075199O14TGATGGGCCTAAGGCCCAAATNONE 
J100083L01TGATGGGCCTAAGGCCCAAATNONE 
Os03g0125700009-132-G03AAGGCCCAAAANONE 
AK062913AAGGCCCAAAAConserved hypothetical protein. 
J075046C16AAGGCCCAAAANONE 
J075115L05AAGGCCCAAAANONE 
J075143I05AAGGCCCAAAANONE 
J075197O07AAGGCCCAAAANONE 
Os03g0135600J065183G03TCCGGCCCAAAAnkyrin repeat containing protein. 
Os03g0142800015-062-B07CTGGCCCAAACNONE 
AK064325CTGGCCCAAACNONE 
Os03g0153900015-084-H06GTTTGGGCCGTANONE 
AK106420GTTTGGGCCGTAAromatic-ring hydroxylase family protein. 
Os03g0159700012-100-B09TTTTGGGCCGTANONE 
AK063559TTTTGGGCCGTAProtein prenyltransferase domain containing protein. 
J065197I24TTTTGGGCCGTANONE 
J090089G20TTTTGGGCCGTANONE 
Os03g0162200009-031-E05GTTTGGGCCGAGNONE 
013-049-D04GTTTGGGCCGAGNONE 
013-082-E03GTTTGGGCCGAGNONE 
014-039-G04GTTTGGGCCGAGNONE 
014-098-G11GTTTGGGCCGAGNONE 
AK061605GTTTGGGCCGAGNONE 
AK121533GTTTGGGCCGAGSimilar to Histone H2A. 
J033024D06GTTTGGGCCGAGNONE 
J033030P21GTTTGGGCCGAGNONE 
J065063C20GTTTGGGCCGAGNONE 
J065064A18GTTTGGGCCGAGNONE 
J065147G02GTTTGGGCCGAGNONE 
J065204K06GTTTGGGCCGAGNONE 
J090004C22GTTTGGGCCGAGNONE 
J090014K02GTTTGGGCCGAGNONE 
J090074E10GTTTGGGCCGAGNONE 
J090086L09GTTTGGGCCGAGNONE 
Os03g0167600AK121254TTTGGGCCGCSimilar to Male sterility protein 2. 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0192100AK064747ATTTGGGCCGGGCNONE 
AK105523ATTTGGGCCGGGCPeptidase S10, serine carboxypeptidase family protein. 
Os03g0210400AK065966ATTTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0219200011-045-E01CTGGCCCAAAANONE 
AK073785CTGGCCCAAAASimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19CTGGCCCAAAANONE 
J043009H23CTGGCCCAAAANONE 
Os03g0227000AK068454GTTTGGGCCAASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0232500AK110980TTTTGGGCCACGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TTTTGGGCCACNONE 
Os03g0240700009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
Os03g0249200009-103-B08AAAGCCCACATAGGCCCAAATNONE 
AK069944AAAGCCCACATAGGCCCAAATClass I peptide chain release factor domain containing protein. 
J065166E13AAAGCCCACATAGGCCCAAATNONE 
Os03g0255500AK102392ATTTGGGCCTCSimilar to Phosphoenolpyruvate carboxykinase 4 (EC 4.1.1.49) (Fragment). 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0257900009-150-G06AATTGGGCCTTTTTGGGCCGANONE 
009-181-H05AATTGGGCCTTTTTGGGCCGANONE 
AK063892AATTGGGCCTTTTTGGGCCGANONE 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK103486AATTGGGCCTTTTTGGGCCGANONE 
J023006K11AATTGGGCCTTTTTGGGCCGANONE 
J075005E15AATTGGGCCTTTTTGGGCCGANONE 
J075007K24AATTGGGCCTTTTTGGGCCGANONE 
J075034G06AATTGGGCCTTTTTGGGCCGANONE 
J075051I19AATTGGGCCTTTTTGGGCCGANONE 
J075076A08AATTGGGCCTTTTTGGGCCGANONE 
J075096H04AATTGGGCCTTTTTGGGCCGANONE 
J075115I09AATTGGGCCTTTTTGGGCCGANONE 
J075132K23AATTGGGCCTTTTTGGGCCGANONE 
J075147C17AATTGGGCCTTTTTGGGCCGANONE 
J090059O20AATTGGGCCTTTTTGGGCCGANONE 
Os03g0261500AK061995ATTTGGGCCTCNONE 
AK061995TTTGGGCCATNONE 
J013044K20ATTTGGGCCTCNONE 
J013044K20TTTGGGCCATNONE 
J033113A11ATTTGGGCCTCNONE 
J033113A11TTTGGGCCATNONE 
J100032O18ATTTGGGCCTCNONE 
J100032O18TTTGGGCCATNONE 
J100037K21ATTTGGGCCTCNONE 
J100037K21TTTGGGCCATNONE 
Os03g0263500006-112-E09GTGGGCTTGGGCCCAAAANONE 
009-122-C01GTGGGCTTGGGCCCAAAANONE 
AK106060GTGGGCTTGGGCCCAAAASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0266900013-080-C12ATTTGGGCCGAAANONE 
014-010-A09ATTTGGGCCGAAANONE 
014-013-G10ATTTGGGCCGAAANONE 
014-019-D06ATTTGGGCCGAAANONE 
014-030-F08ATTTGGGCCGAAANONE 
014-039-C05ATTTGGGCCGAAANONE 
014-053-H08ATTTGGGCCGAAANONE 
014-089-F06ATTTGGGCCGAAANONE 
014-094-A05ATTTGGGCCGAAANONE 
014-098-C12ATTTGGGCCGAAANONE 
AK119243ATTTGGGCCGAAALow molecular mass heat shock protein Oshsp17.3. 
AK119717ATTTGGGCCGAAANONE 
D12635ATTTGGGCCGAAANONE 
M80186ATTTGGGCCGAAANONE 
Os03g0277000AK100522TCTGGCCCAAAASimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0278900006-049-H12TACGGCCCAAATNONE 
006-082-A07TACGGCCCAAATNONE 
009-169-C04TACGGCCCAAATNONE 
AK066019TACGGCCCAAATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TACGGCCCAAATNONE 
AY224460TACGGCCCAAATNONE 
J065021K17TACGGCCCAAATNONE 
J065141H24TACGGCCCAAATNONE 
J065142J20TACGGCCCAAATNONE 
J065152J03TACGGCCCAAATNONE 
J065163A13TACGGCCCAAATNONE 
J065191I21TACGGCCCAAATNONE 
J065193K12TACGGCCCAAATNONE 
J075003D01TACGGCCCAAATNONE 
J075017D24TACGGCCCAAATNONE 
J075060F20TACGGCCCAAATNONE 
J075154C11TACGGCCCAAATNONE 
J075173F04TACGGCCCAAATNONE 
Os03g0283100006-097-E01ATTTGGGCCGAGNONE 
AK061849ATTTGGGCCGAGNONE 
AK065887ATTTGGGCCGAGSimilar to In2-1 protein. 
J013044J05ATTTGGGCCGAGNONE 
J013130I02ATTTGGGCCGAGNONE 
J013162M18ATTTGGGCCGAGNONE 
J023014O17ATTTGGGCCGAGNONE 
J023139N17ATTTGGGCCGAGNONE 
Os03g0293100AK060680GGCCCGGCCCAAAConserved hypothetical protein. 
J065193F02GGCCCGGCCCAAANONE 
J075003N10GGCCCGGCCCAAANONE 
Os03g0297100006-113-D12ATTTGGGCCCCACANONE 
AK059192GCGGCCCAAANONE 
AK061276ATTTGGGCCCCACASimilar to 40S ribosomal protein S7. 
AK122143GCGGCCCAAANONE 
J023012D24GCGGCCCAAANONE 
J023041A08GCGGCCCAAANONE 
J033067H08GCGGCCCAAANONE 
J033119B03ATTTGGGCCCCACANONE 
J033131K19GCGGCCCAAANONE 
J033136J20GCGGCCCAAANONE 
J053027D07GCGGCCCAAANONE 
J065191B01GCGGCCCAAANONE 
J065205G10ATTTGGGCCCCACANONE 
J075112A12GCGGCCCAAANONE 
J075136D05GCGGCCCAAANONE 
J080069C17ATTTGGGCCCCACANONE 
J090073P06GCGGCCCAAANONE 
J100026B16GCGGCCCAAANONE 
J100068P21GCGGCCCAAANONE 
J100069E15ATTTGGGCCCCACANONE 
J100081D07ATTTGGGCCCCACANONE 
J100088C15GCGGCCCAAANONE 
Os03g0302700006-099-F12ATTTGGGCCGAAANONE 
AK112010ATTTGGGCCGAAAZinc finger, RING-type domain containing protein. 
AK121656ATTTGGGCCGAAANONE 
J075090A19ATTTGGGCCGAAANONE 
J075148M06ATTTGGGCCGAAANONE 
Os03g0308900AK064183GAGGCCCAAAConserved hypothetical protein. 
Os03g0322600009-180-H12GAGGCCCAAAANONE 
AK067222GAGGCCCAAAAHypothetical protein. 
J065017H05GAGGCCCAAAANONE 
J065118G12GAGGCCCAAAANONE 
J065175F07GAGGCCCAAAANONE 
J065175N14GAGGCCCAAAANONE 
Os03g0324800AK059868AATGGGCCCAAACNONE 
AK059868GAGGCCCAAATNONE 
AK071431AATGGGCCCAAACHypothetical protein. 
AK071431GAGGCCCAAATHypothetical protein. 
Os03g0347800AK073756TCGGCCCAAACPeptidyl-tRNA hydrolase family protein. 
Os03g0360500009-103-B05ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK059166ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK101285ATTTGGGCCCAAAGTGGCCCAGTProtein of unknown function DUF1077 family protein. 
J033061G19ATTTGGGCCCAAAGTGGCCCAGTNONE 
J065169P12ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075104C18ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075166G07ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075170J04ATTTGGGCCCAAAGTGGCCCAGTNONE 
Os03g0411000AK072079GGGGCCCAAAApoptosis inhibitory 5 family protein. 
AK120207GGGGCCCAAANONE 
J013038J18GGGGCCCAAANONE 
J013063P09GGGGCCCAAANONE 
J013118N09GGGGCCCAAANONE 
J033022P08GGGGCCCAAANONE 
J033043E22GGGGCCCAAANONE 
J033094K23GGGGCCCAAANONE 
J033118J19GGGGCCCAAANONE 
J043010M20GGGGCCCAAANONE 
J065006E09GGGGCCCAAANONE 
J065011M01GGGGCCCAAANONE 
J065044F22GGGGCCCAAANONE 
J065131F15GGGGCCCAAANONE 
J065147G04GGGGCCCAAANONE 
J065154C20GGGGCCCAAANONE 
J065158H17GGGGCCCAAANONE 
J090011G09GGGGCCCAAANONE 
J090030I09GGGGCCCAAANONE 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0598200AK068322TTTTGGGCCTCNop14-like protein family protein. 
Os03g0625900AK101109CGGGCCCAAAAWD40-like domain containing protein. 
Os03g0628900009-062-G01ATTTGGGCCCGGGNONE 
AK103619ATTTGGGCCCGGGPrefoldin domain containing protein. 
J033133L23ATTTGGGCCCGGGNONE 
J100039C17ATTTGGGCCCGGGNONE 
J100048I07ATTTGGGCCCGGGNONE 
J100062E19ATTTGGGCCCGGGNONE 
J100063B11ATTTGGGCCCGGGNONE 
Os03g0646300AK069229TTGGCCCAAAASimilar to Cyclic nucleotide-gated channel A (Fragment). 
AK069229TTTTGGGCCGCSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0683700AK065067TAGGCCCAAAGGCCCAGGProtein of unknown function DUF810 family protein. 
Os03g0685000009-031-F08GCGGCCCAAACNONE 
AK059896GCGGCCCAAACSimilar to Ferredoxin. 
AK098989GCGGCCCAAACNONE 
AK099303GCGGCCCAAACNONE 
J065041E14GCGGCCCAAACNONE 
J065085G22GCGGCCCAAACNONE 
Os03g0701900AK068404CTGGCCCAAAAConserved hypothetical protein. 
Os03g0708600AK069199CACGGCCCAAATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CACGGCCCAAATNONE 
J023008E04CACGGCCCAAATNONE 
J023030D22CACGGCCCAAATNONE 
J033027E16CACGGCCCAAATNONE 
J033046D09CACGGCCCAAATNONE 
J033068I10CACGGCCCAAATNONE 
J033135A12CACGGCCCAAATNONE 
J065027E22CACGGCCCAAATNONE 
J065191K23CACGGCCCAAATNONE 
J090054D15CACGGCCCAAATNONE 
J090058J15CACGGCCCAAATNONE 
Os03g0712200AK073205TCGGCCCAAACZinc finger, RanBP2-type domain containing protein. 
AK098968TCGGCCCAAACNONE 
Os03g0726900AK072553GGCCCGTTTGGGCCACConserved hypothetical protein. 
AK100280GGCCCGTTTGGGCCACNONE 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0740800AK071772CAGGCCCAAAAXRCC4, N-terminal domain containing protein. 
J023110F02CAGGCCCAAAANONE 
J075054I11CAGGCCCAAAANONE 
Os03g0752800AB041020GACGGCCCAAAANONE 
AF058697GACGGCCCAAAAMADS14 protein. 
AF139664GACGGCCCAAAANONE 
AK121171GACGGCCCAAAANONE 
AY332478GACGGCCCAAAANONE 
AY551916GACGGCCCAAAANONE 
J023081C04GACGGCCCAAAANONE 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0785500AK067718ACATGGGCCCAAACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0793100AK067897GTTTGGGCCACGlycosyl transferase, family 43 protein. 
J033125G24GTTTGGGCCACNONE 
J065132N21GTTTGGGCCACNONE 
Os03g0801800AK067130CAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J090079D17CAGGCCCAAACNONE 
J090087F23CAGGCCCAAACNONE 
Os03g0807200011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0821900AK070847ATTTGGGCCATSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0833700011-060-A10ATTTGGGCCTANONE 
AK121918ATTTGGGCCTARNA 3'-terminal phosphate cyclase family protein. 
Os03g0848100J013028M09GAGGCCCAAACNONE 
J065080L17GAGGCCCAAACNONE 
J065083C11GAGGCCCAAACNONE 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
006-098-C01TTTGGGCCGGCNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK060496TTTGGGCCGGCSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK102202TTTGGGCCGGCNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
AK104157TTTGGGCCGGCNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTTGGGCCGGCNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTTGGGCCGGCNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTTGGGCCGGCNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTTGGGCCGGCNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTTGGGCCGGCNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTTGGGCCGGCNONE 
Os03g0851900AK102145TTTTGGGCCTCAFG1-like ATPase family protein. 
J033086B08TTTTGGGCCTCNONE 
Os03g0855700AK070400ATGGCCCAAATNucleic acid-binding, OB-fold domain containing protein. 
Os03g0858700006-024-D11TTTTGGGCCTTGNONE 
AK061723TTTTGGGCCTTGProtein of unknown function DUF1499 family protein. 
AK064976TTTTGGGCCTTGNONE 
J013001B23TTTTGGGCCTTGNONE 
Os04g0208500015-079-C10GTTTGGGCCATNONE 
AK106410GTTTGGGCCATCyclin-like F-box domain containing protein. 
Os04g0305700009-180-E11TTTTGGGCCTANONE 
AK068128TTTTGGGCCTAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK105689TTTTGGGCCTANONE 
J065026K17TTTTGGGCCTANONE 
J065122C23TTTTGGGCCTANONE 
Os04g0378200AK103076ACCGGCCCAAACSterile alpha motif SAM domain containing protein. 
J033118E02ACCGGCCCAAACNONE 
J065065F15ACCGGCCCAAACNONE 
J090080I24ACCGGCCCAAACNONE 
Os04g0388900AK063224GAGGCCCAAASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19GAGGCCCAAANONE 
J065148P22GAGGCCCAAANONE 
J075040G12GAGGCCCAAANONE 
Os04g0436800015-053-A06CAAGGCCCAAAANONE 
AK101115CAAGGCCCAAAAProtein prenyltransferase domain containing protein. 
J033025G14CAAGGCCCAAAANONE 
J033073N23CAAGGCCCAAAANONE 
J033097L19CAAGGCCCAAAANONE 
Os04g0445200009-034-A06GAGGCCCAAATNONE 
AK062427GAGGCCCAAATProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720GAGGCCCAAATNONE 
J065022E20GAGGCCCAAATNONE 
J065062D16GAGGCCCAAATNONE 
J065081I02GAGGCCCAAATNONE 
J065087C10GAGGCCCAAATNONE 
J065116N16GAGGCCCAAATNONE 
J065132F10GAGGCCCAAATNONE 
J065140F18GAGGCCCAAATNONE 
J065143M22GAGGCCCAAATNONE 
J065158K17GAGGCCCAAATNONE 
J065162D07GAGGCCCAAATNONE 
J065207H19GAGGCCCAAATNONE 
J075155B20GAGGCCCAAATNONE 
J075167E24GAGGCCCAAATNONE 
J075178B19GAGGCCCAAATNONE 
J080301D22GAGGCCCAAATNONE 
J080301J15GAGGCCCAAATNONE 
J080308J02GAGGCCCAAATNONE 
Os04g0449000AK064234ATTTGGGCCGNONE 
AK105976ATTTGGGCCGNONE 
Os04g0457700J075145N15TTTGGGCCTCGCGCGCConserved hypothetical protein. 
Os04g0465000AK060688TAGGCCCAAAANONE 
AK102302TAGGCCCAAAASterile alpha motif homology domain containing protein. 
J023084D14TAGGCCCAAAANONE 
J023086J22TAGGCCCAAAANONE 
Os04g0476600014-086-A01TTTGGGCCTGANONE 
015-073-B12TTTGGGCCTGANONE 
AK105466TTTGGGCCTGAC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0477900006-046-B01ATTTGGGCCGCANONE 
006-103-C03ATTTGGGCCGCANONE 
006-106-F09ATTTGGGCCGCANONE 
009-093-B07ATTTGGGCCGCANONE 
AK059948ATTTGGGCCGCASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTTGGGCCGCANONE 
J013158A11ATTTGGGCCGCANONE 
J023050E17ATTTGGGCCGCANONE 
J023078J03ATTTGGGCCGCANONE 
J033027G18ATTTGGGCCGCANONE 
J033086G10ATTTGGGCCGCANONE 
J090060G14ATTTGGGCCGCANONE 
Os04g0480900AK109889AGTTGGGCTTTGGGCCCCAGlycoside hydrolase, family 5 protein. 
Os04g0482300015-088-C07GGTGGGCCCAAACNONE 
AK064143GGTGGGCCCAAACBTB domain containing protein. 
J065053L16GGTGGGCCCAAACNONE 
J065053N15GGTGGGCCCAAACNONE 
Os04g0495900AK061559TACGGCCCAAAAConserved hypothetical protein. 
Os04g0503800J065116G03TTTTGGGCCAGNONE 
Os04g0509500AK107601TTGGCCCAAACSimilar to Ammonium transporter Amt1;1 (Fragment). 
Os04g0520900AK068793TAGGCCCAAATProtein prenyltransferase domain containing protein. 
AK068793TCTCGGCCCAAATProtein prenyltransferase domain containing protein. 
AK105606TAGGCCCAAATNONE 
AK105606TCTCGGCCCAAATNONE 
Os04g0530000009-106-E11CACGGCCCAAAANONE 
011-012-E12CACGGCCCAAAANONE 
AK066169CACGGCCCAAAAConserved hypothetical protein. 
J013052P20CACGGCCCAAAANONE 
J090060G12CACGGCCCAAAANONE 
J100073H10CACGGCCCAAAANONE 
Os04g0542900AK068610AAGGCCCAAACConserved hypothetical protein. 
Os04g0547600AK109141TTTGGGCCTTPathogenesis-related transcriptional factor and ERF domain containing protein. 
AY339379TTTGGGCCTTNONE 
J065112J12TTTGGGCCTTNONE 
Os04g0551300AK103502AGGGCCCAAAASimilar to Growth regulator like protein. 
Os04g0551800016-049-G12GTTTGGGCCGGTNONE 
AK121568GTTTGGGCCGGTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06GTTTGGGCCGGTNONE 
J013111B11GTTTGGGCCGGTNONE 
J013121H23GTTTGGGCCGGTNONE 
J023012A17GTTTGGGCCGGTNONE 
J023092M05GTTTGGGCCGGTNONE 
J033026P14GTTTGGGCCGGTNONE 
J033033C10GTTTGGGCCGGTNONE 
J033033M10GTTTGGGCCGGTNONE 
J033035C24GTTTGGGCCGGTNONE 
J033052E19GTTTGGGCCGGTNONE 
J033140K19GTTTGGGCCGGTNONE 
J065036F18GTTTGGGCCGGTNONE 
J065067L12GTTTGGGCCGGTNONE 
J065095G09GTTTGGGCCGGTNONE 
J065115B08GTTTGGGCCGGTNONE 
J065218E24GTTTGGGCCGGTNONE 
J090002N13GTTTGGGCCGGTNONE 
J090008B12GTTTGGGCCGGTNONE 
J090016F24GTTTGGGCCGGTNONE 
J090019H14GTTTGGGCCGGTNONE 
J090020G20GTTTGGGCCGGTNONE 
J090029L18GTTTGGGCCGGTNONE 
J090057C23GTTTGGGCCGGTNONE 
J090073H23GTTTGGGCCGGTNONE 
J090081C16GTTTGGGCCGGTNONE 
J090081E21GTTTGGGCCGGTNONE 
J090084L14GTTTGGGCCGGTNONE 
J090086M01GTTTGGGCCGGTNONE 
J090089E16GTTTGGGCCGGTNONE 
J100031P12GTTTGGGCCGGTNONE 
J100090N23GTTTGGGCCGGTNONE 
Os04g0573200AK065277AAGGCCCAAACNONE 
AK120348AAGGCCCAAACHeavy metal transport/detoxification protein domain containing protein. 
Os04g0581300009-171-H01ATTTGGGCCTTTTTGGGCCTANONE 
AK063093ATTTGGGCCTTTTTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0585600006-117-A02TCTGGCCCAAAANONE 
AK106073TCTGGCCCAAAAConserved hypothetical protein. 
J053089I23TCTGGCCCAAAANONE 
J065112K06TCTGGCCCAAAANONE 
J065128D09TCTGGCCCAAAANONE 
J100038D09TCTGGCCCAAAANONE 
Os04g0592500AK066893TACGGCCCAAAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TACGGCCCAAAANONE 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
Os04g0610500006-115-C07TACGGCCCAAATNONE 
AK066289TACGGCCCAAATPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817TACGGCCCAAATNONE 
J013096N09TACGGCCCAAATNONE 
J023054I11TACGGCCCAAATNONE 
J023121P20TACGGCCCAAATNONE 
J053039O20TACGGCCCAAATNONE 
J053071L20TACGGCCCAAATNONE 
J053088H23TACGGCCCAAATNONE 
J053096J03TACGGCCCAAATNONE 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
Os04g0612800016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0625600AK070994TTTTGGGCCGGATRAF-like domain containing protein. 
J023080H04TTTTGGGCCGGANONE 
J023086H15TTTTGGGCCGGANONE 
J033037L21TTTTGGGCCGGANONE 
J033044P14TTTTGGGCCGGANONE 
J065075C23TTTTGGGCCGGANONE 
J065167C18TTTTGGGCCGGANONE 
J100024E02TTTTGGGCCGGANONE 
J100068N24TTTTGGGCCGGANONE 
J100070G20TTTTGGGCCGGANONE 
Os04g0640800AK065522GTTTGGGCCGTCProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0658100AK065495CAACGGCCCAAAAHistone-fold domain containing protein. 
J013021B22CAACGGCCCAAAANONE 
J065054D12CAACGGCCCAAAANONE 
J065135I05CAACGGCCCAAAANONE 
J065198F14CAACGGCCCAAAANONE 
J090027O06CAACGGCCCAAAANONE 
Os04g0658300AK067399ATTTGGGCCCATTASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0660600009-113-A11TTGTGGGCCCAAACNONE 
AK120899TTGTGGGCCCAAACATPase, V0 complex, subunit H family protein. 
J023030J05TTGTGGGCCCAAACNONE 
J065068M07TTGTGGGCCCAAACNONE 
J065120G22TTGTGGGCCCAAACNONE 
J065168J18TTGTGGGCCCAAACNONE 
J065211M10TTGTGGGCCCAAACNONE 
J075175E21TTGTGGGCCCAAACNONE 
J090021C06TTGTGGGCCCAAACNONE 
J090032P15TTGTGGGCCCAAACNONE 
J090082E05TTGTGGGCCCAAACNONE 
J100090O11TTGTGGGCCCAAACNONE 
Os04g0665000009-149-A12TCCGGCCCAAAANONE 
AK062995TCCGGCCCAAAACHCH domain containing protein. 
J065017G19TCCGGCCCAAAANONE 
J080301G12TCCGGCCCAAAANONE 
Os04g0665700013-084-D06GAGGCCCAAAGCCCAACTNONE 
013-084-D06GTGGCCCAAAGCCCAAGNONE 
AK121951GAGGCCCAAAGCCCAACTZinc finger, CCCH-type domain containing protein. 
AK121951GTGGCCCAAAGCCCAAGZinc finger, CCCH-type domain containing protein. 
J013020L20GAGGCCCAAAGCCCAACTNONE 
J013020L20GTGGCCCAAAGCCCAAGNONE 
J033034K12GAGGCCCAAAGCCCAACTNONE 
J033034K12GTGGCCCAAAGCCCAAGNONE 
J033107K04GAGGCCCAAAGCCCAACTNONE 
J033107K04GTGGCCCAAAGCCCAAGNONE 
J065044C03GAGGCCCAAAGCCCAACTNONE 
J065044C03GTGGCCCAAAGCCCAAGNONE 
J065103I10GAGGCCCAAAGCCCAACTNONE 
J065103I10GTGGCCCAAAGCCCAAGNONE 
J065106P15GAGGCCCAAAGCCCAACTNONE 
J065106P15GTGGCCCAAAGCCCAAGNONE 
J075061O20GAGGCCCAAAGCCCAACTNONE 
J075061O20GTGGCCCAAAGCCCAAGNONE 
J075091P11GAGGCCCAAAGCCCAACTNONE 
J075091P11GTGGCCCAAAGCCCAAGNONE 
J075095A18GAGGCCCAAAGCCCAACTNONE 
J075095A18GTGGCCCAAAGCCCAAGNONE 
J075117C22GAGGCCCAAAGCCCAACTNONE 
J075117C22GTGGCCCAAAGCCCAAGNONE 
J075166B22GAGGCCCAAAGCCCAACTNONE 
J075166B22GTGGCCCAAAGCCCAAGNONE 
J075198L04GAGGCCCAAAGCCCAACTNONE 
J075198L04GTGGCCCAAAGCCCAAGNONE 
J090032K13GAGGCCCAAAGCCCAACTNONE 
J090032K13GTGGCCCAAAGCCCAAGNONE 
J090045E22GAGGCCCAAAGCCCAACTNONE 
J090045E22GTGGCCCAAAGCCCAAGNONE 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
J065195K10GGGGCCCAGGCCCAAAANONE 
Os05g0103500AK060306ATGGCCCAAACHCH domain containing protein. 
AK102829ATGGCCCAAANONE 
J033109D16ATGGCCCAAANONE 
J043016E20ATGGCCCAAANONE 
J065001C14ATGGCCCAAANONE 
J065116L24ATGGCCCAAANONE 
J075018E04ATGGCCCAAANONE 
J075045E18ATGGCCCAAANONE 
J075093G20ATGGCCCAAANONE 
J075171A09ATGGCCCAAANONE 
J100029F18ATGGCCCAAANONE 
J100046I24ATGGCCCAAANONE 
Os05g0106100009-186-E05CAGGCCCAAAANONE 
013-067-H01CAGGCCCAAAANONE 
AK063178CAGGCCCAAAASimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
J065010J15CAGGCCCAAAANONE 
J065073M24CAGGCCCAAAANONE 
J065077A22CAGGCCCAAAANONE 
J065167I04CAGGCCCAAAANONE 
J075084F11CAGGCCCAAAANONE 
J075086M18CAGGCCCAAAANONE 
Os05g0110500AK060179TACGGCCCAAATNONE 
AK066175TACGGCCCAAATSimilar to RNA helicase (Fragment). 
J013055E22TACGGCCCAAATNONE 
J090056E03TACGGCCCAAATNONE 
Os05g0121000009-181-E02GTTTGGGCCCACTAGGCCCAACCNONE 
AK058867GTTTGGGCCCACTAGGCCCAACCNONE 
AK071341GTTTGGGCCCACTAGGCCCAACCProtein of unknown function DUF1218 family protein. 
J023024H24GTTTGGGCCCACTAGGCCCAACCNONE 
J023090B22GTTTGGGCCCACTAGGCCCAACCNONE 
J023111G15GTTTGGGCCCACTAGGCCCAACCNONE 
J023134K14GTTTGGGCCCACTAGGCCCAACCNONE 
J033057C05GTTTGGGCCCACTAGGCCCAACCNONE 
J033067J15GTTTGGGCCCACTAGGCCCAACCNONE 
J033084L15GTTTGGGCCCACTAGGCCCAACCNONE 
J033088B04GTTTGGGCCCACTAGGCCCAACCNONE 
J043027A08GTTTGGGCCCACTAGGCCCAACCNONE 
J043029L03GTTTGGGCCCACTAGGCCCAACCNONE 
J053031K22GTTTGGGCCCACTAGGCCCAACCNONE 
J053046I01GTTTGGGCCCACTAGGCCCAACCNONE 
J053070B05GTTTGGGCCCACTAGGCCCAACCNONE 
J053072C10GTTTGGGCCCACTAGGCCCAACCNONE 
J065097M22GTTTGGGCCCACTAGGCCCAACCNONE 
J065164I17GTTTGGGCCCACTAGGCCCAACCNONE 
J075058I08GTTTGGGCCCACTAGGCCCAACCNONE 
J075064C09GTTTGGGCCCACTAGGCCCAACCNONE 
J080304C16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304H16GTTTGGGCCCACTAGGCCCAACCNONE 
J080306E17GTTTGGGCCCACTAGGCCCAACCNONE 
J080310L03GTTTGGGCCCACTAGGCCCAACCNONE 
J080316J07GTTTGGGCCCACTAGGCCCAACCNONE 
J080317L23GTTTGGGCCCACTAGGCCCAACCNONE 
J080319A10GTTTGGGCCCACTAGGCCCAACCNONE 
J090060F01GTTTGGGCCCACTAGGCCCAACCNONE 
J100042N16GTTTGGGCCCACTAGGCCCAACCNONE 
J100047F05GTTTGGGCCCACTAGGCCCAACCNONE 
J100075J19GTTTGGGCCCACTAGGCCCAACCNONE 
Os05g0122900009-052-C11CCACGGCCCAAATNONE 
009-132-C12CCACGGCCCAAATNONE 
014-091-G03CCACGGCCCAAATNONE 
AB072977CCACGGCCCAAATNONE 
AK071296CCACGGCCCAAATNONE 
AK099375CCACGGCCCAAATNONE 
AK104970CCACGGCCCAAATBLE1 protein. 
J065007I09CCACGGCCCAAATNONE 
J065081H07CCACGGCCCAAATNONE 
J065122B18CCACGGCCCAAATNONE 
J065181G15CCACGGCCCAAATNONE 
J065182J07CCACGGCCCAAATNONE 
J065197D23CCACGGCCCAAATNONE 
J065197G08CCACGGCCCAAATNONE 
J065201H20CCACGGCCCAAATNONE 
J090034E11CCACGGCCCAAATNONE 
J100077M04CCACGGCCCAAATNONE 
Os05g0125600AK102952AAGGCCCAAAProtein of unknown function DUF1677, Oryza sativa family protein. 
J033115D18AAGGCCCAAANONE 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
J033091I05GTTTGGGCCTAGGCCCACCCGNONE 
Os05g0155100006-075-B02AAGGCCCAAACCAGCCCACAANONE 
AK061929AAGGCCCAAACCAGCCCACAANONE 
AK102810AAGGCCCAAACCAGCCCACAANONE 
AK120877AAGGCCCAAACCAGCCCACAASimilar to 60S ribosomal protein L18. 
J013023E03AAGGCCCAAACCAGCCCACAANONE 
J013038C16AAGGCCCAAACCAGCCCACAANONE 
J013120M14AAGGCCCAAACCAGCCCACAANONE 
J013153B04AAGGCCCAAACCAGCCCACAANONE 
J013159B07AAGGCCCAAACCAGCCCACAANONE 
J023012A02AAGGCCCAAACCAGCCCACAANONE 
J023027F08AAGGCCCAAACCAGCCCACAANONE 
J023027I12AAGGCCCAAACCAGCCCACAANONE 
J023120F05AAGGCCCAAACCAGCCCACAANONE 
J023138O03AAGGCCCAAACCAGCCCACAANONE 
J023142H13AAGGCCCAAACCAGCCCACAANONE 
J023143P06AAGGCCCAAACCAGCCCACAANONE 
J033023P09AAGGCCCAAACCAGCCCACAANONE 
J033035O14AAGGCCCAAACCAGCCCACAANONE 
J033042N19AAGGCCCAAACCAGCCCACAANONE 
J033043B12AAGGCCCAAACCAGCCCACAANONE 
J033065D10AAGGCCCAAACCAGCCCACAANONE 
J033081A12AAGGCCCAAACCAGCCCACAANONE 
J033084N05AAGGCCCAAACCAGCCCACAANONE 
J033085M03AAGGCCCAAACCAGCCCACAANONE 
J033112D15AAGGCCCAAACCAGCCCACAANONE 
J033114O07AAGGCCCAAACCAGCCCACAANONE 
J033119D15AAGGCCCAAACCAGCCCACAANONE 
J033140E06AAGGCCCAAACCAGCCCACAANONE 
J033141K23AAGGCCCAAACCAGCCCACAANONE 
J043040I22AAGGCCCAAACCAGCCCACAANONE 
J053050B21AAGGCCCAAACCAGCCCACAANONE 
J053065I18AAGGCCCAAACCAGCCCACAANONE 
J053074O16AAGGCCCAAACCAGCCCACAANONE 
J065072K13AAGGCCCAAACCAGCCCACAANONE 
J065211I09AAGGCCCAAACCAGCCCACAANONE 
J090004K04AAGGCCCAAACCAGCCCACAANONE 
J090016L06AAGGCCCAAACCAGCCCACAANONE 
J090040F22AAGGCCCAAACCAGCCCACAANONE 
J090063F22AAGGCCCAAACCAGCCCACAANONE 
J090081J09AAGGCCCAAACCAGCCCACAANONE 
J100032A10AAGGCCCAAACCAGCCCACAANONE 
J100037G20AAGGCCCAAACCAGCCCACAANONE 
J100056O10AAGGCCCAAACCAGCCCACAANONE 
J100071D10AAGGCCCAAACCAGCCCACAANONE 
J100075K13AAGGCCCAAACCAGCCCACAANONE 
J100079F16AAGGCCCAAACCAGCCCACAANONE 
J100080O16AAGGCCCAAACCAGCCCACAANONE 
J100086N05AAGGCCCAAACCAGCCCACAANONE 
Os05g0177100AK064652CAAGGCCCAAATConserved hypothetical protein. 
Os05g0198700Os05g0198700TTTGGGCCACREX1 DNA Repair family protein. 
Os05g0215500AK070424ATTTGGGCCATHypothetical protein. 
J023050J01ATTTGGGCCATNONE 
Os05g0223200015-037-E09CACGGCCCAAANONE 
AK106308CACGGCCCAAASimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17CACGGCCCAAANONE 
J065056N06CACGGCCCAAANONE 
J065080I11CACGGCCCAAANONE 
J065104F11CACGGCCCAAANONE 
J065183L10CACGGCCCAAANONE 
J065185H12CACGGCCCAAANONE 
J065186N17CACGGCCCAAANONE 
Os05g0226300AK067770ATTTGGGCCTTConserved hypothetical protein. 
J013120H22ATTTGGGCCTTNONE 
J013146E15ATTTGGGCCTTNONE 
Os05g0243200009-073-F12GGGGCCCAAAANONE 
AK061317GGGGCCCAAAASimilar to Ribosomal protein L13. 
J065120F21GGGGCCCAAAANONE 
J065185K05GGGGCCCAAAANONE 
Os05g0244600009-176-H11TTATGGGCCCAAATGAAGCCCACNONE 
AK073979TTATGGGCCCAAATGAAGCCCACNucleic acid-binding, OB-fold domain containing protein. 
J065085L13TTATGGGCCCAAATGAAGCCCACNONE 
J065086F22TTATGGGCCCAAATGAAGCCCACNONE 
J065124H03TTATGGGCCCAAATGAAGCCCACNONE 
J065170C22TTATGGGCCCAAATGAAGCCCACNONE 
J065197K01TTATGGGCCCAAATGAAGCCCACNONE 
J075110M09TTATGGGCCCAAATGAAGCCCACNONE 
J090074F17TTATGGGCCCAAATGAAGCCCACNONE 
J100071O17TTATGGGCCCAAATGAAGCCCACNONE 
Os05g0339200AK111022CAGGCCCAAAAConserved hypothetical protein. 
Os05g0357100AK102042AAGGCCCAAAA3'-5' exonuclease domain containing protein. 
J033081J05AAGGCCCAAAANONE 
J100022A18AAGGCCCAAAANONE 
Os05g0386900009-015-C03TTTGGGCCTTGNONE 
AK059319TTTGGGCCTTGNONE 
Os05g0388500AK065313TTTTGGGCCCAATCCGACGSimilar to 50S ribosomal protein L1. 
AK098990TTTTGGGCCCAATCCGACGNONE 
AK104689TTTTGGGCCCAATCCGACGNONE 
J013094L23TTTTGGGCCCAATCCGACGNONE 
J065118O04TTTTGGGCCCAATCCGACGNONE 
Os05g0412800AF402803GCCCGGCCGGCCCAAATSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0415600AK065818GCGGCCCAAAANONE 
J013042K21GCGGCCCAAAANONE 
J013114E15GCGGCCCAAAANONE 
J013131H02GCGGCCCAAAANONE 
J023041G06GCGGCCCAAAANONE 
J100037M21GCGGCCCAAAANONE 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
Os05g0437200014-036-D04GCGGCCCAAAANONE 
AK059283GCGGCCCAAAANONE 
AK121867GCGGCCCAAAAProtein of unknown function DUF502 family protein. 
Os05g0456000AK058420GCGTGGGCGTGTGGCCCAAAAMitochondrial glycoprotein family protein. 
AK102036GCGTGGGCGTGTGGCCCAAAANONE 
J065066F02GCGTGGGCGTGTGGCCCAAAANONE 
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH. 
Os05g0487600AK100817CAAGGCCCAAACNONE 
AK103104CAAGGCCCAAACNONE 
J043027P10CAAGGCCCAAACNONE 
J065183N17CAAGGCCCAAACNONE 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0520200006-031-F07AAGGCCCAAACNONE 
AK061451AAGGCCCAAACThioredoxin-related domain containing protein. 
AK099433AAGGCCCAAACNONE 
Os05g0528200009-146-C01GAGGCCCAAACNONE 
AK062985GAGGCCCAAACSimilar to 50S ribosomal protein L20. 
Os05g0542300009-050-C12ATTTGGGCCGGCNONE 
009-185-D06ATTTGGGCCGGCNONE 
AK062488ATTTGGGCCGGCConserved hypothetical protein. 
Os05g0555300009-032-C03GTTTGGGCCCTNONE 
009-125-E08GTTTGGGCCCTNONE 
009-149-C12GTTTGGGCCCTNONE 
009-172-C01GTTTGGGCCCTNONE 
AK062890GTTTGGGCCCTFerredoxin domain containing protein. 
AK062997GTTTGGGCCCTNONE 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
J013074C15GAAGCCCAAGGCCCAAACNONE 
J013098O16GAAGCCCAAGGCCCAAACNONE 
J033030M01GAAGCCCAAGGCCCAAACNONE 
J090058H12GAAGCCCAAGGCCCAAACNONE 
J090075M06GAAGCCCAAGGCCCAAACNONE 
Os05g0565000AK102673TCCGGCCCAAACSimilar to 60S ribosomal protein L18a-1. 
J033102C12TCCGGCCCAAACNONE 
J033124C13TCCGGCCCAAACNONE 
J043003L04TCCGGCCCAAACNONE 
J043006N08TCCGGCCCAAACNONE 
Os05g0567300013-039-F11TTTTGGGCCAGCCCAAGNONE 
AK112068TTTTGGGCCAGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0571400009-019-B04AGCCCATGCGGCCCAAAANONE 
009-043-H02AGCCCATGCGGCCCAAAANONE 
AK062369AGCCCATGCGGCCCAAAAConserved hypothetical protein. 
Os05g0589000AK061980GACGGCCCAAACGCGGAGAGNONE 
AK099181GACGGCCCAAACGCGGAGAGConserved hypothetical protein. 
Os05g0591400AK120015GAGGCCCAAATHeat shock protein Hsp70 family protein. 
Os06g0113600016-067-E03ATTTGGGCCGGANONE 
016-067-E03ATTTGGGCCTCCCATGGGCCATNONE 
AK062095ATTTGGGCCGGANONE 
AK062095ATTTGGGCCTCCCATGGGCCATNONE 
AK101235ATTTGGGCCGGACyclin-like F-box domain containing protein. 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCGGANONE 
AK122025ATTTGGGCCTCCCATGGGCCATNONE 
J013022O19ATTTGGGCCGGANONE 
J013022O19ATTTGGGCCTCCCATGGGCCATNONE 
J023045P05ATTTGGGCCGGANONE 
J023045P05ATTTGGGCCTCCCATGGGCCATNONE 
J033031K01ATTTGGGCCGGANONE 
J033031K01ATTTGGGCCTCCCATGGGCCATNONE 
J033034I09ATTTGGGCCGGANONE 
J033034I09ATTTGGGCCTCCCATGGGCCATNONE 
J033041O04ATTTGGGCCGGANONE 
J033041O04ATTTGGGCCTCCCATGGGCCATNONE 
J033071K03ATTTGGGCCGGANONE 
J033071K03ATTTGGGCCTCCCATGGGCCATNONE 
J033075K16ATTTGGGCCGGANONE 
J033075K16ATTTGGGCCTCCCATGGGCCATNONE 
J033097M01ATTTGGGCCGGANONE 
J033097M01ATTTGGGCCTCCCATGGGCCATNONE 
J033099M22ATTTGGGCCGGANONE 
J033099M22ATTTGGGCCTCCCATGGGCCATNONE 
J033108N15ATTTGGGCCGGANONE 
J033108N15ATTTGGGCCTCCCATGGGCCATNONE 
J033121D18ATTTGGGCCGGANONE 
J033121D18ATTTGGGCCTCCCATGGGCCATNONE 
J033125O06ATTTGGGCCGGANONE 
J033125O06ATTTGGGCCTCCCATGGGCCATNONE 
J033139M16ATTTGGGCCGGANONE 
J033139M16ATTTGGGCCTCCCATGGGCCATNONE 
J033145P18ATTTGGGCCGGANONE 
J033145P18ATTTGGGCCTCCCATGGGCCATNONE 
J033149D05ATTTGGGCCGGANONE 
J033149D05ATTTGGGCCTCCCATGGGCCATNONE 
Os06g0114600015-077-E06ATGGCCCAAANONE 
AK067972ATGGCCCAAAConserved hypothetical protein. 
Os06g0116400006-082-G06TAGGCCCAAACNONE 
AK058327TAGGCCCAAACNONE 
AK105979TAGGCCCAAACHigh-affinity nickel-transporter family protein. 
J065083I24TAGGCCCAAACNONE 
J100072O18TAGGCCCAAACNONE 
Os06g0128500AK058563ATTTGGGCCTGARibosomal protein L47, mitochondrial family protein. 
AK122132ATTTGGGCCTGANONE 
J033133F04ATTTGGGCCTGANONE 
J065094M24ATTTGGGCCTGANONE 
J065122J07ATTTGGGCCTGANONE 
J065137G10ATTTGGGCCTGANONE 
J065178L09ATTTGGGCCTGANONE 
J080011E11ATTTGGGCCTGANONE 
J080020G21ATTTGGGCCTGANONE 
J080039H03ATTTGGGCCTGANONE 
J080039J04ATTTGGGCCTGANONE 
Os06g0144000AK068998TTTTGGGCCCCAGBRCT domain containing protein. 
J023001F16TTTTGGGCCCCAGNONE 
Os06g0146900AK071352CCAGGCCCAAAHypothetical protein. 
J065068D05CCAGGCCCAAANONE 
J075036G17CCAGGCCCAAANONE 
Os06g0152800003-125-D04ATTTGGGCCGGCCCAGGNONE 
AK099578ATTTGGGCCGGCCCAGGConserved hypothetical protein. 
Os06g0187900009-171-C09CCAGGCCCAAACNONE 
009-171-C09CGGGCCCAAANONE 
AK063879CCAGGCCCAAACNONE 
AK063879CGGGCCCAAANONE 
AK071765CCAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK071765CGGGCCCAAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CCAGGCCCAAACNONE 
J023112N11CGGGCCCAAANONE 
J033098E13CCAGGCCCAAACNONE 
J033098E13CGGGCCCAAANONE 
J100036J11CCAGGCCCAAACNONE 
J100036J11CGGGCCCAAANONE 
J100047B19CCAGGCCCAAACNONE 
J100047B19CGGGCCCAAANONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0210200012-084-E04TTTGGGCCTTNONE 
AK060502TTTGGGCCTTNONE 
AK069709TTTGGGCCTTN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23TTTGGGCCTTNONE 
J023056O05TTTGGGCCTTNONE 
J033075N06TTTGGGCCTTNONE 
J065099C14TTTGGGCCTTNONE 
J065158C17TTTGGGCCTTNONE 
J065214B02TTTGGGCCTTNONE 
J075026E10TTTGGGCCTTNONE 
J075066J06TTTGGGCCTTNONE 
J075121I06TTTGGGCCTTNONE 
J075124L08TTTGGGCCTTNONE 
J100055D09TTTGGGCCTTNONE 
J100055E04TTTGGGCCTTNONE 
J100077L12TTTGGGCCTTNONE 
Os06g0225300AK065224AAGGCCCAAATAGGCCCACTNONE 
AK100258AAGGCCCAAATAGGCCCACTSimilar to SERK1 (Fragment). 
J013002G23AAGGCCCAAATAGGCCCACTNONE 
Os06g0248200Os06g0248200AACGGGCCCAAAANONE 
Os06g0257200J053059P05GCGGCCCAAATAAATGGGCCCCNONE 
J075006K03GCGGCCCAAATAAATGGGCCCCNONE 
J075067F07GCGGCCCAAATAAATGGGCCCCNONE 
J075068F14GCGGCCCAAATAAATGGGCCCCNONE 
J075068H14GCGGCCCAAATAAATGGGCCCCNONE 
J075098N06GCGGCCCAAATAAATGGGCCCCNONE 
J075099F08GCGGCCCAAATAAATGGGCCCCNONE 
J075154G24GCGGCCCAAATAAATGGGCCCCNONE 
J075195H09GCGGCCCAAATAAATGGGCCCCNONE 
Os06g0269300AK064807AGGGCCCAAAANONE 
AK122070AGGGCCCAAAASoluble quinoprotein glucose dehydrogenase domain containing protein. 
J013000D18AGGGCCCAAAANONE 
J023060J19AGGGCCCAAAANONE 
J033028I01AGGGCCCAAAANONE 
J033032M06AGGGCCCAAAANONE 
J033038E05AGGGCCCAAAANONE 
J033106J02AGGGCCCAAAANONE 
Os06g0324000AK109614TAGGCCCAAACConserved hypothetical protein. 
Os06g0360500AK109778CGGGCCCAAATConserved hypothetical protein. 
Os06g0539066J065210J16GTGGCCCAAAConserved hypothetical protein. 
Os06g0560400AK103575TACGGCCCAAANONE 
AK108074TACGGCCCAAAProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0581300AK070987TTTGGGCCTTProtein of unknown function DUF1475 family protein. 
AK073185TTTGGGCCTTNONE 
J065209C10TTTGGGCCTTNONE 
J075060B03TTTGGGCCTTNONE 
J075117M08TTTGGGCCTTNONE 
J075126E04TTTGGGCCTTNONE 
J075189G04TTTGGGCCTTNONE 
J075189L16TTTGGGCCTTNONE 
J100061E16TTTGGGCCTTNONE 
Os06g0592500AK119729CAACGGCCCAAAASimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CAACGGCCCAAAANONE 
Os06g0603400AK060002AGGGCCCAAATNONE 
AK060002GGGGCCCAAACNONE 
AK102325AGGGCCCAAATNONE 
AK102325GGGGCCCAAACNONE 
AK106905AGGGCCCAAATSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
AK106905GGGGCCCAAACSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22AGGGCCCAAATNONE 
J090039I22GGGGCCCAAACNONE 
J100022N15AGGGCCCAAATNONE 
J100022N15GGGGCCCAAACNONE 
J100023E09AGGGCCCAAATNONE 
J100023E09GGGGCCCAAACNONE 
J100052D21AGGGCCCAAATNONE 
J100052D21GGGGCCCAAACNONE 
Os06g0607800012-010-G03CAAGGCCCAAATNONE 
012-010-G03TAGGCCCAAATNONE 
AB070254CAAGGCCCAAATNONE 
AB070254TAGGCCCAAATNONE 
AK063158CAAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK063158TAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695CAAGGCCCAAATNONE 
AK066695TAGGCCCAAATNONE 
J013074G13CAAGGCCCAAATNONE 
J013074G13TAGGCCCAAATNONE 
J090015C16CAAGGCCCAAATNONE 
J090015C16TAGGCCCAAATNONE 
J090069H10CAAGGCCCAAATNONE 
J090069H10TAGGCCCAAATNONE 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTGGCCCAAAAGGCCCACANONE 
J065100L18TCTGGCCCAAAAGGCCCACANONE 
J065129N15TCTGGCCCAAAAGGCCCACANONE 
J065152M08TCTGGCCCAAAAGGCCCACANONE 
J065198M12TCTGGCCCAAAAGGCCCACANONE 
J090077J22TCTGGCCCAAAAGGCCCACANONE 
J100024G23TCTGGCCCAAAAGGCCCACANONE 
J100027L01TCTGGCCCAAAAGGCCCACANONE 
J100047C06TCTGGCCCAAAAGGCCCACANONE 
J100055D01TCTGGCCCAAAAGGCCCACANONE 
J100067M05TCTGGCCCAAAAGGCCCACANONE 
J100077M16TCTGGCCCAAAAGGCCCACANONE 
J100078M22TCTGGCCCAAAAGGCCCACANONE 
Os06g0634600011-029-F10TTTCGGCCCAAATNONE 
011-057-B11TTTCGGCCCAAATNONE 
AK122074TTTCGGCCCAAATProtein of unknown function FAF1 domain containing protein. 
J033118C24TTTCGGCCCAAATNONE 
J033132A01TTTCGGCCCAAATNONE 
J065059I05TTTCGGCCCAAATNONE 
J100069I04TTTCGGCCCAAATNONE 
Os06g0670100AK102577GAGGCCCAAACHypothetical protein. 
Os06g0673800AK066054TACGGCCCAAATHypothetical protein. 
Os06g0683800AK110639CGGCTCGGCCCAAATConserved hypothetical protein. 
Os06g0696600006-060-B12AAGGCCCAAAANONE 
AK105934AAGGCCCAAAASimilar to Xyloglucan endo-transglycosylase homolog. 
Os06g0702800009-039-E05ACATGGGCCAGGCCCAAATNONE 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
Os06g0726400AF136268TTGGCCCAAANONE 
AK065121TTGGCCCAAANONE 
AK119436TTGGCCCAAABranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332TTGGCCCAAANONE 
AY302112TTGGCCCAAANONE 
D10752TTGGCCCAAANONE 
D11082TTGGCCCAAANONE 
J013031L12TTGGCCCAAANONE 
J013042M09TTGGCCCAAANONE 
J013058E01TTGGCCCAAANONE 
J013058O09TTGGCCCAAANONE 
J013063J17TTGGCCCAAANONE 
J013066I24TTGGCCCAAANONE 
J013069F17TTGGCCCAAANONE 
J013106E01TTGGCCCAAANONE 
J013118D19TTGGCCCAAANONE 
J013162M11TTGGCCCAAANONE 
J023028B19TTGGCCCAAANONE 
J023031A13TTGGCCCAAANONE 
J023047H18TTGGCCCAAANONE 
J023059N10TTGGCCCAAANONE 
J023104N22TTGGCCCAAANONE 
J033025J03TTGGCCCAAANONE 
J033045B05TTGGCCCAAANONE 
J033067M08TTGGCCCAAANONE 
J033113D04TTGGCCCAAANONE 
J043003D11TTGGCCCAAANONE 
J043009O20TTGGCCCAAANONE 
J043016P06TTGGCCCAAANONE 
J043017C21TTGGCCCAAANONE 
J043017J20TTGGCCCAAANONE 
J043021P15TTGGCCCAAANONE 
J043026I22TTGGCCCAAANONE 
J043032L15TTGGCCCAAANONE 
J043034G14TTGGCCCAAANONE 
J043039L16TTGGCCCAAANONE 
J075003D02TTGGCCCAAANONE 
J075003O22TTGGCCCAAANONE 
J075005I24TTGGCCCAAANONE 
J075006N09TTGGCCCAAANONE 
J075011A22TTGGCCCAAANONE 
J075012K24TTGGCCCAAANONE 
J075017D01TTGGCCCAAANONE 
J075017I23TTGGCCCAAANONE 
J075023D17TTGGCCCAAANONE 
J075024B03TTGGCCCAAANONE 
J075025H05TTGGCCCAAANONE 
J075031D19TTGGCCCAAANONE 
J075034B02TTGGCCCAAANONE 
J075035C02TTGGCCCAAANONE 
J075037J12TTGGCCCAAANONE 
J075038M11TTGGCCCAAANONE 
J075039J17TTGGCCCAAANONE 
J075042P10TTGGCCCAAANONE 
J075046J20TTGGCCCAAANONE 
J075047F21TTGGCCCAAANONE 
J075053E05TTGGCCCAAANONE 
J075054D11TTGGCCCAAANONE 
J075054K06TTGGCCCAAANONE 
J075059E15TTGGCCCAAANONE 
J075061O04TTGGCCCAAANONE 
J075062I20TTGGCCCAAANONE 
J075066I12TTGGCCCAAANONE 
J075066L06TTGGCCCAAANONE 
J075071H12TTGGCCCAAANONE 
J075071N19TTGGCCCAAANONE 
J075074K01TTGGCCCAAANONE 
J075077H22TTGGCCCAAANONE 
J075083H18TTGGCCCAAANONE 
J075085F04TTGGCCCAAANONE 
J075085K09TTGGCCCAAANONE 
J075086C06TTGGCCCAAANONE 
J075086E06TTGGCCCAAANONE 
J075087A15TTGGCCCAAANONE 
J075090N02TTGGCCCAAANONE 
J075090N22TTGGCCCAAANONE 
J075091C04TTGGCCCAAANONE 
J075091G16TTGGCCCAAANONE 
J075097E04TTGGCCCAAANONE 
J075099E04TTGGCCCAAANONE 
J075102P22TTGGCCCAAANONE 
J075109B08TTGGCCCAAANONE 
J075109J02TTGGCCCAAANONE 
J075115I12TTGGCCCAAANONE 
J075117E17TTGGCCCAAANONE 
J075123C07TTGGCCCAAANONE 
J075124N05TTGGCCCAAANONE 
J075125E12TTGGCCCAAANONE 
J075126B11TTGGCCCAAANONE 
J075129E14TTGGCCCAAANONE 
J075130N15TTGGCCCAAANONE 
J075131I07TTGGCCCAAANONE 
J075141B13TTGGCCCAAANONE 
J075141B20TTGGCCCAAANONE 
J075144D23TTGGCCCAAANONE 
J075144N01TTGGCCCAAANONE 
J075147M24TTGGCCCAAANONE 
J075148L16TTGGCCCAAANONE 
J075151A22TTGGCCCAAANONE 
J075151D03TTGGCCCAAANONE 
J075151D04TTGGCCCAAANONE 
J075153E23TTGGCCCAAANONE 
J075156D02TTGGCCCAAANONE 
J075156P05TTGGCCCAAANONE 
J075162E23TTGGCCCAAANONE 
J075165J22TTGGCCCAAANONE 
J075166A06TTGGCCCAAANONE 
J075168H13TTGGCCCAAANONE 
J075170D04TTGGCCCAAANONE 
J075171C19TTGGCCCAAANONE 
J075173B12TTGGCCCAAANONE 
J075173M23TTGGCCCAAANONE 
J075174C03TTGGCCCAAANONE 
J075185O11TTGGCCCAAANONE 
J075186G21TTGGCCCAAANONE 
J075187D06TTGGCCCAAANONE 
J075195G21TTGGCCCAAANONE 
J090003D18TTGGCCCAAANONE 
J090005I12TTGGCCCAAANONE 
J090007D15TTGGCCCAAANONE 
J090007G20TTGGCCCAAANONE 
J090014G13TTGGCCCAAANONE 
J090014L08TTGGCCCAAANONE 
J090016J03TTGGCCCAAANONE 
J090023P22TTGGCCCAAANONE 
J090025C19TTGGCCCAAANONE 
J090028F11TTGGCCCAAANONE 
J090028G01TTGGCCCAAANONE 
J090028H02TTGGCCCAAANONE 
J090037I11TTGGCCCAAANONE 
J090040F21TTGGCCCAAANONE 
J090040N24TTGGCCCAAANONE 
J090044M12TTGGCCCAAANONE 
J090045B13TTGGCCCAAANONE 
J090045M22TTGGCCCAAANONE 
J090048C10TTGGCCCAAANONE 
J090051J02TTGGCCCAAANONE 
J090058O15TTGGCCCAAANONE 
J090062F11TTGGCCCAAANONE 
J090067D23TTGGCCCAAANONE 
J090069G15TTGGCCCAAANONE 
J090072I06TTGGCCCAAANONE 
J090073H18TTGGCCCAAANONE 
J090073L01TTGGCCCAAANONE 
J090075O21TTGGCCCAAANONE 
J090084K24TTGGCCCAAANONE 
J090087P11TTGGCCCAAANONE 
J090092B17TTGGCCCAAANONE 
J100042H08TTGGCCCAAANONE 
Os07g0105300AK107419TCGGCCCAAACConserved hypothetical protein. 
AK109521TCGGCCCAAACNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0123000AK070836ATGGCCCAAAACyclin-like F-box domain containing protein. 
Os07g0127500009-139-F12ATTTGGGCCACGTGNONE 
AK062949ATTTGGGCCACGTGSimilar to PR-1a pathogenesis related protein (Hv-1a) precursor. 
J100077L01ATTTGGGCCACGTGNONE 
Os07g0142900003-001-H01ATTTGGGCCGTCCNONE 
AK060737ATTTGGGCCGTCCAldo/keto reductase family protein. 
AK064848ATTTGGGCCGTCCNONE 
Os07g0164500J013094M18CTCGGCCCAAATNONE 
J013153L05CTCGGCCCAAATNONE 
J023011J18CTCGGCCCAAATNONE 
J023106H21CTCGGCCCAAATNONE 
J033105F10CTCGGCCCAAATNONE 
J065210M20CTCGGCCCAAATSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CTCGGCCCAAATNONE 
J090061C13CTCGGCCCAAATNONE 
J090074K15CTCGGCCCAAATNONE 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0191700AK066389TAGGCCCAAAGCCCAGTASimilar to AT.I.24-9 protein (Fragment). 
AK103768TAGGCCCAAAGCCCAGTANONE 
Os07g0205000009-018-A12GTGGCCCAAACNONE 
AK103963GTGGCCCAAACNONE 
AK121368GTGGCCCAAACNONE 
J023001M20GTGGCCCAAACNONE 
J023125I03GTGGCCCAAACNONE 
J053034L22GTGGCCCAAACNONE 
J065078A21GTGGCCCAAACNONE 
J065089G24GTGGCCCAAACNONE 
J065096G23GTGGCCCAAACNONE 
J065103N06GTGGCCCAAACNONE 
J065146J22GTGGCCCAAACNONE 
J065159K18GTGGCCCAAACNONE 
J065204L04GTGGCCCAAACNONE 
J065207N07GTGGCCCAAACNONE 
J065208E24GTGGCCCAAACNONE 
J075057F19GTGGCCCAAACNONE 
J075058K01GTGGCCCAAACNONE 
J075072H13GTGGCCCAAACNONE 
J080003D08GTGGCCCAAACNONE 
J080025F02GTGGCCCAAACNONE 
Os07g0205700AK120553GTTTGGGCCCAAGSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24GTTTGGGCCCAAGNONE 
Os07g0213600AK107696TTTTGGGCCCAATPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09TTTTGGGCCCAATNONE 
J100082J05TTTTGGGCCCAATNONE 
Os07g0231500AK109283TAGGCCCAAACyclin-like domain containing protein. 
J075001D10TAGGCCCAAANONE 
J075088P14TAGGCCCAAANONE 
J075115C22TAGGCCCAAANONE 
J075199L15TAGGCCCAAANONE 
Os07g0242600AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
AK065752TTGGCCCAAATCyclin-like F-box domain containing protein. 
J013037K22GTTTGGGCCCAGCCCATAANONE 
J013037K22TTGGCCCAAATNONE 
Os07g0245100AK059133GTTTGGGCCTTNONE 
Os07g0270900015-039-A02ATTTGGGCCGCNONE 
AK058966ATTTGGGCCGCMak16 protein family protein. 
AK068904ATTTGGGCCGCNONE 
J013169N21ATTTGGGCCGCNONE 
J065039I11ATTTGGGCCGCNONE 
J065081J11ATTTGGGCCGCNONE 
J065162P04ATTTGGGCCGCNONE 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0290800AK071498ATGGCCCAAAATic22-like family protein. 
J075099P10ATGGCCCAAAANONE 
Os07g0296900J075050I18ATTTGGGCCCAATTConserved hypothetical protein. 
Os07g0450000009-033-A08ATTTGGGCCGANONE 
AK063789ATTTGGGCCGANONE 
AK121702ATTTGGGCCGASimilar to 60S ribosomal protein L44. 
J033073H17ATTTGGGCCGANONE 
J065006A02ATTTGGGCCGANONE 
J065009C05ATTTGGGCCGANONE 
J065028M04ATTTGGGCCGANONE 
J065070D07ATTTGGGCCGANONE 
J065072H17ATTTGGGCCGANONE 
J065114J23ATTTGGGCCGANONE 
J065127A02ATTTGGGCCGANONE 
J065146L07ATTTGGGCCGANONE 
J065213H17ATTTGGGCCGANONE 
J065214B07ATTTGGGCCGANONE 
J100045B16ATTTGGGCCGANONE 
Os07g0462700009-033-D05TTTTGGGCCTTGNONE 
AK073834TTTTGGGCCTTGNONE 
AK104968TTTTGGGCCTTGThioesterase superfamily domain containing protein. 
J065104G16TTTTGGGCCTTGNONE 
J065197C14TTTTGGGCCTTGNONE 
J065213E17TTTTGGGCCTTGNONE 
J065215D11TTTTGGGCCTTGNONE 
J075001J15TTTTGGGCCTTGNONE 
J075026M11TTTTGGGCCTTGNONE 
J075142G03TTTTGGGCCTTGNONE 
J075178H04TTTTGGGCCTTGNONE 
J100069P18TTTTGGGCCTTGNONE 
Os07g0463100009-138-B06GCGGCCCAAATNONE 
AK121807GCGGCCCAAATDNA-directed RNA polymerase, 14 to 18 kDa subunit family protein. 
J013162G21GCGGCCCAAATNONE 
J065061H22GCGGCCCAAATNONE 
J075091J19GCGGCCCAAATNONE 
J075107E13GCGGCCCAAATNONE 
J075141I11GCGGCCCAAATNONE 
J075172E07GCGGCCCAAATNONE 
J080305N05GCGGCCCAAATNONE 
J080311B17GCGGCCCAAATNONE 
J080316I07GCGGCCCAAATNONE 
Os07g0479200005-017-H08GAGGCCCAAANONE 
AK058326GAGGCCCAAASimilar to SL15-like (Fragment). 
J013092A08GAGGCCCAAANONE 
J033139E04GAGGCCCAAANONE 
J043016M16GAGGCCCAAANONE 
J053050O18GAGGCCCAAANONE 
J053098B03GAGGCCCAAANONE 
J065068G10GAGGCCCAAANONE 
J065091I17GAGGCCCAAANONE 
J065109A03GAGGCCCAAANONE 
J065168B17GAGGCCCAAANONE 
J065177A05GAGGCCCAAANONE 
J065180J01GAGGCCCAAANONE 
J075006F13GAGGCCCAAANONE 
J075022J03GAGGCCCAAANONE 
J075024N09GAGGCCCAAANONE 
J075114B12GAGGCCCAAANONE 
J080023M06GAGGCCCAAANONE 
J080081N24GAGGCCCAAANONE 
J090060N07GAGGCCCAAANONE 
Os07g0535200011-024-E05TTTTGGGCCTANONE 
AK063926TTTTGGGCCTANONE 
AK101804TTTTGGGCCTACyclin-like F-box domain containing protein. 
J033066K01TTTTGGGCCTANONE 
J033133J23TTTTGGGCCTANONE 
Os07g0543000AB110196TCTGGCCCAAANONE 
AK058889TCTGGCCCAAASimilar to Helix-loop-helix-like protein (Fragment). 
Os07g0562700003-111-G08GCCCGGCCCAAAANONE 
004-013-E07GCCCGGCCCAAAANONE 
006-021-D03GCCCGGCCCAAAANONE 
006-021-D07GCCCGGCCCAAAANONE 
006-021-F09GCCCGGCCCAAAANONE 
006-023-D01GCCCGGCCCAAAANONE 
006-024-F04GCCCGGCCCAAAANONE 
006-024-G09GCCCGGCCCAAAANONE 
006-024-G11GCCCGGCCCAAAANONE 
006-025-A10GCCCGGCCCAAAANONE 
006-025-B08GCCCGGCCCAAAANONE 
006-025-E10GCCCGGCCCAAAANONE 
006-025-F10GCCCGGCCCAAAANONE 
006-026-B04GCCCGGCCCAAAANONE 
006-026-C08GCCCGGCCCAAAANONE 
006-026-D03GCCCGGCCCAAAANONE 
006-026-F03GCCCGGCCCAAAANONE 
006-026-F08GCCCGGCCCAAAANONE 
006-026-F12GCCCGGCCCAAAANONE 
006-027-A10GCCCGGCCCAAAANONE 
006-027-C03GCCCGGCCCAAAANONE 
006-028-C03GCCCGGCCCAAAANONE 
006-029-E02GCCCGGCCCAAAANONE 
006-029-G05GCCCGGCCCAAAANONE 
006-030-A10GCCCGGCCCAAAANONE 
006-030-C06GCCCGGCCCAAAANONE 
006-030-D03GCCCGGCCCAAAANONE 
006-030-D06GCCCGGCCCAAAANONE 
006-030-G05GCCCGGCCCAAAANONE 
006-031-B10GCCCGGCCCAAAANONE 
006-031-D04GCCCGGCCCAAAANONE 
006-031-D11GCCCGGCCCAAAANONE 
006-031-H09GCCCGGCCCAAAANONE 
006-032-C09GCCCGGCCCAAAANONE 
006-032-H09GCCCGGCCCAAAANONE 
006-033-B02GCCCGGCCCAAAANONE 
006-033-B09GCCCGGCCCAAAANONE 
006-033-E01GCCCGGCCCAAAANONE 
006-033-F06GCCCGGCCCAAAANONE 
006-033-G03GCCCGGCCCAAAANONE 
006-034-A08GCCCGGCCCAAAANONE 
006-034-C09GCCCGGCCCAAAANONE 
006-034-F06GCCCGGCCCAAAANONE 
006-035-B12GCCCGGCCCAAAANONE 
006-035-C12GCCCGGCCCAAAANONE 
006-035-H04GCCCGGCCCAAAANONE 
006-035-H12GCCCGGCCCAAAANONE 
006-036-A05GCCCGGCCCAAAANONE 
006-036-A09GCCCGGCCCAAAANONE 
006-036-B10GCCCGGCCCAAAANONE 
006-036-C03GCCCGGCCCAAAANONE 
006-036-E06GCCCGGCCCAAAANONE 
006-037-H11GCCCGGCCCAAAANONE 
006-038-G01GCCCGGCCCAAAANONE 
006-039-B01GCCCGGCCCAAAANONE 
006-039-B12GCCCGGCCCAAAANONE 
006-039-C02GCCCGGCCCAAAANONE 
006-039-E06GCCCGGCCCAAAANONE 
006-039-G12GCCCGGCCCAAAANONE 
006-040-G07GCCCGGCCCAAAANONE 
006-041-H04GCCCGGCCCAAAANONE 
006-042-A11GCCCGGCCCAAAANONE 
006-042-E07GCCCGGCCCAAAANONE 
006-042-F12GCCCGGCCCAAAANONE 
006-043-C01GCCCGGCCCAAAANONE 
006-045-H12GCCCGGCCCAAAANONE 
006-046-A12GCCCGGCCCAAAANONE 
006-046-F03GCCCGGCCCAAAANONE 
006-047-A07GCCCGGCCCAAAANONE 
006-047-A09GCCCGGCCCAAAANONE 
006-047-E10GCCCGGCCCAAAANONE 
006-047-G12GCCCGGCCCAAAANONE 
006-048-B04GCCCGGCCCAAAANONE 
006-049-D01GCCCGGCCCAAAANONE 
006-049-G02GCCCGGCCCAAAANONE 
006-049-G10GCCCGGCCCAAAANONE 
006-049-H04GCCCGGCCCAAAANONE 
006-050-D05GCCCGGCCCAAAANONE 
006-050-F05GCCCGGCCCAAAANONE 
006-051-B05GCCCGGCCCAAAANONE 
006-051-G12GCCCGGCCCAAAANONE 
006-052-D12GCCCGGCCCAAAANONE 
006-053-D06GCCCGGCCCAAAANONE 
006-054-H02GCCCGGCCCAAAANONE 
006-055-A03GCCCGGCCCAAAANONE 
006-055-C01GCCCGGCCCAAAANONE 
006-055-E07GCCCGGCCCAAAANONE 
006-055-H06GCCCGGCCCAAAANONE 
006-056-F06GCCCGGCCCAAAANONE 
006-057-D03GCCCGGCCCAAAANONE 
006-057-D05GCCCGGCCCAAAANONE 
006-057-G01GCCCGGCCCAAAANONE 
006-058-A03GCCCGGCCCAAAANONE 
006-058-B06GCCCGGCCCAAAANONE 
006-059-A09GCCCGGCCCAAAANONE 
006-059-H11GCCCGGCCCAAAANONE 
006-060-A04GCCCGGCCCAAAANONE 
006-060-A09GCCCGGCCCAAAANONE 
006-060-C11GCCCGGCCCAAAANONE 
006-060-D08GCCCGGCCCAAAANONE 
006-061-A04GCCCGGCCCAAAANONE 
006-061-E01GCCCGGCCCAAAANONE 
006-061-G10GCCCGGCCCAAAANONE 
006-061-H12GCCCGGCCCAAAANONE 
006-062-B07GCCCGGCCCAAAANONE 
006-062-G03GCCCGGCCCAAAANONE 
006-062-H12GCCCGGCCCAAAANONE 
006-063-D05GCCCGGCCCAAAANONE 
006-063-E04GCCCGGCCCAAAANONE 
006-063-F05GCCCGGCCCAAAANONE 
006-063-G05GCCCGGCCCAAAANONE 
006-064-B07GCCCGGCCCAAAANONE 
006-065-C11GCCCGGCCCAAAANONE 
006-065-H02GCCCGGCCCAAAANONE 
006-067-C12GCCCGGCCCAAAANONE 
006-067-F10GCCCGGCCCAAAANONE 
006-068-E02GCCCGGCCCAAAANONE 
006-068-G04GCCCGGCCCAAAANONE 
006-069-A02GCCCGGCCCAAAANONE 
006-071-A07GCCCGGCCCAAAANONE 
006-072-F11GCCCGGCCCAAAANONE 
006-072-F12GCCCGGCCCAAAANONE 
006-073-E12GCCCGGCCCAAAANONE 
006-073-F08GCCCGGCCCAAAANONE 
006-073-H07GCCCGGCCCAAAANONE 
006-074-A07GCCCGGCCCAAAANONE 
006-075-A12GCCCGGCCCAAAANONE 
006-075-B01GCCCGGCCCAAAANONE 
006-075-H10GCCCGGCCCAAAANONE 
006-075-H12GCCCGGCCCAAAANONE 
006-076-B06GCCCGGCCCAAAANONE 
006-077-A09GCCCGGCCCAAAANONE 
006-077-D05GCCCGGCCCAAAANONE 
006-078-C11GCCCGGCCCAAAANONE 
006-078-D12GCCCGGCCCAAAANONE 
006-078-E02GCCCGGCCCAAAANONE 
006-079-A01GCCCGGCCCAAAANONE 
006-079-E02GCCCGGCCCAAAANONE 
006-079-F03GCCCGGCCCAAAANONE 
006-080-G11GCCCGGCCCAAAANONE 
006-081-C02GCCCGGCCCAAAANONE 
006-081-C08GCCCGGCCCAAAANONE 
006-082-B06GCCCGGCCCAAAANONE 
006-082-C11GCCCGGCCCAAAANONE 
006-082-H04GCCCGGCCCAAAANONE 
006-083-E04GCCCGGCCCAAAANONE 
006-083-H12GCCCGGCCCAAAANONE 
006-084-C08GCCCGGCCCAAAANONE 
006-084-E07GCCCGGCCCAAAANONE 
006-084-E10GCCCGGCCCAAAANONE 
006-085-E06GCCCGGCCCAAAANONE 
006-085-E10GCCCGGCCCAAAANONE 
006-086-F06GCCCGGCCCAAAANONE 
006-087-D08GCCCGGCCCAAAANONE 
006-087-F03GCCCGGCCCAAAANONE 
006-087-F10GCCCGGCCCAAAANONE 
006-087-G07GCCCGGCCCAAAANONE 
006-088-A02GCCCGGCCCAAAANONE 
006-089-A04GCCCGGCCCAAAANONE 
006-089-B12GCCCGGCCCAAAANONE 
006-089-D06GCCCGGCCCAAAANONE 
006-089-D10GCCCGGCCCAAAANONE 
006-089-H05GCCCGGCCCAAAANONE 
006-090-C06GCCCGGCCCAAAANONE 
006-091-A03GCCCGGCCCAAAANONE 
006-091-E04GCCCGGCCCAAAANONE 
006-091-H12GCCCGGCCCAAAANONE 
006-092-A08GCCCGGCCCAAAANONE 
006-092-F01GCCCGGCCCAAAANONE 
006-092-G08GCCCGGCCCAAAANONE 
006-093-B12GCCCGGCCCAAAANONE 
006-093-D04GCCCGGCCCAAAANONE 
006-093-F01GCCCGGCCCAAAANONE 
006-094-A08GCCCGGCCCAAAANONE 
006-094-F01GCCCGGCCCAAAANONE 
006-094-F03GCCCGGCCCAAAANONE 
006-095-C12GCCCGGCCCAAAANONE 
006-095-E10GCCCGGCCCAAAANONE 
006-095-E12GCCCGGCCCAAAANONE 
006-095-G06GCCCGGCCCAAAANONE 
006-096-B12GCCCGGCCCAAAANONE 
006-096-C12GCCCGGCCCAAAANONE 
006-096-G02GCCCGGCCCAAAANONE 
006-097-D01GCCCGGCCCAAAANONE 
006-097-D07GCCCGGCCCAAAANONE 
006-097-F04GCCCGGCCCAAAANONE 
006-098-C07GCCCGGCCCAAAANONE 
006-098-D04GCCCGGCCCAAAANONE 
006-099-E06GCCCGGCCCAAAANONE 
006-099-F02GCCCGGCCCAAAANONE 
006-099-F10GCCCGGCCCAAAANONE 
006-100-A07GCCCGGCCCAAAANONE 
006-100-B10GCCCGGCCCAAAANONE 
006-100-G01GCCCGGCCCAAAANONE 
006-100-H06GCCCGGCCCAAAANONE 
006-101-D01GCCCGGCCCAAAANONE 
006-101-F03GCCCGGCCCAAAANONE 
006-102-A12GCCCGGCCCAAAANONE 
006-102-B11GCCCGGCCCAAAANONE 
006-102-C03GCCCGGCCCAAAANONE 
006-102-F11GCCCGGCCCAAAANONE 
006-103-A08GCCCGGCCCAAAANONE 
006-103-B06GCCCGGCCCAAAANONE 
006-103-D01GCCCGGCCCAAAANONE 
006-103-F02GCCCGGCCCAAAANONE 
006-104-B02GCCCGGCCCAAAANONE 
006-104-C01GCCCGGCCCAAAANONE 
006-104-F09GCCCGGCCCAAAANONE 
006-104-H11GCCCGGCCCAAAANONE 
006-105-A03GCCCGGCCCAAAANONE 
006-105-D09GCCCGGCCCAAAANONE 
006-106-B10GCCCGGCCCAAAANONE 
006-107-A06GCCCGGCCCAAAANONE 
006-107-C04GCCCGGCCCAAAANONE 
006-107-E03GCCCGGCCCAAAANONE 
006-107-F05GCCCGGCCCAAAANONE 
006-108-C09GCCCGGCCCAAAANONE 
006-109-C09GCCCGGCCCAAAANONE 
006-109-D10GCCCGGCCCAAAANONE 
006-109-E06GCCCGGCCCAAAANONE 
006-109-E10GCCCGGCCCAAAANONE 
006-110-A06GCCCGGCCCAAAANONE 
006-110-C11GCCCGGCCCAAAANONE 
006-111-A02GCCCGGCCCAAAANONE 
006-111-F02GCCCGGCCCAAAANONE 
006-112-A08GCCCGGCCCAAAANONE 
006-112-H06GCCCGGCCCAAAANONE 
006-113-A08GCCCGGCCCAAAANONE 
006-113-B01GCCCGGCCCAAAANONE 
006-113-C05GCCCGGCCCAAAANONE 
006-113-D01GCCCGGCCCAAAANONE 
006-113-D04GCCCGGCCCAAAANONE 
006-113-D06GCCCGGCCCAAAANONE 
006-113-E09GCCCGGCCCAAAANONE 
006-114-F06GCCCGGCCCAAAANONE 
006-116-B02GCCCGGCCCAAAANONE 
006-117-B07GCCCGGCCCAAAANONE 
006-117-G04GCCCGGCCCAAAANONE 
006-118-D01GCCCGGCCCAAAANONE 
006-118-D12GCCCGGCCCAAAANONE 
006-118-F12GCCCGGCCCAAAANONE 
006-118-G12GCCCGGCCCAAAANONE 
006-119-B08GCCCGGCCCAAAANONE 
006-120-E09GCCCGGCCCAAAANONE 
006-120-G05GCCCGGCCCAAAANONE 
006-120-G10GCCCGGCCCAAAANONE 
009-022-D12GCCCGGCCCAAAANONE 
009-051-H08GCCCGGCCCAAAANONE 
009-065-F05GCCCGGCCCAAAANONE 
009-070-A06GCCCGGCCCAAAANONE 
009-073-B07GCCCGGCCCAAAANONE 
009-092-C10GCCCGGCCCAAAANONE 
009-093-D03GCCCGGCCCAAAANONE 
009-103-B04GCCCGGCCCAAAANONE 
009-106-H08GCCCGGCCCAAAANONE 
009-120-B05GCCCGGCCCAAAANONE 
009-121-F05GCCCGGCCCAAAANONE 
009-122-B04GCCCGGCCCAAAANONE 
009-122-D08GCCCGGCCCAAAANONE 
009-123-F07GCCCGGCCCAAAANONE 
009-125-G02GCCCGGCCCAAAANONE 
009-128-F02GCCCGGCCCAAAANONE 
009-128-H07GCCCGGCCCAAAANONE 
009-131-C06GCCCGGCCCAAAANONE 
009-132-F08GCCCGGCCCAAAANONE 
009-133-G08GCCCGGCCCAAAANONE 
009-134-D09GCCCGGCCCAAAANONE 
009-135-F01GCCCGGCCCAAAANONE 
009-149-E11GCCCGGCCCAAAANONE 
009-153-H04GCCCGGCCCAAAANONE 
009-161-E04GCCCGGCCCAAAANONE 
009-163-A09GCCCGGCCCAAAANONE 
009-163-C05GCCCGGCCCAAAANONE 
009-163-E10GCCCGGCCCAAAANONE 
009-165-F04GCCCGGCCCAAAANONE 
009-166-A07GCCCGGCCCAAAANONE 
009-169-G12GCCCGGCCCAAAANONE 
009-172-G08GCCCGGCCCAAAANONE 
009-179-E06GCCCGGCCCAAAANONE 
009-181-F09GCCCGGCCCAAAANONE 
009-190-G07GCCCGGCCCAAAANONE 
009-191-D01GCCCGGCCCAAAANONE 
009-195-G02GCCCGGCCCAAAANONE 
AF022738GCCCGGCCCAAAANONE 
AK061512GCCCGGCCCAAAANONE 
AK068972GCCCGGCCCAAAANONE 
AK103926GCCCGGCCCAAAANONE 
AK103999GCCCGGCCCAAAANONE 
AK104224GCCCGGCCCAAAANONE 
AK104465GCCCGGCCCAAAANONE 
AK104495GCCCGGCCCAAAANONE 
AK109399GCCCGGCCCAAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCCCGGCCCAAAANONE 
AK119545GCCCGGCCCAAAANONE 
J013043L10GCCCGGCCCAAAANONE 
J013050A09GCCCGGCCCAAAANONE 
J023001G03GCCCGGCCCAAAANONE 
J023024D14GCCCGGCCCAAAANONE 
J023072E11GCCCGGCCCAAAANONE 
J023149E18GCCCGGCCCAAAANONE 
J033029B16GCCCGGCCCAAAANONE 
J065001O21GCCCGGCCCAAAANONE 
J065035B04GCCCGGCCCAAAANONE 
J065044D18GCCCGGCCCAAAANONE 
J065057F12GCCCGGCCCAAAANONE 
J065060A11GCCCGGCCCAAAANONE 
J065062G15GCCCGGCCCAAAANONE 
J065080F13GCCCGGCCCAAAANONE 
J065084N12GCCCGGCCCAAAANONE 
J065101D02GCCCGGCCCAAAANONE 
J065107C07GCCCGGCCCAAAANONE 
J065112N24GCCCGGCCCAAAANONE 
J065141I16GCCCGGCCCAAAANONE 
J065147D05GCCCGGCCCAAAANONE 
J065167H02GCCCGGCCCAAAANONE 
J065207K23GCCCGGCCCAAAANONE 
J075008E16GCCCGGCCCAAAANONE 
J075014F03GCCCGGCCCAAAANONE 
J075015O17GCCCGGCCCAAAANONE 
J075020H20GCCCGGCCCAAAANONE 
J075021E22GCCCGGCCCAAAANONE 
J075023N13GCCCGGCCCAAAANONE 
J075028H10GCCCGGCCCAAAANONE 
J075040F20GCCCGGCCCAAAANONE 
J075051L23GCCCGGCCCAAAANONE 
J075069G16GCCCGGCCCAAAANONE 
J075084F24GCCCGGCCCAAAANONE 
J075090H09GCCCGGCCCAAAANONE 
J075092M21GCCCGGCCCAAAANONE 
J075110C10GCCCGGCCCAAAANONE 
J075111J12GCCCGGCCCAAAANONE 
J075114L04GCCCGGCCCAAAANONE 
J075139E02GCCCGGCCCAAAANONE 
J075160M10GCCCGGCCCAAAANONE 
J075176J03GCCCGGCCCAAAANONE 
J075183I17GCCCGGCCCAAAANONE 
J075191N10GCCCGGCCCAAAANONE 
J075193D07GCCCGGCCCAAAANONE 
J075194M16GCCCGGCCCAAAANONE 
J075197K04GCCCGGCCCAAAANONE 
J080032I11GCCCGGCCCAAAANONE 
J080076M11GCCCGGCCCAAAANONE 
J080311J08GCCCGGCCCAAAANONE 
J080317E05GCCCGGCCCAAAANONE 
J090034L08GCCCGGCCCAAAANONE 
J100040D19GCCCGGCCCAAAANONE 
J100074C11GCCCGGCCCAAAANONE 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
J023056G18GTTTGGGCCTTCTTGGGCCGANONE 
J065131K04GTTTGGGCCTTCTTGGGCCGANONE 
J065190L19GTTTGGGCCTTCTTGGGCCGANONE 
J065209B06GTTTGGGCCTTCTTGGGCCGANONE 
J065216P11GTTTGGGCCTTCTTGGGCCGANONE 
J090088F06GTTTGGGCCTTCTTGGGCCGANONE 
Os07g0565600AK071983CTGGCCCAAAASimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481CTGGCCCAAAANONE 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0573800AK072835ATTTGGGCCATPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK104154ATTTGGGCCATNONE 
AK104308ATTTGGGCCATNONE 
AK107962ATTTGGGCCATNONE 
J023134F17ATTTGGGCCATNONE 
J043027A09ATTTGGGCCATNONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0598900015-040-C12TTTTGGGCCATNONE 
AK102627TTTTGGGCCATCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521TTTTGGGCCATNONE 
J033087C18TTTTGGGCCATNONE 
J033099K03TTTTGGGCCATNONE 
J065054E02TTTTGGGCCATNONE 
J090055O05TTTTGGGCCATNONE 
Os07g0611600AK059431TTTTGGGCCTTGNONE 
J033096O12TTTTGGGCCTTGNONE 
J075143O21TTTTGGGCCTTGNONE 
Os07g0614100AB032062ATTTGGGCCGGANONE 
AB032062TTTTGGGCCGCANONE 
AK058885ATTTGGGCCGGANONE 
AK058885TTTTGGGCCGCANONE 
AK069145ATTTGGGCCGGANONE 
AK069145TTTTGGGCCGCANONE 
AK102448ATTTGGGCCGGAAlpha 1-2 subunit of 20S proteasome. 
AK102448TTTTGGGCCGCAAlpha 1-2 subunit of 20S proteasome. 
J023007E07ATTTGGGCCGGANONE 
J023007E07TTTTGGGCCGCANONE 
J033093O06ATTTGGGCCGGANONE 
J033093O06TTTTGGGCCGCANONE 
Os07g0616900AK071047CTCGGCCCAAAAProtein of unknown function DUF500 family protein. 
J013106G03CTCGGCCCAAAANONE 
J013124C20CTCGGCCCAAAANONE 
J033096D16CTCGGCCCAAAANONE 
J043005E08CTCGGCCCAAAANONE 
J065197K12CTCGGCCCAAAANONE 
J065211I03CTCGGCCCAAAANONE 
Os07g0620200AK099859GTGGCCCAAATHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04GTGGCCCAAATNONE 
Os07g0641600AK068478GTTTGGGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073802GTTTGGGCCCAACTNONE 
Os07g0668200AK059051ATGGCCCAAATNONE 
AK101682ATGGCCCAAATConserved hypothetical protein. 
AK102839ATGGCCCAAATNONE 
Os07g0687300AK073043ATTTGGGCCCATAASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os07g0688300AK068325TTGGCCCAAAASimilar to Importin alpha 1. 
AK099611TTGGCCCAAAANONE 
Os08g0112800009-113-D03ATTTGGGCCAANONE 
009-113-D03GAGGCCCAAANONE 
AK121176ATTTGGGCCAARickettsia 17 kDa surface antigen family protein. 
AK121176GAGGCCCAAARickettsia 17 kDa surface antigen family protein. 
J023083C18ATTTGGGCCAANONE 
J023083C18GAGGCCCAAANONE 
J033074M10ATTTGGGCCAANONE 
J033074M10GAGGCCCAAANONE 
J033097G10ATTTGGGCCAANONE 
J033097G10GAGGCCCAAANONE 
J065090F05ATTTGGGCCAANONE 
J065090F05GAGGCCCAAANONE 
J090001J03ATTTGGGCCAANONE 
J090001J03GAGGCCCAAANONE 
J090044F23ATTTGGGCCAANONE 
J090044F23GAGGCCCAAANONE 
J090078H09ATTTGGGCCAANONE 
J090078H09GAGGCCCAAANONE 
J100088G23ATTTGGGCCAANONE 
J100088G23GAGGCCCAAANONE 
Os08g0113800J033069I12TCTCGGCCCAAACNONE 
J053050I07TCTCGGCCCAAACNONE 
J065006J11TCTCGGCCCAAACNONE 
J065013D02TCTCGGCCCAAACNONE 
J065055L24TCTCGGCCCAAACNONE 
J065071I11TCTCGGCCCAAACConserved hypothetical protein. 
J065093G12TCTCGGCCCAAACNONE 
J065101N03TCTCGGCCCAAACNONE 
Os08g0143500006-072-G06TTTTGGGCCGTTNONE 
016-053-H02TTTTGGGCCGTTNONE 
AK061094TTTTGGGCCGTTNONE 
AK071122TTTTGGGCCGTTGlycosyl transferase, family 14 protein. 
J023081E17TTTTGGGCCGTTNONE 
J023106O18TTTTGGGCCGTTNONE 
J043001N22TTTTGGGCCGTTNONE 
J065062D05TTTTGGGCCGTTNONE 
J065099M15TTTTGGGCCGTTNONE 
J065180K12TTTTGGGCCGTTNONE 
J090045L23TTTTGGGCCGTTNONE 
J100088K05TTTTGGGCCGTTNONE 
Os08g0162500AK121633ATTTGGGCCTAConserved hypothetical protein. 
J033105E19ATTTGGGCCTANONE 
J080012K11ATTTGGGCCTANONE 
J080041I12ATTTGGGCCTANONE 
J080049G05ATTTGGGCCTANONE 
J080050P09ATTTGGGCCTANONE 
J080051A10ATTTGGGCCTANONE 
J080054G05ATTTGGGCCTANONE 
J080058M08ATTTGGGCCTANONE 
J080064N23ATTTGGGCCTANONE 
J080072L15ATTTGGGCCTANONE 
J080096H09ATTTGGGCCTANONE 
J100079I08ATTTGGGCCTANONE 
Os08g0227100AK071657TAGGCCCAAAATRAF-like domain containing protein. 
AK103481TAGGCCCAAAANONE 
J065183O06TAGGCCCAAAANONE 
J090013C07TAGGCCCAAAANONE 
J090081F11TAGGCCCAAAANONE 
Os08g0243600AB110183CACGGCCCAAAANONE 
AK101443CACGGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0243900011-052-H03GTTTGGGCCGTGNONE 
011-052-H03TTTTGGGCCAGNONE 
AK102707GTTTGGGCCGTGNONE 
AK102707TTTTGGGCCAGNONE 
AK121452GTTTGGGCCGTGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
AK121452TTTTGGGCCAGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20GTTTGGGCCGTGNONE 
J023142L20TTTTGGGCCAGNONE 
J065168E04GTTTGGGCCGTGNONE 
J065168E04TTTTGGGCCAGNONE 
Os08g0282000016-023-A09TAGGCCCAAACNONE 
AK101411TAGGCCCAAACCD9/CD37/CD63 antigen family protein. 
J033037J09TAGGCCCAAACNONE 
J090047I07TAGGCCCAAACNONE 
J100021H13TAGGCCCAAACNONE 
Os08g0327400AK070992AAGGCCCAAAASimilar to Enoyl-ACP reductase (Fragment). 
J023077K10AAGGCCCAAAANONE 
J065075F06AAGGCCCAAAANONE 
J065112N14AAGGCCCAAAANONE 
J090028K07AAGGCCCAAAANONE 
J090039C15AAGGCCCAAAANONE 
J090048I11AAGGCCCAAAANONE 
J090083M10AAGGCCCAAAANONE 
Os08g0412100AK072641TTGGCCCAAAADisease resistance protein family protein. 
Os08g0412200006-028-H07AAGGCCCAAATNONE 
AJ575234AAGGCCCAAATNONE 
AK059631AAGGCCCAAATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367AAGGCCCAAATNONE 
AK104578AAGGCCCAAATNONE 
J033071L08AAGGCCCAAATNONE 
J065197K18AAGGCCCAAATNONE 
Os08g0431500009-186-D05ATTTGGGCCGGGCNONE 
AK058993ATTTGGGCCGGGCNONE 
AK100797ATTTGGGCCGGGCConserved hypothetical protein. 
J023121F15ATTTGGGCCGGGCNONE 
Os08g0433200013-023-E07AAGGCCCAAACNONE 
013-023-E07TACGGCCCGGCCCAAANONE 
AK099471AAGGCCCAAACConserved hypothetical protein. 
AK099471TACGGCCCGGCCCAAAConserved hypothetical protein. 
J013024A05AAGGCCCAAACNONE 
J013024A05TACGGCCCGGCCCAAANONE 
J013065N03AAGGCCCAAACNONE 
J013065N03TACGGCCCGGCCCAAANONE 
J023111A21AAGGCCCAAACNONE 
J023111A21TACGGCCCGGCCCAAANONE 
J065035F10AAGGCCCAAACNONE 
J065035F10TACGGCCCGGCCCAAANONE 
J065083H01AAGGCCCAAACNONE 
J065083H01TACGGCCCGGCCCAAANONE 
J065159E03AAGGCCCAAACNONE 
J065159E03TACGGCCCGGCCCAAANONE 
J065186A03AAGGCCCAAACNONE 
J065186A03TACGGCCCGGCCCAAANONE 
J075032B02AAGGCCCAAACNONE 
J075032B02TACGGCCCGGCCCAAANONE 
J075038L14AAGGCCCAAACNONE 
J075038L14TACGGCCCGGCCCAAANONE 
J075047N21AAGGCCCAAACNONE 
J075047N21TACGGCCCGGCCCAAANONE 
J075076H05AAGGCCCAAACNONE 
J075076H05TACGGCCCGGCCCAAANONE 
J075110C08AAGGCCCAAACNONE 
J075110C08TACGGCCCGGCCCAAANONE 
J090096K17AAGGCCCAAACNONE 
J090096K17TACGGCCCGGCCCAAANONE 
Os08g0441400011-033-F01ATTTGGGCCGCANONE 
015-084-B04ATTTGGGCCGCANONE 
AK063317ATTTGGGCCGCANONE 
AK064141ATTTGGGCCGCAConserved hypothetical protein. 
J065060F06ATTTGGGCCGCANONE 
J075110A22ATTTGGGCCGCANONE 
J080307P11ATTTGGGCCGCANONE 
J090041E06ATTTGGGCCGCANONE 
Os08g0455800006-050-A09TCTGGCCCAAACNONE 
AK061573TCTGGCCCAAACProtein of unknown function DUF985 family protein. 
AK099156TCTGGCCCAAACNONE 
J023067L05TCTGGCCCAAACNONE 
J065101A05TCTGGCCCAAACNONE 
J065171H09TCTGGCCCAAACNONE 
J100022D08TCTGGCCCAAACNONE 
J100029K04TCTGGCCCAAACNONE 
J100029O10TCTGGCCCAAACNONE 
Os08g0474750J075009C13TCTGGCCCAAATNONE 
J075122O14TCTGGCCCAAATHypothetical protein. 
Os08g0474800Os08g0474800TCTGGCCCAAATEsterase/lipase/thioesterase domain containing protein. 
Os08g0487100AK107150CTCGGCCCAAATSimilar to BZIP transcription factor BZI-2. 
Os08g0492100AK060178AAATGGGCTGTATTTGGGCCAANONE 
AK071053AAATGGGCTGTATTTGGGCCAAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AAATGGGCTGTATTTGGGCCAANONE 
J023004I20AAATGGGCTGTATTTGGGCCAANONE 
J023067D13AAATGGGCTGTATTTGGGCCAANONE 
J033028G05AAATGGGCTGTATTTGGGCCAANONE 
J033060L15AAATGGGCTGTATTTGGGCCAANONE 
J033103N12AAATGGGCTGTATTTGGGCCAANONE 
J033125B19AAATGGGCTGTATTTGGGCCAANONE 
J065132A12AAATGGGCTGTATTTGGGCCAANONE 
J065161F02AAATGGGCTGTATTTGGGCCAANONE 
J065162L05AAATGGGCTGTATTTGGGCCAANONE 
J090093I18AAATGGGCTGTATTTGGGCCAANONE 
J100061I05AAATGGGCTGTATTTGGGCCAANONE 
J100081G13AAATGGGCTGTATTTGGGCCAANONE 
Os08g0495300Os08g0495300GTTTGGGCCGTAConserved hypothetical protein. 
Os08g0496000011-009-D02AGCCCATTCGGCCCAAACNONE 
AK103187AGCCCATTCGGCCCAAACCytochrome oxidase assembly family protein. 
J033121L24AGCCCATTCGGCCCAAACNONE 
J033149A07AGCCCATTCGGCCCAAACNONE 
J065198L20AGCCCATTCGGCCCAAACNONE 
J090096F24AGCCCATTCGGCCCAAACNONE 
Os08g0517600009-066-H05GCTGGGCCCAAACNONE 
AK073374GCTGGGCCCAAACNONE 
AK105385GCTGGGCCCAAACSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07GCTGGGCCCAAACNONE 
J075004A12GCTGGGCCCAAACNONE 
J075062F16GCTGGGCCCAAACNONE 
J075115K05GCTGGGCCCAAACNONE 
J075116H09GCTGGGCCCAAACNONE 
Os08g0520100AK059686TTTTGGGCCCACAANONE 
AK120052TTTTGGGCCCACAAPseudouridine synthase domain containing protein. 
Os08g0526500016-063-D04TTTTGGGCCAGANONE 
AK073431TTTTGGGCCAGASimilar to SOX-1 protein. 
J033042D10TTTTGGGCCAGANONE 
J065019E02TTTTGGGCCAGANONE 
Os08g0530200009-166-A09TTTTGGGCCCNONE 
AK062052TTTTGGGCCCNONE 
AK120448TTTTGGGCCCSimilar to 60S ribosomal protein L17. 
J013100M19TTTTGGGCCCNONE 
J023045K22TTTTGGGCCCNONE 
J033046D13TTTTGGGCCCNONE 
J033066N01TTTTGGGCCCNONE 
J033143N05TTTTGGGCCCNONE 
J053070P13TTTTGGGCCCNONE 
J065011C18TTTTGGGCCCNONE 
J065013C23TTTTGGGCCCNONE 
J065016B09TTTTGGGCCCNONE 
J065016C21TTTTGGGCCCNONE 
J065023K18TTTTGGGCCCNONE 
J065028F12TTTTGGGCCCNONE 
J065030L02TTTTGGGCCCNONE 
J065042H15TTTTGGGCCCNONE 
J065078H02TTTTGGGCCCNONE 
J065092D07TTTTGGGCCCNONE 
J065092E01TTTTGGGCCCNONE 
J065104M21TTTTGGGCCCNONE 
J065119P21TTTTGGGCCCNONE 
J065124B15TTTTGGGCCCNONE 
J065146H09TTTTGGGCCCNONE 
J065149L09TTTTGGGCCCNONE 
J065156A09TTTTGGGCCCNONE 
J065157H23TTTTGGGCCCNONE 
J065165L14TTTTGGGCCCNONE 
J065165M18TTTTGGGCCCNONE 
J065172O03TTTTGGGCCCNONE 
J065192M18TTTTGGGCCCNONE 
J065198D21TTTTGGGCCCNONE 
J065200D05TTTTGGGCCCNONE 
J065202B20TTTTGGGCCCNONE 
J065212P11TTTTGGGCCCNONE 
J065215E08TTTTGGGCCCNONE 
J065217P19TTTTGGGCCCNONE 
J075005I19TTTTGGGCCCNONE 
J075134J06TTTTGGGCCCNONE 
J075162G12TTTTGGGCCCNONE 
J075178H07TTTTGGGCCCNONE 
J075186K01TTTTGGGCCCNONE 
J080315I17TTTTGGGCCCNONE 
J080318P19TTTTGGGCCCNONE 
J090004H16TTTTGGGCCCNONE 
J090020A16TTTTGGGCCCNONE 
J090047J12TTTTGGGCCCNONE 
J090080E07TTTTGGGCCCNONE 
J090090H23TTTTGGGCCCNONE 
J100021G24TTTTGGGCCCNONE 
J100037L04TTTTGGGCCCNONE 
J100043L09TTTTGGGCCCNONE 
J100044A10TTTTGGGCCCNONE 
Os08g0535400004-001-H10CCCGGCCCAAAANONE 
AK071527CCCGGCCCAAAAZinc finger, DHHC-type domain containing protein. 
J023107B02CCCGGCCCAAAANONE 
Os08g0540500AK106511TACGGCCCAAACSAM (and some other nucleotide) binding motif domain containing protein. 
AK106511TAGGCCCAAATSAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0557100AK070743AAGGCCCAAAANONE 
AK101214AAGGCCCAAAASimilar to Nucleic acid-binding protein precursor. 
AK105901AAGGCCCAAAANONE 
J033031B04AAGGCCCAAAANONE 
J080004F08AAGGCCCAAAANONE 
J080004H12AAGGCCCAAAANONE 
J080005H08AAGGCCCAAAANONE 
J080005I02AAGGCCCAAAANONE 
J080008N16AAGGCCCAAAANONE 
J080009H23AAGGCCCAAAANONE 
J080012H17AAGGCCCAAAANONE 
J080012J21AAGGCCCAAAANONE 
J080013I20AAGGCCCAAAANONE 
J080016E07AAGGCCCAAAANONE 
J080018O04AAGGCCCAAAANONE 
J080020B18AAGGCCCAAAANONE 
J080021I16AAGGCCCAAAANONE 
J080022N01AAGGCCCAAAANONE 
J080023G08AAGGCCCAAAANONE 
J080023N09AAGGCCCAAAANONE 
J080024J24AAGGCCCAAAANONE 
J080025M12AAGGCCCAAAANONE 
J080028A22AAGGCCCAAAANONE 
J080028I01AAGGCCCAAAANONE 
J080029D22AAGGCCCAAAANONE 
J080030M02AAGGCCCAAAANONE 
J080031B06AAGGCCCAAAANONE 
J080035G08AAGGCCCAAAANONE 
J080036F19AAGGCCCAAAANONE 
J080038P14AAGGCCCAAAANONE 
J080039C17AAGGCCCAAAANONE 
J080043A10AAGGCCCAAAANONE 
J080044H02AAGGCCCAAAANONE 
J080044P12AAGGCCCAAAANONE 
J080047L06AAGGCCCAAAANONE 
J080050L06AAGGCCCAAAANONE 
J080052J11AAGGCCCAAAANONE 
J080052M10AAGGCCCAAAANONE 
J080053E20AAGGCCCAAAANONE 
J080054J01AAGGCCCAAAANONE 
J080059N09AAGGCCCAAAANONE 
J080064F19AAGGCCCAAAANONE 
J080064N22AAGGCCCAAAANONE 
J080065K14AAGGCCCAAAANONE 
J080065M12AAGGCCCAAAANONE 
J080068O07AAGGCCCAAAANONE 
J080076P20AAGGCCCAAAANONE 
J080087D08AAGGCCCAAAANONE 
J080087H16AAGGCCCAAAANONE 
J080090N23AAGGCCCAAAANONE 
J080091H04AAGGCCCAAAANONE 
J080091P13AAGGCCCAAAANONE 
J080094O15AAGGCCCAAAANONE 
J080094P14AAGGCCCAAAANONE 
J080095I07AAGGCCCAAAANONE 
J080097E22AAGGCCCAAAANONE 
Os08g0558000J080005K14TCCGGCCCAAAAGGCCCAGTANONE 
Os09g0112400AK109186AATTGGGCCCAAATSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0325300011-005-H08TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
AK068435TCGGCCCAAACTTGGGCCGGCCCGTTConserved hypothetical protein. 
AK073998TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J033071H21TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J065214H05TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
Os09g0327300AK059603AGGGCCCAAAASimilar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment). 
AK059603GTGGCCCAAAASimilar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment). 
J100073E06AGGGCCCAAAANONE 
J100073E06GTGGCCCAAAANONE 
Os09g0329800AK069775TTTTGGGCCTAACAGCCCATATConserved hypothetical protein. 
Os09g0329900Os09g0329900TTTTGGGCCTAACAGCCCATATNONE 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0355400AK105685ATTTGGGCCCATTANONE 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0450901J065009G09GTTTGGGCCGAANONE 
J065015O13GTTTGGGCCGAANONE 
J065082C06GTTTGGGCCGAAConserved hypothetical protein. 
Os09g0467100012-085-D01TTCGGCCCAAACNONE 
AK063444TTCGGCCCAAACSAICAR synthetase family protein. 
J065083E16TTCGGCCCAAACNONE 
Os09g0485800AK108749ATTTGGGCCAGAConserved hypothetical protein. 
AK108749GTTTGGGCCGTTTConserved hypothetical protein. 
J065137H03ATTTGGGCCAGANONE 
J065137H03GTTTGGGCCGTTTNONE 
Os09g0509200AK069525GGCTGGGCCTTTGGGCCAASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0531900AK073015CAGGCCCAAATAGCCCAGCSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0532600J013002F02TTTGGGCCAAGCCCATGTNONE 
Os09g0534000AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0542200006-092-A09AGATGGGCCCAAATNONE 
AK064887AGATGGGCCCAAATThioredoxin fold domain containing protein. 
AK104804AGATGGGCCCAAATNONE 
J013000K12AGATGGGCCCAAATNONE 
J013170A19AGATGGGCCCAAATNONE 
J033103B02AGATGGGCCCAAATNONE 
J065196J20AGATGGGCCCAAATNONE 
J075037H17AGATGGGCCCAAATNONE 
J075069H14AGATGGGCCCAAATNONE 
J075071C16AGATGGGCCCAAATNONE 
J075095N02AGATGGGCCCAAATNONE 
J075136N03AGATGGGCCCAAATNONE 
J075192L16AGATGGGCCCAAATNONE 
J100057N23AGATGGGCCCAAATNONE 
J100060O07AGATGGGCCCAAATNONE 
J100062F10AGATGGGCCCAAATNONE 
J100077I08AGATGGGCCCAAATNONE 
J100086B07AGATGGGCCCAAATNONE 
J100088L14AGATGGGCCCAAATNONE 
Os09g0549700J053039F06CCACGGCCCAAATNONE 
J065089F23CCACGGCCCAAATRibosomal protein L18P/L5E family protein. 
J065090G14CCACGGCCCAAATNONE 
J065093M17CCACGGCCCAAATNONE 
J065096L23CCACGGCCCAAATNONE 
J065152A18CCACGGCCCAAATNONE 
J065155H12CCACGGCCCAAATNONE 
Os09g0565200004-007-A08ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-045-E10ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-051-A01ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-079-G03ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-C05ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-E11ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-111-E07ATATGGGCCGTGATTTGGGCCCATGGNONE 
AK069121ATATGGGCCGTGATTTGGGCCCATGGSimilar to Nucleic acid-binding protein precursor. 
AK104354ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013090J23ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013093C19ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023007A14ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023099J21ATATGGGCCGTGATTTGGGCCCATGGNONE 
J065023L09ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075060J06ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075092C03ATATGGGCCGTGATTTGGGCCCATGGNONE 
Os09g0568000AK068829CAGGCCCAAAANONE 
Os11g0132700AK103286TTGTGGGCTTCCGGCCCAAATCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0153600AK065028TTTTGGGCCTGAGTP-binding signal recognition particle SRP54, G-domain containing protein. 
J013001G13TTTTGGGCCTGANONE 
Os11g0156200AK100124GAGGCCCAAATPeptidase S28 family protein. 
Os11g0175500015-087-F02TTTTGGGCCCCACANONE 
AK064320TTTTGGGCCCCACAZinc finger, RING-type domain containing protein. 
AK101592TTTTGGGCCCCACANONE 
Os11g0202600AK102530CTGGCCCAAAAHypothetical protein. 
J090084P12CTGGCCCAAAANONE 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
J075053H03GCCGGCCCAAACGGCCCACGAANONE 
J075062F23GCCGGCCCAAACGGCCCACGAANONE 
J090029D08GCCGGCCCAAACGGCCCACGAANONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0497000AK111924CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065097A08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065123J10CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J075096F04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J080065C15CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090033J04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090072N23CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100021E08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100063H21CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
Os11g0549690J065085G07ATTTGGGCCCACCTGTConserved hypothetical protein. 
J065218B08ATTTGGGCCCACCTGTNONE 
J090036H16ATTTGGGCCCACCTGTNONE 
Os11g0586300AK072257GGACGGCCCAAATConserved hypothetical protein. 
Os11g0593100AK070035GTGGCCCAAAProtein of unknown function DUF295 family protein. 
J023038E14GTGGCCCAAANONE 
J100062C21GTGGCCCAAANONE 
Os11g0615700AB026561ATTTGGGCCTTNONE 
AK059521ATTTGGGCCTTNONE 
AK103487ATTTGGGCCTTProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ATTTGGGCCTTNONE 
J065044A11ATTTGGGCCTTNONE 
J065090I02ATTTGGGCCTTNONE 
J065104I09ATTTGGGCCTTNONE 
J065187J10ATTTGGGCCTTNONE 
J075024E07ATTTGGGCCTTNONE 
J075025O13ATTTGGGCCTTNONE 
J090062N12ATTTGGGCCTTNONE 
J090087G06ATTTGGGCCTTNONE 
J090098K11ATTTGGGCCTTNONE 
Os11g0616200AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0645300003-107-E03ATTTGGGCCAGCCCAACCNONE 
006-108-C01ATTTGGGCCAGCCCAACCNONE 
009-015-H10ATTTGGGCCAGCCCAACCNONE 
009-020-G11ATTTGGGCCAGCCCAACCNONE 
009-047-F04ATTTGGGCCAGCCCAACCNONE 
009-053-A12ATTTGGGCCAGCCCAACCNONE 
009-059-B03ATTTGGGCCAGCCCAACCNONE 
009-067-A06ATTTGGGCCAGCCCAACCNONE 
009-084-C03ATTTGGGCCAGCCCAACCNONE 
009-108-G09ATTTGGGCCAGCCCAACCNONE 
009-122-G05ATTTGGGCCAGCCCAACCNONE 
009-124-D08ATTTGGGCCAGCCCAACCNONE 
009-136-C07ATTTGGGCCAGCCCAACCNONE 
013-049-E07ATTTGGGCCAGCCCAACCNONE 
014-056-G04ATTTGGGCCAGCCCAACCNONE 
AK062126ATTTGGGCCAGCCCAACCNONE 
AK120284ATTTGGGCCAGCCCAACCPlant disease resistance response protein family protein. 
J013043F05ATTTGGGCCAGCCCAACCNONE 
J013049N05ATTTGGGCCAGCCCAACCNONE 
J013050H05ATTTGGGCCAGCCCAACCNONE 
J065053N22ATTTGGGCCAGCCCAACCNONE 
J065218J04ATTTGGGCCAGCCCAACCNONE 
J075064K03ATTTGGGCCAGCCCAACCNONE 
J075073L24ATTTGGGCCAGCCCAACCNONE 
J075108C10ATTTGGGCCAGCCCAACCNONE 
Os11g0657200AK059959GTTTGGGCCTC2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07GAGGCCCAAACNONE 
AK062752GAGGCCCAAACSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os12g0120000011-024-E09GTGGCCCAAANONE 
AK105399GTGGCCCAAAProtein of unknown function DUF936, plant family protein. 
Os12g0131300J090086B06TTGTGGGCTTCCGGCCCAAATHypothetical protein. 
Os12g0143150009-090-F09GGGGCCCAAATUbiquitin domain containing protein. 
J013121D01GGGGCCCAAATNONE 
J065129G09GGGGCCCAAATNONE 
J080311D13GGGGCCCAAATNONE 
J090014O10GGGGCCCAAATNONE 
J090045E21GGGGCCCAAATNONE 
J100047D12GGGGCCCAAATNONE 
Os12g0165200AK110577AAACGGCCCAAAHSP20-like chaperone domain containing protein. 
Os12g0167900005-004-A06ATTTGGGCCGTANONE 
006-024-H01ATTTGGGCCGTANONE 
006-044-H12ATTTGGGCCGTANONE 
006-053-B08ATTTGGGCCGTANONE 
015-080-F12ATTTGGGCCGTANONE 
AK060925ATTTGGGCCGTA60S ribosomal protein L3. 
D10403ATTTGGGCCGTANONE 
D12630ATTTGGGCCGTANONE 
J013046A17ATTTGGGCCGTANONE 
J013048A16ATTTGGGCCGTANONE 
J013057L14ATTTGGGCCGTANONE 
J023058G08ATTTGGGCCGTANONE 
J023058I08ATTTGGGCCGTANONE 
J023078E17ATTTGGGCCGTANONE 
J023087E03ATTTGGGCCGTANONE 
J023097D18ATTTGGGCCGTANONE 
J023141E14ATTTGGGCCGTANONE 
J023150P21ATTTGGGCCGTANONE 
J033045K05ATTTGGGCCGTANONE 
J033071G03ATTTGGGCCGTANONE 
J033071I15ATTTGGGCCGTANONE 
J033136D08ATTTGGGCCGTANONE 
J043012M21ATTTGGGCCGTANONE 
J043015C13ATTTGGGCCGTANONE 
J053031L19ATTTGGGCCGTANONE 
J053050C01ATTTGGGCCGTANONE 
J053055I20ATTTGGGCCGTANONE 
J053074B18ATTTGGGCCGTANONE 
J053091I08ATTTGGGCCGTANONE 
J053097N01ATTTGGGCCGTANONE 
J065058A02ATTTGGGCCGTANONE 
J065141H11ATTTGGGCCGTANONE 
J075019D10ATTTGGGCCGTANONE 
J075078G18ATTTGGGCCGTANONE 
J075094C12ATTTGGGCCGTANONE 
J075165H12ATTTGGGCCGTANONE 
J090011E05ATTTGGGCCGTANONE 
J090021H18ATTTGGGCCGTANONE 
J090027N07ATTTGGGCCGTANONE 
J090035F04ATTTGGGCCGTANONE 
J090050F21ATTTGGGCCGTANONE 
J090051M02ATTTGGGCCGTANONE 
J090060F21ATTTGGGCCGTANONE 
J090075G15ATTTGGGCCGTANONE 
J090092P11ATTTGGGCCGTANONE