version

Summary of OsREG626 (All List)

OrganismOryza sativa  
IDOsREG626  
SequenceGGCCCAAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
CCAACGG  function unknown  
PLACE Motif 
Total Entry Count2446  

Entry Sequences (2446 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952TACGGCCCAACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118TACGGCCCAACANONE 
J013123J12TACGGCCCAACANONE 
J033026O19TACGGCCCAACANONE 
J033128C08TACGGCCCAACANONE 
J065116M14TACGGCCCAACANONE 
J090058F15TACGGCCCAACANONE 
J090079F20TACGGCCCAACANONE 
Os01g0104000AK072087TGTTGGGCCGANONE 
AK103808TGTTGGGCCGAC-type lectin domain containing protein. 
Os01g0104100AK072797TCGGCCCAACAZinc finger, RING-type domain containing protein. 
AK104280TCGGCCCAACANONE 
Os01g0158000AK058679AGTTGGGCCACACGNONE 
AK103127AGTTGGGCCACACGImportin alpha-2 subunit. 
D78504AGTTGGGCCACACGNONE 
Os01g0172000012-070-G06GGTTGGGCCGGANONE 
AK068405GGTTGGGCCGGAALG3 family protein. 
J013149A07GGTTGGGCCGGANONE 
J053047H05GGTTGGGCCGGANONE 
J065075N03GGTTGGGCCGGANONE 
J065093G22GGTTGGGCCGGANONE 
J065130N21GGTTGGGCCGGANONE 
J065143P05GGTTGGGCCGGANONE 
J065216H07GGTTGGGCCGGANONE 
J075013B06GGTTGGGCCGGANONE 
J075196M05GGTTGGGCCGGANONE 
J100039G24GGTTGGGCCGGANONE 
J100041B11GGTTGGGCCGGANONE 
J100069A16GGTTGGGCCGGANONE 
J100069L12GGTTGGGCCGGANONE 
J100074P16GGTTGGGCCGGANONE 
Os01g0179901J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0221300011-021-E12TCTCGGCCCAACANONE 
AK073330TCTCGGCCCAACAConserved hypothetical protein. 
J013130J18TCTCGGCCCAACANONE 
J033024A12TCTCGGCCCAACANONE 
J065063H09TCTCGGCCCAACANONE 
J065093G05TCTCGGCCCAACANONE 
J090007K12TCTCGGCCCAACANONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
AK069972CAAGGCCCAACASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075090M12CAAGGCCCAACANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12CAAGGCCCAACANONE 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
Os01g0331900013-026-D04TGTTGGGCCAGNONE 
AK064784TGTTGGGCCAGNONE 
AK121761TGTTGGGCCAGProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15TGTTGGGCCAGNONE 
J033090D07TGTTGGGCCAGNONE 
J090006L21TGTTGGGCCAGNONE 
Os01g0358300AK060388TTCGGCCCAACTNONE 
AK072081TTCGGCCCAACTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AGTTGGGCCGAANONE 
006-083-B11AGTTGGGCCGAANONE 
006-083-C09AGTTGGGCCGAANONE 
006-088-H03AGTTGGGCCGAANONE 
006-102-H05AGTTGGGCCGAANONE 
AK061826AGTTGGGCCGAASimilar to 40S ribosomal protein S4. 
J013105M07AGTTGGGCCGAANONE 
J013155A16AGTTGGGCCGAANONE 
J033025C03AGTTGGGCCGAANONE 
J033072L20AGTTGGGCCGAANONE 
J033095I15AGTTGGGCCGAANONE 
J033105E03AGTTGGGCCGAANONE 
J033112G18AGTTGGGCCGAANONE 
J033125D09AGTTGGGCCGAANONE 
J065100L16AGTTGGGCCGAANONE 
J065176I05AGTTGGGCCGAANONE 
J090001C14AGTTGGGCCGAANONE 
J090058E15AGTTGGGCCGAANONE 
J090068F07AGTTGGGCCGAANONE 
Os01g0530400016-019-E07AAGGCCCAACNONE 
AK103724AAGGCCCAACNONE 
AK106476AAGGCCCAACGlutaredoxin-related protein family protein. 
J023108F14AAGGCCCAACNONE 
J033138C10AAGGCCCAACNONE 
Os01g0546900AK073801GAGGCCCAACCTranscription factor jumonji/aspartyl beta-hydroxylase domain containing protein. 
Os01g0551000006-104-A04CCCAGCCCGGCCCAACCNONE 
009-183-B08CCCAGCCCGGCCCAACCNONE 
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein. 
AK106034CCCAGCCCGGCCCAACCNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0581300AK066182GGGGCCCAACSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015GGGGCCCAACNONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE 
012-005-A05GTTGGGCCGGGGCCCATTANONE 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
AK099235GTTGGGCCGGGGCCCATTANONE 
AK105022GTTGGGCCGGGGCCCATTANONE 
J065030D21GTTGGGCCGGGGCCCATTANONE 
J065031C10GTTGGGCCGGGGCCCATTANONE 
J065105A22GTTGGGCCGGGGCCCATTANONE 
J065173M19GTTGGGCCGGGGCCCATTANONE 
J075188F15GTTGGGCCGGGGCCCATTANONE 
J090050C15GTTGGGCCGGGGCCCATTANONE 
J100058K07GTTGGGCCGGGGCCCATTANONE 
Os01g0618200AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0618500011-019-D03ATTGGGCCAGGTTGGGCCATNONE 
AK067476ATTGGGCCAGGTTGGGCCATSimilar to RNA helicase (Fragment). 
J013020E19ATTGGGCCAGGTTGGGCCATNONE 
J033046J12ATTGGGCCAGGTTGGGCCATNONE 
J033055D06ATTGGGCCAGGTTGGGCCATNONE 
Os01g0621700AK108938GACGGCCCAACCMyosin tail 2 domain containing protein. 
J100033P13GACGGCCCAACCNONE 
Os01g0649000AK073564TCGGCCCAACGGCCWD40-like domain containing protein. 
Os01g0658500AK058491GCGGGCCCAACProtein of unknown function DUF852, eukaryotic family protein. 
AK069050GCGGGCCCAACNONE 
J043036P22GCGGGCCCAACNONE 
Os01g0678500AB071014TTGGCCCAACNONE 
AB100696TTGGCCCAACSimilar to Two-pore calcium channel. 
AK067839TTGGCCCAACNONE 
AK100998TTGGCCCAACNONE 
J013089O09TTGGCCCAACNONE 
J013126J24TTGGCCCAACNONE 
J013146L16TTGGCCCAACNONE 
J013160D06TTGGCCCAACNONE 
J090067N19TTGGCCCAACNONE 
J090070E11TTGGCCCAACNONE 
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0707300AK059962TGTTGGGCCTTNONE 
AK104463TGTTGGGCCTTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0715800011-061-G06TGTTGGGCCTTNONE 
AK063369TGTTGGGCCTTConserved hypothetical protein. 
J065194O22TGTTGGGCCTTNONE 
Os01g0742400AK109885AGTTGGGCCTTNONE 
AK119360AGTTGGGCCTTNONE 
AK120741AGTTGGGCCTTProtein kinase-like domain containing protein. 
J023003P18AGTTGGGCCTTNONE 
Os01g0761100AK122112GCGGCCCAACATesmin/TSO1-like, CXC domain containing protein. 
Os01g0773700003-115-A05TTGGCCCAACTNONE 
009-016-C08TTGGCCCAACTNONE 
009-027-A08TTGGCCCAACTNONE 
009-038-C02TTGGCCCAACTNONE 
009-087-D04TTGGCCCAACTNONE 
009-119-A01TTGGCCCAACTNONE 
009-125-D06TTGGCCCAACTNONE 
009-129-B06TTGGCCCAACTNONE 
009-136-G07TTGGCCCAACTNONE 
009-141-D09TTGGCCCAACTNONE 
009-149-C06TTGGCCCAACTNONE 
009-149-G03TTGGCCCAACTNONE 
009-149-H06TTGGCCCAACTNONE 
009-151-C05TTGGCCCAACTNONE 
009-153-D08TTGGCCCAACTNONE 
009-154-H12TTGGCCCAACTNONE 
009-181-C03TTGGCCCAACTNONE 
009-181-C06TTGGCCCAACTNONE 
009-181-G02TTGGCCCAACTNONE 
009-183-B06TTGGCCCAACTNONE 
009-187-D09TTGGCCCAACTNONE 
009-194-C07TTGGCCCAACTNONE 
009-194-C10TTGGCCCAACTNONE 
009-195-F10TTGGCCCAACTNONE 
009-199-G07TTGGCCCAACTNONE 
AK060438TTGGCCCAACTNONE 
AK060476TTGGCCCAACTNONE 
AK119161TTGGCCCAACTSimilar to Photosystem II reaction center W protein (PSII 6.1 kDa protein) (Fragment). 
J013132H23TTGGCCCAACTNONE 
J013158C16TTGGCCCAACTNONE 
J023008K22TTGGCCCAACTNONE 
J023012B02TTGGCCCAACTNONE 
J065045L04TTGGCCCAACTNONE 
J065046O07TTGGCCCAACTNONE 
J065048G02TTGGCCCAACTNONE 
J065060H11TTGGCCCAACTNONE 
J065101B04TTGGCCCAACTNONE 
J065148G21TTGGCCCAACTNONE 
J065158L13TTGGCCCAACTNONE 
J065180I22TTGGCCCAACTNONE 
J075007F14TTGGCCCAACTNONE 
J075047L09TTGGCCCAACTNONE 
J075122H09TTGGCCCAACTNONE 
J075175B12TTGGCCCAACTNONE 
J075193A01TTGGCCCAACTNONE 
J080303H08TTGGCCCAACTNONE 
J080305O21TTGGCCCAACTNONE 
J080306M22TTGGCCCAACTNONE 
Os01g0782300AK109175AGCCCACCTGGCCCAACAConserved hypothetical protein. 
Os01g0785700AK100774AGCCGTTGGGCCTGNONE 
AK102081AGCCGTTGGGCCTGProtein prenyltransferase domain containing protein. 
AY129829AGCCGTTGGGCCTGNONE 
J023120B17AGCCGTTGGGCCTGNONE 
J033082K10AGCCGTTGGGCCTGNONE 
Os01g0800300006-097-C12ATGGCCCAACCNONE 
014-070-C12ATGGCCCAACCNONE 
AK072549ATGGCCCAACCNONE 
AK100942ATGGCCCAACCNONE 
AK100951ATGGCCCAACCConserved hypothetical protein. 
AK106023ATGGCCCAACCNONE 
J023138D05ATGGCCCAACCNONE 
J075097P16ATGGCCCAACCNONE 
J075099F23ATGGCCCAACCNONE 
Os01g0807000AK109751TGTTGGGCCCGConserved hypothetical protein. 
Os01g0810100AK071916GTTGGGCCACACGRibonuclease III domain containing protein. 
AK099056GTTGGGCCACACGNONE 
AK104320GTTGGGCCACACGNONE 
Os01g0817700006-112-C04TGTTGGGCCTGNONE 
Os01g0829266J065010C18TGTTGGGCCCATTANONE 
J065037A22TGTTGGGCCCATTANONE 
J065044B02TGTTGGGCCCATTAConserved hypothetical protein. 
J065044B10TGTTGGGCCCATTANONE 
J065051A06TGTTGGGCCCATTANONE 
J065073E06TGTTGGGCCCATTANONE 
J065074I11TGTTGGGCCCATTANONE 
J065086D22TGTTGGGCCCATTANONE 
J065104H10TGTTGGGCCCATTANONE 
J065107C05TGTTGGGCCCATTANONE 
J065124H16TGTTGGGCCCATTANONE 
J065165F22TGTTGGGCCCATTANONE 
J065169B11TGTTGGGCCCATTANONE 
J065172G21TGTTGGGCCCATTANONE 
J065191E05TGTTGGGCCCATTANONE 
J065191F18TGTTGGGCCCATTANONE 
Os01g0836400AK073540GTTGGGCCTGSAC3/GANP family protein. 
J023019D11GTTGGGCCTGNONE 
J023139O22GTTGGGCCTGNONE 
J033042J20GTTGGGCCTGNONE 
J033046M18GTTGGGCCTGNONE 
J033124J09GTTGGGCCTGNONE 
J090015E05GTTGGGCCTGNONE 
J090076J09GTTGGGCCTGNONE 
Os01g0851000AK065338TGTTGGGCCTAPfkB domain containing protein. 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0876500J053026A07AGGGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17AGGGCCCAACCNONE 
Os01g0907300015-031-F03TGTTGGGCCTANONE 
AK103626TGTTGGGCCTAConserved hypothetical protein. 
AK108617TGTTGGGCCTANONE 
J013094D23TGTTGGGCCTANONE 
J013106G24TGTTGGGCCTANONE 
J013120M13TGTTGGGCCTANONE 
J023056M16TGTTGGGCCTANONE 
J023092M24TGTTGGGCCTANONE 
J033133N22TGTTGGGCCTANONE 
J043010O12TGTTGGGCCTANONE 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
Os01g0949200AK102412ACCGGCCCAACTNONE 
J033093A04ACCGGCCCAACTNONE 
J065053P06ACCGGCCCAACTNONE 
J100086D18ACCGGCCCAACTNONE 
Os01g0966200009-079-H11TGTTGGGCCGTANONE 
009-124-G10TGTTGGGCCGTANONE 
AK058564TGTTGGGCCGTAProtein of unknown function YGGT family protein. 
AK098935TGTTGGGCCGTANONE 
Os02g0119700AK108777TCTGGCCCAACCProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0129900Os02g0129900TACGGCCCAACTPGAP1-like family protein. 
Os02g0158400006-048-F06TGTTGGGCCGGGNONE 
AK061569TGTTGGGCCGGGssDNA-binding transcriptional regulator family protein. 
AK099479TGTTGGGCCGGGNONE 
AK104768TGTTGGGCCGGGNONE 
J013025B22TGTTGGGCCGGGNONE 
J023009C03TGTTGGGCCGGGNONE 
J033115N14TGTTGGGCCGGGNONE 
J065036F05TGTTGGGCCGGGNONE 
J065191K17TGTTGGGCCGGGNONE 
J065202K16TGTTGGGCCGGGNONE 
J075053E14TGTTGGGCCGGGNONE 
J075101E04TGTTGGGCCGGGNONE 
J075111C06TGTTGGGCCGGGNONE 
J075137O04TGTTGGGCCGGGNONE 
J075139E07TGTTGGGCCGGGNONE 
J075143K07TGTTGGGCCGGGNONE 
J075144K15TGTTGGGCCGGGNONE 
J075164L14TGTTGGGCCGGGNONE 
J075199D06TGTTGGGCCGGGNONE 
J090010G24TGTTGGGCCGGGNONE 
J090017C18TGTTGGGCCGGGNONE 
J090066F01TGTTGGGCCGGGNONE 
J090088G01TGTTGGGCCGGGNONE 
Os02g0179100AK058557TCCGGCCCAACAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10TCCGGCCCAACANONE 
Os02g0180100005-013-B11GAGGCCCAACCNONE 
AK067359GAGGCCCAACCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700GAGGCCCAACCNONE 
J013090O22GAGGCCCAACCNONE 
J013099P19GAGGCCCAACCNONE 
J090041M21GAGGCCCAACCNONE 
J090049C14GAGGCCCAACCNONE 
Os02g0190950J075001E02TTTTGGGCCCAACCConserved hypothetical protein. 
J075117E23TTTTGGGCCCAACCNONE 
J075117F23TTTTGGGCCCAACCNONE 
J075144M12TTTTGGGCCCAACCNONE 
J075145H10TTTTGGGCCCAACCNONE 
J075186B15TTTTGGGCCCAACCNONE 
Os02g0192700004-020-H12TAGGCCCAACCNONE 
004-020-H12TTTCGGCCCAACANONE 
006-024-H06TAGGCCCAACCNONE 
006-024-H06TTTCGGCCCAACANONE 
006-042-F06TAGGCCCAACCNONE 
006-042-F06TTTCGGCCCAACANONE 
006-050-D04TAGGCCCAACCNONE 
006-050-D04TTTCGGCCCAACANONE 
006-059-E10TAGGCCCAACCNONE 
006-059-E10TTTCGGCCCAACANONE 
006-070-B02TAGGCCCAACCNONE 
006-070-B02TTTCGGCCCAACANONE 
006-084-A09TAGGCCCAACCNONE 
006-084-A09TTTCGGCCCAACANONE 
006-114-E11TAGGCCCAACCNONE 
006-114-E11TTTCGGCCCAACANONE 
006-117-E05TAGGCCCAACCNONE 
006-117-E05TTTCGGCCCAACANONE 
009-126-D11TAGGCCCAACCNONE 
009-126-D11TTTCGGCCCAACANONE 
AK061629TAGGCCCAACCSimilar to Thioredoxin peroxidase. 
AK061629TTTCGGCCCAACASimilar to Thioredoxin peroxidase. 
AK065909TAGGCCCAACCNONE 
AK065909TTTCGGCCCAACANONE 
J013043E11TAGGCCCAACCNONE 
J013043E11TTTCGGCCCAACANONE 
J065038I09TAGGCCCAACCNONE 
J065038I09TTTCGGCCCAACANONE 
J065078C12TAGGCCCAACCNONE 
J065078C12TTTCGGCCCAACANONE 
J065122O14TAGGCCCAACCNONE 
J065122O14TTTCGGCCCAACANONE 
J065198H04TAGGCCCAACCNONE 
J065198H04TTTCGGCCCAACANONE 
Os02g0194000015-020-A08GGTTGGGCCCAATNONE 
AK064096GGTTGGGCCCAATMyb, DNA-binding domain containing protein. 
J090092L06GGTTGGGCCCAATNONE 
Os02g0220600AK103901AAGGCCCAACANONE 
J013058O03AAGGCCCAACANONE 
J013124E21AAGGCCCAACANONE 
J023023L03AAGGCCCAACANONE 
J023023L21AAGGCCCAACANONE 
J023061N01AAGGCCCAACANONE 
J023065O09AAGGCCCAACANONE 
J023106J17AAGGCCCAACANONE 
J023119N08AAGGCCCAACANONE 
J033058A19AAGGCCCAACANONE 
J033098O13AAGGCCCAACANONE 
J033100M18AAGGCCCAACANONE 
J033125A21AAGGCCCAACANONE 
J033148C12AAGGCCCAACANONE 
J043017F03AAGGCCCAACANONE 
J043032J02AAGGCCCAACANONE 
J053047N10AAGGCCCAACANONE 
J053089P04AAGGCCCAACANONE 
J065051K09AAGGCCCAACANONE 
J065064H24AAGGCCCAACANONE 
J090001L06AAGGCCCAACANONE 
J090017C24AAGGCCCAACANONE 
J090058G15AAGGCCCAACANONE 
J090058H23AAGGCCCAACANONE 
J090061G20AAGGCCCAACANONE 
J090069N23AAGGCCCAACANONE 
J090071A08AAGGCCCAACANONE 
J090074A08AAGGCCCAACANONE 
J090077B15AAGGCCCAACANONE 
J090081K06AAGGCCCAACANONE 
J090083I05AAGGCCCAACANONE 
J090091O22AAGGCCCAACANONE 
J090097L10AAGGCCCAACANONE 
J100026B11AAGGCCCAACANONE 
J100044M01AAGGCCCAACANONE 
J100046F10AAGGCCCAACANONE 
J100051K14AAGGCCCAACANONE 
J100060D22AAGGCCCAACANONE 
J100060H18AAGGCCCAACANONE 
J100070I06AAGGCCCAACANONE 
J100071C04AAGGCCCAACANONE 
J100078M13AAGGCCCAACANONE 
J100080E17AAGGCCCAACANONE 
J100083I09AAGGCCCAACANONE 
Os02g0250600J075143F23AGTTGGGCCGTCLate embryogenesis abundant protein repeat containing protein. 
Os02g0256000AK108573GGTTGGGCCTGGConserved hypothetical protein. 
Os02g0266500AK100307GGTTGGGCCTCSimilar to RASPBERRY3. 
Os02g0281200009-184-D06TTGGCCCAACANONE 
AK063172TTGGCCCAACANONE 
Os02g0461200012-026-A12CACGGCCCAACTNONE 
AK063459CACGGCCCAACTConserved hypothetical protein. 
J065183F11CACGGCCCAACTNONE 
J075190G18CACGGCCCAACTNONE 
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein. 
Os02g0565000AK120665TCCGTCCGGCCCAACAHomeodomain-like containing protein. 
J100070C12TCCGTCCGGCCCAACANONE 
J100074L08TCCGTCCGGCCCAACANONE 
Os02g0582600006-041-F11GGGGCCCAACANONE 
AK059791GGGGCCCAACANONE 
AK102380GGGGCCCAACAHeavy metal transport/detoxification protein domain containing protein. 
J033092A09GGGGCCCAACANONE 
Os02g0621500AK120798TTTCGGCCCAACCZinc finger, RING-type domain containing protein. 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0655300006-024-H05TCTGGCCCAACTNONE 
006-032-G04TCTGGCCCAACTNONE 
006-045-F03TCTGGCCCAACTNONE 
006-076-D04TCTGGCCCAACTNONE 
006-086-C09TCTGGCCCAACTNONE 
006-104-C07TCTGGCCCAACTNONE 
AK061544TCTGGCCCAACTNONE 
AK103778TCTGGCCCAACTNONE 
AK106107TCTGGCCCAACTNONE 
AK120006TCTGGCCCAACTNONE 
AY363174TCTGGCCCAACTSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TCTGGCCCAACTNONE 
J065021C16TCTGGCCCAACTNONE 
J065182F01TCTGGCCCAACTNONE 
J075063I18TCTGGCCCAACTNONE 
J075151E01TCTGGCCCAACTNONE 
J075198K18TCTGGCCCAACTNONE 
J090026M06TCTGGCCCAACTNONE 
J090081H02TCTGGCCCAACTNONE 
J100061E20TCTGGCCCAACTNONE 
Os02g0658300AK073923TCTGGCCCAACAConserved hypothetical protein. 
J065152M15TCTGGCCCAACANONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AAGGCCCAACAAGCCCAACTNONE 
J023098L23AAGGCCCAACAAGCCCAACTNONE 
J065042J21AAGGCCCAACAAGCCCAACTNONE 
J065187L09AAGGCCCAACAAGCCCAACTNONE 
J065190O10AAGGCCCAACAAGCCCAACTNONE 
J080041G14AAGGCCCAACAAGCCCAACTNONE 
J080078K08AAGGCCCAACAAGCCCAACTNONE 
J080089D20AAGGCCCAACAAGCCCAACTNONE 
J080094D04AAGGCCCAACAAGCCCAACTNONE 
Os02g0689700AK063776GAGGCCCAACCRibosomal protein L18P/L5E family protein. 
Os02g0697200015-013-B10TGTTGGGCCGGTNONE 
AK059475TGTTGGGCCGGTNONE 
AK102993TGTTGGGCCGGTConserved hypothetical protein. 
J033079I18TGTTGGGCCGGTNONE 
J033082A14TGTTGGGCCGGTNONE 
J065047H08TGTTGGGCCGGTNONE 
J065131M14TGTTGGGCCGGTNONE 
Os02g0705300006-028-G05TGTTGGGCCGCNONE 
006-064-H09TGTTGGGCCGCNONE 
AK062089TGTTGGGCCGCNONE 
AK064855TGTTGGGCCGCNONE 
AK106164TGTTGGGCCGCTubby family protein. 
Os02g0723200AK108140GCGGCCCAACCSimilar to Alpha galactosyltransferase (Fragment). 
J090087D22GCGGCCCAACCNONE 
Os02g0752300AK072544AACGGCCCAACCConserved hypothetical protein. 
J023132N16AACGGCCCAACCNONE 
J033069F17AACGGCCCAACCNONE 
Os02g0755200AK070699AGTTGGGCCATSimilar to FLOWERING LOCUS D (Fragment). 
J023056I20AGTTGGGCCATNONE 
J065048B13AGTTGGGCCATNONE 
J065128H21AGTTGGGCCATNONE 
J065201E09AGTTGGGCCATNONE 
Os02g0767900009-154-G01GTTGGGCCTGGNONE 
009-172-H09GTTGGGCCTGGNONE 
AK099885GTTGGGCCTGGGlutaredoxin 2 family protein. 
Os02g0771700011-075-D10GTTGGGCCCCNONE 
011-086-E10GTTGGGCCCCNONE 
AK058571GTTGGGCCCCGlycoside hydrolase, family 17 protein. 
AK102185GTTGGGCCCCNONE 
J023001D03GTTGGGCCCCNONE 
J023041N11GTTGGGCCCCNONE 
J033086N13GTTGGGCCCCNONE 
J033106K14GTTGGGCCCCNONE 
J033125P22GTTGGGCCCCNONE 
Os02g0775900AK119974GGTTGGGCCGGAConserved hypothetical protein. 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK072784GCTGGGCCGGCCCAACNONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
AK121143GCTGGGCCGGCCCAACConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023075M13GCTGGGCCGGCCCAACNONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14GCTGGGCCGGCCCAACNONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16GCTGGGCCGGCCCAACNONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06GCTGGGCCGGCCCAACNONE 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0815300AK061607TGTTGGGCCATConserved hypothetical protein. 
J075088I01TGTTGGGCCATNONE 
Os02g0816700009-132-E07AGTTGGGCCCAATTNONE 
AK059572AGTTGGGCCCAATTConserved hypothetical protein. 
Os02g0816800013-089-A09AATTGGGCCCAACTNONE 
AK102271AATTGGGCCCAACTNAD-dependent epimerase/dehydratase family protein. 
J013105O04AATTGGGCCCAACTNONE 
J013124I08AATTGGGCCCAACTNONE 
J023002E08AATTGGGCCCAACTNONE 
J023025C01AATTGGGCCCAACTNONE 
J023037O12AATTGGGCCCAACTNONE 
J023049N06AATTGGGCCCAACTNONE 
J023069G18AATTGGGCCCAACTNONE 
J033029M02AATTGGGCCCAACTNONE 
J033037L22AATTGGGCCCAACTNONE 
J033089A08AATTGGGCCCAACTNONE 
J033103L07AATTGGGCCCAACTNONE 
J033125L19AATTGGGCCCAACTNONE 
J090008N20AATTGGGCCCAACTNONE 
J090041F23AATTGGGCCCAACTNONE 
J090092H16AATTGGGCCCAACTNONE 
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein. 
J065055C02AGTTGGGCCGTTGGNONE 
J065098A17AGTTGGGCCGTTGGNONE 
J065119B13AGTTGGGCCGTTGGNONE 
J065146F10AGTTGGGCCGTTGGNONE 
J065209G06AGTTGGGCCGTTGGNONE 
J080001K12AGTTGGGCCGTTGGNONE 
J080004O17AGTTGGGCCGTTGGNONE 
J080005P21AGTTGGGCCGTTGGNONE 
J080009M18AGTTGGGCCGTTGGNONE 
J080013O18AGTTGGGCCGTTGGNONE 
J080014B04AGTTGGGCCGTTGGNONE 
J080014O21AGTTGGGCCGTTGGNONE 
J080015B04AGTTGGGCCGTTGGNONE 
J080016B17AGTTGGGCCGTTGGNONE 
J080017G09AGTTGGGCCGTTGGNONE 
J080022A17AGTTGGGCCGTTGGNONE 
J080024M10AGTTGGGCCGTTGGNONE 
J080025F17AGTTGGGCCGTTGGNONE 
J080025O16AGTTGGGCCGTTGGNONE 
J080029H09AGTTGGGCCGTTGGNONE 
J080030G24AGTTGGGCCGTTGGNONE 
J080031E02AGTTGGGCCGTTGGNONE 
J080032A18AGTTGGGCCGTTGGNONE 
J080032G24AGTTGGGCCGTTGGNONE 
J080033C05AGTTGGGCCGTTGGNONE 
J080033N19AGTTGGGCCGTTGGNONE 
J080035H10AGTTGGGCCGTTGGNONE 
J080035L05AGTTGGGCCGTTGGNONE 
J080042N09AGTTGGGCCGTTGGNONE 
J080044C14AGTTGGGCCGTTGGNONE 
J080048K16AGTTGGGCCGTTGGNONE 
J080050L07AGTTGGGCCGTTGGNONE 
J080051L06AGTTGGGCCGTTGGNONE 
J080051P22AGTTGGGCCGTTGGNONE 
J080053D09AGTTGGGCCGTTGGNONE 
J080053J15AGTTGGGCCGTTGGNONE 
J080053O12AGTTGGGCCGTTGGNONE 
J080057L01AGTTGGGCCGTTGGNONE 
J080062E08AGTTGGGCCGTTGGNONE 
J080062I09AGTTGGGCCGTTGGNONE 
J080063A21AGTTGGGCCGTTGGNONE 
J080063E04AGTTGGGCCGTTGGNONE 
J080063E08AGTTGGGCCGTTGGNONE 
J080064D15AGTTGGGCCGTTGGNONE 
J080064N15AGTTGGGCCGTTGGNONE 
J080068F13AGTTGGGCCGTTGGNONE 
J080070L16AGTTGGGCCGTTGGNONE 
J080072O17AGTTGGGCCGTTGGNONE 
J080075A07AGTTGGGCCGTTGGNONE 
J080076H10AGTTGGGCCGTTGGNONE 
J080077K19AGTTGGGCCGTTGGNONE 
J080078E19AGTTGGGCCGTTGGNONE 
J080082A02AGTTGGGCCGTTGGNONE 
J080083O05AGTTGGGCCGTTGGNONE 
J080091I07AGTTGGGCCGTTGGNONE 
J080094K10AGTTGGGCCGTTGGNONE 
J080094N03AGTTGGGCCGTTGGNONE 
J080096F09AGTTGGGCCGTTGGNONE 
J080097O04AGTTGGGCCGTTGGNONE 
J090037B19AGTTGGGCCGTTGGNONE 
J100017A13AGTTGGGCCGTTGGNONE 
J100068N22AGTTGGGCCGTTGGNONE 
J100072C06AGTTGGGCCGTTGGNONE 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein. 
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
Os03g0130700AK110670GGCTGGGCCCAACANONE 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein. 
AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0160900J065071D24CGGGCCCAACTNONE 
J065132L03CGGGCCCAACTHypothetical protein. 
J075189L19CGGGCCCAACTNONE 
Os03g0161400Os03g0161400TCGGCCCAACCIQ calmodulin-binding region domain containing protein. 
Os03g0168200AK099530AGTTGGGCCAAConserved hypothetical protein. 
Os03g0175600AK059981GTTGGGCCCCACSimilar to Nit protein 2 (CUA002). 
Os03g0181600AK067807TACGGCCCAACTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TACGGCCCAACTNONE 
Os03g0186800AK100356CACGGCCCAACAModifier of rudimentary, Modr family protein. 
Os03g0192400009-081-A03AGTTGGGCCGGTNONE 
009-159-B02AGTTGGGCCGGTNONE 
AK070573AGTTGGGCCGGTGRIM-19 family protein. 
J023056B01AGTTGGGCCGGTNONE 
J023075G06AGTTGGGCCGGTNONE 
J033048K16AGTTGGGCCGGTNONE 
J033048L16AGTTGGGCCGGTNONE 
J053031H23AGTTGGGCCGGTNONE 
J065002H14AGTTGGGCCGGTNONE 
J065006G22AGTTGGGCCGGTNONE 
J065032G13AGTTGGGCCGGTNONE 
J065056A09AGTTGGGCCGGTNONE 
J065078I01AGTTGGGCCGGTNONE 
J065095G01AGTTGGGCCGGTNONE 
J065095I18AGTTGGGCCGGTNONE 
J065134M18AGTTGGGCCGGTNONE 
J065158P07AGTTGGGCCGGTNONE 
J065165K17AGTTGGGCCGGTNONE 
J065181J12AGTTGGGCCGGTNONE 
J065189N09AGTTGGGCCGGTNONE 
J065200D13AGTTGGGCCGGTNONE 
J065202H20AGTTGGGCCGGTNONE 
J065215K20AGTTGGGCCGGTNONE 
J075049N19AGTTGGGCCGGTNONE 
J075147J16AGTTGGGCCGGTNONE 
J090081E19AGTTGGGCCGGTNONE 
J100017C16AGTTGGGCCGGTNONE 
J100039M16AGTTGGGCCGGTNONE 
J100043E23AGTTGGGCCGGTNONE 
J100063L12AGTTGGGCCGGTNONE 
J100079F22AGTTGGGCCGGTNONE 
Os03g0197400AK071413AAGGCCCAACCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905AAGGCCCAACCNONE 
J053023D18AAGGCCCAACCNONE 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0227000AK068454CTGGCCCAACASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0240700009-086-G10GGCCCGGCCCAACANONE 
AK071799GGCCCGGCCCAACAConserved hypothetical protein. 
J023112A13GGCCCGGCCCAACANONE 
J043022A01GGCCCGGCCCAACANONE 
J065106A01GGCCCGGCCCAACANONE 
J075023P22GGCCCGGCCCAACANONE 
J075138I21GGCCCGGCCCAACANONE 
J075173L02GGCCCGGCCCAACANONE 
Os03g0240800006-092-D05TGTTGGGCCGGGCCNONE 
AK059292TGTTGGGCCGGGCCNONE 
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp. 
AK121552TGTTGGGCCGGGCCNONE 
J023131D06TGTTGGGCCGGGCCNONE 
J033033E14TGTTGGGCCGGGCCNONE 
J033105B01TGTTGGGCCGGGCCNONE 
J033114L18TGTTGGGCCGGGCCNONE 
J033132N24TGTTGGGCCGGGCCNONE 
J065032H03TGTTGGGCCGGGCCNONE 
J065115J20TGTTGGGCCGGGCCNONE 
J065150C05TGTTGGGCCGGGCCNONE 
J080302A11TGTTGGGCCGGGCCNONE 
J080302H16TGTTGGGCCGGGCCNONE 
J080305M12TGTTGGGCCGGGCCNONE 
J080306F13TGTTGGGCCGGGCCNONE 
J080312A06TGTTGGGCCGGGCCNONE 
J090088P09TGTTGGGCCGGGCCNONE 
Os03g0249400009-059-H08AGTTGGGCCGAGANONE 
AK062522AGTTGGGCCGAGASimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05AGTTGGGCCGAGANONE 
J053052E06AGTTGGGCCGAGANONE 
J053061K22AGTTGGGCCGAGANONE 
J065108I02AGTTGGGCCGAGANONE 
Os03g0257600Os03g0257600TCGGCCCAACProtein of unknown function DUF292, eukaryotic domain containing protein. 
Os03g0257900009-150-G06TGTTGGGCCAANONE 
009-181-H05TGTTGGGCCAANONE 
AK063892TGTTGGGCCAANONE 
AK100114TGTTGGGCCAASimilar to Lectin-like receptor kinase 7;2. 
AK103486TGTTGGGCCAANONE 
J023006K11TGTTGGGCCAANONE 
J075005E15TGTTGGGCCAANONE 
J075007K24TGTTGGGCCAANONE 
J075034G06TGTTGGGCCAANONE 
J075051I19TGTTGGGCCAANONE 
J075076A08TGTTGGGCCAANONE 
J075096H04TGTTGGGCCAANONE 
J075115I09TGTTGGGCCAANONE 
J075132K23TGTTGGGCCAANONE 
J075147C17TGTTGGGCCAANONE 
J090059O20TGTTGGGCCAANONE 
Os03g0265900009-004-C01TGTTGGGCCTTNONE 
009-045-B03TGTTGGGCCTTNONE 
AK099963TGTTGGGCCTTNONE 
AK120374TGTTGGGCCTTConserved hypothetical protein. 
J013036A19TGTTGGGCCTTNONE 
J013070J20TGTTGGGCCTTNONE 
J013071C06TGTTGGGCCTTNONE 
J013088C01TGTTGGGCCTTNONE 
J013112H21TGTTGGGCCTTNONE 
J065114K10TGTTGGGCCTTNONE 
J100028M20TGTTGGGCCTTNONE 
Os03g0266000AK068775AAGGCCCAACAOvarian tumour, otubain domain containing protein. 
AK104949AAGGCCCAACANONE 
J075149K24AAGGCCCAACANONE 
J075184C19AAGGCCCAACANONE 
Os03g0270700AK119531TGTTGGGCCGTANONE 
Os03g0276500011-014-A06ACCGGCCCAACNONE 
012-043-E04ACCGGCCCAACNONE 
012-096-G01ACCGGCCCAACNONE 
014-005-A07ACCGGCCCAACNONE 
014-031-F09ACCGGCCCAACNONE 
014-040-C09ACCGGCCCAACNONE 
014-092-G02ACCGGCCCAACNONE 
AK072830ACCGGCCCAACNONE 
AK099275ACCGGCCCAACNONE 
AK109474ACCGGCCCAACSimilar to Heat shock protein 70. 
J013036E08ACCGGCCCAACNONE 
J013047P03ACCGGCCCAACNONE 
J013048H14ACCGGCCCAACNONE 
J013060E24ACCGGCCCAACNONE 
J013093N10ACCGGCCCAACNONE 
J013123K11ACCGGCCCAACNONE 
J013153C09ACCGGCCCAACNONE 
J023010D20ACCGGCCCAACNONE 
J023027O13ACCGGCCCAACNONE 
J023029B01ACCGGCCCAACNONE 
J023063G14ACCGGCCCAACNONE 
J023083D09ACCGGCCCAACNONE 
J023091M13ACCGGCCCAACNONE 
J023121M10ACCGGCCCAACNONE 
J023126D10ACCGGCCCAACNONE 
J023139H01ACCGGCCCAACNONE 
J023145B18ACCGGCCCAACNONE 
J033029G15ACCGGCCCAACNONE 
J033050K13ACCGGCCCAACNONE 
J033057L09ACCGGCCCAACNONE 
J033092M15ACCGGCCCAACNONE 
J065007N14ACCGGCCCAACNONE 
J065038E07ACCGGCCCAACNONE 
J065043A09ACCGGCCCAACNONE 
J065100C19ACCGGCCCAACNONE 
J065117C02ACCGGCCCAACNONE 
J065213I04ACCGGCCCAACNONE 
J090001F01ACCGGCCCAACNONE 
J090025D07ACCGGCCCAACNONE 
J090037C11ACCGGCCCAACNONE 
J090047N11ACCGGCCCAACNONE 
J090053O05ACCGGCCCAACNONE 
J090070F11ACCGGCCCAACNONE 
J090082O16ACCGGCCCAACNONE 
J090085F20ACCGGCCCAACNONE 
J090096N08ACCGGCCCAACNONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE 
J053029J05TTGGCCCATATAAGGCCCAACTNONE 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
J065024G23TTGGCCCATATAAGGCCCAACTNONE 
J065036F08TTGGCCCATATAAGGCCCAACTNONE 
J065066M11TTGGCCCATATAAGGCCCAACTNONE 
J065143G19TTGGCCCATATAAGGCCCAACTNONE 
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE 
AK106050CACGTGGGCCCAACTNONE 
Os03g0297100006-113-D12CTGGCCCAACNONE 
AK059192CTGGCCCAACNONE 
AK061276CTGGCCCAACSimilar to 40S ribosomal protein S7. 
AK122143CTGGCCCAACNONE 
J023012D24CTGGCCCAACNONE 
J023041A08CTGGCCCAACNONE 
J033067H08CTGGCCCAACNONE 
J033119B03CTGGCCCAACNONE 
J033131K19CTGGCCCAACNONE 
J033136J20CTGGCCCAACNONE 
J053027D07CTGGCCCAACNONE 
J065191B01CTGGCCCAACNONE 
J065205G10CTGGCCCAACNONE 
J075112A12CTGGCCCAACNONE 
J075136D05CTGGCCCAACNONE 
J080069C17CTGGCCCAACNONE 
J090073P06CTGGCCCAACNONE 
J100026B16CTGGCCCAACNONE 
J100068P21CTGGCCCAACNONE 
J100069E15CTGGCCCAACNONE 
J100081D07CTGGCCCAACNONE 
J100088C15CTGGCCCAACNONE 
Os03g0305500AK070638GGTTGGGCCTTArgininosuccinate lyase domain containing protein. 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
016-023-H09CTGGCCCAACNONE 
016-023-H09TAGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
AK100355CTGGCCCAACUbiquitin-conjugating enzyme, E2 domain containing protein. 
AK100355TAGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023013H05CTGGCCCAACNONE 
J023013H05TAGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023043K04CTGGCCCAACNONE 
J023043K04TAGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J023083I20CTGGCCCAACNONE 
J023083I20TAGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033068F22CTGGCCCAACNONE 
J033068F22TAGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J033125P21CTGGCCCAACNONE 
J033125P21TAGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J065207A22CTGGCCCAACNONE 
J065207A22TAGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100018D20CTGGCCCAACNONE 
J100018D20TAGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100026L17CTGGCCCAACNONE 
J100026L17TAGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100055D14CTGGCCCAACNONE 
J100055D14TAGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100060P03CTGGCCCAACNONE 
J100060P03TAGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
J100078A20CTGGCCCAACNONE 
J100078A20TAGGCCCAACANONE 
Os03g0336000AK100067GTTGGGCCCTProtein prenyltransferase domain containing protein. 
J065161K02GTTGGGCCCTNONE 
J065162C21GTTGGGCCCTNONE 
Os03g0339100AK111641AAGGCCCAACTSimilar to PRL1 protein. 
Os03g0340700011-070-H05CGGGCCGAGTTGGGCCTANONE 
AK100470CGGGCCGAGTTGGGCCTATetratricopeptide-like helical domain containing protein. 
J013158I08CGGGCCGAGTTGGGCCTANONE 
J023009H24CGGGCCGAGTTGGGCCTANONE 
J023031L20CGGGCCGAGTTGGGCCTANONE 
J023093E24CGGGCCGAGTTGGGCCTANONE 
J023105J11CGGGCCGAGTTGGGCCTANONE 
J100059O05CGGGCCGAGTTGGGCCTANONE 
J100075G03CGGGCCGAGTTGGGCCTANONE 
J100086J06CGGGCCGAGTTGGGCCTANONE 
Os03g0341100009-012-D06TTGGCCCAACCNONE 
AK121580TTGGCCCAACCSimilar to 60S ribosomal protein L18. 
J033037B18TTGGCCCAACCNONE 
J053090K21TTGGCCCAACCNONE 
J065040D12TTGGCCCAACCNONE 
J075106P15TTGGCCCAACCNONE 
J075117P13TTGGCCCAACCNONE 
J075128N02TTGGCCCAACCNONE 
J090031L12TTGGCCCAACCNONE 
J100023E19TTGGCCCAACCNONE 
J100033O21TTGGCCCAACCNONE 
J100070A12TTGGCCCAACCNONE 
J100087M20TTGGCCCAACCNONE 
Os03g0343500009-042-G06CCACGGCCCAACNONE 
009-063-D01CCACGGCCCAACNONE 
009-156-H09CCACGGCCCAACNONE 
AB117995CCACGGCCCAACNONE 
AK058737CCACGGCCCAACNONE 
AK059599CCACGGCCCAACSimilar to 60S ribosomal protein L22-2. 
AK121502CCACGGCCCAACNONE 
J023082D10CCACGGCCCAACNONE 
J033022G11CCACGGCCCAACNONE 
J075048M16CCACGGCCCAACNONE 
J075049O20CCACGGCCCAACNONE 
J075082I02CCACGGCCCAACNONE 
J075105G01CCACGGCCCAACNONE 
J075131K05CCACGGCCCAACNONE 
J080002H01CCACGGCCCAACNONE 
J080003H01CCACGGCCCAACNONE 
J080005G08CCACGGCCCAACNONE 
J080011M13CCACGGCCCAACNONE 
J080020M02CCACGGCCCAACNONE 
J080026N24CCACGGCCCAACNONE 
J080028L09CCACGGCCCAACNONE 
J080032O14CCACGGCCCAACNONE 
J080033J12CCACGGCCCAACNONE 
J080035D05CCACGGCCCAACNONE 
J080039H01CCACGGCCCAACNONE 
J080044B07CCACGGCCCAACNONE 
J080044E23CCACGGCCCAACNONE 
J080049N11CCACGGCCCAACNONE 
J080050A21CCACGGCCCAACNONE 
J080055L24CCACGGCCCAACNONE 
J080059N20CCACGGCCCAACNONE 
J080061F04CCACGGCCCAACNONE 
J080078I16CCACGGCCCAACNONE 
J080079G24CCACGGCCCAACNONE 
J080080K13CCACGGCCCAACNONE 
J080083G20CCACGGCCCAACNONE 
J080087B08CCACGGCCCAACNONE 
J080091L19CCACGGCCCAACNONE 
J080094D06CCACGGCCCAACNONE 
J090038L06CCACGGCCCAACNONE 
J090075H06CCACGGCCCAACNONE 
J090081D12CCACGGCCCAACNONE 
Os03g0347800AK073756AGCCCACAGGGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os03g0363350Os03g0363350GTATGGGCCATGAGGCCCAACAProtein of unknown function DUF455 family protein. 
Os03g0372700AK064323GGTTGGGCCGAAANONE 
AK073312GGTTGGGCCGAAALow temperature viability protein family protein. 
Os03g0390400009-175-E06TTCGGCCCAACTNONE 
013-040-G01TTCGGCCCAACTNONE 
014-050-G05TTCGGCCCAACTNONE 
AB025187TTCGGCCCAACTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TTCGGCCCAACTNONE 
J013033A17TTCGGCCCAACTNONE 
J023028J08TTCGGCCCAACTNONE 
J023061N05TTCGGCCCAACTNONE 
J023077A03TTCGGCCCAACTNONE 
J023086E01TTCGGCCCAACTNONE 
J033022A08TTCGGCCCAACTNONE 
J033040F24TTCGGCCCAACTNONE 
J075073I24TTCGGCCCAACTNONE 
J075081H01TTCGGCCCAACTNONE 
J075175N19TTCGGCCCAACTNONE 
J100025M03TTCGGCCCAACTNONE 
J100036J06TTCGGCCCAACTNONE 
J100045O18TTCGGCCCAACTNONE 
J100062G15TTCGGCCCAACTNONE 
J100090N19TTCGGCCCAACTNONE 
Os03g0405100AK108624CCGTGGGCCCAACCRpsU-divergently transcribed family protein. 
Os03g0576900AK071314AAGGCCCAACCAmino acid/polyamine transporter I family protein. 
J023074L08AAGGCCCAACCNONE 
J023084D13AAGGCCCAACCNONE 
J080011C14AAGGCCCAACCNONE 
J080012F24AAGGCCCAACCNONE 
J080018M05AAGGCCCAACCNONE 
J080021G05AAGGCCCAACCNONE 
J080021N18AAGGCCCAACCNONE 
J080023E19AAGGCCCAACCNONE 
J080024H14AAGGCCCAACCNONE 
J080025E15AAGGCCCAACCNONE 
J080038F19AAGGCCCAACCNONE 
J080044N09AAGGCCCAACCNONE 
J080054D05AAGGCCCAACCNONE 
J080057J16AAGGCCCAACCNONE 
J080060A05AAGGCCCAACCNONE 
J080061M12AAGGCCCAACCNONE 
J080063H13AAGGCCCAACCNONE 
J080065O04AAGGCCCAACCNONE 
J080066I17AAGGCCCAACCNONE 
J080066J06AAGGCCCAACCNONE 
J080089J22AAGGCCCAACCNONE 
J080090I03AAGGCCCAACCNONE 
J080091J23AAGGCCCAACCNONE 
J080091K20AAGGCCCAACCNONE 
J080093G24AAGGCCCAACCNONE 
J080094I08AAGGCCCAACCNONE 
J080096A17AAGGCCCAACCNONE 
J090051G12AAGGCCCAACCNONE 
Os03g0577000012-055-F04AGGGCCCAACCCGCGCNONE 
AK061051AGGGCCCAACCCGCGCSimilar to Ribosomal protein S3 (Fragment). 
AK099146AGGGCCCAACCCGCGCNONE 
J065060A01AGGGCCCAACCCGCGCNONE 
J075079B17AGGGCCCAACCCGCGCNONE 
J075134K12AGGGCCCAACCCGCGCNONE 
J090048F23AGGGCCCAACCCGCGCNONE 
J090072I19AGGGCCCAACCCGCGCNONE 
J100087C19AGGGCCCAACCCGCGCNONE 
J100090C21AGGGCCCAACCCGCGCNONE 
Os03g0647400AK073665TGTTGGGCCTAGCK domain containing protein. 
J033051B07TGTTGGGCCTANONE 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK073205GTGGTGGGGCCCAACZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
AK098968GTGGTGGGGCCCAACNONE 
Os03g0727100AK068587GAGGCCCAACTConserved hypothetical protein. 
AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GAGGCCCAACTNONE 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GAGGCCCAACTNONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0743200J065049G14TGTTGGGCCTCNONE 
J065158O18TGTTGGGCCTCNONE 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0746800AK101718GGTGGGCCCAACWD-40 repeat containing protein. 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0758700AK106620GTGGCCCAACAWD40-like domain containing protein. 
Os03g0763000AK120812GTTGGGCCGAACAGCCCASimilar to Casein kinase II alpha subunit. 
Os03g0765000AK073918TGCGGCCCAACTSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0766000AK070596AGTTGGGCCGGGNONE 
AK104743AGTTGGGCCGGGNONE 
AK106079AGTTGGGCCGGGNONE 
J013063M09AGTTGGGCCGGGNONE 
J023056A03AGTTGGGCCGGGNONE 
J043038L07AGTTGGGCCGGGNONE 
J053067N16AGTTGGGCCGGGNONE 
J053073G09AGTTGGGCCGGGNONE 
J053075I19AGTTGGGCCGGGNONE 
Os03g0772800009-023-E05CAACGGCCCAACANONE 
009-059-F12CAACGGCCCAACANONE 
009-114-B08CAACGGCCCAACANONE 
009-115-G09CAACGGCCCAACANONE 
009-151-D08CAACGGCCCAACANONE 
009-158-A10CAACGGCCCAACANONE 
009-191-H02CAACGGCCCAACANONE 
009-192-E05CAACGGCCCAACANONE 
009-197-F11CAACGGCCCAACANONE 
AK059576CAACGGCCCAACANONE 
AK121608CAACGGCCCAACACytochrome c oxidase, subunit VIa family protein. 
J023087H20CAACGGCCCAACANONE 
J023105P14CAACGGCCCAACANONE 
J033026P15CAACGGCCCAACANONE 
J033042K10CAACGGCCCAACANONE 
J033133C09CAACGGCCCAACANONE 
J065123K13CAACGGCCCAACANONE 
J075190D03CAACGGCCCAACANONE 
J080310M14CAACGGCCCAACANONE 
J080317L14CAACGGCCCAACANONE 
J100067J19CAACGGCCCAACANONE 
J100079H21CAACGGCCCAACANONE 
Os03g0791800013-037-A12GGTTGGGCCCCNONE 
AB079798GGTTGGGCCCCNONE 
AK067703GGTTGGGCCCCRad6 (Ubiquitin carrier protein). 
AK120251GGTTGGGCCCCNONE 
J013045G10GGTTGGGCCCCNONE 
J023102B18GGTTGGGCCCCNONE 
J065020J23GGTTGGGCCCCNONE 
J065127I21GGTTGGGCCCCNONE 
J065151E11GGTTGGGCCCCNONE 
J075076B05GGTTGGGCCCCNONE 
J075116C15GGTTGGGCCCCNONE 
J075136A07GGTTGGGCCCCNONE 
J100029G21GGTTGGGCCCCNONE 
J100030K01GGTTGGGCCCCNONE 
J100041J02GGTTGGGCCCCNONE 
J100049C22GGTTGGGCCCCNONE 
J100057G17GGTTGGGCCCCNONE 
J100086L12GGTTGGGCCCCNONE 
Os03g0792400AK064808AGTTGGGCCAGPeptidase M50 family protein. 
J013000D19AGTTGGGCCAGNONE 
J013106E22AGTTGGGCCAGNONE 
J075053A21AGTTGGGCCAGNONE 
Os03g0800800AK065406GCGGCCCAACSMAD/FHA domain containing protein. 
J013020B01GCGGCCCAACNONE 
J033116K11GCGGCCCAACNONE 
J090079M08GCGGCCCAACNONE 
Os03g0802300AK120564TGTTGGGCCAGConserved hypothetical protein. 
AK120687TGTTGGGCCAGNONE 
Os03g0822200AK069405GCGGCCCAACANAD-dependent epimerase/dehydratase family protein. 
AK104151GCGGCCCAACANONE 
AK104209GCGGCCCAACANONE 
J065107D01GCGGCCCAACANONE 
J065191L23GCGGCCCAACANONE 
J065217B05GCGGCCCAACANONE 
Os03g0825900AK109694AGTTGGGCCCACAConserved hypothetical protein. 
Os03g0828100009-088-D04TAGGCCCAACCNONE 
009-125-F01TAGGCCCAACCNONE 
009-169-C06TAGGCCCAACCNONE 
AK059132TAGGCCCAACCNONE 
AK062799TAGGCCCAACCNONE 
AK099043TAGGCCCAACCSimilar to 50S ribosomal protein L18. 
J013146D01TAGGCCCAACCNONE 
J065057J16TAGGCCCAACCNONE 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0843400009-195-F11CCCGGCCCAACANONE 
AK061198CCCGGCCCAACASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076CCCGGCCCAACANONE 
Os03g0843500AK067985CGGGCCCAACANONE 
AK101661CGGGCCCAACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAACANONE 
J080302L23CGGGCCCAACANONE 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE 
Os03g0852900011-012-A12TCCGGGCCCAACTNONE 
AK100660TCCGGGCCCAACTSimilar to Cleavage and polyadenylation specificity factor, 73 kDa subunit (CPSF 73 kDa subunit). 
J013073D18TCCGGGCCCAACTNONE 
J013152K17TCCGGGCCCAACTNONE 
J023111N01TCCGGGCCCAACTNONE 
J065214G07TCCGGGCCCAACTNONE 
J090080E10TCCGGGCCCAACTNONE 
Os03g0854000009-186-C03TGTTGGGCCGCANONE 
AK061374TGTTGGGCCGCAProtein of unknown function UPF0131 family protein. 
J065138B11TGTTGGGCCGCANONE 
Os04g0117100009-025-D02CCCGGCCCAACANONE 
009-056-D03CCCGGCCCAACANONE 
009-145-F01CCCGGCCCAACANONE 
009-146-C06CCCGGCCCAACANONE 
009-186-C05CCCGGCCCAACANONE 
AK060395CCCGGCCCAACANONE 
AK121763CCCGGCCCAACAConserved hypothetical protein. 
J033090J17CCCGGCCCAACANONE 
J065058O06CCCGGCCCAACANONE 
J065058P05CCCGGCCCAACANONE 
J065141C14CCCGGCCCAACANONE 
J065162F07CCCGGCCCAACANONE 
J065199N16CCCGGCCCAACANONE 
J065214I05CCCGGCCCAACANONE 
J075003L04CCCGGCCCAACANONE 
J075014C14CCCGGCCCAACANONE 
J075063K14CCCGGCCCAACANONE 
J075111N19CCCGGCCCAACANONE 
J075138E13CCCGGCCCAACANONE 
J075189E23CCCGGCCCAACANONE 
J080304J23CCCGGCCCAACANONE 
J080310L07CCCGGCCCAACANONE 
J080318A16CCCGGCCCAACANONE 
J100054P14CCCGGCCCAACANONE 
Os04g0195100AK107201GGTTGGGCCATCyclin-like F-box domain containing protein. 
Os04g0208500015-079-C10TTGGCCCAACCNONE 
AK106410TTGGCCCAACCCyclin-like F-box domain containing protein. 
Os04g0320200012-089-H09AGGGCCCAACANONE 
AK069513AGGGCCCAACAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028AGGGCCCAACANONE 
AK119256AGGGCCCAACANONE 
J023020H09AGGGCCCAACANONE 
J065112F21AGGGCCCAACANONE 
J100036M07AGGGCCCAACANONE 
Os04g0466100AK064543TGTTGGGCCTCSimilar to Cell division protein FtsH-like protein. 
Os04g0490000AK108365AGTTGGGCCTTGSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0492900AK102780AGGGCCCAACTCRS1/YhbY domain containing protein. 
AK120004AGGGCCCAACTNONE 
AK120369AGGGCCCAACTNONE 
Os04g0504200AK110863TGTTGGGCCAAConserved hypothetical protein. 
Os04g0504600J065162K24GACGGCCCAACANONE 
Os04g0520900AK068793TGTTGGGCCAAProtein prenyltransferase domain containing protein. 
AK105606TGTTGGGCCAANONE 
Os04g0581300009-171-H01ATGGCCCATAAGGCCCAACANONE 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0602900AK065982CCTGGGCCCAACTNONE 
AK100414CCTGGGCCCAACTIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05CCTGGGCCCAACTNONE 
J065196I21CCTGGGCCCAACTNONE 
J065205B13CCTGGGCCCAACTNONE 
J090017J24CCTGGGCCCAACTNONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0625600AK070994AGTTGGGCCGCTRAF-like domain containing protein. 
J023080H04AGTTGGGCCGCNONE 
J023086H15AGTTGGGCCGCNONE 
J033037L21AGTTGGGCCGCNONE 
J033044P14AGTTGGGCCGCNONE 
J065075C23AGTTGGGCCGCNONE 
J065167C18AGTTGGGCCGCNONE 
J100024E02AGTTGGGCCGCNONE 
J100068N24AGTTGGGCCGCNONE 
J100070G20AGTTGGGCCGCNONE 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
Os04g0658300AK067399GTTGGGCCATSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0665000009-149-A12CACGGCCCAACNONE 
AK062995CACGGCCCAACCHCH domain containing protein. 
J065017G19CACGGCCCAACNONE 
J080301G12CACGGCCCAACNONE 
Os04g0681500AK105582AAATGGGCCAGGCCCAACEF-Hand type domain containing protein. 
Os04g0683900004-009-A11GTTGGGCCAANONE 
014-076-H12GTTGGGCCAANONE 
AK060880GTTGGGCCAANONE 
AK099749GTTGGGCCAAHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GTTGGGCCAANONE 
J013050K21GTTGGGCCAANONE 
J013092E09GTTGGGCCAANONE 
J013095N06GTTGGGCCAANONE 
J013095P07GTTGGGCCAANONE 
J013130D22GTTGGGCCAANONE 
J013134O15GTTGGGCCAANONE 
J023022I06GTTGGGCCAANONE 
J023062L11GTTGGGCCAANONE 
J023078J11GTTGGGCCAANONE 
J023086J01GTTGGGCCAANONE 
J033125A20GTTGGGCCAANONE 
J065023K13GTTGGGCCAANONE 
J065045N02GTTGGGCCAANONE 
J065129F01GTTGGGCCAANONE 
J065164H14GTTGGGCCAANONE 
J065192H09GTTGGGCCAANONE 
J075064P15GTTGGGCCAANONE 
J075088G17GTTGGGCCAANONE 
J075199D20GTTGGGCCAANONE 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os04g0692200006-047-H10ATGGCCCAGGCCCAACANONE 
006-107-D08ATGGCCCAGGCCCAACANONE 
009-122-B09ATGGCCCAGGCCCAACANONE 
AK059807ATGGCCCAGGCCCAACANONE 
AK060875ATGGCCCAGGCCCAACANONE 
AK071726ATGGCCCAGGCCCAACAConserved hypothetical protein. 
J023110I24ATGGCCCAGGCCCAACANONE 
J033091O06ATGGCCCAGGCCCAACANONE 
J053027N16ATGGCCCAGGCCCAACANONE 
J053089E19ATGGCCCAGGCCCAACANONE 
J053098H12ATGGCCCAGGCCCAACANONE 
J053099N13ATGGCCCAGGCCCAACANONE 
J075031B15ATGGCCCAGGCCCAACANONE 
J080013D12ATGGCCCAGGCCCAACANONE 
J080013H05ATGGCCCAGGCCCAACANONE 
J080013H07ATGGCCCAGGCCCAACANONE 
J080088I03ATGGCCCAGGCCCAACANONE 
Os04g0692500AK101528GCGGCCCAACANONE 
Os05g0113000AK067079CAAGTGGGCCCAACCAmino acid-binding ACT domain containing protein. 
Os05g0118000AK110694CTGGCCCAACASRR1 domain containing protein. 
Os05g0120800AK066865TCCGGCCCAACAConserved hypothetical protein. 
Os05g0121000009-181-E02GTTTGGGCCCACTAGGCCCAACCNONE 
AK058867GTTTGGGCCCACTAGGCCCAACCNONE 
AK071341GTTTGGGCCCACTAGGCCCAACCProtein of unknown function DUF1218 family protein. 
J023024H24GTTTGGGCCCACTAGGCCCAACCNONE 
J023090B22GTTTGGGCCCACTAGGCCCAACCNONE 
J023111G15GTTTGGGCCCACTAGGCCCAACCNONE 
J023134K14GTTTGGGCCCACTAGGCCCAACCNONE 
J033057C05GTTTGGGCCCACTAGGCCCAACCNONE 
J033067J15GTTTGGGCCCACTAGGCCCAACCNONE 
J033084L15GTTTGGGCCCACTAGGCCCAACCNONE 
J033088B04GTTTGGGCCCACTAGGCCCAACCNONE 
J043027A08GTTTGGGCCCACTAGGCCCAACCNONE 
J043029L03GTTTGGGCCCACTAGGCCCAACCNONE 
J053031K22GTTTGGGCCCACTAGGCCCAACCNONE 
J053046I01GTTTGGGCCCACTAGGCCCAACCNONE 
J053070B05GTTTGGGCCCACTAGGCCCAACCNONE 
J053072C10GTTTGGGCCCACTAGGCCCAACCNONE 
J065097M22GTTTGGGCCCACTAGGCCCAACCNONE 
J065164I17GTTTGGGCCCACTAGGCCCAACCNONE 
J075058I08GTTTGGGCCCACTAGGCCCAACCNONE 
J075064C09GTTTGGGCCCACTAGGCCCAACCNONE 
J080304C16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304H16GTTTGGGCCCACTAGGCCCAACCNONE 
J080306E17GTTTGGGCCCACTAGGCCCAACCNONE 
J080310L03GTTTGGGCCCACTAGGCCCAACCNONE 
J080316J07GTTTGGGCCCACTAGGCCCAACCNONE 
J080317L23GTTTGGGCCCACTAGGCCCAACCNONE 
J080319A10GTTTGGGCCCACTAGGCCCAACCNONE 
J090060F01GTTTGGGCCCACTAGGCCCAACCNONE 
J100042N16GTTTGGGCCCACTAGGCCCAACCNONE 
J100047F05GTTTGGGCCCACTAGGCCCAACCNONE 
J100075J19GTTTGGGCCCACTAGGCCCAACCNONE 
Os05g0121500006-117-B10GGTTGGGCCATNONE 
009-059-D04GGTTGGGCCATNONE 
J065066C12GGTTGGGCCATConserved hypothetical protein. 
J075013I12GGTTGGGCCATNONE 
J090046D18GGTTGGGCCATNONE 
Os05g0121800AK101222AAGGCCCAACAConserved hypothetical protein. 
J033031D02AAGGCCCAACANONE 
J065078F10AAGGCCCAACANONE 
J065151J16AAGGCCCAACANONE 
J065151K04AAGGCCCAACANONE 
J090057E18AAGGCCCAACANONE 
Os05g0122700J065185N19GCCACGTGGCCCAACTNONE 
J065188N05GCCACGTGGCCCAACTNONE 
J065198E09GCCACGTGGCCCAACTNONE 
J065215H08GCCACGTGGCCCAACTSimilar to Low-temperature induced protein lt101.2. 
Os05g0126200AK059554GCGGCCCAACAConserved hypothetical protein. 
AK121734GCGGCCCAACANONE 
J033084B09GCGGCCCAACANONE 
J090010I10GCGGCCCAACANONE 
Os05g0148300009-031-A08TGTTGGGCCGTTNONE 
AK062421TGTTGGGCCGTTRibosomal protein S27, mitochondrial family protein. 
Os05g0152400Os05g0152400AGTTGGGCCAAGlycosyl transferase, family 14 protein. 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0169400AK073439TCCGGCCCAACProtein of unknown function DUF1421 family protein. 
J013110E15TCCGGCCCAACNONE 
J033044H02TCCGGCCCAACNONE 
Os05g0182700003-102-E07CCACTGACATGTGGGCCCAACTNONE 
011-019-D04CCACTGACATGTGGGCCCAACTNONE 
013-068-D09CCACTGACATGTGGGCCCAACTNONE 
014-032-G03CCACTGACATGTGGGCCCAACTNONE 
AK065911CCACTGACATGTGGGCCCAACTProtein of unknown function DUF1664 family protein. 
AK104343CCACTGACATGTGGGCCCAACTNONE 
J013045E01CCACTGACATGTGGGCCCAACTNONE 
J013156L15CCACTGACATGTGGGCCCAACTNONE 
J023029P17CCACTGACATGTGGGCCCAACTNONE 
J023134I24CCACTGACATGTGGGCCCAACTNONE 
J033099A10CCACTGACATGTGGGCCCAACTNONE 
J033115L16CCACTGACATGTGGGCCCAACTNONE 
J090007M24CCACTGACATGTGGGCCCAACTNONE 
J090019F02CCACTGACATGTGGGCCCAACTNONE 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0347000009-013-E04AGTTGGGCCGGANONE 
AK109444AGTTGGGCCGGATAFII55 protein conserved region domain containing protein. 
J065049M12AGTTGGGCCGGANONE 
J065190K18AGTTGGGCCGGANONE 
J075169G13AGTTGGGCCGGANONE 
Os05g0349000AK070681CCATGGGCGTTGGGCCTCConserved hypothetical protein. 
AK120753CCATGGGCGTTGGGCCTCNONE 
J023006K02CCATGGGCGTTGGGCCTCNONE 
J023063E02CCATGGGCGTTGGGCCTCNONE 
J043003J19CCATGGGCGTTGGGCCTCNONE 
Os05g0365500AK072352CTGGCCCAACTProtein prenyltransferase domain containing protein. 
AK072352GACGGCCCAACProtein prenyltransferase domain containing protein. 
J043027P13CTGGCCCAACTNONE 
J043027P13GACGGCCCAACNONE 
Os05g0375400003-125-H02GTTGGGCCAGNONE 
003-128-D02GTTGGGCCAGNONE 
003-128-F08GTTGGGCCAGNONE 
004-007-B08GTTGGGCCAGNONE 
006-026-D11GTTGGGCCAGNONE 
006-027-A12GTTGGGCCAGNONE 
006-029-G06GTTGGGCCAGNONE 
006-047-B10GTTGGGCCAGNONE 
006-053-D08GTTGGGCCAGNONE 
006-070-H11GTTGGGCCAGNONE 
006-078-C06GTTGGGCCAGNONE 
006-079-A04GTTGGGCCAGNONE 
006-084-C10GTTGGGCCAGNONE 
006-099-G02GTTGGGCCAGNONE 
006-112-F07GTTGGGCCAGNONE 
006-118-A02GTTGGGCCAGNONE 
006-119-G04GTTGGGCCAGNONE 
009-039-D09GTTGGGCCAGNONE 
009-053-C11GTTGGGCCAGNONE 
009-178-E07GTTGGGCCAGNONE 
011-004-H01GTTGGGCCAGNONE 
011-010-A04GTTGGGCCAGNONE 
011-010-H04GTTGGGCCAGNONE 
011-018-A04GTTGGGCCAGNONE 
011-023-H04GTTGGGCCAGNONE 
011-025-H01GTTGGGCCAGNONE 
011-044-B04GTTGGGCCAGNONE 
011-044-H08GTTGGGCCAGNONE 
011-049-F01GTTGGGCCAGNONE 
011-056-C03GTTGGGCCAGNONE 
011-064-H01GTTGGGCCAGNONE 
011-070-D07GTTGGGCCAGNONE 
011-081-H09GTTGGGCCAGNONE 
011-087-D03GTTGGGCCAGNONE 
011-090-E01GTTGGGCCAGNONE 
011-094-F08GTTGGGCCAGNONE 
011-097-E08GTTGGGCCAGNONE 
011-099-C03GTTGGGCCAGNONE 
012-027-H12GTTGGGCCAGNONE 
012-031-H01GTTGGGCCAGNONE 
012-040-G01GTTGGGCCAGNONE 
012-047-A03GTTGGGCCAGNONE 
012-055-E06GTTGGGCCAGNONE 
012-076-H11GTTGGGCCAGNONE 
012-086-B03GTTGGGCCAGNONE 
012-091-A05GTTGGGCCAGNONE 
012-096-C03GTTGGGCCAGNONE 
013-001-F09GTTGGGCCAGNONE 
013-003-D02GTTGGGCCAGNONE 
013-006-C08GTTGGGCCAGNONE 
013-006-G04GTTGGGCCAGNONE 
013-007-D08GTTGGGCCAGNONE 
013-008-B10GTTGGGCCAGNONE 
013-008-C12GTTGGGCCAGNONE 
013-011-A10GTTGGGCCAGNONE 
013-011-D04GTTGGGCCAGNONE 
013-014-B10GTTGGGCCAGNONE 
013-015-F02GTTGGGCCAGNONE 
013-018-F08GTTGGGCCAGNONE 
013-021-D03GTTGGGCCAGNONE 
013-021-E12GTTGGGCCAGNONE 
013-026-A06GTTGGGCCAGNONE 
013-026-E12GTTGGGCCAGNONE 
013-028-F08GTTGGGCCAGNONE 
013-032-B01GTTGGGCCAGNONE 
013-032-H07GTTGGGCCAGNONE 
013-037-B09GTTGGGCCAGNONE 
013-038-F11GTTGGGCCAGNONE 
013-039-C04GTTGGGCCAGNONE 
013-040-E11GTTGGGCCAGNONE 
013-050-E12GTTGGGCCAGNONE 
013-050-G09GTTGGGCCAGNONE 
013-053-G07GTTGGGCCAGNONE 
013-055-D04GTTGGGCCAGNONE 
013-056-E10GTTGGGCCAGNONE 
013-056-F04GTTGGGCCAGNONE 
013-060-G06GTTGGGCCAGNONE 
013-066-E12GTTGGGCCAGNONE 
013-068-A09GTTGGGCCAGNONE 
013-068-G07GTTGGGCCAGNONE 
013-072-B02GTTGGGCCAGNONE 
013-073-F07GTTGGGCCAGNONE 
013-075-G07GTTGGGCCAGNONE 
013-082-E04GTTGGGCCAGNONE 
013-083-B04GTTGGGCCAGNONE 
013-085-F08GTTGGGCCAGNONE 
013-087-D08GTTGGGCCAGNONE 
013-089-C08GTTGGGCCAGNONE 
013-090-A01GTTGGGCCAGNONE 
013-093-B03GTTGGGCCAGNONE 
013-099-A07GTTGGGCCAGNONE 
013-099-E03GTTGGGCCAGNONE 
014-024-E04GTTGGGCCAGNONE 
014-049-C09GTTGGGCCAGNONE 
014-078-E06GTTGGGCCAGNONE 
015-038-A11GTTGGGCCAGNONE 
015-070-G03GTTGGGCCAGNONE 
015-074-D01GTTGGGCCAGNONE 
015-082-G04GTTGGGCCAGNONE 
016-006-E05GTTGGGCCAGNONE 
016-011-E07GTTGGGCCAGNONE 
016-040-F10GTTGGGCCAGNONE 
016-042-F10GTTGGGCCAGNONE 
016-052-B11GTTGGGCCAGNONE 
016-069-B04GTTGGGCCAGNONE 
016-079-C01GTTGGGCCAGNONE 
016-080-A10GTTGGGCCAGNONE 
016-085-C09GTTGGGCCAGNONE 
016-093-D08GTTGGGCCAGNONE 
AF323610GTTGGGCCAGNONE 
AK060867GTTGGGCCAGNONE 
AK121825GTTGGGCCAGBeta-glucanase precursor. 
AY768944GTTGGGCCAGNONE 
J013099L04GTTGGGCCAGNONE 
J013153K08GTTGGGCCAGNONE 
J033099G01GTTGGGCCAGNONE 
J065176D10GTTGGGCCAGNONE 
J065176G02GTTGGGCCAGNONE 
J075138B12GTTGGGCCAGNONE 
J075170I16GTTGGGCCAGNONE 
J075194A22GTTGGGCCAGNONE 
J100036M10GTTGGGCCAGNONE 
J100037E23GTTGGGCCAGNONE 
J100037I10GTTGGGCCAGNONE 
J100041D24GTTGGGCCAGNONE 
J100053D13GTTGGGCCAGNONE 
J100054F07GTTGGGCCAGNONE 
J100087M21GTTGGGCCAGNONE 
J100090H22GTTGGGCCAGNONE 
Os05g0386800009-185-E02GAGGCCCAACTNONE 
AK062748GAGGCCCAACTNONE 
Os05g0393800AK069074TCGGCCCAACProtein of unknown function DUF221 domain containing protein. 
Os05g0400600AK072045TCCGGCCCAACTCobalt transport protein family protein. 
Os05g0406800AK062566GGGCCCAACNONE 
AK099640GGGCCCAACLeucine rich repeat, N-terminal domain containing protein. 
J013060B14GGGCCCAACNONE 
J090013F14GGGCCCAACNONE 
J090062E13GGGCCCAACNONE 
J090063D09GGGCCCAACNONE 
J090075H10GGGCCCAACNONE 
J090096E22GGGCCCAACNONE 
Os05g0412800AF402803ATGGCCCAACASimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0415400AK107330CAGGTGGGGCCCAACTSimilar to OsNAC6 protein. 
AK119651CAGGTGGGGCCCAACTNONE 
Os05g0443300Os05g0443300AGTTGGGCCGCSec23/Sec24 trunk region domain containing protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0480700AK100850GGTTGGGCCCATCTSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11GGTTGGGCCCATCTNONE 
Os05g0490800J065037L19TCCGGCCCAACTNONE 
Os05g0540100AB021666GAGGCCCAACTNONE 
AK060623GAGGCCCAACTNONE 
AK103819GAGGCCCAACTFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0540800AK060731AGTTGGGCCGGCCCAATANONE 
AK071090AGTTGGGCCGGCCCAATAHomeodomain-like containing protein. 
J013095F03AGTTGGGCCGGCCCAATANONE 
J023079C11AGTTGGGCCGGCCCAATANONE 
J033080E08AGTTGGGCCGGCCCAATANONE 
Os05g0553400AK108452CTGGGGCCCAACCSimilar to Myb-related transcription factor-like protein (MYB transcription factor). 
Os05g0555300009-032-C03GCGGCCCAACANONE 
009-125-E08GCGGCCCAACANONE 
009-149-C12GCGGCCCAACANONE 
009-172-C01GCGGCCCAACANONE 
AK062890GCGGCCCAACAFerredoxin domain containing protein. 
AK062997GCGGCCCAACANONE 
Os05g0557200AK062090CTTGGGCTCGGCCCAACANONE 
AK102111CTTGGGCTCGGCCCAACAArmadillo-like helical domain containing protein. 
J013047E13CTTGGGCTCGGCCCAACANONE 
J013089P04CTTGGGCTCGGCCCAACANONE 
J013130H17CTTGGGCTCGGCCCAACANONE 
J013132C20CTTGGGCTCGGCCCAACANONE 
J023001E06CTTGGGCTCGGCCCAACANONE 
J023108C09CTTGGGCTCGGCCCAACANONE 
J023125C12CTTGGGCTCGGCCCAACANONE 
J033023O10CTTGGGCTCGGCCCAACANONE 
J033033K16CTTGGGCTCGGCCCAACANONE 
J033064C11CTTGGGCTCGGCCCAACANONE 
J033071P07CTTGGGCTCGGCCCAACANONE 
J033072H14CTTGGGCTCGGCCCAACANONE 
J033084F06CTTGGGCTCGGCCCAACANONE 
J033084H11CTTGGGCTCGGCCCAACANONE 
J033097C05CTTGGGCTCGGCCCAACANONE 
J043009E20CTTGGGCTCGGCCCAACANONE 
J053035M10CTTGGGCTCGGCCCAACANONE 
J053043J22CTTGGGCTCGGCCCAACANONE 
J053082K10CTTGGGCTCGGCCCAACANONE 
J053094N13CTTGGGCTCGGCCCAACANONE 
Os05g0561500006-066-D12GGTTGGGCCTGGNONE 
AK061788GGTTGGGCCTGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862GGTTGGGCCTGGNONE 
J013000O09GGTTGGGCCTGGNONE 
J033145C24GGTTGGGCCTGGNONE 
Os05g0564400006-023-A05GTGGCCCAACCNONE 
AK073075GTGGCCCAACCSimilar to GTP-binding protein. 
AK109344GTGGCCCAACCNONE 
Os05g0565000AK102673TACGGCCCAACTSimilar to 60S ribosomal protein L18a-1. 
J033102C12TACGGCCCAACTNONE 
J033124C13TACGGCCCAACTNONE 
J043003L04TACGGCCCAACTNONE 
J043006N08TACGGCCCAACTNONE 
Os05g0565200004-015-E06AAGGCCCAACCNONE 
004-015-E06AAGGCCCAACCNONE 
004-015-E06GAGGCCCAACCNONE 
004-015-E06TCCGGCCCAACCNONE 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090GAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090TCCGGCCCAACCSimilar to Urease accessory protein G. 
AK104200AAGGCCCAACCNONE 
AK104200AAGGCCCAACCNONE 
AK104200GAGGCCCAACCNONE 
AK104200TCCGGCCCAACCNONE 
AK104368AAGGCCCAACCNONE 
AK104368AAGGCCCAACCNONE 
AK104368GAGGCCCAACCNONE 
AK104368TCCGGCCCAACCNONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
Os05g0571300AK072262CCAGGCCCAACAConserved hypothetical protein. 
AK109853CCAGGCCCAACANONE 
AK111014CCAGGCCCAACANONE 
Os05g0571600Os05g0571600TTTCGGCCCAACCConserved hypothetical protein. 
Os05g0572900AK103180GTTGGGCCCAAGProtein prenyltransferase domain containing protein. 
Os05g0596200009-059-G06AGTTGGGCCCAGGNONE 
AK062521AGTTGGGCCCAGGNONE 
AK107887AGTTGGGCCCAGGConserved hypothetical protein. 
AK108209AGTTGGGCCCAGGNONE 
J065154B01AGTTGGGCCCAGGNONE 
Os06g0101300013-080-G09AGTTGGGCCTAATTGGGCCTGGNONE 
015-006-A01AGTTGGGCCTAATTGGGCCTGGNONE 
015-044-F09AGTTGGGCCTAATTGGGCCTGGNONE 
AK109515AGTTGGGCCTAATTGGGCCTGGZinc finger, RING-type domain containing protein. 
AK121897AGTTGGGCCTAATTGGGCCTGGNONE 
J033084O06AGTTGGGCCTAATTGGGCCTGGNONE 
J033105E24AGTTGGGCCTAATTGGGCCTGGNONE 
J033126H24AGTTGGGCCTAATTGGGCCTGGNONE 
J065001F05AGTTGGGCCTAATTGGGCCTGGNONE 
J065002H03AGTTGGGCCTAATTGGGCCTGGNONE 
J065026B12AGTTGGGCCTAATTGGGCCTGGNONE 
J065093E11AGTTGGGCCTAATTGGGCCTGGNONE 
J065122E04AGTTGGGCCTAATTGGGCCTGGNONE 
J065164O07AGTTGGGCCTAATTGGGCCTGGNONE 
J065182M16AGTTGGGCCTAATTGGGCCTGGNONE 
J065217N11AGTTGGGCCTAATTGGGCCTGGNONE 
J090002P22AGTTGGGCCTAATTGGGCCTGGNONE 
Os06g0103200011-003-H09TGTTGGGCCACCAACNONE 
011-017-H05TGTTGGGCCACCAACNONE 
011-027-G08TGTTGGGCCACCAACNONE 
011-059-F08TGTTGGGCCACCAACNONE 
AK103757TGTTGGGCCACCAACTransferase family protein. 
J033143E17TGTTGGGCCACCAACNONE 
Os06g0113600016-067-E03TTATGGGCCCAACTNONE 
AK062095TTATGGGCCCAACTNONE 
AK101235TTATGGGCCCAACTCyclin-like F-box domain containing protein. 
AK122025TTATGGGCCCAACTNONE 
J013022O19TTATGGGCCCAACTNONE 
J023045P05TTATGGGCCCAACTNONE 
J033031K01TTATGGGCCCAACTNONE 
J033034I09TTATGGGCCCAACTNONE 
J033041O04TTATGGGCCCAACTNONE 
J033071K03TTATGGGCCCAACTNONE 
J033075K16TTATGGGCCCAACTNONE 
J033097M01TTATGGGCCCAACTNONE 
J033099M22TTATGGGCCCAACTNONE 
J033108N15TTATGGGCCCAACTNONE 
J033121D18TTATGGGCCCAACTNONE 
J033125O06TTATGGGCCCAACTNONE 
J033139M16TTATGGGCCCAACTNONE 
J033145P18TTATGGGCCCAACTNONE 
J033149D05TTATGGGCCCAACTNONE 
Os06g0114600015-077-E06AGTTGGGCCCACACNONE 
AK067972AGTTGGGCCCACACConserved hypothetical protein. 
Os06g0114700AK061552AGGGCCCAACAProtein of unknown function DUF1218 family protein. 
AK098848AGGGCCCAACANONE 
AK122142AGGGCCCAACANONE 
J013000D16AGGGCCCAACANONE 
Os06g0124900009-128-B12GGTTGGGCCAGNONE 
009-186-H09GGTTGGGCCAGNONE 
AK062901GGTTGGGCCAGConserved hypothetical protein. 
J013056D13GGTTGGGCCAGNONE 
J013056D17GGTTGGGCCAGNONE 
J013066A13GGTTGGGCCAGNONE 
J013066C03GGTTGGGCCAGNONE 
J013066F01GGTTGGGCCAGNONE 
J023078D03GGTTGGGCCAGNONE 
J033113N02GGTTGGGCCAGNONE 
J065019F09GGTTGGGCCAGNONE 
J065048C21GGTTGGGCCAGNONE 
J065077L13GGTTGGGCCAGNONE 
J065082J09GGTTGGGCCAGNONE 
J065113H16GGTTGGGCCAGNONE 
J065147A20GGTTGGGCCAGNONE 
J065180A13GGTTGGGCCAGNONE 
J065198M18GGTTGGGCCAGNONE 
J065207K19GGTTGGGCCAGNONE 
J075109H13GGTTGGGCCAGNONE 
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0140100011-063-A02AAGGCCCAACANONE 
011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371AAGGCCCAACALeucine carboxyl methyltransferase family protein. 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0143000AB014056GGGGCCCAACTNONE 
AK062073GGGGCCCAACTNONE 
AK071301GGGGCCCAACTIron-superoxide dismutase (EC 1.15.1.1). 
J013043A16GGGGCCCAACTNONE 
J023001M11GGGGCCCAACTNONE 
J023087L08GGGGCCCAACTNONE 
J023145K23GGGGCCCAACTNONE 
J033123L01GGGGCCCAACTNONE 
J065127O08GGGGCCCAACTNONE 
Os06g0144000AK068998TGTTGGGCCGCBRCT domain containing protein. 
J023001F16TGTTGGGCCGCNONE 
Os06g0147200013-026-F09CTGGCCCAACNONE 
AK064042CTGGCCCAACConserved hypothetical protein. 
AK070059CTGGCCCAACNONE 
J023042A02CTGGCCCAACNONE 
J100047A15CTGGCCCAACNONE 
J100070B03CTGGCCCAACNONE 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
Os06g0210200012-084-E04GCTGGGCTGGTTGGGCCTCNONE 
AK060502GCTGGGCTGGTTGGGCCTCNONE 
AK069709GCTGGGCTGGTTGGGCCTCN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23GCTGGGCTGGTTGGGCCTCNONE 
J023056O05GCTGGGCTGGTTGGGCCTCNONE 
J033075N06GCTGGGCTGGTTGGGCCTCNONE 
J065099C14GCTGGGCTGGTTGGGCCTCNONE 
J065158C17GCTGGGCTGGTTGGGCCTCNONE 
J065214B02GCTGGGCTGGTTGGGCCTCNONE 
J075026E10GCTGGGCTGGTTGGGCCTCNONE 
J075066J06GCTGGGCTGGTTGGGCCTCNONE 
J075121I06GCTGGGCTGGTTGGGCCTCNONE 
J075124L08GCTGGGCTGGTTGGGCCTCNONE 
J100055D09GCTGGGCTGGTTGGGCCTCNONE 
J100055E04GCTGGGCTGGTTGGGCCTCNONE 
J100077L12GCTGGGCTGGTTGGGCCTCNONE 
Os06g0214300AK108107TACGGCCCAACTEsterase/lipase/thioesterase domain containing protein. 
Os06g0226600006-083-D04AAGGCCCAACTNONE 
006-083-D04GTTGGGCCTTNONE 
AK061806AAGGCCCAACTNONE 
AK061806GTTGGGCCTTNONE 
AK102752AAGGCCCAACTTB2/DP1 and HVA22 related protein family protein. 
AK102752GTTGGGCCTTTB2/DP1 and HVA22 related protein family protein. 
J013089J11AAGGCCCAACTNONE 
J013089J11GTTGGGCCTTNONE 
J033106M05AAGGCCCAACTNONE 
J033106M05GTTGGGCCTTNONE 
J100044M21AAGGCCCAACTNONE 
J100044M21GTTGGGCCTTNONE 
J100056E06AAGGCCCAACTNONE 
J100056E06GTTGGGCCTTNONE 
J100059F06AAGGCCCAACTNONE 
J100059F06GTTGGGCCTTNONE 
Os06g0247800AK102187GGCCCGGCCCAACCSimilar to Dynamin-like protein (Fragment). 
AY224491GGCCCGGCCCAACCNONE 
Os06g0257200J053059P05TGGGGCCCAACNONE 
J075006K03TGGGGCCCAACNONE 
J075067F07TGGGGCCCAACNONE 
J075068F14TGGGGCCCAACNONE 
J075068H14TGGGGCCCAACNONE 
J075098N06TGGGGCCCAACNONE 
J075099F08TGGGGCCCAACNONE 
J075154G24TGGGGCCCAACNONE 
J075195H09TGGGGCCCAACNONE 
Os06g0298400AK066952TAGGCCCAACWW/Rsp5/WWP domain containing protein. 
J013090J20TAGGCCCAACNONE 
J033024J05TAGGCCCAACNONE 
J033033H19TAGGCCCAACNONE 
J033057J15TAGGCCCAACNONE 
J065047L24TAGGCCCAACNONE 
J065198L23TAGGCCCAACNONE 
J065218N03TAGGCCCAACNONE 
J090001F10TAGGCCCAACNONE 
J090025N24TAGGCCCAACNONE 
J090073E16TAGGCCCAACNONE 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCAACGCCCAGCCCNONE 
J023028N24GGCCCGGCCCAACGCCCAGCCCNONE 
J033098H21GGCCCGGCCCAACGCCCAGCCCNONE 
J033118G04GGCCCGGCCCAACGCCCAGCCCNONE 
J090056P15GGCCCGGCCCAACGCCCAGCCCNONE 
J090062B02GGCCCGGCCCAACGCCCAGCCCNONE 
J100024B09GGCCCGGCCCAACGCCCAGCCCNONE 
J100060I04GGCCCGGCCCAACGCCCAGCCCNONE 
J100078H11GGCCCGGCCCAACGCCCAGCCCNONE 
J100080A14GGCCCGGCCCAACGCCCAGCCCNONE 
J100086F18GGCCCGGCCCAACGCCCAGCCCNONE 
Os06g0482200AK119703TGTTGGGCCGCAThioredoxin fold domain containing protein. 
J065014B11TGTTGGGCCGCANONE 
J065055E22TGTTGGGCCGCANONE 
J065092L13TGTTGGGCCGCANONE 
J065113E21TGTTGGGCCGCANONE 
J065191D11TGTTGGGCCGCANONE 
J065214F18TGTTGGGCCGCANONE 
J075104E18TGTTGGGCCGCANONE 
J075149O19TGTTGGGCCGCANONE 
J075170I11TGTTGGGCCGCANONE 
Os06g0530200009-042-B02TGTTGGGCCGGGCCNONE 
009-050-E10TGTTGGGCCGGGCCNONE 
009-060-F07TGTTGGGCCGGGCCNONE 
009-117-H08TGTTGGGCCGGGCCNONE 
009-129-C10TGTTGGGCCGGGCCNONE 
AK073116TGTTGGGCCGGGCCConserved hypothetical protein. 
AK104077TGTTGGGCCGGGCCNONE 
J065032N16TGTTGGGCCGGGCCNONE 
J065153K07TGTTGGGCCGGGCCNONE 
J065169N18TGTTGGGCCGGGCCNONE 
J065190H18TGTTGGGCCGGGCCNONE 
J075127E14TGTTGGGCCGGGCCNONE 
J090008F20TGTTGGGCCGGGCCNONE 
Os06g0567000009-166-G12CAAGGCCCAACANONE 
009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CAAGGCCCAACAProtein of unknown function UPF0197 family protein. 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CAAGGCCCAACANONE 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CAAGGCCCAACANONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CAAGGCCCAACANONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CAAGGCCCAACANONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CAAGGCCCAACANONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CAAGGCCCAACANONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CAAGGCCCAACANONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CAAGGCCCAACANONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CAAGGCCCAACANONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CAAGGCCCAACANONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CAAGGCCCAACANONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CAAGGCCCAACANONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CAAGGCCCAACANONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CAAGGCCCAACANONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CAAGGCCCAACANONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CAAGGCCCAACANONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CAAGGCCCAACANONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CAAGGCCCAACANONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CAAGGCCCAACANONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CAAGGCCCAACANONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CAAGGCCCAACANONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CAAGGCCCAACANONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CAAGGCCCAACANONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CAAGGCCCAACANONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CAAGGCCCAACANONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CAAGGCCCAACANONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CAAGGCCCAACANONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CAAGGCCCAACANONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CAAGGCCCAACANONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CAAGGCCCAACANONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CAAGGCCCAACANONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CAAGGCCCAACANONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CAAGGCCCAACANONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CAAGGCCCAACANONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CAAGGCCCAACANONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CAAGGCCCAACANONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CAAGGCCCAACANONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CAAGGCCCAACANONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CAAGGCCCAACANONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CAAGGCCCAACANONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CAAGGCCCAACANONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CAAGGCCCAACANONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CAAGGCCCAACANONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CAAGGCCCAACANONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CAAGGCCCAACANONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CAAGGCCCAACANONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CAAGGCCCAACANONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CAAGGCCCAACANONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CAAGGCCCAACANONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CAAGGCCCAACANONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CAAGGCCCAACANONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CAAGGCCCAACANONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CAAGGCCCAACANONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CAAGGCCCAACANONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CAAGGCCCAACANONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CAAGGCCCAACANONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CAAGGCCCAACANONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CAAGGCCCAACANONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CAAGGCCCAACANONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CAAGGCCCAACANONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CAAGGCCCAACANONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CAAGGCCCAACANONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0587300AK069419TGTTGGGCCCACAConserved hypothetical protein. 
AK121885TGTTGGGCCCACANONE 
Os06g0590301J033139K16TTCGGCCCAACNONE 
J065011M13TTCGGCCCAACNONE 
J065027D20TTCGGCCCAACNONE 
J065039O05TTCGGCCCAACGlucose/ribitol dehydrogenase family protein. 
J065051O10TTCGGCCCAACNONE 
J065128I21TTCGGCCCAACNONE 
J065163P10TTCGGCCCAACNONE 
J065169H02TTCGGCCCAACNONE 
Os06g0602600AK121619AATGGGCCCAACAlba, DNA/RNA-binding protein family protein. 
AK121619AGTTGGGCCAGAAlba, DNA/RNA-binding protein family protein. 
J033044O03AATGGGCCCAACNONE 
J033044O03AGTTGGGCCAGANONE 
J043036G04AATGGGCCCAACNONE 
J043036G04AGTTGGGCCAGANONE 
J075107E08AATGGGCCCAACNONE 
J075107E08AGTTGGGCCAGANONE 
J090060N14AATGGGCCCAACNONE 
J090060N14AGTTGGGCCAGANONE 
J090094K04AATGGGCCCAACNONE 
J090094K04AGTTGGGCCAGANONE 
Os06g0647900AK073750GCGGCCCAACAConserved hypothetical protein. 
AK073750GCGGCCCAACAConserved hypothetical protein. 
J033029K17GCGGCCCAACANONE 
J033029K17GCGGCCCAACANONE 
J033070L21GCGGCCCAACANONE 
J033070L21GCGGCCCAACANONE 
Os06g0649500AK072591AGTTGGGCCTGAWD40-like domain containing protein. 
Os06g0667400AK065424GAGGCCCAACAConserved hypothetical protein. 
AK065580GAGGCCCAACANONE 
Os06g0677600009-200-F02GGTTGGGCCGGANONE 
AK063252GGTTGGGCCGGALike-Sm ribonucleoprotein, core family protein. 
J075028G10GGTTGGGCCGGANONE 
J075189D08GGTTGGGCCGGANONE 
J090045C02GGTTGGGCCGGANONE 
Os06g0682800011-092-E01GGTTGGGCCGCNONE 
AK064816GGTTGGGCCGCZinc finger, CCCH-type domain containing protein. 
J013000E13GGTTGGGCCGCNONE 
J013035J22GGTTGGGCCGCNONE 
J013045M06GGTTGGGCCGCNONE 
J013120A07GGTTGGGCCGCNONE 
J033144H15GGTTGGGCCGCNONE 
J033145H15GGTTGGGCCGCNONE 
J033145N16GGTTGGGCCGCNONE 
J090019J02GGTTGGGCCGCNONE 
Os06g0688100AK063450TTGGCCCAACTNONE 
AK101144TTGGCCCAACTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0690600AK107925GACGGCCCAACTConserved hypothetical protein. 
Os06g0709100006-057-D06GTTGGGCCTANONE 
011-040-A08GTTGGGCCTANONE 
016-044-A01GTTGGGCCTANONE 
AK059732GTTGGGCCTANONE 
AK070881GTTGGGCCTACyclin-like F-box domain containing protein. 
AK103683GTTGGGCCTANONE 
J065026P10GTTGGGCCTANONE 
J090017L13GTTGGGCCTANONE 
Os06g0714100AK121079TTGGCCCAACTComplex 1 LYR protein family protein. 
J023062M13TTGGCCCAACTNONE 
J043020D18TTGGCCCAACTNONE 
J065073A17TTGGCCCAACTNONE 
J065158D09TTGGCCCAACTNONE 
J065195H04TTGGCCCAACTNONE 
J065214P13TTGGCCCAACTNONE 
J080079I22TTGGCCCAACTNONE 
J100031M06TTGGCCCAACTNONE 
J100036I12TTGGCCCAACTNONE 
Os07g0124100014-015-G11GTTGGGCCCACGTGTNONE 
AJ276693GTTGGGCCCACGTGTPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GTTGGGCCCACGTGTNONE 
Os07g0124500012-092-F01GAGGCCCAACTNONE 
012-092-F01TTGGCCCAACANONE 
AK070529GAGGCCCAACTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK070529TTGGCCCAACASimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000GAGGCCCAACTNONE 
AK101000TTGGCCCAACANONE 
J090007O11GAGGCCCAACTNONE 
J090007O11TTGGCCCAACANONE 
J090010E02GAGGCCCAACTNONE 
J090010E02TTGGCCCAACANONE 
J090078C04GAGGCCCAACTNONE 
J090078C04TTGGCCCAACANONE 
Os07g0146600J075074M15CACGGCCCAACAConserved hypothetical protein. 
J075120F11CACGGCCCAACANONE 
J075170L13CACGGCCCAACANONE 
J080302A21CACGGCCCAACANONE 
J080304J04CACGGCCCAACANONE 
J080308I12CACGGCCCAACANONE 
J080312F11CACGGCCCAACANONE 
J080315M22CACGGCCCAACANONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0479200005-017-H08TTCGGCCCAACACGTCACNONE 
AK058326TTCGGCCCAACACGTCACSimilar to SL15-like (Fragment). 
J013092A08TTCGGCCCAACACGTCACNONE 
J033139E04TTCGGCCCAACACGTCACNONE 
J043016M16TTCGGCCCAACACGTCACNONE 
J053050O18TTCGGCCCAACACGTCACNONE 
J053098B03TTCGGCCCAACACGTCACNONE 
J065068G10TTCGGCCCAACACGTCACNONE 
J065091I17TTCGGCCCAACACGTCACNONE 
J065109A03TTCGGCCCAACACGTCACNONE 
J065168B17TTCGGCCCAACACGTCACNONE 
J065177A05TTCGGCCCAACACGTCACNONE 
J065180J01TTCGGCCCAACACGTCACNONE 
J075006F13TTCGGCCCAACACGTCACNONE 
J075022J03TTCGGCCCAACACGTCACNONE 
J075024N09TTCGGCCCAACACGTCACNONE 
J075114B12TTCGGCCCAACACGTCACNONE 
J080023M06TTCGGCCCAACACGTCACNONE 
J080081N24TTCGGCCCAACACGTCACNONE 
J090060N07TTCGGCCCAACACGTCACNONE 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
Os07g0516200AK061373CAAGGCCCAACASimilar to Endoribonuclease, L-PSP family. 
Os07g0564000AK069806AGTTGGGCCGAGAConserved hypothetical protein. 
AK069806AGTTGGGCCTCConserved hypothetical protein. 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
AK065242TTCGGCCCAACTRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
J013002I12TTCGGCCCAACTNONE 
Os07g0572500AK108612ACCGGCCCAACCConserved hypothetical protein. 
Os07g0585800006-106-A05TTGGCCCAACANONE 
AK066419TTGGCCCAACANONE 
AK105064TTGGCCCAACASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TTGGCCCAACANONE 
J065085B08TTGGCCCAACANONE 
J065099I23TTGGCCCAACANONE 
J065169A01TTGGCCCAACANONE 
J065187N13TTGGCCCAACANONE 
J065191L18TTGGCCCAACANONE 
J065194D04TTGGCCCAACANONE 
J065211M09TTGGCCCAACANONE 
J065212I02TTGGCCCAACANONE 
J090003C10TTGGCCCAACANONE 
J090025O11TTGGCCCAACANONE 
J090092F10TTGGCCCAACANONE 
J100055A04TTGGCCCAACANONE 
J100064A01TTGGCCCAACANONE 
J100080L02TTGGCCCAACANONE 
Os07g0591400Os07g0591400GGTTGGGCCTACGTGGGCCCCCACNONE 
Os07g0595700003-103-G05AGTTGGGCCGCNONE 
AK108488AGTTGGGCCGCConserved hypothetical protein. 
J065136O05AGTTGGGCCGCNONE 
Os07g0595800011-069-G09GCGGCCCAACTNONE 
AK066349GCGGCCCAACTPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05GCGGCCCAACTNONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
AK065746CTCGGCCCAACAProtein of unknown function DUF751 family protein. 
AK065746TTCGGCCCAACAProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065037B15CTCGGCCCAACANONE 
J065037B15TTCGGCCCAACANONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065042E20CTCGGCCCAACANONE 
J065042E20TTCGGCCCAACANONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
J065161I08CTCGGCCCAACANONE 
J065161I08TTCGGCCCAACANONE 
Os07g0620200AK099859TGTTGGGCCTTHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04TGTTGGGCCTTNONE 
Os07g0625500AK064628TCTGGCCCAACASimilar to Fimbriata-associated protein (Fragment). 
Os07g0641600AK068478GTTTGGGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073802GTTTGGGCCCAACTNONE 
Os07g0644300AK066726TCGGCCCAACASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TCGGCCCAACANONE 
Os07g0673500005-016-H01TGCGGCCCAACCNONE 
AK072839TGCGGCCCAACCNONE 
AK106176TGCGGCCCAACCSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TGCGGCCCAACCNONE 
J013153M24TGCGGCCCAACCNONE 
J023129E21TGCGGCCCAACCNONE 
J023141I23TGCGGCCCAACCNONE 
J033069A22TGCGGCCCAACCNONE 
J075021G17TGCGGCCCAACCNONE 
J075022B06TGCGGCCCAACCNONE 
J075049O15TGCGGCCCAACCNONE 
J075060O14TGCGGCCCAACCNONE 
J075073G03TGCGGCCCAACCNONE 
J075095D13TGCGGCCCAACCNONE 
J075120M18TGCGGCCCAACCNONE 
J075130D09TGCGGCCCAACCNONE 
J075152C20TGCGGCCCAACCNONE 
J075158L19TGCGGCCCAACCNONE 
J075199P18TGCGGCCCAACCNONE 
J090011K21TGCGGCCCAACCNONE 
J090078O10TGCGGCCCAACCNONE 
Os07g0686100AK110915GGTTGGGCCCAGCCAGCCCAGSimilar to Abscisic acid responsive elements-binding factor. 
Os07g0687300AK073043TTTCGGCCCAACASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0101600AB074260TGTTGGGCCGGCGTGGGCTTGSingle-strand DNA endonuclease-1. 
AK102542TGTTGGGCCGGCGTGGGCTTGNONE 
Os08g0107900014-055-C03TGTTGGGCCGCANONE 
J065062G20TGTTGGGCCGCANONE 
Os08g0120000006-042-E02AAACGGCCCAACANONE 
006-051-F06AAACGGCCCAACANONE 
006-052-G03AAACGGCCCAACANONE 
006-095-B11AAACGGCCCAACANONE 
AB017427AAACGGCCCAACANONE 
AB017428AAACGGCCCAACANONE 
AK059789AAACGGCCCAACANONE 
AK059815AAACGGCCCAACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077AAACGGCCCAACANONE 
AK102607AAACGGCCCAACANONE 
AK104303AAACGGCCCAACANONE 
AK104304AAACGGCCCAACANONE 
AK104421AAACGGCCCAACANONE 
D10414AAACGGCCCAACANONE 
J013170D08AAACGGCCCAACANONE 
J023086D16AAACGGCCCAACANONE 
J033099B04AAACGGCCCAACANONE 
J065042P05AAACGGCCCAACANONE 
J065144E22AAACGGCCCAACANONE 
J065162J20AAACGGCCCAACANONE 
J065196N13AAACGGCCCAACANONE 
J090013B11AAACGGCCCAACANONE 
Os08g0127600AK058365CGCGTGGGGCCCAACCCCACCACHeat shock protein DnaJ, N-terminal domain containing protein. 
AK058365TGTTGGGCCTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CGCGTGGGGCCCAACCCCACCACNONE 
AK068373TGTTGGGCCTANONE 
J013149L10CGCGTGGGGCCCAACCCCACCACNONE 
J013149L10TGTTGGGCCTANONE 
J075027H17CGCGTGGGGCCCAACCCCACCACNONE 
J075027H17TGTTGGGCCTANONE 
J075060F10CGCGTGGGGCCCAACCCCACCACNONE 
J075060F10TGTTGGGCCTANONE 
Os08g0127700012-086-F03GTGGTGGGGTTGGGCCCCACGCGNONE 
012-086-F03TAGGCCCAACANONE 
AK059350GTGGTGGGGTTGGGCCCCACGCGNONE 
AK059350TAGGCCCAACANONE 
AK099242GTGGTGGGGTTGGGCCCCACGCGNONE 
AK099242TAGGCCCAACANONE 
AK121348GTGGTGGGGTTGGGCCCCACGCGConserved hypothetical protein. 
AK121348TAGGCCCAACAConserved hypothetical protein. 
J033027J18GTGGTGGGGTTGGGCCCCACGCGNONE 
J033027J18TAGGCCCAACANONE 
J065012F22GTGGTGGGGTTGGGCCCCACGCGNONE 
J065012F22TAGGCCCAACANONE 
J065046N17GTGGTGGGGTTGGGCCCCACGCGNONE 
J065046N17TAGGCCCAACANONE 
J065197B02GTGGTGGGGTTGGGCCCCACGCGNONE 
J065197B02TAGGCCCAACANONE 
J100018P04GTGGTGGGGTTGGGCCCCACGCGNONE 
J100018P04TAGGCCCAACANONE 
J100052C14GTGGTGGGGTTGGGCCCCACGCGNONE 
J100052C14TAGGCCCAACANONE 
J100083A12GTGGTGGGGTTGGGCCCCACGCGNONE 
J100083A12TAGGCCCAACANONE 
Os08g0129200014-040-E08AGTTGGGCCGCNONE 
AK070034AGTTGGGCCGCNONE 
AK101577AGTTGGGCCGCSimilar to Cold shock protein-1. 
J065137A09AGTTGGGCCGCNONE 
J100062K14AGTTGGGCCGCNONE 
Os08g0224200AK101331TGTTGGGCCGTGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01GAGGCCCAACANONE 
AK067127GAGGCCCAACAConserved hypothetical protein. 
J013096C05GAGGCCCAACANONE 
J100032D12GAGGCCCAACANONE 
Os08g0260600AK108529AGTTGGGCCGAGACD9/CD37/CD63 antigen family protein. 
Os08g0302000AK106760AAACGGCCCAACSimilar to Peroxidase 40 precursor (EC 1.11.1.7) (Atperox P40). 
Os08g0316900013-024-A06GTGGCCCAACCNONE 
J033112J20GTGGCCCAACCNONE 
J065025M22GTGGCCCAACCNONE 
J065026E15GTGGCCCAACCNONE 
Os08g0319900AK108030GTGGCCCAACPutative cyclase family protein. 
Os08g0411500J013050J08ATGGCCCAACANONE 
Os08g0414600AK101578GGTTGGGCCGTGSoluble quinoprotein glucose dehydrogenase domain containing protein. 
AK101579GGTTGGGCCGTGNONE 
Os08g0452200AK100150GTTGGGCCAAConserved hypothetical protein. 
Os08g0461300AK065651GACGGCCCAACCCyclin-like F-box domain containing protein. 
Os08g0486200012-094-G01CACGGCCCAACCNONE 
015-022-G01CACGGCCCAACCNONE 
AK064030CACGGCCCAACCSimilar to Splicing factor SC35. 
AK103676CACGGCCCAACCNONE 
J023034B03CACGGCCCAACCNONE 
J033126D21CACGGCCCAACCNONE 
J033136B19CACGGCCCAACCNONE 
J043004H03CACGGCCCAACCNONE 
J080009E16CACGGCCCAACCNONE 
J080020G22CACGGCCCAACCNONE 
J080029L21CACGGCCCAACCNONE 
J080033M18CACGGCCCAACCNONE 
J080043H20CACGGCCCAACCNONE 
J080046N23CACGGCCCAACCNONE 
J080055K10CACGGCCCAACCNONE 
J080059P19CACGGCCCAACCNONE 
J080060G22CACGGCCCAACCNONE 
J080064L15CACGGCCCAACCNONE 
J080065D19CACGGCCCAACCNONE 
J080065J06CACGGCCCAACCNONE 
J080074L14CACGGCCCAACCNONE 
J080076H14CACGGCCCAACCNONE 
J080079A08CACGGCCCAACCNONE 
J080092D09CACGGCCCAACCNONE 
J080093D19CACGGCCCAACCNONE 
J080093F01CACGGCCCAACCNONE 
J080095L16CACGGCCCAACCNONE 
J090073P10CACGGCCCAACCNONE 
Os08g0499200AK120828CCCGGCCCAACCSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os08g0527400AK119389CACGGCCCAACTPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0535600AK121683GTTGGGCCTAZinc finger, Tim10/DDP-type family protein. 
J065077E05GTTGGGCCTANONE 
J075088M24GTTGGGCCTANONE 
J075140B03GTTGGGCCTANONE 
J090014B14GTTGGGCCTANONE 
Os08g0557400006-024-C02TAGGCCCAACCNONE 
AK060067TAGGCCCAACCProtein tyrosine phosphatase-like protein. 
AY224424TAGGCCCAACCNONE 
Os08g0558400AK071334GGTTGGGCCGCAGCCCACAASimilar to Kinesin heavy chain (Fragment). 
Os09g0112400AK109186TGTTGGGCCGGCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0115900009-055-E06AGTTGGGCCGGGCCNONE 
AK068597AGTTGGGCCGGGCCConserved hypothetical protein. 
J065136F11AGTTGGGCCGGGCCNONE 
J080023D14AGTTGGGCCGGGCCNONE 
Os09g0122000J075038D18TGTTGGGCCAANONE 
J075080K22TGTTGGGCCAANONE 
J075153J04TGTTGGGCCAANONE 
J075161K18TGTTGGGCCAANONE 
J075163H20TGTTGGGCCAANONE 
J075174C07TGTTGGGCCAAConserved hypothetical protein. 
Os09g0274100009-112-B02AGTTGGGCCCGCANONE 
AK062823AGTTGGGCCCGCAConserved hypothetical protein. 
Os09g0325300011-005-H08CTGGCCCAACGCGGAGAGNONE 
AK068435CTGGCCCAACGCGGAGAGConserved hypothetical protein. 
AK073998CTGGCCCAACGCGGAGAGNONE 
J033071H21CTGGCCCAACGCGGAGAGNONE 
J065214H05CTGGCCCAACGCGGAGAGNONE 
Os09g0338400AK059171CCACGGCCCAACANONE 
AK068798CCACGGCCCAACANONE 
AK072043CCACGGCCCAACANONE 
AK098947CCACGGCCCAACASimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0363700AK103667TGTTGGGCCGGCCCAAGConserved hypothetical protein. 
J075001L14TGTTGGGCCGGCCCAAGNONE 
J075049M23TGTTGGGCCGGCCCAAGNONE 
J075051I04TGTTGGGCCGGCCCAAGNONE 
J075073L04TGTTGGGCCGGCCCAAGNONE 
J075077E03TGTTGGGCCGGCCCAAGNONE 
J075083J11TGTTGGGCCGGCCCAAGNONE 
J075094J22TGTTGGGCCGGCCCAAGNONE 
J075112E08TGTTGGGCCGGCCCAAGNONE 
J075137J23TGTTGGGCCGGCCCAAGNONE 
J075192E02TGTTGGGCCGGCCCAAGNONE 
J100039K04TGTTGGGCCGGCCCAAGNONE 
Os09g0397100J075141L14CAAGGCCCAACANONE 
J100063H17CAAGGCCCAACAConserved hypothetical protein. 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0458100AK109625GTTGGGCCGAGATXyloglucan fucosyltransferase family protein. 
Os09g0467400AK066610AGTTGGGCCCTProtein of unknown function DUF6, transmembrane domain containing protein. 
Os09g0471900AK073815CAAGGCCCAACABacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
AK073815GCCCGGCCCAACTBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0510000AK121614GCAGCCCACTTGTTGGGCCTCConserved hypothetical protein. 
AK121614TCCGGCCCAACCConserved hypothetical protein. 
J033043O11GCAGCCCACTTGTTGGGCCTCNONE 
J033043O11TCCGGCCCAACCNONE 
J065113F04GCAGCCCACTTGTTGGGCCTCNONE 
J065113F04TCCGGCCCAACCNONE 
J080044D13GCAGCCCACTTGTTGGGCCTCNONE 
J080044D13TCCGGCCCAACCNONE 
Os09g0517800012-034-H10TCCGGCCCAACTNONE 
AK121391TCCGGCCCAACTCyclin-like F-box domain containing protein. 
J023129D04TCCGGCCCAACTNONE 
J043012D11TCCGGCCCAACTNONE 
Os09g0522800015-033-B12GAGGCCCAACCNONE 
015-083-G12GAGGCCCAACCNONE 
AK070906GAGGCCCAACCProtein of unknown function DUF1618 domain containing protein. 
J023065L17GAGGCCCAACCNONE 
J090090P20GAGGCCCAACCNONE 
Os09g0525500AK107918GCCGGCCCAACCYY1 protein precursor. 
D50575GCCGGCCCAACCNONE 
Os09g0527700AK111128ACCGGCCCAACCSimilar to Auxin-induced protein IAA4. 
J065124H12ACCGGCCCAACCNONE 
J065181I07ACCGGCCCAACCNONE 
J065207G14ACCGGCCCAACCNONE 
Os09g0532800J065167K16TGTTGGGCCAAProtein prenyltransferase domain containing protein. 
Os09g0535300AK071211GTGGCCCAACTXAP5 protein family protein. 
Os09g0537600006-054-B05AGTGGGCCCAACANONE 
AK061004AGTGGGCCCAACASimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20AGTGGGCCCAACANONE 
J075029H16AGTGGGCCCAACANONE 
Os09g0547200016-021-H03AGTTGGGCCGAGCCGNONE 
AK073078AGTTGGGCCGAGCCGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984AGTTGGGCCGAGCCGNONE 
J065005L05AGTTGGGCCGAGCCGNONE 
J065039C06AGTTGGGCCGAGCCGNONE 
J065116H17AGTTGGGCCGAGCCGNONE 
J100046A17AGTTGGGCCGAGCCGNONE 
Os09g0554000J065123C23ATGGCCCAACTSimilar to Mitochondrial phosphate transporter. 
Os09g0559800AK071542GTTGGGCCTGGACGGCCCATGGSimilar to Transporter-like protein. 
J013063N24GTTGGGCCTGGACGGCCCATGGNONE 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
Os11g0153700AK058576TAGGCCCATATGTGGGCCCAACASimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0156401J100027N11ATGGCCCAACCProtein of unknown function DUF623, plant domain containing protein. 
J100042A10ATGGCCCAACCNONE 
J100063F10ATGGCCCAACCNONE 
Os11g0167300AK071335GGGGCCCAACAProtein of unknown function DUF537 family protein. 
AK101314GGGGCCCAACANONE 
Os11g0171700AK099115GGCCCGGCCCAACGGAACGSMAD/FHA domain containing protein. 
Os11g0182400016-077-B04AGTTGGGCCGAGNONE 
AK112089AGTTGGGCCGAGCyclin-like F-box domain containing protein. 
Os11g0244200AK107883ATTGGGCCCAACTSimilar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment). 
AK107883TGTTGGGCCTASimilar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment). 
Os11g0482000006-056-D12CCCGGCCCGGCCCAACANONE 
006-102-C10CCCGGCCCGGCCCAACANONE 
009-005-E07CCCGGCCCGGCCCAACANONE 
014-088-D03CCCGGCCCGGCCCAACANONE 
AK059558CCCGGCCCGGCCCAACASimilar to 40S ribosomal protein S5-1. 
AK103918CCCGGCCCGGCCCAACANONE 
Os11g0490600AK067664GGTTGGGCCCCConserved hypothetical protein. 
Os11g0544000AK066017GCCGGCCCAACTCGGCCCAAGConserved hypothetical protein. 
AK071393GCCGGCCCAACTCGGCCCAAGNONE 
J013050C10GCCGGCCCAACTCGGCCCAAGNONE 
J013118O12GCCGGCCCAACTCGGCCCAAGNONE 
Os11g0545000011-025-F09CCCGGCCCAACTCAGCCCAATANONE 
AK058871CCCGGCCCAACTCAGCCCAATAConserved hypothetical protein. 
AK063297CCCGGCCCAACTCAGCCCAATANONE 
AK100607CCCGGCCCAACTCAGCCCAATANONE 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0557900009-196-H11AGTTGGGCCGGGCNONE 
AK063232AGTTGGGCCGGGCARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE 
J075044E18CTGGCCCAACGGCCCACGANONE 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
Os11g0617800009-105-D10CACGGCCCATTCTGGCCCAACANONE 
AK062778CACGGCCCATTCTGGCCCAACAConserved hypothetical protein. 
Os11g0629200AK065196CCCGGCCCAACCSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0630900AK107482GCCGGCCCAACAMATH domain containing protein. 
Os11g0642100AK107010TTGGCCCAACCyclin-like F-box domain containing protein. 
Os12g0168700AK065708CCAGGCCCAACAAMP-dependent synthetase and ligase domain containing protein. 
AK065718CCAGGCCCAACANONE 
Os12g0294100AK111535CGGGCCCAACTWD40-like domain containing protein. 
J013030D09CGGGCCCAACTNONE 
J013153J16CGGGCCCAACTNONE 
J033079N17CGGGCCCAACTNONE 
J090002M14CGGGCCCAACTNONE 
J090071M08CGGGCCCAACTNONE 
J090090E07CGGGCCCAACTNONE 
Os12g0481100AK073151GCCGGCCCAACTSimilar to RNA helicase. 
Os12g0498800AK067767CACGGCCCAACCConserved hypothetical protein. 
J065073G03CACGGCCCAACCNONE 
J065102I05CACGGCCCAACCNONE 
Os12g0508300009-006-G07GAGGCCCAACTNONE 
009-133-E05GAGGCCCAACTNONE 
009-137-F10GAGGCCCAACTNONE 
014-024-A06GAGGCCCAACTNONE 
AK059123GAGGCCCAACTRibosomal protein S14 family protein. 
J100088E22GAGGCCCAACTNONE 
Os12g0509300AK108497GCCCGGCCCAACConserved hypothetical protein. 
Os12g0577900015-034-E07TCAGGCCCAACCNONE 
AK106299TCAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os12g0599900AK101252CCATGGGCCCAACTTetratricopeptide region domain containing protein. 
J033032F05CCATGGGCCCAACTNONE 
Os12g0605400009-005-G05CTCGGCCCAACCCAGCCCACCTNONE 
016-024-B01CTCGGCCCAACCCAGCCCACCTNONE 
016-043-A11CTCGGCCCAACCCAGCCCACCTNONE 
AK068060CTCGGCCCAACCCAGCCCACCTSimilar to CROC-1-like protein (Fragment). 
J013130B07CTCGGCCCAACCCAGCCCACCTNONE 
J023141C14CTCGGCCCAACCCAGCCCACCTNONE 
J033037O04CTCGGCCCAACCCAGCCCACCTNONE 
J033081L17CTCGGCCCAACCCAGCCCACCTNONE 
J033108C03CTCGGCCCAACCCAGCCCACCTNONE 
J065079G22CTCGGCCCAACCCAGCCCACCTNONE 
J065082D03CTCGGCCCAACCCAGCCCACCTNONE 
J065207O15CTCGGCCCAACCCAGCCCACCTNONE 
J075027C23CTCGGCCCAACCCAGCCCACCTNONE 
J075037A17CTCGGCCCAACCCAGCCCACCTNONE 
J075056D17CTCGGCCCAACCCAGCCCACCTNONE 
J075064O21CTCGGCCCAACCCAGCCCACCTNONE 
J075096E08CTCGGCCCAACCCAGCCCACCTNONE 
J090036I15CTCGGCCCAACCCAGCCCACCTNONE 
J100018P15CTCGGCCCAACCCAGCCCACCTNONE 
J100074O06CTCGGCCCAACCCAGCCCACCTNONE 
Os12g0611000AK111837TTCGGCCCAACCSimilar to Zinc-finger protein Lsd1. 
Os12g0624800AK103828AGTTGGGCCATHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.