version

Summary of OsREG627 (All List)

OrganismOryza sativa  
IDOsREG627  
SequenceGGCCCACA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3285  

Entry Sequences (3285 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087TAGGCCCACAGAAGCCCATAANONE 
AK103808TAGGCCCACAGAAGCCCATAAC-type lectin domain containing protein. 
Os01g0104100AK072797TTATGGGCTTCTGTGGGCCTAZinc finger, RING-type domain containing protein. 
AK104280TTATGGGCTTCTGTGGGCCTANONE 
Os01g0134800011-091-C12ATGGCCCACANONE 
AK063402ATGGCCCACASimilar to (1,4)-beta-xylan endohydrolase, isoenzyme X-II (EC 3.2.1.8) (Fragment). 
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0144600006-037-H02ACCGGGCCCACANONE 
006-037-H02TGTGGGCCCGCACGCCACNONE 
AK061501ACCGGGCCCACAConserved hypothetical protein. 
AK061501TGTGGGCCCGCACGCCACConserved hypothetical protein. 
AK102823ACCGGGCCCACANONE 
AK102823TGTGGGCCCGCACGCCACNONE 
J033108P10ACCGGGCCCACANONE 
J033108P10TGTGGGCCCGCACGCCACNONE 
J043026K08ACCGGGCCCACANONE 
J043026K08TGTGGGCCCGCACGCCACNONE 
J090009H21ACCGGGCCCACANONE 
J090009H21TGTGGGCCCGCACGCCACNONE 
Os01g0147700AK066686TGTGGGCCCTRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0157600AK106766GGGGCCCACAAnkyrin repeat containing protein. 
Os01g0174300012-006-G02CCGTGGGCCCACACNONE 
AK071324CCGTGGGCCCACACNADH:cytochrome b5 reductase (CBR) family protein. 
AK104306CCGTGGGCCCACACNONE 
J023089J04CCGTGGGCCCACACNONE 
J023107J15CCGTGGGCCCACACNONE 
J033084J16CCGTGGGCCCACACNONE 
J065097O20CCGTGGGCCCACACNONE 
J065099J15CCGTGGGCCCACACNONE 
J090006K02CCGTGGGCCCACACNONE 
J090023L17CCGTGGGCCCACACNONE 
J090088G14CCGTGGGCCCACACNONE 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0185200009-146-B06GCGGGCCCACACNONE 
009-163-F01GCGGGCCCACACNONE 
AK062984GCGGGCCCACACNONE 
AK065125GCGGGCCCACACGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222GCGGGCCCACACNONE 
AK111284GCGGGCCCACACNONE 
Os01g0191100009-011-A02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-011-A02TAGGCCCACACGNONE 
009-028-D05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-028-D05TAGGCCCACACGNONE 
009-058-B11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-058-B11TAGGCCCACACGNONE 
009-151-D09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-151-D09TAGGCCCACACGNONE 
013-026-G03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-026-G03TAGGCCCACACGNONE 
013-063-F04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-063-F04TAGGCCCACACGNONE 
013-069-B05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-069-B05TAGGCCCACACGNONE 
014-029-E04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-029-E04TAGGCCCACACGNONE 
014-072-H04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-072-H04TAGGCCCACACGNONE 
014-089-E09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-089-E09TAGGCCCACACGNONE 
015-047-G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
015-047-G05TAGGCCCACACGNONE 
016-033-G06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
016-033-G06TAGGCCCACACGNONE 
AK058815CCACCTGTGGGCCTTCTGGGCTTTTSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
AK058815TAGGCCCACACGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023069C08TAGGCCCACACGNONE 
J023077K21CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023077K21TAGGCCCACACGNONE 
J023081F19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023081F19TAGGCCCACACGNONE 
J033052N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033052N11TAGGCCCACACGNONE 
J033058N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033058N11TAGGCCCACACGNONE 
J033114G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114G05TAGGCCCACACGNONE 
J033114O17CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114O17TAGGCCCACACGNONE 
J033129L14CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033129L14TAGGCCCACACGNONE 
J053029I12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J053029I12TAGGCCCACACGNONE 
J065067N19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065067N19TAGGCCCACACGNONE 
J065084I19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065084I19TAGGCCCACACGNONE 
J065099O03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065099O03TAGGCCCACACGNONE 
J065201I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065201I08TAGGCCCACACGNONE 
J075035B08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075035B08TAGGCCCACACGNONE 
J075037B22CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075037B22TAGGCCCACACGNONE 
J075054L16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075054L16TAGGCCCACACGNONE 
J075059D15CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075059D15TAGGCCCACACGNONE 
J075164I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075164I08TAGGCCCACACGNONE 
J075185J01CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075185J01TAGGCCCACACGNONE 
J090042O06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090042O06TAGGCCCACACGNONE 
J090044F12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090044F12TAGGCCCACACGNONE 
J090063L02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090063L02TAGGCCCACACGNONE 
J090073I10CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090073I10TAGGCCCACACGNONE 
J090078E18CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090078E18TAGGCCCACACGNONE 
J100072K16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J100072K16TAGGCCCACACGNONE 
Os01g0198100AK119908TGTGGGCCCCConserved hypothetical protein. 
Os01g0221500012-036-F06AGGGCCCACANONE 
AK063996AGGGCCCACAConserved hypothetical protein. 
J065061G22AGGGCCCACANONE 
J065098K21AGGGCCCACANONE 
J065214G03AGGGCCCACANONE 
J065218L03AGGGCCCACANONE 
J080301D09AGGGCCCACANONE 
Os01g0239700AK067723ACCGGGCCCACAASimilar to Leucine-rich receptor-like protein kinase. 
AK122130ACCGGGCCCACAANONE 
Os01g0250900AK065179TGTGGGCCCCACGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
J013002D15TGTGGGCCCCACGNONE 
J013037K03TGTGGGCCCCACGNONE 
J013091F03TGTGGGCCCCACGNONE 
J013127B14TGTGGGCCCCACGNONE 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0269100011-080-F08GTGTGGGCCGTANONE 
AK067610GTGTGGGCCGTASimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18GTGTGGGCCGTANONE 
J013112F12GTGTGGGCCGTANONE 
J023002M17GTGTGGGCCGTANONE 
J023022J24GTGTGGGCCGTANONE 
J033050A10GTGTGGGCCGTANONE 
J033091A17GTGTGGGCCGTANONE 
J033123E17GTGTGGGCCGTANONE 
J033143H04GTGTGGGCCGTANONE 
J043005H18GTGTGGGCCGTANONE 
J075038A05GTGTGGGCCGTANONE 
J075091K23GTGTGGGCCGTANONE 
J075118O05GTGTGGGCCGTANONE 
J075195P17GTGTGGGCCGTANONE 
J090027J21GTGTGGGCCGTANONE 
J100024I09GTGTGGGCCGTANONE 
J100032D15GTGTGGGCCGTANONE 
J100071I02GTGTGGGCCGTANONE 
J100080E01GTGTGGGCCGTANONE 
J100086A08GTGTGGGCCGTANONE 
Os01g0270100006-096-H09TGTGGGCCGCANONE 
009-009-C10TGTGGGCCGCANONE 
009-054-E06TGTGGGCCGCANONE 
014-085-F09TGTGGGCCGCANONE 
AK073275TGTGGGCCGCANONE 
AK104155TGTGGGCCGCANONE 
AK119511TGTGGGCCGCASimilar to Cysteine protease inhibitor. 
J033025K21TGTGGGCCGCANONE 
J075065H10TGTGGGCCGCANONE 
J075143G10TGTGGGCCGCANONE 
J100059J02TGTGGGCCGCANONE 
Os01g0276700011-014-A12CCCGGCCCACACNONE 
012-092-G12CCCGGCCCACACNONE 
AK103164CCCGGCCCACACNONE 
AK103465CCCGGCCCACACSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CCCGGCCCACACNONE 
J023084I02CCCGGCCCACACNONE 
J033027F20CCCGGCCCACACNONE 
J033029M06CCCGGCCCACACNONE 
J033039K13CCCGGCCCACACNONE 
J033057C24CCCGGCCCACACNONE 
J033058G20CCCGGCCCACACNONE 
J033060A14CCCGGCCCACACNONE 
J033061M21CCCGGCCCACACNONE 
J033068M10CCCGGCCCACACNONE 
J033074K16CCCGGCCCACACNONE 
J033076C11CCCGGCCCACACNONE 
J033093O13CCCGGCCCACACNONE 
J033119H20CCCGGCCCACACNONE 
J033121D22CCCGGCCCACACNONE 
J033129N11CCCGGCCCACACNONE 
J033131E12CCCGGCCCACACNONE 
J033150L07CCCGGCCCACACNONE 
J053024N17CCCGGCCCACACNONE 
J053034G19CCCGGCCCACACNONE 
J053035E18CCCGGCCCACACNONE 
J053046M01CCCGGCCCACACNONE 
J053047P04CCCGGCCCACACNONE 
J053048B06CCCGGCCCACACNONE 
J053050M22CCCGGCCCACACNONE 
J053053E09CCCGGCCCACACNONE 
J053053I07CCCGGCCCACACNONE 
J053059K03CCCGGCCCACACNONE 
J053059P12CCCGGCCCACACNONE 
J053060C12CCCGGCCCACACNONE 
J053060H24CCCGGCCCACACNONE 
J053064D19CCCGGCCCACACNONE 
J053066L15CCCGGCCCACACNONE 
J053073I02CCCGGCCCACACNONE 
J053083E15CCCGGCCCACACNONE 
J053094D05CCCGGCCCACACNONE 
J053094P18CCCGGCCCACACNONE 
J053095C15CCCGGCCCACACNONE 
J053095C21CCCGGCCCACACNONE 
J053099N16CCCGGCCCACACNONE 
J090025O19CCCGGCCCACACNONE 
J090049N22CCCGGCCCACACNONE 
J090050F17CCCGGCCCACACNONE 
Os01g0299400AK107814GAGGCCCACAASterile alpha motif homology domain containing protein. 
J065112H10GAGGCCCACAANONE 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0348700009-125-H02CAAGGCCCAATCGGCCCACAANONE 
009-156-F08CAAGGCCCAATCGGCCCACAANONE 
009-177-A11CAAGGCCCAATCGGCCCACAANONE 
009-195-D02CAAGGCCCAATCGGCCCACAANONE 
013-040-B06CAAGGCCCAATCGGCCCACAANONE 
013-051-B09CAAGGCCCAATCGGCCCACAANONE 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
J013071O22CAAGGCCCAATCGGCCCACAANONE 
J023022J07CAAGGCCCAATCGGCCCACAANONE 
J033028J08CAAGGCCCAATCGGCCCACAANONE 
J033109M11CAAGGCCCAATCGGCCCACAANONE 
J043022K15CAAGGCCCAATCGGCCCACAANONE 
J043031N11CAAGGCCCAATCGGCCCACAANONE 
J053023I10CAAGGCCCAATCGGCCCACAANONE 
J053045F16CAAGGCCCAATCGGCCCACAANONE 
J053054F22CAAGGCCCAATCGGCCCACAANONE 
J053094P15CAAGGCCCAATCGGCCCACAANONE 
J065048F01CAAGGCCCAATCGGCCCACAANONE 
J075012F16CAAGGCCCAATCGGCCCACAANONE 
J075089C09CAAGGCCCAATCGGCCCACAANONE 
J075179J20CAAGGCCCAATCGGCCCACAANONE 
J080305E19CAAGGCCCAATCGGCCCACAANONE 
J080309B21CAAGGCCCAATCGGCCCACAANONE 
J090017L05CAAGGCCCAATCGGCCCACAANONE 
J090058B11CAAGGCCCAATCGGCCCACAANONE 
Os01g0372100J075029A10CCTGGGCCCACAConserved hypothetical protein. 
Os01g0392600J065002C11ATGGCCCACAANONE 
J065101G17ATGGCCCACAANONE 
J065104H18ATGGCCCACAANONE 
J100041A03ATGGCCCACAANONE 
Os01g0595900AK100625AATTGGGCCCACACyclin-like F-box domain containing protein. 
Os01g0596300016-083-D09TTTCGGCCCACACNONE 
AK069151TTTCGGCCCACACCyclin-like F-box domain containing protein. 
J023007D17TTTCGGCCCACACNONE 
J065141M02TTTCGGCCCACACNONE 
Os01g0612800AK071035TGTGGGCCGAAConserved hypothetical protein. 
J090075K01TGTGGGCCGAANONE 
Os01g0613900014-018-D04ACCGGCCCACAANONE 
AK119181ACCGGCCCACAAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14ACCGGCCCACAANONE 
J065019A15ACCGGCCCACAANONE 
J075090J10ACCGGCCCACAANONE 
J075195H12ACCGGCCCACAANONE 
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein. 
Os01g0684800AK073525TCGGCCCACAProtein prenyltransferase domain containing protein. 
Os01g0688200AK120982GCGGGCCCACAAlpha/beta hydrolase family protein. 
Os01g0706000006-098-D12TGTGGGCCCCACANONE 
AK059936TGTGGGCCCCACASimilar to RNA polymerase II transcriptional coactivator KELP. 
AK070545TGTGGGCCCCACANONE 
AK104192TGTGGGCCCCACANONE 
J023055M24TGTGGGCCCCACANONE 
J033102J04TGTGGGCCCCACANONE 
J065050P18TGTGGGCCCCACANONE 
J065076D07TGTGGGCCCCACANONE 
J065078O14TGTGGGCCCCACANONE 
J065104L13TGTGGGCCCCACANONE 
J065115J23TGTGGGCCCCACANONE 
J065143P08TGTGGGCCCCACANONE 
J065178N17TGTGGGCCCCACANONE 
J065179H14TGTGGGCCCCACANONE 
J065187J06TGTGGGCCCCACANONE 
J075047B18TGTGGGCCCCACANONE 
Os01g0716200AK062106TGTGGGCCCCCGCGIQ calmodulin-binding region domain containing protein. 
AK098920TGTGGGCCCCCGCGNONE 
J013002N06TGTGGGCCCCCGCGNONE 
J013050O19TGTGGGCCCCCGCGNONE 
J013074N19TGTGGGCCCCCGCGNONE 
J013127F17TGTGGGCCCCCGCGNONE 
J013155C17TGTGGGCCCCCGCGNONE 
J013158K07TGTGGGCCCCCGCGNONE 
J053086D01TGTGGGCCCCCGCGNONE 
Os01g0723000AK073592TTGTGGGCCCGSimilar to Elongation factor EF-2 (Fragment). 
AK102586TTGTGGGCCCGNONE 
J033048F11TTGTGGGCCCGNONE 
J033098E24TTGTGGGCCCGNONE 
Os01g0727400AK065692TGTGGGCCCATATConserved hypothetical protein. 
Os01g0736900AK062151TGTGGGCCCTNONE 
AK065226TGTGGGCCCTNONE 
AK121245TGTGGGCCCTReticulon family protein. 
J013070F01TGTGGGCCCTNONE 
J013156J22TGTGGGCCCTNONE 
J023067B03TGTGGGCCCTNONE 
J023082O14TGTGGGCCCTNONE 
J023087F01TGTGGGCCCTNONE 
J023099G09TGTGGGCCCTNONE 
J023147M08TGTGGGCCCTNONE 
J033028C13TGTGGGCCCTNONE 
J033060K07TGTGGGCCCTNONE 
J033140C08TGTGGGCCCTNONE 
J033142C08TGTGGGCCCTNONE 
J043005M06TGTGGGCCCTNONE 
J043010C19TGTGGGCCCTNONE 
J043030H20TGTGGGCCCTNONE 
J065006K03TGTGGGCCCTNONE 
J065056E13TGTGGGCCCTNONE 
J065067O06TGTGGGCCCTNONE 
J065117P05TGTGGGCCCTNONE 
J065169I07TGTGGGCCCTNONE 
J080304L01TGTGGGCCCTNONE 
J080319G10TGTGGGCCCTNONE 
J090002N09TGTGGGCCCTNONE 
J090008E16TGTGGGCCCTNONE 
J090010L14TGTGGGCCCTNONE 
J090033C23TGTGGGCCCTNONE 
J090038D19TGTGGGCCCTNONE 
J090051E24TGTGGGCCCTNONE 
J090051H09TGTGGGCCCTNONE 
J090058A20TGTGGGCCCTNONE 
J090058B16TGTGGGCCCTNONE 
J090081I15TGTGGGCCCTNONE 
J090083P18TGTGGGCCCTNONE 
J090089J07TGTGGGCCCTNONE 
J090096D13TGTGGGCCCTNONE 
J100036N19TGTGGGCCCTNONE 
J100043M11TGTGGGCCCTNONE 
J100046C12TGTGGGCCCTNONE 
J100072C01TGTGGGCCCTNONE 
J100088P11TGTGGGCCCTNONE 
Os01g0737900012-087-D12TTGTGGGCCCCNONE 
AK072600TTGTGGGCCCCProtein prenyltransferase domain containing protein. 
J023006E12TTGTGGGCCCCNONE 
J023130A18TTGTGGGCCCCNONE 
J023134O05TTGTGGGCCCCNONE 
Os01g0745400AK107872TGTGGGCCCACASec34-like protein family protein. 
Os01g0764800AK102809CGTGTGGGCCACSimilar to Nt-gh3 deduced protein. 
Os01g0767700AK122168ATGGCCCACACGSimilar to DEIH-box RNA/DNA helicase. 
Os01g0794100009-027-B12TGTGGGCCTGNONE 
AK062404TGTGGGCCTGConserved hypothetical protein. 
Os01g0800800AK108093ACCGGCCCACAConserved hypothetical protein. 
Os01g0818600AK066550TGTGGGCCCGGTLeucine rich repeat, N-terminal domain containing protein. 
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE 
AK061475AGATGGGCCCACACTGACAGNONE 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
J065168H17AGATGGGCCCACACTGACAGNONE 
J065211O10AGATGGGCCCACACTGACAGNONE 
Os01g0834200AK069188CATGGGCCCACANONE 
AK100543CATGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0836400AK068741TTGTGGGCCCAAACNONE 
AK073540TTGTGGGCCCAAACSAC3/GANP family protein. 
J023019D11TTGTGGGCCCAAACNONE 
J023139O22TTGTGGGCCCAAACNONE 
J033042J20TTGTGGGCCCAAACNONE 
J033046M18TTGTGGGCCCAAACNONE 
J033124J09TTGTGGGCCCAAACNONE 
J090015E05TTGTGGGCCCAAACNONE 
J090076J09TTGTGGGCCCAAACNONE 
Os01g0839300AK064685TTGGCCCACAASimilar to 50S ribosomal protein L17. 
J065060I21TTGGCCCACAANONE 
Os01g0855600003-004-C02GTGGCCCACACGNONE 
016-023-G11GTGGCCCACACGNONE 
AK099776GTGGCCCACACGSimilar to Hs1pro-1 protein. 
AY224522GTGGCCCACACGNONE 
J013095E24GTGGCCCACACGNONE 
J023041J04GTGGCCCACACGNONE 
J065130B09GTGGCCCACACGNONE 
J075031B02GTGGCCCACACGNONE 
J075069H11GTGGCCCACACGNONE 
J100026O10GTGGCCCACACGNONE 
J100050J01GTGGCCCACACGNONE 
J100052G04GTGGCCCACACGNONE 
J100053D07GTGGCCCACACGNONE 
J100054K16GTGGCCCACACGNONE 
J100067A06GTGGCCCACACGNONE 
J100067G01GTGGCCCACACGNONE 
J100088C18GTGGCCCACACGNONE 
Os01g0860700009-026-D05GGTGGGGCCCACANONE 
AK062402GGTGGGGCCCACAConserved hypothetical protein. 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os01g0876500J053026A07GGGGCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17GGGGCCCACACNONE 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
J065066N18CCACTGACATGTGGGCCCCACANONE 
Os01g0886600AK070098GCGGCCCACASimilar to CLP protease regulatory subunit CLPX precursor. 
Os01g0889000AK103621TTGTGGGCCGGTTetratricopeptide-like helical domain containing protein. 
Os01g0895100AK058611TTGGCCCACASimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698TTGGCCCACANONE 
AK099166TTGGCCCACANONE 
J023065I03TTGGCCCACANONE 
J023081J06TTGGCCCACANONE 
J023126H17TTGGCCCACANONE 
J023126O09TTGGCCCACANONE 
J033035I06TTGGCCCACANONE 
J090065C10TTGGCCCACANONE 
J090095O16TTGGCCCACANONE 
Os01g0896800AK065268CCAGGCCCACANONE 
AK104693CCAGGCCCACAEukaryotic ribosomal protein L5 family protein. 
J013126P09CCAGGCCCACANONE 
J033046N15CCAGGCCCACANONE 
J090008K02CCAGGCCCACANONE 
J090024F15CCAGGCCCACANONE 
J090074I23CCAGGCCCACANONE 
J090093F03CCAGGCCCACANONE 
J090096N02CCAGGCCCACANONE 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0918200009-034-H02GCGGCCCACANONE 
AK062434GCGGCCCACASimilar to Ubiquitin-like protein SMT3. 
AK103092GCGGCCCACANONE 
J065093P18GCGGCCCACANONE 
J065137C15GCGGCCCACANONE 
J065156G01GCGGCCCACANONE 
J065206H16GCGGCCCACANONE 
J065209D03GCGGCCCACANONE 
J075073K05GCGGCCCACANONE 
J075099B17GCGGCCCACANONE 
J075166N04GCGGCCCACANONE 
Os01g0918300009-036-G04GCGGCCCACANONE 
009-036-G04GGGGCCCACACNONE 
009-128-H04GCGGCCCACANONE 
009-128-H04GGGGCCCACACNONE 
009-189-D06GCGGCCCACANONE 
009-189-D06GGGGCCCACACNONE 
AB016030GCGGCCCACANONE 
AB016030GGGGCCCACACNONE 
AK058869GCGGCCCACAUbiquitin-like protein SMT3. 
AK058869GGGGCCCACACUbiquitin-like protein SMT3. 
AK069668GCGGCCCACANONE 
AK069668GGGGCCCACACNONE 
J023026B05GCGGCCCACANONE 
J023026B05GGGGCCCACACNONE 
J053042E12GCGGCCCACANONE 
J053042E12GGGGCCCACACNONE 
J053045P19GCGGCCCACANONE 
J053045P19GGGGCCCACACNONE 
J053078C24GCGGCCCACANONE 
J053078C24GGGGCCCACACNONE 
J065038J05GCGGCCCACANONE 
J065038J05GGGGCCCACACNONE 
J065170B12GCGGCCCACANONE 
J065170B12GGGGCCCACACNONE 
J065174C07GCGGCCCACANONE 
J065174C07GGGGCCCACACNONE 
J075002G06GCGGCCCACANONE 
J075002G06GGGGCCCACACNONE 
J075024O07GCGGCCCACANONE 
J075024O07GGGGCCCACACNONE 
J075068H04GCGGCCCACANONE 
J075068H04GGGGCCCACACNONE 
J075071H14GCGGCCCACANONE 
J075071H14GGGGCCCACACNONE 
J075095G03GCGGCCCACANONE 
J075095G03GGGGCCCACACNONE 
J075117O08GCGGCCCACANONE 
J075117O08GGGGCCCACACNONE 
J075118J23GCGGCCCACANONE 
J075118J23GGGGCCCACACNONE 
J075124P18GCGGCCCACANONE 
J075124P18GGGGCCCACACNONE 
J100057D06GCGGCCCACANONE 
J100057D06GGGGCCCACACNONE 
J100063L03GCGGCCCACANONE 
J100063L03GGGGCCCACACNONE 
X99608GCGGCCCACANONE 
X99608GGGGCCCACACNONE 
Os01g0924000004-020-C09CGGGCCCACAANONE 
005-014-A06CGGGCCCACAANONE 
009-085-G12CGGGCCCACAANONE 
009-123-A08CGGGCCCACAANONE 
009-134-A05CGGGCCCACAANONE 
009-137-F06CGGGCCCACAANONE 
016-016-B08CGGGCCCACAANONE 
AF050674CGGGCCCACAANONE 
AK061690CGGGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797CGGGCCCACAANONE 
J013040A15CGGGCCCACAANONE 
J013104L20CGGGCCCACAANONE 
J013127E12CGGGCCCACAANONE 
J013158O05CGGGCCCACAANONE 
J023012E09CGGGCCCACAANONE 
J023126L23CGGGCCCACAANONE 
J023143B03CGGGCCCACAANONE 
J065005B16CGGGCCCACAANONE 
J065101J15CGGGCCCACAANONE 
J065105K16CGGGCCCACAANONE 
J065155K16CGGGCCCACAANONE 
J065171M17CGGGCCCACAANONE 
J065182F07CGGGCCCACAANONE 
J065187D10CGGGCCCACAANONE 
J065194I24CGGGCCCACAANONE 
J065207E24CGGGCCCACAANONE 
J075001C24CGGGCCCACAANONE 
J075090O10CGGGCCCACAANONE 
J075095H17CGGGCCCACAANONE 
J075109M24CGGGCCCACAANONE 
J075123C18CGGGCCCACAANONE 
J075148G22CGGGCCCACAANONE 
J090009B09CGGGCCCACAANONE 
J090075K17CGGGCCCACAANONE 
J090081H23CGGGCCCACAANONE 
J090097H21CGGGCCCACAANONE 
J100063P14CGGGCCCACAANONE 
Os01g0937300AK062872TGTGGGCCACNONE 
J033136K12TGTGGGCCACNONE 
J053048E20TGTGGGCCACNONE 
J053088K08TGTGGGCCACNONE 
J065011G23TGTGGGCCACNONE 
J065202J09TGTGGGCCACNONE 
Os02g0105500AK063929TGTGGGCCCTNONE 
AK102953TGTGGGCCCTIQ calmodulin-binding region domain containing protein. 
Os02g0115700AK065094GGGGCCCACATCCACCCatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231GGGGCCCACATCCACCNONE 
AK099923GGGGCCCACATCCACCNONE 
X61626GGGGCCCACATCCACCNONE 
Os02g0122800AK062255CAGGTGGGCCCACANONE 
AK121372CAGGTGGGCCCACANucleotide-binding, alpha-beta plait domain containing protein. 
J013056N24CAGGTGGGCCCACANONE 
J023037M12CAGGTGGGCCCACANONE 
J023099B21CAGGTGGGCCCACANONE 
J023126J16CAGGTGGGCCCACANONE 
J033031J05CAGGTGGGCCCACANONE 
J033048L07CAGGTGGGCCCACANONE 
J033052J23CAGGTGGGCCCACANONE 
J033076F24CAGGTGGGCCCACANONE 
J033085F01CAGGTGGGCCCACANONE 
J033101I11CAGGTGGGCCCACANONE 
J033128E01CAGGTGGGCCCACANONE 
J100070N12CAGGTGGGCCCACANONE 
Os02g0133800006-092-D12CGTGTGGGCCCCNONE 
006-111-G01CGTGTGGGCCCCNONE 
AK103646CGTGTGGGCCCCNONE 
AK109376CGTGTGGGCCCCProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CGTGTGGGCCCCNONE 
J033135B19CGTGTGGGCCCCNONE 
J065200F01CGTGTGGGCCCCNONE 
J065213J11CGTGTGGGCCCCNONE 
J075031N16CGTGTGGGCCCCNONE 
J075032N17CGTGTGGGCCCCNONE 
J075047P04CGTGTGGGCCCCNONE 
J075063D01CGTGTGGGCCCCNONE 
J075105F23CGTGTGGGCCCCNONE 
J075121E16CGTGTGGGCCCCNONE 
J075176F10CGTGTGGGCCCCNONE 
J075182M16CGTGTGGGCCCCNONE 
J075190E09CGTGTGGGCCCCNONE 
J075191B14CGTGTGGGCCCCNONE 
J100055J24CGTGTGGGCCCCNONE 
J100066H24CGTGTGGGCCCCNONE 
J100073N01CGTGTGGGCCCCNONE 
Os02g0135600AK069843GCCGGCCCAGTTAGGCCCACAConserved hypothetical protein. 
J023034H09GCCGGCCCAGTTAGGCCCACANONE 
J033090D08GCCGGCCCAGTTAGGCCCACANONE 
J100025N07GCCGGCCCAGTTAGGCCCACANONE 
J100075G18GCCGGCCCAGTTAGGCCCACANONE 
Os02g0135700AK100570TGTGGGCCTAACTGGGCCGGCDNA polymerase V family protein. 
Os02g0146700AK105609CAAGGCCCACASimilar to PSMD2 subunit (Fragment). 
AK119490CAAGGCCCACANONE 
AK121963CAAGGCCCACANONE 
Os02g0178400009-151-B08TAGGCCCACANONE 
AK063815TAGGCCCACAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCACANONE 
J033026A17TAGGCCCACANONE 
J065011K14TAGGCCCACANONE 
J065056D01TAGGCCCACANONE 
J065061L22TAGGCCCACANONE 
J065076M01TAGGCCCACANONE 
J075092E14TAGGCCCACANONE 
Os02g0193600AK060499TAGGCCCACAMad3/BUB1 homology region 1 domain containing protein. 
Os02g0198000AK067695TGTGGGCCGAGProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0282600AK070262GTGTGGGCCCCACAConserved hypothetical protein. 
AK070262GTGTGGGGCCCACAConserved hypothetical protein. 
J023041L18GTGTGGGCCCCACANONE 
J023041L18GTGTGGGGCCCACANONE 
Os02g0299200AK105486CGGGCCCACAIQ calmodulin-binding region domain containing protein. 
Os02g0452800J043024P15TGTGGGCCAGConserved hypothetical protein. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0510300AK067961CTCGGCCCACAConserved hypothetical protein. 
AK067961TGTGGGCCTAConserved hypothetical protein. 
AK104001CTCGGCCCACANONE 
AK104001TGTGGGCCTANONE 
J013123J20CTCGGCCCACANONE 
J013123J20TGTGGGCCTANONE 
J065169H15CTCGGCCCACANONE 
J065169H15TGTGGGCCTANONE 
Os02g0513100AK103266CCCGTGGGGGGCCCACASimilar to MtN3 protein precursor. 
Os02g0517531AK121247TTGGCCCACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0525400011-008-B01TAGGCCCACAGCCCAAACNONE 
AK065368TAGGCCCACAGCCCAAACSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13TAGGCCCACAGCCCAAACNONE 
J033046H10TAGGCCCACAGCCCAAACNONE 
Os02g0534600Os02g0534600TGTGGGGCCCACAConserved hypothetical protein. 
Os02g0548900AK070239TGTGGGCCCCCACHypothetical protein. 
J023045K14TGTGGGCCCCCACNONE 
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein. 
AK068282TGTGGGCCTAConserved hypothetical protein. 
J075034A17GTGTGGGCCCATGANONE 
J075034A17TGTGGGCCTANONE 
J075129I09GTGTGGGCCCATGANONE 
J075129I09TGTGGGCCTANONE 
Os02g0591800AK060611TGTGGGCCGCABrix domain containing protein. 
AK102534TGTGGGCCGCANONE 
J075057H08TGTGGGCCGCANONE 
J075179P18TGTGGGCCGCANONE 
J080011H01TGTGGGCCGCANONE 
J080018E14TGTGGGCCGCANONE 
J080026N17TGTGGGCCGCANONE 
J080047A13TGTGGGCCGCANONE 
J080049C17TGTGGGCCGCANONE 
J080050G07TGTGGGCCGCANONE 
J080064D10TGTGGGCCGCANONE 
J080080A03TGTGGGCCGCANONE 
J080080G20TGTGGGCCGCANONE 
J080080I03TGTGGGCCGCANONE 
J080081H12TGTGGGCCGCANONE 
J080090K07TGTGGGCCGCANONE 
J080092O06TGTGGGCCGCANONE 
J080096B07TGTGGGCCGCANONE 
J080097M08TGTGGGCCGCANONE 
Os02g0600200009-154-A06CCCACCCGGGCCCACACNONE 
AK058978CCCACCCGGGCCCACACNONE 
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein. 
Os02g0606800AK073760CCCGGGCCCACAIsochorismatase hydrolase family protein. 
J100033B19CCCGGGCCCACANONE 
J100047E15CCCGGGCCCACANONE 
J100058A18CCCGGGCCCACANONE 
J100068L14CCCGGGCCCACANONE 
J100089I02CCCGGGCCCACANONE 
Os02g0606900J023065M01TAGGCCCACANONE 
J075046E14TAGGCCCACANONE 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
Os02g0621600AK071074CACGGCCCACAANONE 
AK108575CACGGCCCACAAConserved hypothetical protein. 
J023078O20CACGGCCCACAANONE 
J075025M01CACGGCCCACAANONE 
J090047L11CACGGCCCACAANONE 
Os02g0643500AK068423TCTCGGCCCACAAPentapeptide repeat containing protein. 
Os02g0666800AK101444TAGGCCCACAAProtein of unknown function DUF788 family protein. 
J033039F09TAGGCCCACAANONE 
J065041E15TAGGCCCACAANONE 
J075087I24TAGGCCCACAANONE 
J100079A10TAGGCCCACAANONE 
Os02g0670900003-115-B09TGTGGGCCCATGANONE 
005-004-F12TGTGGGCCCATGANONE 
006-037-B11TGTGGGCCCATGANONE 
006-094-B07TGTGGGCCCATGANONE 
011-020-A12TGTGGGCCCATGANONE 
AK061649TGTGGGCCCATGANONE 
AK061743TGTGGGCCCATGANONE 
AK064827TGTGGGCCCATGANONE 
AK100650TGTGGGCCCATGASimilar to Amino acid transporter protein-like. 
AK119517TGTGGGCCCATGANONE 
J013000F07TGTGGGCCCATGANONE 
J013027M02TGTGGGCCCATGANONE 
J013027M22TGTGGGCCCATGANONE 
J013031G16TGTGGGCCCATGANONE 
J013044H17TGTGGGCCCATGANONE 
J013045G22TGTGGGCCCATGANONE 
J013059N20TGTGGGCCCATGANONE 
J013063G15TGTGGGCCCATGANONE 
J013064J09TGTGGGCCCATGANONE 
J013089F14TGTGGGCCCATGANONE 
J013099L15TGTGGGCCCATGANONE 
J013119A08TGTGGGCCCATGANONE 
J013119B13TGTGGGCCCATGANONE 
J013126K07TGTGGGCCCATGANONE 
J023019J06TGTGGGCCCATGANONE 
J023019K19TGTGGGCCCATGANONE 
J023038I17TGTGGGCCCATGANONE 
J023042O17TGTGGGCCCATGANONE 
J023060G23TGTGGGCCCATGANONE 
J023064A12TGTGGGCCCATGANONE 
J023072G01TGTGGGCCCATGANONE 
J023108K16TGTGGGCCCATGANONE 
J023111D04TGTGGGCCCATGANONE 
J023134O14TGTGGGCCCATGANONE 
J023142P09TGTGGGCCCATGANONE 
J033039F01TGTGGGCCCATGANONE 
J033068J18TGTGGGCCCATGANONE 
J033117B05TGTGGGCCCATGANONE 
J033118I01TGTGGGCCCATGANONE 
J033136E10TGTGGGCCCATGANONE 
J033140C15TGTGGGCCCATGANONE 
J043024E09TGTGGGCCCATGANONE 
J043038B21TGTGGGCCCATGANONE 
J090005F19TGTGGGCCCATGANONE 
J090022N04TGTGGGCCCATGANONE 
J090023F15TGTGGGCCCATGANONE 
J090038O19TGTGGGCCCATGANONE 
J090042N22TGTGGGCCCATGANONE 
J090051C06TGTGGGCCCATGANONE 
J090063O09TGTGGGCCCATGANONE 
J090079N05TGTGGGCCCATGANONE 
J090096L17TGTGGGCCCATGANONE 
J100038G08TGTGGGCCCATGANONE 
J100041F17TGTGGGCCCATGANONE 
J100042G15TGTGGGCCCATGANONE 
J100042N11TGTGGGCCCATGANONE 
J100048B10TGTGGGCCCATGANONE 
J100056C24TGTGGGCCCATGANONE 
J100059K07TGTGGGCCCATGANONE 
J100069A06TGTGGGCCCATGANONE 
J100077B01TGTGGGCCCATGANONE 
J100089D17TGTGGGCCCATGANONE 
Os02g0672500AK109266ACCGGCCCACACNONE 
Os02g0677700AK119947TGTGGGCCCCACANONE 
Os02g0682600AK108470TGTGGGCCTAZinc finger, Tim10/DDP-type family protein. 
J065019B06TGTGGGCCTANONE 
J065065L01TGTGGGCCTANONE 
Os02g0697200015-013-B10AACGGGCCCACANONE 
AK059475AACGGGCCCACANONE 
AK102993AACGGGCCCACAConserved hypothetical protein. 
J033079I18AACGGGCCCACANONE 
J033082A14AACGGGCCCACANONE 
J065047H08AACGGGCCCACANONE 
J065131M14AACGGGCCCACANONE 
Os02g0698100009-089-H10TGTGGGCCCCACGNONE 
AK060614TGTGGGCCCCACGGalactose oxidase, central domain containing protein. 
J090039P20TGTGGGCCCCACGNONE 
Os02g0699700AK072471AGGGCCCACAASimilar to DNA topoisomerase II. 
Os02g0725100AK071759TTGTGGGCCCCNONE 
Os02g0733500AK108506TTGTGGGCCCCParvalbumin family protein. 
Os02g0741100AK068712GGTGGGGCCCACASimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK068712TGTGGGCCACSimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK071144GGTGGGGCCCACANONE 
AK071144TGTGGGCCACNONE 
J065056A02GGTGGGGCCCACANONE 
J065056A02TGTGGGCCACNONE 
J065212F10GGTGGGGCCCACANONE 
J065212F10TGTGGGCCACNONE 
J080005J10GGTGGGGCCCACANONE 
J080005J10TGTGGGCCACNONE 
J080013A11GGTGGGGCCCACANONE 
J080013A11TGTGGGCCACNONE 
J080015E01GGTGGGGCCCACANONE 
J080015E01TGTGGGCCACNONE 
J080022G23GGTGGGGCCCACANONE 
J080022G23TGTGGGCCACNONE 
J080025C13GGTGGGGCCCACANONE 
J080025C13TGTGGGCCACNONE 
J080026P14GGTGGGGCCCACANONE 
J080026P14TGTGGGCCACNONE 
J080027D22GGTGGGGCCCACANONE 
J080027D22TGTGGGCCACNONE 
J080027G13GGTGGGGCCCACANONE 
J080027G13TGTGGGCCACNONE 
J080027L23GGTGGGGCCCACANONE 
J080027L23TGTGGGCCACNONE 
J080027N23GGTGGGGCCCACANONE 
J080027N23TGTGGGCCACNONE 
J080028F21GGTGGGGCCCACANONE 
J080028F21TGTGGGCCACNONE 
J080028J18GGTGGGGCCCACANONE 
J080028J18TGTGGGCCACNONE 
J080028P22GGTGGGGCCCACANONE 
J080028P22TGTGGGCCACNONE 
J080038P04GGTGGGGCCCACANONE 
J080038P04TGTGGGCCACNONE 
J080042M11GGTGGGGCCCACANONE 
J080042M11TGTGGGCCACNONE 
J080043B19GGTGGGGCCCACANONE 
J080043B19TGTGGGCCACNONE 
J080045J23GGTGGGGCCCACANONE 
J080045J23TGTGGGCCACNONE 
J080047B06GGTGGGGCCCACANONE 
J080047B06TGTGGGCCACNONE 
J080052F04GGTGGGGCCCACANONE 
J080052F04TGTGGGCCACNONE 
J080057F01GGTGGGGCCCACANONE 
J080057F01TGTGGGCCACNONE 
J080057G03GGTGGGGCCCACANONE 
J080057G03TGTGGGCCACNONE 
J080060H12GGTGGGGCCCACANONE 
J080060H12TGTGGGCCACNONE 
J080061L12GGTGGGGCCCACANONE 
J080061L12TGTGGGCCACNONE 
J080062J17GGTGGGGCCCACANONE 
J080062J17TGTGGGCCACNONE 
J080062M22GGTGGGGCCCACANONE 
J080062M22TGTGGGCCACNONE 
J080072C01GGTGGGGCCCACANONE 
J080072C01TGTGGGCCACNONE 
J080075F01GGTGGGGCCCACANONE 
J080075F01TGTGGGCCACNONE 
J080076A09GGTGGGGCCCACANONE 
J080076A09TGTGGGCCACNONE 
J080076I01GGTGGGGCCCACANONE 
J080076I01TGTGGGCCACNONE 
J080077D01GGTGGGGCCCACANONE 
J080077D01TGTGGGCCACNONE 
J080077F19GGTGGGGCCCACANONE 
J080077F19TGTGGGCCACNONE 
J080079L19GGTGGGGCCCACANONE 
J080079L19TGTGGGCCACNONE 
J080088B03GGTGGGGCCCACANONE 
J080088B03TGTGGGCCACNONE 
J080090J15GGTGGGGCCCACANONE 
J080090J15TGTGGGCCACNONE 
J080092J21GGTGGGGCCCACANONE 
J080092J21TGTGGGCCACNONE 
J080095J12GGTGGGGCCCACANONE 
J080095J12TGTGGGCCACNONE 
J090012C05GGTGGGGCCCACANONE 
J090012C05TGTGGGCCACNONE 
J090039K19GGTGGGGCCCACANONE 
J090039K19TGTGGGCCACNONE 
J090078L12GGTGGGGCCCACANONE 
J090078L12TGTGGGCCACNONE 
Os02g0755600014-024-D06TGTGGGCCCACGTGNONE 
015-039-F09TGTGGGCCCACGTGNONE 
AK064105TGTGGGCCCACGTGNONE 
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase. 
Os02g0762300AK106684TTGGCCCACAProtein of unknown function UPF0021 family protein. 
J090060M09TTGGCCCACANONE 
J100083E05TTGGCCCACANONE 
Os02g0767500005-017-F10CGGGCCCACANONE 
AB016065CGGGCCCACANONE 
AK069611CGGGCCCACAMitochondrial phosphate transporter. 
J013020K11CGGGCCCACANONE 
J013066I18CGGGCCCACANONE 
J023012D02CGGGCCCACANONE 
J023020J16CGGGCCCACANONE 
J023022H13CGGGCCCACANONE 
J023044N15CGGGCCCACANONE 
J023067E15CGGGCCCACANONE 
J023079C06CGGGCCCACANONE 
J023080B07CGGGCCCACANONE 
J023081G11CGGGCCCACANONE 
J023091H22CGGGCCCACANONE 
J023092J03CGGGCCCACANONE 
J023114D02CGGGCCCACANONE 
J023121J15CGGGCCCACANONE 
J023128G10CGGGCCCACANONE 
J023132B15CGGGCCCACANONE 
J023140G10CGGGCCCACANONE 
J023142B10CGGGCCCACANONE 
J033026C15CGGGCCCACANONE 
J033029F21CGGGCCCACANONE 
J033037I09CGGGCCCACANONE 
J033046D11CGGGCCCACANONE 
J033081L20CGGGCCCACANONE 
J033097J19CGGGCCCACANONE 
J033125D19CGGGCCCACANONE 
J033125I04CGGGCCCACANONE 
J033141M21CGGGCCCACANONE 
J033143K08CGGGCCCACANONE 
J053091N01CGGGCCCACANONE 
J065093C20CGGGCCCACANONE 
J065104K11CGGGCCCACANONE 
J065143L16CGGGCCCACANONE 
J065205I23CGGGCCCACANONE 
J090057C12CGGGCCCACANONE 
J090075P11CGGGCCCACANONE 
Os02g0770700AK106494TGTGGGCCTAPeptidase C50, separase family protein. 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0803600AK064750TGTGGGCCCCALongin-like domain containing protein. 
Os02g0815200AK067252AGGGCCCACASimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK104489AGGGCCCACANONE 
Os02g0817600006-085-G03TTGTGGGCCCCACANONE 
AJ748648TTGTGGGCCCCACANONE 
AK069892TTGTGGGCCCCACAAUX/IAA protein family protein. 
AK104501TTGTGGGCCCCACANONE 
AK104802TTGTGGGCCCCACANONE 
J013027H10TTGTGGGCCCCACANONE 
J013106L07TTGTGGGCCCCACANONE 
J013118N15TTGTGGGCCCCACANONE 
J013131H01TTGTGGGCCCCACANONE 
J013170C08TTGTGGGCCCCACANONE 
J023060C13TTGTGGGCCCCACANONE 
J033024K10TTGTGGGCCCCACANONE 
J033052I08TTGTGGGCCCCACANONE 
J090010H15TTGTGGGCCCCACANONE 
J090011J11TTGTGGGCCCCACANONE 
J090038P15TTGTGGGCCCCACANONE 
J090060B02TTGTGGGCCCCACANONE 
J100079J16TTGTGGGCCCCACANONE 
Os02g0819700AK067374CAAGGCCCACACGZinc finger, Zim17-type family protein. 
AK067374TCGGCCCACAAZinc finger, Zim17-type family protein. 
AK099160CAAGGCCCACACGNONE 
AK099160TCGGCCCACAANONE 
J100086K17CAAGGCCCACACGNONE 
J100086K17TCGGCCCACAANONE 
Os02g0823400AK105029ATCTGGGCCCACASimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment). 
J033140N12ATCTGGGCCCACANONE 
J075104C12ATCTGGGCCCACANONE 
J075120E03ATCTGGGCCCACANONE 
J075126M18ATCTGGGCCCACANONE 
J075189P21ATCTGGGCCCACANONE 
Os02g0828200AK071199TGCGGCCCACAGCCCAATANONE 
Os03g0113900AK107900GTGTGGGCCCCACCProtein of unknown function DUF584 family protein. 
AK119700GTGTGGGCCCCACCNONE 
Os03g0127000AK068479TGTGGGCCTCConserved hypothetical protein. 
J013152D10TGTGGGCCTCNONE 
J075167I20TGTGGGCCTCNONE 
J090067O04TGTGGGCCTCNONE 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGGGTGGGCCCACACGNONE 
Os03g0133300AK064510GGTGGGCCCACAConserved hypothetical protein. 
Os03g0143000AK073102TTGTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24TTGTGGGCCTCNONE 
Os03g0143400AK073999TAGGCCCACAACCCGGCCCATTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21TAGGCCCACAACCCGGCCCATTNONE 
J033073C08TAGGCCCACAACCCGGCCCATTNONE 
J033094C19TAGGCCCACAACCCGGCCCATTNONE 
J065017L10TAGGCCCACAACCCGGCCCATTNONE 
J065070H22TAGGCCCACAACCCGGCCCATTNONE 
J065079M09TAGGCCCACAACCCGGCCCATTNONE 
J065091N18TAGGCCCACAACCCGGCCCATTNONE 
J065109N03TAGGCCCACAACCCGGCCCATTNONE 
J065113F05TAGGCCCACAACCCGGCCCATTNONE 
J065135D23TAGGCCCACAACCCGGCCCATTNONE 
J065156L16TAGGCCCACAACCCGGCCCATTNONE 
J065207O04TAGGCCCACAACCCGGCCCATTNONE 
J065208F03TAGGCCCACAACCCGGCCCATTNONE 
J090010M15TAGGCCCACAACCCGGCCCATTNONE 
J090056J18TAGGCCCACAACCCGGCCCATTNONE 
Os03g0143600AB110188CAAGGCCCACANONE 
AK068424CAAGGCCCACASimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464CAAGGCCCACANONE 
AY224545CAAGGCCCACANONE 
J013154F02CAAGGCCCACANONE 
Os03g0148000AK110468GCCGGGCCCACAProtein of unknown function DUF677 family protein. 
Os03g0149400AK111396CCACGGCCCACAProtein prenyltransferase domain containing protein. 
Os03g0151800AK064955CGGGCCCACACNONE 
AK098874CGGGCCCACACNONE 
AK098980CGGGCCCACACNONE 
AK099712CGGGCCCACACNONE 
AK099889CGGGCCCACACNONE 
AK121641CGGGCCCACACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGGGCCCACACNONE 
J013001D04CGGGCCCACACNONE 
J013121O12CGGGCCCACACNONE 
Os03g0177000AK071368CCCACCCGGACCCACTCTCCAGGCCCACAGCN5-related N-acetyltransferase domain containing protein. 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0219200011-045-E01TAGGCCCACAANONE 
AK073785TAGGCCCACAASimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19TAGGCCCACAANONE 
J043009H23TAGGCCCACAANONE 
Os03g0249200009-103-B08GTGGCCCACACNONE 
AK069944GTGGCCCACACClass I peptide chain release factor domain containing protein. 
J065166E13GTGGCCCACACNONE 
Os03g0251500AK101151CAGGTGGGGGCCCACANONE 
AK119298CAGGTGGGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0253100AK119618TAGGCCCACAGCCCACTTGPhosphomevalonate kinase Erg8 family protein. 
J033052A14TAGGCCCACAGCCCACTTGNONE 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0260100AK066143TGATGGGCCCACAConserved hypothetical protein. 
Os03g0266300006-027-H06ATGGCCCACANONE 
006-027-H06TGTGGGCCCCANONE 
013-051-G08ATGGCCCACANONE 
013-051-G08TGTGGGCCCCANONE 
014-002-C05ATGGCCCACANONE 
014-002-C05TGTGGGCCCCANONE 
014-002-H02ATGGCCCACANONE 
014-002-H02TGTGGGCCCCANONE 
014-005-A09ATGGCCCACANONE 
014-005-A09TGTGGGCCCCANONE 
014-008-D02ATGGCCCACANONE 
014-008-D02TGTGGGCCCCANONE 
014-008-G06ATGGCCCACANONE 
014-008-G06TGTGGGCCCCANONE 
014-009-C12ATGGCCCACANONE 
014-009-C12TGTGGGCCCCANONE 
014-010-A07ATGGCCCACANONE 
014-010-A07TGTGGGCCCCANONE 
014-012-H03ATGGCCCACANONE 
014-012-H03TGTGGGCCCCANONE 
014-013-E03ATGGCCCACANONE 
014-013-E03TGTGGGCCCCANONE 
014-014-D03ATGGCCCACANONE 
014-014-D03TGTGGGCCCCANONE 
014-028-C09ATGGCCCACANONE 
014-028-C09TGTGGGCCCCANONE 
014-037-G05ATGGCCCACANONE 
014-037-G05TGTGGGCCCCANONE 
014-038-E04ATGGCCCACANONE 
014-038-E04TGTGGGCCCCANONE 
014-041-F08ATGGCCCACANONE 
014-041-F08TGTGGGCCCCANONE 
014-049-E11ATGGCCCACANONE 
014-049-E11TGTGGGCCCCANONE 
014-050-A05ATGGCCCACANONE 
014-050-A05TGTGGGCCCCANONE 
014-053-F10ATGGCCCACANONE 
014-053-F10TGTGGGCCCCANONE 
014-054-C04ATGGCCCACANONE 
014-054-C04TGTGGGCCCCANONE 
014-056-A01ATGGCCCACANONE 
014-056-A01TGTGGGCCCCANONE 
014-060-A08ATGGCCCACANONE 
014-060-A08TGTGGGCCCCANONE 
014-072-C09ATGGCCCACANONE 
014-072-C09TGTGGGCCCCANONE 
014-072-D02ATGGCCCACANONE 
014-072-D02TGTGGGCCCCANONE 
014-077-G08ATGGCCCACANONE 
014-077-G08TGTGGGCCCCANONE 
014-080-C10ATGGCCCACANONE 
014-080-C10TGTGGGCCCCANONE 
014-098-E01ATGGCCCACANONE 
014-098-E01TGTGGGCCCCANONE 
014-100-C02ATGGCCCACANONE 
014-100-C02TGTGGGCCCCANONE 
014-100-E03ATGGCCCACANONE 
014-100-E03TGTGGGCCCCANONE 
014-100-E10ATGGCCCACANONE 
014-100-E10TGTGGGCCCCANONE 
015-061-D06ATGGCCCACANONE 
015-061-D06TGTGGGCCCCANONE 
016-033-H10ATGGCCCACANONE 
016-033-H10TGTGGGCCCCANONE 
AB110191ATGGCCCACANONE 
AB110191TGTGGGCCCCANONE 
AF467729ATGGCCCACANONE 
AF467729TGTGGGCCCCANONE 
AK073671ATGGCCCACANONE 
AK073671TGTGGGCCCCANONE 
AK104129ATGGCCCACAClass I low-molecular-weight heat shock protein 17.9. 
AK104129TGTGGGCCCCAClass I low-molecular-weight heat shock protein 17.9. 
AK119239ATGGCCCACANONE 
AK119239TGTGGGCCCCANONE 
AK119616ATGGCCCACANONE 
AK119616TGTGGGCCCCANONE 
AK119664ATGGCCCACANONE 
AK119664TGTGGGCCCCANONE 
AK119675ATGGCCCACANONE 
AK119675TGTGGGCCCCANONE 
D21285ATGGCCCACANONE 
D21285TGTGGGCCCCANONE 
J033051H23ATGGCCCACANONE 
J033051H23TGTGGGCCCCANONE 
J065036L24ATGGCCCACANONE 
J065036L24TGTGGGCCCCANONE 
J065045J20ATGGCCCACANONE 
J065045J20TGTGGGCCCCANONE 
J065104C03ATGGCCCACANONE 
J065104C03TGTGGGCCCCANONE 
J065109J20ATGGCCCACANONE 
J065109J20TGTGGGCCCCANONE 
J065116F24ATGGCCCACANONE 
J065116F24TGTGGGCCCCANONE 
J065146F06ATGGCCCACANONE 
J065146F06TGTGGGCCCCANONE 
J065146P18ATGGCCCACANONE 
J065146P18TGTGGGCCCCANONE 
J065167A09ATGGCCCACANONE 
J065167A09TGTGGGCCCCANONE 
J065183K12ATGGCCCACANONE 
J065183K12TGTGGGCCCCANONE 
J075019J15ATGGCCCACANONE 
J075019J15TGTGGGCCCCANONE 
J075112F10ATGGCCCACANONE 
J075112F10TGTGGGCCCCANONE 
J075150H04ATGGCCCACANONE 
J075150H04TGTGGGCCCCANONE 
J075159N20ATGGCCCACANONE 
J075159N20TGTGGGCCCCANONE 
J075164P19ATGGCCCACANONE 
J075164P19TGTGGGCCCCANONE 
J075185O05ATGGCCCACANONE 
J075185O05TGTGGGCCCCANONE 
J100030A19ATGGCCCACANONE 
J100030A19TGTGGGCCCCANONE 
J100044E07ATGGCCCACANONE 
J100044E07TGTGGGCCCCANONE 
Os03g0277500014-019-A09GTGTGGGCCGTGNONE 
AK063650GTGTGGGCCGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18GTGTGGGCCGTGNONE 
J065092A08GTGTGGGCCGTGNONE 
J065122E17GTGTGGGCCGTGNONE 
J065182K12GTGTGGGCCGTGNONE 
J065197H15GTGTGGGCCGTGNONE 
J075115A05GTGTGGGCCGTGNONE 
Os03g0284500012-066-D02GTGGCCCACATGTCAGTGNONE 
AK105295GTGGCCCACATGTCAGTGNONE 
AK121300GTGGCCCACATGTCAGTGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0284600AK110712CACTGACATGTGGGCCACThioredoxin fold domain containing protein. 
Os03g0294200AK069285CCCGGGCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0295500009-083-F02TGTGGGCCAGANONE 
J053029J05TGTGGGCCAGANONE 
J053054B07TGTGGGCCAGACHCH domain containing protein. 
J065024G23TGTGGGCCAGANONE 
J065036F08TGTGGGCCAGANONE 
J065066M11TGTGGGCCAGANONE 
J065143G19TGTGGGCCAGANONE 
Os03g0300600003-125-G06AAGGCCCACAANONE 
006-048-C04AAGGCCCACAANONE 
009-044-A09AAGGCCCACAANONE 
AK059801AAGGCCCACAANONE 
AK066250AAGGCCCACAASimilar to Chaperone protein dnaJ. 
AK069897AAGGCCCACAANONE 
AK104186AAGGCCCACAANONE 
J065197D15AAGGCCCACAANONE 
J090031C11AAGGCCCACAANONE 
J100024C23AAGGCCCACAANONE 
J100030B16AAGGCCCACAANONE 
J100033K12AAGGCCCACAANONE 
J100043M19AAGGCCCACAANONE 
J100056N09AAGGCCCACAANONE 
J100058E12AAGGCCCACAANONE 
J100084J08AAGGCCCACAANONE 
Os03g0316200009-196-H10AGGGCCCACAANONE 
013-011-H03AGGGCCCACAANONE 
014-031-F04AGGGCCCACAANONE 
014-083-C08AGGGCCCACAANONE 
AK071812AGGGCCCACAASimilar to Galactinol synthase (Fragment). 
AK103958AGGGCCCACAANONE 
J023054E12AGGGCCCACAANONE 
J023075G21AGGGCCCACAANONE 
J023113D08AGGGCCCACAANONE 
J065067M09AGGGCCCACAANONE 
J065102E07AGGGCCCACAANONE 
J065103M07AGGGCCCACAANONE 
Os03g0333300015-069-B02TGTGGGCCGGCNONE 
AK063858TGTGGGCCGGCNONE 
AK073228TGTGGGCCGGCSimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
Os03g0352800009-030-G08AAGGCCCACAAGGCCCNONE 
009-030-G08TGTGGGGCCCACANONE 
AK059673AAGGCCCACAAGGCCCSimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
AK059673TGTGGGGCCCACASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17AAGGCCCACAAGGCCCNONE 
J023060F17TGTGGGGCCCACANONE 
J075050N19AAGGCCCACAAGGCCCNONE 
J075050N19TGTGGGGCCCACANONE 
J075104J18AAGGCCCACAAGGCCCNONE 
J075104J18TGTGGGGCCCACANONE 
J075142K05AAGGCCCACAAGGCCCNONE 
J075142K05TGTGGGGCCCACANONE 
J100050I19AAGGCCCACAAGGCCCNONE 
J100050I19TGTGGGGCCCACANONE 
J100057N04AAGGCCCACAAGGCCCNONE 
J100057N04TGTGGGGCCCACANONE 
Os03g0395900AK120654AAGGCCCACANONE 
J075050E23AAGGCCCACANONE 
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CGTGTGGGCCCGGGCCCGGANONE 
J023036P06CGTGTGGGCCCGGGCCCGGANONE 
J023145E24CGTGTGGGCCCGGGCCCGGANONE 
J033142I11CGTGTGGGCCCGGGCCCGGANONE 
J043003A10CGTGTGGGCCCGGGCCCGGANONE 
J075023H21CGTGTGGGCCCGGGCCCGGANONE 
J075145O10CGTGTGGGCCCGGGCCCGGANONE 
J075149A03CGTGTGGGCCCGGGCCCGGANONE 
J090099B09CGTGTGGGCCCGGGCCCGGANONE 
J100017L14CGTGTGGGCCCGGGCCCGGANONE 
J100050K18CGTGTGGGCCCGGGCCCGGANONE 
J100063P16CGTGTGGGCCCGGGCCCGGANONE 
Os03g0405000AK070839AGATGGGCCCACAReticulon family protein. 
Os03g0565600J090030D24TGTGGGCCATNONE 
Os03g0647500015-025-E10CTCGGCCCACAANONE 
AK064308CTCGGCCCACAAConserved hypothetical protein. 
AK103649CTCGGCCCACAANONE 
J033135D01CTCGGCCCACAANONE 
Os03g0670200011-069-G05TGTGGGCCCCACCGATCCGNONE 
AK069553TGTGGGCCCCACCGATCCGSimilar to YJR013Wp (Fragment). 
J023020O11TGTGGGCCCCACCGATCCGNONE 
J023114J22TGTGGGCCCCACCGATCCGNONE 
J100084F17TGTGGGCCCCACCGATCCGNONE 
J100087A11TGTGGGCCCCACCGATCCGNONE 
Os03g0701700011-034-E06GGTGTGTGGGCCGTGTGGCNONE 
AF013979GGTGTGTGGGCCGTGTGGCNONE 
AK065161GGTGTGTGGGCCGTGTGGCSimilar to Ethylene receptor. 
AK067813GGTGTGTGGGCCGTGTGGCNONE 
J013002C04GGTGTGTGGGCCGTGTGGCNONE 
J013035M07GGTGTGTGGGCCGTGTGGCNONE 
J013049B10GGTGTGTGGGCCGTGTGGCNONE 
J013065F11GGTGTGTGGGCCGTGTGGCNONE 
J013072K18GGTGTGTGGGCCGTGTGGCNONE 
J013073P08GGTGTGTGGGCCGTGTGGCNONE 
J013098F08GGTGTGTGGGCCGTGTGGCNONE 
J013154M13GGTGTGTGGGCCGTGTGGCNONE 
J023001H02GGTGTGTGGGCCGTGTGGCNONE 
J023003D16GGTGTGTGGGCCGTGTGGCNONE 
J023014P17GGTGTGTGGGCCGTGTGGCNONE 
J023036A22GGTGTGTGGGCCGTGTGGCNONE 
J023038N01GGTGTGTGGGCCGTGTGGCNONE 
J023042E11GGTGTGTGGGCCGTGTGGCNONE 
J023058O05GGTGTGTGGGCCGTGTGGCNONE 
J023084D05GGTGTGTGGGCCGTGTGGCNONE 
J023088O17GGTGTGTGGGCCGTGTGGCNONE 
J023138O11GGTGTGTGGGCCGTGTGGCNONE 
J023147A10GGTGTGTGGGCCGTGTGGCNONE 
J033029G18GGTGTGTGGGCCGTGTGGCNONE 
J033031N13GGTGTGTGGGCCGTGTGGCNONE 
J033090D09GGTGTGTGGGCCGTGTGGCNONE 
J033091I06GGTGTGTGGGCCGTGTGGCNONE 
J033096B20GGTGTGTGGGCCGTGTGGCNONE 
J033101A19GGTGTGTGGGCCGTGTGGCNONE 
J033135D03GGTGTGTGGGCCGTGTGGCNONE 
J043001L13GGTGTGTGGGCCGTGTGGCNONE 
J043020A13GGTGTGTGGGCCGTGTGGCNONE 
J053071K24GGTGTGTGGGCCGTGTGGCNONE 
J053092L14GGTGTGTGGGCCGTGTGGCNONE 
J053099F19GGTGTGTGGGCCGTGTGGCNONE 
J065009P22GGTGTGTGGGCCGTGTGGCNONE 
J065046A22GGTGTGTGGGCCGTGTGGCNONE 
J065099K22GGTGTGTGGGCCGTGTGGCNONE 
J065112O22GGTGTGTGGGCCGTGTGGCNONE 
J065119K11GGTGTGTGGGCCGTGTGGCNONE 
J065212B11GGTGTGTGGGCCGTGTGGCNONE 
J090022A11GGTGTGTGGGCCGTGTGGCNONE 
J090054F15GGTGTGTGGGCCGTGTGGCNONE 
J090076B20GGTGTGTGGGCCGTGTGGCNONE 
J090099M22GGTGTGTGGGCCGTGTGGCNONE 
J100032L01GGTGTGTGGGCCGTGTGGCNONE 
J100065H13GGTGTGTGGGCCGTGTGGCNONE 
Os03g0735200011-051-E04TGTGGGCCCACAANONE 
AK063345TGTGGGCCCACAATetratricopeptide-like helical domain containing protein. 
Os03g0746000AK073682GCGGCCCACAConserved hypothetical protein. 
AK111472GCGGCCCACANONE 
J090083F05GCGGCCCACANONE 
Os03g0760700AK060701TGTGGGCCGCSimilar to Aspartate-semialdehyde dehydrogenase (EC 1.2.1.11) (Fragment). 
Os03g0765000AK073918GAGGCCCACACSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0780400011-100-D09AGGGCCCACANONE 
AK061347AGGGCCCACANONE 
AK073162AGGGCCCACASimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22AGGGCCCACANONE 
J065045I07AGGGCCCACANONE 
J090036F17AGGGCCCACANONE 
J090077M14AGGGCCCACANONE 
J100055G20AGGGCCCACANONE 
Os03g0784500AK109744ACAGGTGGGGCCCACAANONE 
Os03g0785200003-116-B06TTGTGGGCCTGANONE 
J013098I23TTGTGGGCCTGANONE 
J023002I24TTGTGGGCCTGAMitochodrial transcription termination factor-related family protein. 
J075150G04TTGTGGGCCTGANONE 
Os03g0793500AK103407GACGGCCCACANONE 
AK121620GACGGCCCACASimilar to Casein kinase-like protein. 
Os03g0793700AK121667CACGGCCCACACCupin 1 domain containing protein. 
AY098743CACGGCCCACACNONE 
Os03g0796800J065024O22TGTGGGCCCGCConserved hypothetical protein. 
Os03g0800500006-075-C12GGTGGGCCCACACNONE 
AK061104GGTGGGCCCACACNONE 
AK070229GGTGGGCCCACACPutative small multi-drug export family protein. 
J065152L13GGTGGGCCCACACNONE 
Os03g0811600009-134-B07TGTGGGCCCCACATGTCAGTGNONE 
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H. 
J023078H22TGTGGGCCCCACATGTCAGTGNONE 
Os03g0819400009-131-F02TGTGGGCCCTNONE 
AK070263TGTGGGCCCTHeavy metal transport/detoxification protein domain containing protein. 
J023043H06TGTGGGCCCTNONE 
J033097J18TGTGGGCCCTNONE 
J033133G11TGTGGGCCCTNONE 
J065037K10TGTGGGCCCTNONE 
J065200J12TGTGGGCCCTNONE 
J075172I11TGTGGGCCCTNONE 
J100082F10TGTGGGCCCTNONE 
Os03g0822900AK099787CACGGCCCACAAZinc finger, BED-type predicted domain containing protein. 
J013042C24CACGGCCCACAANONE 
J013096O21CACGGCCCACAANONE 
J023109I23CACGGCCCACAANONE 
J033106N09CACGGCCCACAANONE 
J033107H03CACGGCCCACAANONE 
J033118G03CACGGCCCACAANONE 
J033145I24CACGGCCCACAANONE 
J065138D15CACGGCCCACAANONE 
J065140L13CACGGCCCACAANONE 
J065179M13CACGGCCCACAANONE 
J065200F05CACGGCCCACAANONE 
J075104F20CACGGCCCACAANONE 
J075143A15CACGGCCCACAANONE 
J075197J11CACGGCCCACAANONE 
Os03g0825900AK109694AGTTGGGCCCACAConserved hypothetical protein. 
Os03g0829000AK071107TTGTGGGCCATFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTGTGGGCCATNONE 
AK121596TTGTGGGCCATNONE 
J065045C17TTGTGGGCCATNONE 
J065068E23TTGTGGGCCATNONE 
J065083N15TTGTGGGCCATNONE 
J065166P10TTGTGGGCCATNONE 
J065189B13TTGTGGGCCATNONE 
J090082J08TTGTGGGCCATNONE 
J100030P13TTGTGGGCCATNONE 
Os03g0832600AK120137CGTGTGGGCCAGSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0833700011-060-A10GTGTGGGCCCACAGCCCAGCNONE 
AK121918GTGTGGGCCCACAGCCCAGCRNA 3'-terminal phosphate cyclase family protein. 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0837900AK068346ACCGGGCCCACACStreptomyces cyclase/dehydrase family protein. 
Os03g0843500AK067985TACGGCCCACANONE 
AK101661TACGGCCCACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454TACGGCCCACANONE 
J080302L23TACGGCCCACANONE 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os03g0851900AK102145TAGGCCCACAAAFG1-like ATPase family protein. 
J033086B08TAGGCCCACAANONE 
Os03g0852000009-105-G08TGTGGGCCACNONE 
AK063830TGTGGGCCACNONE 
AK100922TGTGGGCCACConserved hypothetical protein. 
J023133O06TGTGGGCCACNONE 
Os04g0103200003-106-F06CAAGGCCCACANONE 
015-058-G03CAAGGCCCACANONE 
AK060850CAAGGCCCACANONE 
AK066032CAAGGCCCACAProteasome component region PCI domain containing protein. 
J013046D12CAAGGCCCACANONE 
J013088L18CAAGGCCCACANONE 
J013093J06CAAGGCCCACANONE 
J013111I01CAAGGCCCACANONE 
J013120B15CAAGGCCCACANONE 
J013149K17CAAGGCCCACANONE 
J023010J08CAAGGCCCACANONE 
J023034J10CAAGGCCCACANONE 
J023055D05CAAGGCCCACANONE 
J033023L03CAAGGCCCACANONE 
J033025N21CAAGGCCCACANONE 
J033026A19CAAGGCCCACANONE 
J033026M14CAAGGCCCACANONE 
J033046J22CAAGGCCCACANONE 
J033052H11CAAGGCCCACANONE 
J033058P05CAAGGCCCACANONE 
J033064A11CAAGGCCCACANONE 
J033067K11CAAGGCCCACANONE 
J033076H02CAAGGCCCACANONE 
J033094E04CAAGGCCCACANONE 
J033106A02CAAGGCCCACANONE 
J033108N14CAAGGCCCACANONE 
J033114I06CAAGGCCCACANONE 
J033118H18CAAGGCCCACANONE 
J033148C05CAAGGCCCACANONE 
J043010I24CAAGGCCCACANONE 
J043037C07CAAGGCCCACANONE 
J053025M02CAAGGCCCACANONE 
J053026N08CAAGGCCCACANONE 
J053027O14CAAGGCCCACANONE 
J065038N11CAAGGCCCACANONE 
J065219C03CAAGGCCCACANONE 
J090011F14CAAGGCCCACANONE 
J090027C03CAAGGCCCACANONE 
J090067M19CAAGGCCCACANONE 
J090069C17CAAGGCCCACANONE 
J090070P21CAAGGCCCACANONE 
J090075N11CAAGGCCCACANONE 
J090095C22CAAGGCCCACANONE 
J100027O14CAAGGCCCACANONE 
J100055E01CAAGGCCCACANONE 
Os04g0175000AK101746AGGGCCCACAConserved hypothetical protein. 
Os04g0218600009-123-A05GTGTGGGCCGTCNONE 
AK062873GTGTGGGCCGTCNONE 
AK103472GTGTGGGCCGTCConserved hypothetical protein. 
J090077A20GTGTGGGCCGTCNONE 
Os04g0231800AK068417CCTGGGCCCACANONE 
J013153L19CCTGGGCCCACANONE 
J065020J04CCTGGGCCCACANONE 
J065201K08CCTGGGCCCACANONE 
J065214C10CCTGGGCCCACANONE 
Os04g0244800009-066-G06CGTGTGGGCCCCANONE 
011-024-D02CGTGTGGGCCCCANONE 
AK121488CGTGTGGGCCCCAHeavy metal transport/detoxification protein domain containing protein. 
J023095P14CGTGTGGGCCCCANONE 
J023150J09CGTGTGGGCCCCANONE 
J053097G24CGTGTGGGCCCCANONE 
J065001K24CGTGTGGGCCCCANONE 
J065009O13CGTGTGGGCCCCANONE 
J065076M12CGTGTGGGCCCCANONE 
J065081I15CGTGTGGGCCCCANONE 
J065105E10CGTGTGGGCCCCANONE 
J065106G04CGTGTGGGCCCCANONE 
J065123I12CGTGTGGGCCCCANONE 
J065137H16CGTGTGGGCCCCANONE 
J065151I11CGTGTGGGCCCCANONE 
J065164H06CGTGTGGGCCCCANONE 
J065173J07CGTGTGGGCCCCANONE 
J065196F02CGTGTGGGCCCCANONE 
J065198I17CGTGTGGGCCCCANONE 
J065206I11CGTGTGGGCCCCANONE 
J065216J02CGTGTGGGCCCCANONE 
J075076D10CGTGTGGGCCCCANONE 
J075098F06CGTGTGGGCCCCANONE 
J075115A20CGTGTGGGCCCCANONE 
J075184H05CGTGTGGGCCCCANONE 
J075193E17CGTGTGGGCCCCANONE 
J090014L09CGTGTGGGCCCCANONE 
J090015H16CGTGTGGGCCCCANONE 
J090024M04CGTGTGGGCCCCANONE 
J090062K08CGTGTGGGCCCCANONE 
J090082I08CGTGTGGGCCCCANONE 
Os04g0390000AK067777TGTGGGCCCCCACNONE 
AK068713TGTGGGCCCCCACNONE 
AK098921TGTGGGCCCCCACSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0408900009-183-E05TGTGGGGCCCACANONE 
AK058627TGTGGGGCCCACASimilar to DNA-binding protein S1FA. 
J023014N01TGTGGGGCCCACANONE 
J023088K23TGTGGGGCCCACANONE 
J065086B17TGTGGGGCCCACANONE 
J065095F08TGTGGGGCCCACANONE 
J065119N11TGTGGGGCCCACANONE 
J100032H17TGTGGGGCCCACANONE 
Os04g0412900AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
J033027C24TGTGGGCCCCACCACNONE 
J033044C16TGTGGGCCCCACCACNONE 
J090023G03TGTGGGCCCCACCACNONE 
J090082C21TGTGGGCCCCACCACNONE 
Os04g0418000006-025-C05CAGGCCCACANONE 
006-025-D11CAGGCCCACANONE 
006-045-F02CAGGCCCACANONE 
006-060-B04CAGGCCCACANONE 
006-063-E03CAGGCCCACANONE 
006-070-G08CAGGCCCACANONE 
006-072-H05CAGGCCCACANONE 
AK061030CAGGCCCACANONE 
AK099124CAGGCCCACANONE 
AK106155CAGGCCCACAConserved hypothetical protein. 
AK119714CAGGCCCACANONE 
J023039I07CAGGCCCACANONE 
J065025N03CAGGCCCACANONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0462500006-073-E08TGTGGGCCCCACCNONE 
AK062065TGTGGGCCCCACCNONE 
AK071311TGTGGGCCCCACCSimilar to 14-3-3-like protein GF14-6. 
AK071822TGTGGGCCCCACCNONE 
AK099243TGTGGGCCCCACCNONE 
AK101938TGTGGGCCCCACCNONE 
J013056F02TGTGGGCCCCACCNONE 
J023020E08TGTGGGCCCCACCNONE 
J023085B16TGTGGGCCCCACCNONE 
J023117D08TGTGGGCCCCACCNONE 
J023133K12TGTGGGCCCCACCNONE 
J033025G04TGTGGGCCCCACCNONE 
J033052A15TGTGGGCCCCACCNONE 
J033074G16TGTGGGCCCCACCNONE 
J033090A16TGTGGGCCCCACCNONE 
J033122A07TGTGGGCCCCACCNONE 
J033133G09TGTGGGCCCCACCNONE 
J065002F16TGTGGGCCCCACCNONE 
J065030M09TGTGGGCCCCACCNONE 
J065056B11TGTGGGCCCCACCNONE 
J065115I10TGTGGGCCCCACCNONE 
J065120O09TGTGGGCCCCACCNONE 
J065124G21TGTGGGCCCCACCNONE 
J075031C14TGTGGGCCCCACCNONE 
J075040H07TGTGGGCCCCACCNONE 
J075047F04TGTGGGCCCCACCNONE 
J075065F14TGTGGGCCCCACCNONE 
J075066G20TGTGGGCCCCACCNONE 
J075105D01TGTGGGCCCCACCNONE 
J075147B04TGTGGGCCCCACCNONE 
J075149A12TGTGGGCCCCACCNONE 
J075172D07TGTGGGCCCCACCNONE 
J075190J11TGTGGGCCCCACCNONE 
J090038H18TGTGGGCCCCACCNONE 
J090087G05TGTGGGCCCCACCNONE 
J100025A10TGTGGGCCCCACCNONE 
J100025O10TGTGGGCCCCACCNONE 
J100027D02TGTGGGCCCCACCNONE 
J100027P06TGTGGGCCCCACCNONE 
J100032K04TGTGGGCCCCACCNONE 
J100056D21TGTGGGCCCCACCNONE 
J100060J08TGTGGGCCCCACCNONE 
J100063N19TGTGGGCCCCACCNONE 
J100064C14TGTGGGCCCCACCNONE 
J100064K18TGTGGGCCCCACCNONE 
J100070L21TGTGGGCCCCACCNONE 
J100072M17TGTGGGCCCCACCNONE 
J100074F21TGTGGGCCCCACCNONE 
J100087E05TGTGGGCCCCACCNONE 
U65956TGTGGGCCCCACCNONE 
Os04g0490000AK108365TTGTGGGCCGTASimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0497600AK059415TCAGGCCCACALupus La protein family protein. 
AK099054TCAGGCCCACANONE 
J013121K15TCAGGCCCACANONE 
J013149O10TCAGGCCCACANONE 
J023112H08TCAGGCCCACANONE 
J033050F07TCAGGCCCACANONE 
Os04g0503500AK099404CGGGCCCACAALeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CGGGCCCACAANONE 
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein. 
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein. 
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein. 
Os04g0550200AK108473CTGGCCCACAAPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0577500006-039-C03CCCGGCCCACAANONE 
006-043-H01CCCGGCCCACAANONE 
AK061538CCCGGCCCACAANONE 
AK065648CCCGGCCCACAATatD-related deoxyribonuclease family protein. 
AK104763CCCGGCCCACAANONE 
J013035E21CCCGGCCCACAANONE 
J013066M11CCCGGCCCACAANONE 
J100026B02CCCGGCCCACAANONE 
Os04g0602800AK100925TATGGGCCCACASimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0606800009-159-H11AGATGGGCCCACATGTCAGTGNONE 
009-159-H11GTGGGGCCCACAAGTCAGTGGNONE 
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein. 
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein. 
J033070J06AGATGGGCCCACATGTCAGTGNONE 
J033070J06GTGGGGCCCACAAGTCAGTGGNONE 
J033119D03AGATGGGCCCACATGTCAGTGNONE 
J033119D03GTGGGGCCCACAAGTCAGTGGNONE 
J100043F05AGATGGGCCCACATGTCAGTGNONE 
J100043F05GTGGGGCCCACAAGTCAGTGGNONE 
J100050A01AGATGGGCCCACATGTCAGTGNONE 
J100050A01GTGGGGCCCACAAGTCAGTGGNONE 
Os04g0650200AK072573TTCGGCCCACANONE 
AK109786TTCGGCCCACALipolytic enzyme, G-D-S-L family protein. 
Os04g0658600AK064729TGTGGGCCGGCNONE 
AK119253TGTGGGCCGGCNucleolar, Nop52 family protein. 
J075132J07TGTGGGCCGGCNONE 
J075157N21TGTGGGCCGGCNONE 
Os04g0660600009-113-A11TTGTGGGCCCAAACNONE 
AK120899TTGTGGGCCCAAACATPase, V0 complex, subunit H family protein. 
J023030J05TTGTGGGCCCAAACNONE 
J065068M07TTGTGGGCCCAAACNONE 
J065120G22TTGTGGGCCCAAACNONE 
J065168J18TTGTGGGCCCAAACNONE 
J065211M10TTGTGGGCCCAAACNONE 
J075175E21TTGTGGGCCCAAACNONE 
J090021C06TTGTGGGCCCAAACNONE 
J090032P15TTGTGGGCCCAAACNONE 
J090082E05TTGTGGGCCCAAACNONE 
J100090O11TTGTGGGCCCAAACNONE 
Os04g0661300AK070723CCCACGGGGCCCACACConserved hypothetical protein. 
AK103942CCCACGGGGCCCACACNONE 
Os04g0667000AK069874CCATGGGCGGCCCACATafazzin family protein. 
J100055P09CCATGGGCGGCCCACANONE 
J100057O12CCATGGGCGGCCCACANONE 
J100067H07CCATGGGCGGCCCACANONE 
J100070D06CCATGGGCGGCCCACANONE 
J100071J16CCATGGGCGGCCCACANONE 
J100072C15CCATGGGCGGCCCACANONE 
Os04g0673300006-055-C10CGTGTGGGTGTGGGCCCCACCCGNONE 
AK059734CGTGTGGGTGTGGGCCCCACCCGSimilar to ZmRR2 protein (Response regulator 2). 
J065006D12CGTGTGGGTGTGGGCCCCACCCGNONE 
J065218N11CGTGTGGGTGTGGGCCCCACCCGNONE 
Os04g0682300AK061384TTGTGGGCCGGTSimilar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2). 
AK104004TTGTGGGCCGGTNONE 
J033102P12TTGTGGGCCGGTNONE 
J100038F01TTGTGGGCCGGTNONE 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os05g0110300AK067116TCCGGCCCACANONE 
AK071038TCCGGCCCACANAD-dependent epimerase/dehydratase family protein. 
J065060E20TCCGGCCCACANONE 
J065093K05TCCGGCCCACANONE 
Os05g0110700AK102486AAGGCCCACACKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12AAGGCCCACACNONE 
Os05g0113000AK067079TGTGGGCCCCACCTGAmino acid-binding ACT domain containing protein. 
Os05g0121000009-181-E02TTGTGGGCCTTNONE 
AK058867TTGTGGGCCTTNONE 
AK071341TTGTGGGCCTTProtein of unknown function DUF1218 family protein. 
J023024H24TTGTGGGCCTTNONE 
J023090B22TTGTGGGCCTTNONE 
J023111G15TTGTGGGCCTTNONE 
J023134K14TTGTGGGCCTTNONE 
J033057C05TTGTGGGCCTTNONE 
J033067J15TTGTGGGCCTTNONE 
J033084L15TTGTGGGCCTTNONE 
J033088B04TTGTGGGCCTTNONE 
J043027A08TTGTGGGCCTTNONE 
J043029L03TTGTGGGCCTTNONE 
J053031K22TTGTGGGCCTTNONE 
J053046I01TTGTGGGCCTTNONE 
J053070B05TTGTGGGCCTTNONE 
J053072C10TTGTGGGCCTTNONE 
J065097M22TTGTGGGCCTTNONE 
J065164I17TTGTGGGCCTTNONE 
J075058I08TTGTGGGCCTTNONE 
J075064C09TTGTGGGCCTTNONE 
J080304C16TTGTGGGCCTTNONE 
J080304H16TTGTGGGCCTTNONE 
J080306E17TTGTGGGCCTTNONE 
J080310L03TTGTGGGCCTTNONE 
J080316J07TTGTGGGCCTTNONE 
J080317L23TTGTGGGCCTTNONE 
J080319A10TTGTGGGCCTTNONE 
J090060F01TTGTGGGCCTTNONE 
J100042N16TTGTGGGCCTTNONE 
J100047F05TTGTGGGCCTTNONE 
J100075J19TTGTGGGCCTTNONE 
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor. 
D12777CCACTGACATGTGGGCCCCACCTGNONE 
J013002F13CCACTGACATGTGGGCCCCACCTGNONE 
J013029I15CCACTGACATGTGGGCCCCACCTGNONE 
J013033A10CCACTGACATGTGGGCCCCACCTGNONE 
J013035H24CCACTGACATGTGGGCCCCACCTGNONE 
J013051H21CCACTGACATGTGGGCCCCACCTGNONE 
J013098H05CCACTGACATGTGGGCCCCACCTGNONE 
J023060B04CCACTGACATGTGGGCCCCACCTGNONE 
J023130D23CCACTGACATGTGGGCCCCACCTGNONE 
J033140N08CCACTGACATGTGGGCCCCACCTGNONE 
J053039L22CCACTGACATGTGGGCCCCACCTGNONE 
J080007K21CCACTGACATGTGGGCCCCACCTGNONE 
Os05g0139200AK108058TGCGGCCCACATGGGTCCCACCyclin-like F-box domain containing protein. 
Os05g0150600011-043-D06CCACTGACAGCGTGGGCCCACANONE 
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein. 
AY180331CCACTGACAGCGTGGGCCCACANONE 
J090053A16CCACTGACAGCGTGGGCCCACANONE 
Os05g0164100AF456329CGTGTGGGCCCCACGNONE 
AK065086CGTGTGGGCCCCACGNONE 
AK072243CGTGTGGGCCCCACGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CGTGTGGGCCCCACGNONE 
J013132O12CGTGTGGGCCCCACGNONE 
J023003N09CGTGTGGGCCCCACGNONE 
Os05g0182700003-102-E07CCACTGACATGTGGGCCCAACTNONE 
003-102-E07TTGTGGGCCGAGATNONE 
011-019-D04CCACTGACATGTGGGCCCAACTNONE 
011-019-D04TTGTGGGCCGAGATNONE 
013-068-D09CCACTGACATGTGGGCCCAACTNONE 
013-068-D09TTGTGGGCCGAGATNONE 
014-032-G03CCACTGACATGTGGGCCCAACTNONE 
014-032-G03TTGTGGGCCGAGATNONE 
AK065911CCACTGACATGTGGGCCCAACTProtein of unknown function DUF1664 family protein. 
AK065911TTGTGGGCCGAGATProtein of unknown function DUF1664 family protein. 
AK104343CCACTGACATGTGGGCCCAACTNONE 
AK104343TTGTGGGCCGAGATNONE 
J013045E01CCACTGACATGTGGGCCCAACTNONE 
J013045E01TTGTGGGCCGAGATNONE 
J013156L15CCACTGACATGTGGGCCCAACTNONE 
J013156L15TTGTGGGCCGAGATNONE 
J023029P17CCACTGACATGTGGGCCCAACTNONE 
J023029P17TTGTGGGCCGAGATNONE 
J023134I24CCACTGACATGTGGGCCCAACTNONE 
J023134I24TTGTGGGCCGAGATNONE 
J033099A10CCACTGACATGTGGGCCCAACTNONE 
J033099A10TTGTGGGCCGAGATNONE 
J033115L16CCACTGACATGTGGGCCCAACTNONE 
J033115L16TTGTGGGCCGAGATNONE 
J090007M24CCACTGACATGTGGGCCCAACTNONE 
J090007M24TTGTGGGCCGAGATNONE 
J090019F02CCACTGACATGTGGGCCCAACTNONE 
J090019F02TTGTGGGCCGAGATNONE 
Os05g0195200015-031-H09TGTGGGCCCCCACNONE 
015-070-C11TGTGGGCCCCCACNONE 
016-063-C11TGTGGGCCCCCACNONE 
AK106392TGTGGGCCCCCACZinc finger, CCCH-type domain containing protein. 
J033051N05TGTGGGCCCCCACNONE 
J065118P05TGTGGGCCCCCACNONE 
J100071H15TGTGGGCCCCCACNONE 
J100078J22TGTGGGCCCCCACNONE 
Os05g0198000J080004C03TGTGGGCCCCACProtein of unknown function DUF247, plant family protein. 
J080004M24TGTGGGCCCCACNONE 
J080004O15TGTGGGCCCCACNONE 
J080006E14TGTGGGCCCCACNONE 
J080006I07TGTGGGCCCCACNONE 
J080007N13TGTGGGCCCCACNONE 
J080009C21TGTGGGCCCCACNONE 
J080009L03TGTGGGCCCCACNONE 
J080010F10TGTGGGCCCCACNONE 
J080015H04TGTGGGCCCCACNONE 
J080015L04TGTGGGCCCCACNONE 
J080018C21TGTGGGCCCCACNONE 
J080022M22TGTGGGCCCCACNONE 
J080027O19TGTGGGCCCCACNONE 
J080030I07TGTGGGCCCCACNONE 
J080037P07TGTGGGCCCCACNONE 
J080044C18TGTGGGCCCCACNONE 
J080049F14TGTGGGCCCCACNONE 
J080050F04TGTGGGCCCCACNONE 
J080052B18TGTGGGCCCCACNONE 
J080081B11TGTGGGCCCCACNONE 
J080083G12TGTGGGCCCCACNONE 
J080086A11TGTGGGCCCCACNONE 
J080087C06TGTGGGCCCCACNONE 
J080088E06TGTGGGCCCCACNONE 
J080091O21TGTGGGCCCCACNONE 
J080094N23TGTGGGCCCCACNONE 
Os05g0214100AK100400TGTGGGCCCTSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
AK100400TGTGGGCCTASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
AK107105TGTGGGCCCTNONE 
AK107105TGTGGGCCTANONE 
J013073B12TGTGGGCCCTNONE 
J013073B12TGTGGGCCTANONE 
J013093B07TGTGGGCCCTNONE 
J013093B07TGTGGGCCTANONE 
J023086N14TGTGGGCCCTNONE 
J023086N14TGTGGGCCTANONE 
J065143B06TGTGGGCCCTNONE 
J065143B06TGTGGGCCTANONE 
J090009B02TGTGGGCCCTNONE 
J090009B02TGTGGGCCTANONE 
J090075A13TGTGGGCCCTNONE 
J090075A13TGTGGGCCTANONE 
Os05g0320700AK100598TGTGGGCCCCACATCCCCCACACSimilar to Cytochrome P450. 
AK104994TGTGGGCCCCACATCCCCCACACNONE 
Os05g0342100AK111106TGTGGGCCCCACCWound-induced WI12 family protein. 
Os05g0395600Os05g0395600TGTGGGCCGGANONE 
Os05g0411300014-098-D05TTGTGGGCCCAGATNONE 
015-093-F04TTGTGGGCCCAGATNONE 
AK071931TTGTGGGCCCAGATConserved hypothetical protein. 
AK073142TTGTGGGCCCAGATNONE 
Os05g0412300AK107782GTGTGGGCCCTHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os05g0415600AK065818GTGGCCCACAAACTGGGCCCTNONE 
J013042K21GTGGCCCACAAACTGGGCCCTNONE 
J013114E15GTGGCCCACAAACTGGGCCCTNONE 
J013131H02GTGGCCCACAAACTGGGCCCTNONE 
J023041G06GTGGCCCACAAACTGGGCCCTNONE 
J100037M21GTGGCCCACAAACTGGGCCCTNONE 
Os05g0424700AK107848TGTGGGCCATSimilar to Copper transporter 1. 
Os05g0429700AK069203GTGGCCCACANONE 
AK103559GTGGCCCACAC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0437800015-045-B10CCAGGCCCGGCCCACANONE 
AK106328CCAGGCCCGGCCCACAConserved hypothetical protein. 
Os05g0456000AK058420ATGGCCCACAMitochondrial glycoprotein family protein. 
AK102036ATGGCCCACANONE 
J065066F02ATGGCCCACANONE 
Os05g0470800011-027-A06TTGTGGGCCTCNONE 
AK069780TTGTGGGCCTCBacterial surface antigen (D15) family protein. 
J023007A20TTGTGGGCCTCNONE 
J023028F19TTGTGGGCCTCNONE 
J023081E20TTGTGGGCCTCNONE 
J023089D13TTGTGGGCCTCNONE 
J023115D18TTGTGGGCCTCNONE 
J033087E22TTGTGGGCCTCNONE 
J033143O14TTGTGGGCCTCNONE 
Os05g0473300AK102559TGTGGGCCCCACGCCTCNONE 
AK103822TGTGGGCCCCACGCCTCNONE 
AK109855TGTGGGCCCCACGCCTCSimilar to Ethylene response factor 1. 
Os05g0488900AK071883TGCGGCCCACACSimilar to Cytochrome b5 reductase. 
AK073699TGCGGCCCACACNONE 
AK105459TGCGGCCCACACNONE 
J080009C06TGCGGCCCACACNONE 
J080021N09TGCGGCCCACACNONE 
J080041K24TGCGGCCCACACNONE 
J080058H15TGCGGCCCACACNONE 
J080064P06TGCGGCCCACACNONE 
J080077B16TGCGGCCCACACNONE 
Os05g0494100AK068320GGTGGGGCCCACAAHistone-fold domain containing protein. 
Os05g0503000AK068335GCCGGCCCACACSimilar to Secretory carrier membrane protein. 
AK104049GCCGGCCCACACNONE 
J013149D04GCCGGCCCACACNONE 
J075085A06GCCGGCCCACACNONE 
Os05g0513400AK069309TGTGGGCCCTProtein of unknown function DUF803 family protein. 
AK069309TGTGGGCCTAProtein of unknown function DUF803 family protein. 
AK121638TGTGGGCCCTNONE 
AK121638TGTGGGCCTANONE 
Os05g0529300AK102648TGTGGGCCCTSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06AGGGCCCACANONE 
AK063846AGGGCCCACAConserved hypothetical protein. 
AK122038AGGGCCCACANONE 
J033113C01AGGGCCCACANONE 
Os05g0533600AK067577CACTGACATGTGGGCCGCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560CACTGACATGTGGGCCGCNONE 
AY373258CACTGACATGTGGGCCGCNONE 
Os05g0553700006-100-D08TGCGGCCCACANONE 
AK099747TGCGGCCCACANONE 
AK101606TGCGGCCCACANONE 
AK103396TGCGGCCCACASimilar to Syntaxin 71 (AtSYP71). 
J033022M23TGCGGCCCACANONE 
J090086G01TGCGGCCCACANONE 
Os05g0566500AK073468CGTGTGGGCCACNONE 
AK073468TGTGGGCCGGGCNONE 
AK099052CGTGTGGGCCACSimilar to Initiation factor 3d (Fragment). 
AK099052TGTGGGCCGGGCSimilar to Initiation factor 3d (Fragment). 
AK104093CGTGTGGGCCACNONE 
AK104093TGTGGGCCGGGCNONE 
J090025I18CGTGTGGGCCACNONE 
J090025I18TGTGGGCCGGGCNONE 
Os05g0577900016-028-C02CAGGCCCACANONE 
016-028-C02TGTGGGCCCATTTNONE 
016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201CAGGCCCACAConserved hypothetical protein. 
AK064201TGTGGGCCCATTTConserved hypothetical protein. 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
AK065040TGTGGGCCTGSimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013001H17TGTGGGCCTGNONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06TGTGGGCCTGNONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08TGTGGGCCTGNONE 
Os05g0592300AK068520TTCGGCCCACAProtein of unknown function DUF1637 family protein. 
Os05g0592400AB037144CAAGGCCCACACNONE 
AK065508CAAGGCCCACACUV-damaged DNA binding protein. 
J013069J24CAAGGCCCACACNONE 
J013075H15CAAGGCCCACACNONE 
J013095H04CAAGGCCCACACNONE 
J013105L19CAAGGCCCACACNONE 
J013152P13CAAGGCCCACACNONE 
J023072O05CAAGGCCCACACNONE 
J033024J22CAAGGCCCACACNONE 
J033030D07CAAGGCCCACACNONE 
J033041D09CAAGGCCCACACNONE 
J033051M16CAAGGCCCACACNONE 
J033126M01CAAGGCCCACACNONE 
J033145H24CAAGGCCCACACNONE 
Os05g0595300011-076-H02GGGGCCCACACGCCACNONE 
012-009-E07GGGGCCCACACGCCACNONE 
012-096-B01GGGGCCCACACGCCACNONE 
AK059614GGGGCCCACACGCCACNONE 
AK121601GGGGCCCACACGCCACSimilar to CONSTANS-like protein. 
J033040P21GGGGCCCACACGCCACNONE 
Os06g0102600J065187I04TTGTGGGCCCTHypothetical protein. 
Os06g0106100009-197-E09TGTGGGCCGGCNONE 
AK111784TGTGGGCCGGCCwf15/Cwc15 cell cycle control protein family protein. 
AK112060TGTGGGCCGGCNONE 
Os06g0113600016-067-E03TGTGGGCCGAAANONE 
AK062095TGTGGGCCGAAANONE 
AK101235TGTGGGCCGAAACyclin-like F-box domain containing protein. 
AK122025TGTGGGCCGAAANONE 
J013022O19TGTGGGCCGAAANONE 
J023045P05TGTGGGCCGAAANONE 
J033031K01TGTGGGCCGAAANONE 
J033034I09TGTGGGCCGAAANONE 
J033041O04TGTGGGCCGAAANONE 
J033071K03TGTGGGCCGAAANONE 
J033075K16TGTGGGCCGAAANONE 
J033097M01TGTGGGCCGAAANONE 
J033099M22TGTGGGCCGAAANONE 
J033108N15TGTGGGCCGAAANONE 
J033121D18TGTGGGCCGAAANONE 
J033125O06TGTGGGCCGAAANONE 
J033139M16TGTGGGCCGAAANONE 
J033145P18TGTGGGCCGAAANONE 
J033149D05TGTGGGCCGAAANONE 
Os06g0114600015-077-E06AGTTGGGCCCACACNONE 
AK067972AGTTGGGCCCACACConserved hypothetical protein. 
Os06g0115200J100029D05CCACTGACATGTGGGCCCCACGNONE 
J100029D05TGTGGGCCCGNONE 
J100029D05TGTGGGGCCCACACNONE 
J100048P05CCACTGACATGTGGGCCCCACGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
J100048P05TGTGGGCCCGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
J100048P05TGTGGGGCCCACACQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0129000Os06g0129000TGTGGGCCTAConserved hypothetical protein. 
Os06g0136600AK069316CACTGACATGTGGGCCCTSimilar to Enolase 1 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 1) (2-phospho- D-glycerate hydro-lyase 1). 
J075010L23CACTGACATGTGGGCCCTNONE 
Os06g0144000AK068998TGTGGGCCCACGTGBRCT domain containing protein. 
J023001F16TGTGGGCCCACGTGNONE 
Os06g0168000AK059250TGTGGGCCGGANONE 
AK099356TGTGGGCCGGAGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19TGTGGGCCGGANONE 
J033097H04TGTGGGCCGGANONE 
J075087M11TGTGGGCCGGANONE 
J075146H06TGTGGGCCGGANONE 
J075188H11TGTGGGCCGGANONE 
J090071D03TGTGGGCCGGANONE 
J090097L20TGTGGGCCGGANONE 
J100051M05TGTGGGCCGGANONE 
J100082H13TGTGGGCCGGANONE 
Os06g0168600AK068858AGGGCCCACASimilar to Ribonucleotide reductase. 
Os06g0194200AK111269TGTGGGCCGCAConserved hypothetical protein. 
J090084F15TGTGGGCCGCANONE 
Os06g0199300J065045H01CACTGACATGTGGGCCCTNONE 
J075177C22CACTGACATGTGGGCCCTNONE 
J080068H06CACTGACATGTGGGCCCTNONE 
J090048F01CACTGACATGTGGGCCCTNONE 
J100066F17CACTGACATGTGGGCCCTNONE 
Os06g0215200AK065717GCGGGCCCACAZinc finger, U1-type domain containing protein. 
AK072439GCGGGCCCACANONE 
J013038O15GCGGGCCCACANONE 
J013075B08GCGGGCCCACANONE 
J013169N19GCGGGCCCACANONE 
J023034P11GCGGGCCCACANONE 
J023111C14GCGGGCCCACANONE 
J043013M01GCGGGCCCACANONE 
J043015L12GCGGGCCCACANONE 
J090011M08GCGGGCCCACANONE 
J090047D24GCGGGCCCACANONE 
J090056M10GCGGGCCCACANONE 
J090075G18GCGGGCCCACANONE 
J090079G14GCGGGCCCACANONE 
J100055M21GCGGGCCCACANONE 
J100058H23GCGGGCCCACANONE 
J100090A01GCGGGCCCACANONE 
J100090I21GCGGGCCCACANONE 
Os06g0216800AK068112GAGGCCCACASimilar to Cyclophilin-40 (Expressed protein). 
J013134M21GAGGCCCACANONE 
J033127L12GAGGCCCACANONE 
J090060B08GAGGCCCACANONE 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK099019CAACGGCCCACAGCCCACGGNONE 
J013118A14CAACGGCCCACAGCCCACGGNONE 
Os06g0226500009-030-E06TGTGGGCCCGGCCCNONE 
AK071601TGTGGGCCCGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J023102C01TGTGGGCCCGGCCCNONE 
Os06g0236200J075111M01ACCGGCCCACACConserved hypothetical protein. 
J075171D01ACCGGCCCACACNONE 
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein. 
Os06g0308300AK059211TGGGGCCCACACGNONE 
AK101549TGGGGCCCACACGNONE 
AK102553TGGGGCCCACACGSimilar to 65kD microtubule associated protein. 
J090014G18TGGGGCCCACACGNONE 
J090082B01TGGGGCCCACACGNONE 
Os06g0318300004-006-E12TGTGGGCCAGNONE 
014-001-H07TGTGGGCCAGNONE 
AK060873TGTGGGCCAGNONE 
AK065671TGTGGGCCAGSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1). 
AY364312TGTGGGCCAGNONE 
J013041C14TGTGGGCCAGNONE 
J065180A18TGTGGGCCAGNONE 
J075013P16TGTGGGCCAGNONE 
Os06g0329350009-021-B05TGGATGGGCCCACANONE 
009-043-A04TGGATGGGCCCACANONE 
009-051-G06TGGATGGGCCCACANONE 
009-107-D02TGGATGGGCCCACANONE 
009-111-B11TGGATGGGCCCACANONE 
009-118-B02TGGATGGGCCCACANONE 
009-132-A11TGGATGGGCCCACANONE 
009-186-B06TGGATGGGCCCACANONE 
J065044N12TGGATGGGCCCACANONE 
J065097L15TGGATGGGCCCACANONE 
J065219N02TGGATGGGCCCACANONE 
J080009E03TGGATGGGCCCACANONE 
J080020P03TGGATGGGCCCACANONE 
J080024O15TGGATGGGCCCACANONE 
J080030B22TGGATGGGCCCACANONE 
J080032G04TGGATGGGCCCACANONE 
J080045B12TGGATGGGCCCACANONE 
J080048M05TGGATGGGCCCACANONE 
J080051M16TGGATGGGCCCACANONE 
J080053K12TGGATGGGCCCACANONE 
J080056G17TGGATGGGCCCACANONE 
J080068O22TGGATGGGCCCACANONE 
J080074K04TGGATGGGCCCACANONE 
J080075B20TGGATGGGCCCACANONE 
J080077I03TGGATGGGCCCACANONE 
J080081E17TGGATGGGCCCACANONE 
J080082B08TGGATGGGCCCACANONE 
J080084I03TGGATGGGCCCACANONE 
J080092F08TGGATGGGCCCACANONE 
J090086C01TGGATGGGCCCACAConserved hypothetical protein. 
Os06g0505700009-010-E06CCTGGGCCCACANONE 
AK121505CCTGGGCCCACAHypothetical protein. 
J033022N03CCTGGGCCCACANONE 
Os06g0515400AK071571TTGTGGGCCTGAConserved hypothetical protein. 
Os06g0526100Os06g0526100TGGTGGGCCCACACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0551400009-003-D11CCCACCCGGCCCGGCCCACANONE 
011-025-C09CCCACCCGGCCCGGCCCACANONE 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
D13758CCCACCCGGCCCGGCCCACANONE 
J013069H14CCCACCCGGCCCGGCCCACANONE 
J053037J07CCCACCCGGCCCGGCCCACANONE 
J065011J03CCCACCCGGCCCGGCCCACANONE 
J065078L15CCCACCCGGCCCGGCCCACANONE 
J065103H24CCCACCCGGCCCGGCCCACANONE 
J065157A07CCCACCCGGCCCGGCCCACANONE 
J065213P12CCCACCCGGCCCGGCCCACANONE 
J090007P04CCCACCCGGCCCGGCCCACANONE 
J090052N23CCCACCCGGCCCGGCCCACANONE 
Os06g0557100AK111851CGTGGGGCCCACACProtein kinase-like domain containing protein. 
AK119892CGTGGGGCCCACACNONE 
J023150C23CGTGGGGCCCACACNONE 
J033108M17CGTGGGGCCCACACNONE 
J065062L01CGTGGGGCCCACACNONE 
J065161G20CGTGGGGCCCACACNONE 
J090062G13CGTGGGGCCCACACNONE 
J090087H11CGTGGGGCCCACACNONE 
J100055H23CGTGGGGCCCACACNONE 
J100063G05CGTGGGGCCCACACNONE 
Os06g0562700AK109753GGCCCACAConserved hypothetical protein. 
Os06g0574200Os06g0574200GTGGGTCCCACACGTGTGGGCCCACCCCCACACAGCCGTTGUspA domain containing protein. 
Os06g0587300AK069419CACTGACATGTGGGCCCCACAConserved hypothetical protein. 
AK069419TGTTGGGCCCACAConserved hypothetical protein. 
AK121885CACTGACATGTGGGCCCCACANONE 
AK121885TGTTGGGCCCACANONE 
Os06g0598900AK100386GCGGCCCACACSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05GCGGCCCACACNONE 
J090043L20GCGGCCCACACNONE 
Os06g0608500AK060097CTGGCCCACAANONE 
AK070667CTGGCCCACAASnf7 family protein. 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTGGCCCAAAAGGCCCACANONE 
J065100L18TCTGGCCCAAAAGGCCCACANONE 
J065129N15TCTGGCCCAAAAGGCCCACANONE 
J065152M08TCTGGCCCAAAAGGCCCACANONE 
J065198M12TCTGGCCCAAAAGGCCCACANONE 
J090077J22TCTGGCCCAAAAGGCCCACANONE 
J100024G23TCTGGCCCAAAAGGCCCACANONE 
J100027L01TCTGGCCCAAAAGGCCCACANONE 
J100047C06TCTGGCCCAAAAGGCCCACANONE 
J100055D01TCTGGCCCAAAAGGCCCACANONE 
J100067M05TCTGGCCCAAAAGGCCCACANONE 
J100077M16TCTGGCCCAAAAGGCCCACANONE 
J100078M22TCTGGCCCAAAAGGCCCACANONE 
Os06g0647100009-005-F12GCGGCCCACANONE 
009-113-D11GCGGCCCACANONE 
009-132-D09GCGGCCCACANONE 
009-147-G06GCGGCCCACANONE 
AK066837GCGGCCCACASimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
J065073M03GCGGCCCACANONE 
Os06g0647400AK068457TGTGGGCCCGSimilar to Lysosomal Pro-X carboxypeptidase. 
AK103281TGTGGGCCCGNONE 
J013151A14TGTGGGCCCGNONE 
Os06g0649500AK072591CTCGGCCCACAWD40-like domain containing protein. 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0731900AK064258TGTGGGCCCACAProtein of unknown function DUF707 family protein. 
AK073333TGTGGGCCCACANONE 
Os07g0123000AK070836GCCCATTAGGCCCACAACyclin-like F-box domain containing protein. 
Os07g0124100014-015-G11GCGGGCCCACACNONE 
AJ276693GCGGGCCCACACPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GCGGGCCCACACNONE 
Os07g0133500015-010-H05GGGGCCCACANONE 
AB110179GGGGCCCACANONE 
AK106244GGGGCCCACAProtein of unknown function DUF1005 family protein. 
J090075I21GGGGCCCACANONE 
Os07g0142000AK059877ACCGGGCCCACAReticulon family protein. 
AK099414ACCGGGCCCACANONE 
Os07g0159800009-100-A07CCCGGGCCCACACGNONE 
009-140-B04CCCGGGCCCACACGNONE 
AK059284CCCGGGCCCACACGNONE 
AK060475CCCGGGCCCACACGE1 protein and Def2/Der2 allergen family protein. 
J023054H06CCCGGGCCCACACGNONE 
J023083L17CCCGGGCCCACACGNONE 
J043005N13CCCGGGCCCACACGNONE 
J065164K01CCCGGGCCCACACGNONE 
J065192C18CCCGGGCCCACACGNONE 
J090058G23CCCGGGCCCACACGNONE 
J100017G10CCCGGGCCCACACGNONE 
J100081F12CCCGGGCCCACACGNONE 
Os07g0168600AK068262TGTGGGCCCCACSimilar to 3-glucanase. 
AK105668TGTGGGCCCCACNONE 
Os07g0173200AK061624CGGGCCCACAFrigida-like family protein. 
AK065275CGGGCCCACANONE 
AK098856CGGGCCCACANONE 
AK098899CGGGCCCACANONE 
Os07g0181800AK121080TGTGGGCCCCACTTGTCTGGCCCConserved hypothetical protein. 
J023063D04TGTGGGCCCCACTTGTCTGGCCCNONE 
J033084A07TGTGGGCCCCACTTGTCTGGCCCNONE 
J075013C04TGTGGGCCCCACTTGTCTGGCCCNONE 
J075027H13TGTGGGCCCCACTTGTCTGGCCCNONE 
J075045P19TGTGGGCCCCACTTGTCTGGCCCNONE 
J090042L13TGTGGGCCCCACTTGTCTGGCCCNONE 
J090098E10TGTGGGCCCCACTTGTCTGGCCCNONE 
Os07g0182100AK066734TGTGGGCCCACCANONE 
AK104002TGTGGGCCCACCASimilar to Tryptophan synthase alpha chain. 
Os07g0202400009-155-C12TAGGCCCACANONE 
AK063024TAGGCCCACAConserved hypothetical protein. 
Os07g0256200AK072904GCCCGGCCCACAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCCCGGCCCACAANONE 
Os07g0289800J080305A01GTGTGGGCCGGGConserved hypothetical protein. 
Os07g0418000AK060294GAGGCCCACANONE 
AK065942GAGGCCCACAConserved hypothetical protein. 
AK105006GAGGCCCACANONE 
J013047M02GAGGCCCACANONE 
J023074D13GAGGCCCACANONE 
J053045I08GAGGCCCACANONE 
J075048C07GAGGCCCACANONE 
Os07g0435100AB037153TTATGGGCCCACANONE 
AK061383TTATGGGCCCACASimilar to 26S proteasome subunit RPN12. 
AK061408TTATGGGCCCACANONE 
AK101316TTATGGGCCCACANONE 
J023133D07TTATGGGCCCACANONE 
J023136B17TTATGGGCCCACANONE 
J033065M08TTATGGGCCCACANONE 
J033070F05TTATGGGCCCACANONE 
J033070L20TTATGGGCCCACANONE 
J033108J15TTATGGGCCCACANONE 
J053080M19TTATGGGCCCACANONE 
J053091B15TTATGGGCCCACANONE 
J065067J03TTATGGGCCCACANONE 
J065102C02TTATGGGCCCACANONE 
J065135H09TTATGGGCCCACANONE 
J080302K03TTATGGGCCCACANONE 
J090059J11TTATGGGCCCACANONE 
J090074G14TTATGGGCCCACANONE 
J100025F20TTATGGGCCCACANONE 
J100028L08TTATGGGCCCACANONE 
J100049L14TTATGGGCCCACANONE 
J100054O07TTATGGGCCCACANONE 
Os07g0474300AK108961CTGGGGCCCACAConserved hypothetical protein. 
Os07g0490300AK068288GCGGCCCACAGCCCAACCSimilar to Preproacrosin. 
J013149P03GCGGCCCACAGCCCAACCNONE 
J065039L14GCGGCCCACAGCCCAACCNONE 
J100024A06GCGGCCCACAGCCCAACCNONE 
Os07g0490400AK067941GGTTGGGCTGTGGGCCGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22GGTTGGGCTGTGGGCCGCNONE 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0561300AK072982TGTGGGCCCTCyclin-like F-box domain containing protein. 
J023149I22TGTGGGCCCTNONE 
J065149C18TGTGGGCCCTNONE 
J065166N15TGTGGGCCCTNONE 
J075011J01TGTGGGCCCTNONE 
J075013I05TGTGGGCCCTNONE 
J075039H11TGTGGGCCCTNONE 
J075067J09TGTGGGCCCTNONE 
J075084E08TGTGGGCCCTNONE 
J075085E12TGTGGGCCCTNONE 
J075090D11TGTGGGCCCTNONE 
J075092D12TGTGGGCCCTNONE 
J075126N17TGTGGGCCCTNONE 
J075179F01TGTGGGCCCTNONE 
J075184P21TGTGGGCCCTNONE 
Os07g0582400003-104-B09AGATGGGCCCACACGNONE 
AK059423AGATGGGCCCACACGNONE 
AK102676AGATGGGCCCACACGNONE 
J065001F09AGATGGGCCCACACGNONE 
J065005K22AGATGGGCCCACACGNONE 
J065006D10AGATGGGCCCACACGNONE 
J065006P17AGATGGGCCCACACGNONE 
J065015G23AGATGGGCCCACACGNONE 
J065020F21AGATGGGCCCACACGNONE 
J065028I05AGATGGGCCCACACGNONE 
J065042N09AGATGGGCCCACACGNONE 
J065043P03AGATGGGCCCACACGNONE 
J065059E15AGATGGGCCCACACGNONE 
J065090I12AGATGGGCCCACACGNONE 
J065130I02AGATGGGCCCACACGNONE 
J065131P05AGATGGGCCCACACGNONE 
J065163I24AGATGGGCCCACACGNONE 
J065168I21AGATGGGCCCACACGNONE 
J065174A12AGATGGGCCCACACGNONE 
J065178K16AGATGGGCCCACACGNONE 
J065182P03AGATGGGCCCACACGNONE 
J065186B07AGATGGGCCCACACGNONE 
J065189M13AGATGGGCCCACACGNONE 
J065208J22AGATGGGCCCACACGNONE 
J065211E11AGATGGGCCCACACGNONE 
J075054E08AGATGGGCCCACACGNONE 
J075067K14AGATGGGCCCACACGNONE 
J075104E20AGATGGGCCCACACGNONE 
J075152M07AGATGGGCCCACACGNONE 
Os07g0591400Os07g0591400TGGGGCCCACGTGGGCCCACANONE 
Os07g0598900015-040-C12TGTGGGCCAANONE 
AK102627TGTGGGCCAACobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521TGTGGGCCAANONE 
J033087C18TGTGGGCCAANONE 
J033099K03TGTGGGCCAANONE 
J065054E02TGTGGGCCAANONE 
J090055O05TGTGGGCCAANONE 
Os07g0603100AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
AK101352GGGGCCCACANuclear transport factor 2 domain containing protein. 
J023077E09GCGGGCCCACACAGCCCACCACNONE 
J023077E09GGGGCCCACANONE 
J023081N15GCGGGCCCACACAGCCCACCACNONE 
J023081N15GGGGCCCACANONE 
J033022N22GCGGGCCCACACAGCCCACCACNONE 
J033022N22GGGGCCCACANONE 
J033024M18GCGGGCCCACACAGCCCACCACNONE 
J033024M18GGGGCCCACANONE 
J033034P09GCGGGCCCACACAGCCCACCACNONE 
J033034P09GGGGCCCACANONE 
J033046A06GCGGGCCCACACAGCCCACCACNONE 
J033046A06GGGGCCCACANONE 
J033051K01GCGGGCCCACACAGCCCACCACNONE 
J033051K01GGGGCCCACANONE 
J033081P09GCGGGCCCACACAGCCCACCACNONE 
J033081P09GGGGCCCACANONE 
J033091B17GCGGGCCCACACAGCCCACCACNONE 
J033091B17GGGGCCCACANONE 
J033092K23GCGGGCCCACACAGCCCACCACNONE 
J033092K23GGGGCCCACANONE 
J033132J09GCGGGCCCACACAGCCCACCACNONE 
J033132J09GGGGCCCACANONE 
J033144A14GCGGGCCCACACAGCCCACCACNONE 
J033144A14GGGGCCCACANONE 
J033145A14GCGGGCCCACACAGCCCACCACNONE 
J033145A14GGGGCCCACANONE 
J043021B20GCGGGCCCACACAGCCCACCACNONE 
J043021B20GGGGCCCACANONE 
J053024D23GCGGGCCCACACAGCCCACCACNONE 
J053024D23GGGGCCCACANONE 
J065212J10GCGGGCCCACACAGCCCACCACNONE 
J065212J10GGGGCCCACANONE 
J090055M05GCGGGCCCACACAGCCCACCACNONE 
J090055M05GGGGCCCACANONE 
J090065E14GCGGGCCCACACAGCCCACCACNONE 
J090065E14GGGGCCCACANONE 
J090092J06GCGGGCCCACACAGCCCACCACNONE 
J090092J06GGGGCCCACANONE 
Os07g0606600AK111621CCCGGCCCACACNONE 
AK112118CCCGGCCCACACSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22CCCGGCCCACACNONE 
Os07g0608800AK059637TGTGGGCCCGCGTCTCSimilar to Peroxisome assembly protein 10 (Peroxin-10) (AthPEX10) (Pex10p) (PER8). 
Os07g0621201J065152G13ACGTGGGGCCCACAConserved hypothetical protein. 
J065152G13GGGGCCCACAConserved hypothetical protein. 
Os07g0622200AB122058CGGGCCCACANONE 
AK069968CGGGCCCACANONE 
AK105687CGGGCCCACASimilar to M-160-u1_1 (Fragment). 
J075095A10CGGGCCCACANONE 
Os07g0623300AK070292GACGGCCCACASimilar to Splicing factor SC35. 
J023050C05GACGGCCCACANONE 
J090025O12GACGGCCCACANONE 
Os07g0626600Os07g0626600TGTGGGCCCCACGSimilar to Embryogenic callus protein-like. 
Os07g0633200AK061338GCGGCCCACACSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GCGGCCCACACNONE 
J033096E22GCGGCCCACACNONE 
J033125D06GCGGCCCACACNONE 
J075048C23GCGGCCCACACNONE 
J075050G02GCGGCCCACACNONE 
J075104J04GCGGCCCACACNONE 
J075144N04GCGGCCCACACNONE 
Os07g0671400AK067933CCTGGGCCCACAHeavy metal transport/detoxification protein domain containing protein. 
Os07g0679300AK065079CACTGACATGTGGGCCCCACANONE 
AK099229CACTGACATGTGGGCCCCACASimilar to Alpha-galactosidase precursor (EC 3.2.1.22) (Melibiase) (Alpha-D- galactoside galactohydrolase). 
J013033F05CACTGACATGTGGGCCCCACANONE 
J013049N18CACTGACATGTGGGCCCCACANONE 
J013071C14CACTGACATGTGGGCCCCACANONE 
J013088P15CACTGACATGTGGGCCCCACANONE 
J013092D24CACTGACATGTGGGCCCCACANONE 
J013093O14CACTGACATGTGGGCCCCACANONE 
J023095E17CACTGACATGTGGGCCCCACANONE 
J043005E21CACTGACATGTGGGCCCCACANONE 
J043015E06CACTGACATGTGGGCCCCACANONE 
J043027P22CACTGACATGTGGGCCCCACANONE 
J065038B15CACTGACATGTGGGCCCCACANONE 
J065073M21CACTGACATGTGGGCCCCACANONE 
J065165P06CACTGACATGTGGGCCCCACANONE 
J065198I06CACTGACATGTGGGCCCCACANONE 
J075007E08CACTGACATGTGGGCCCCACANONE 
J075038I07CACTGACATGTGGGCCCCACANONE 
J075130L20CACTGACATGTGGGCCCCACANONE 
J090057G17CACTGACATGTGGGCCCCACANONE 
J100029K23CACTGACATGTGGGCCCCACANONE 
J100086O16CACTGACATGTGGGCCCCACANONE 
J100087M02CACTGACATGTGGGCCCCACANONE 
Os07g0681100AK103917TGTGGGCCACNONE 
Os08g0107900014-055-C03TGTGGGCCTANONE 
J065062G20TGTGGGCCTANONE 
Os08g0116500009-007-E05ATGGCCCACANONE 
009-074-C07ATGGCCCACANONE 
009-098-A07ATGGCCCACANONE 
009-100-C03ATGGCCCACANONE 
009-136-E04ATGGCCCACANONE 
009-138-B08ATGGCCCACANONE 
009-144-B06ATGGCCCACANONE 
009-184-E04ATGGCCCACANONE 
009-189-F01ATGGCCCACANONE 
013-006-E05ATGGCCCACANONE 
013-015-C10ATGGCCCACANONE 
013-019-F09ATGGCCCACANONE 
013-020-C01ATGGCCCACANONE 
013-021-F05ATGGCCCACANONE 
013-035-D08ATGGCCCACANONE 
013-038-C09ATGGCCCACANONE 
013-054-B07ATGGCCCACANONE 
013-061-G10ATGGCCCACANONE 
013-074-B01ATGGCCCACANONE 
013-079-B06ATGGCCCACANONE 
013-099-B09ATGGCCCACANONE 
013-099-G11ATGGCCCACANONE 
014-023-F04ATGGCCCACANONE 
014-032-C07ATGGCCCACANONE 
014-045-E02ATGGCCCACANONE 
014-085-C02ATGGCCCACANONE 
014-087-F04ATGGCCCACANONE 
014-089-C04ATGGCCCACANONE 
014-090-E01ATGGCCCACANONE 
014-094-G11ATGGCCCACANONE 
014-097-B07ATGGCCCACANONE 
015-024-A12ATGGCCCACANONE 
015-032-C06ATGGCCCACANONE 
016-053-E09ATGGCCCACANONE 
016-081-F10ATGGCCCACANONE 
AK058240ATGGCCCACASimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09ATGGCCCACANONE 
J023107O19ATGGCCCACANONE 
J053029K21ATGGCCCACANONE 
J053073P11ATGGCCCACANONE 
J053074B04ATGGCCCACANONE 
J053078M14ATGGCCCACANONE 
J065001E12ATGGCCCACANONE 
J065006J12ATGGCCCACANONE 
J065015C06ATGGCCCACANONE 
J065025D13ATGGCCCACANONE 
J065029A04ATGGCCCACANONE 
J065031D23ATGGCCCACANONE 
J065032E24ATGGCCCACANONE 
J065034P16ATGGCCCACANONE 
J065043B04ATGGCCCACANONE 
J065044A15ATGGCCCACANONE 
J065062D18ATGGCCCACANONE 
J065079G13ATGGCCCACANONE 
J065080A19ATGGCCCACANONE 
J065080A20ATGGCCCACANONE 
J065089N19ATGGCCCACANONE 
J065111O07ATGGCCCACANONE 
J065115N15ATGGCCCACANONE 
J065131A04ATGGCCCACANONE 
J065138H02ATGGCCCACANONE 
J065139K10ATGGCCCACANONE 
J065144A02ATGGCCCACANONE 
J065155J17ATGGCCCACANONE 
J065159D18ATGGCCCACANONE 
J065159I18ATGGCCCACANONE 
J065167H12ATGGCCCACANONE 
J065174C22ATGGCCCACANONE 
J065184A05ATGGCCCACANONE 
J065188M15ATGGCCCACANONE 
J065191D23ATGGCCCACANONE 
J065203C07ATGGCCCACANONE 
J065207C23ATGGCCCACANONE 
J065207L16ATGGCCCACANONE 
J065212F01ATGGCCCACANONE 
J065212F05ATGGCCCACANONE 
J075037B07ATGGCCCACANONE 
J075042F15ATGGCCCACANONE 
J075059J03ATGGCCCACANONE 
J075068M18ATGGCCCACANONE 
J075079E13ATGGCCCACANONE 
J075081F12ATGGCCCACANONE 
J075083I05ATGGCCCACANONE 
J075123K23ATGGCCCACANONE 
J075142F16ATGGCCCACANONE 
J075156N03ATGGCCCACANONE 
J075162K05ATGGCCCACANONE 
J075171E08ATGGCCCACANONE 
J075177N03ATGGCCCACANONE 
J075182K17ATGGCCCACANONE 
J075186K02ATGGCCCACANONE 
J075191K05ATGGCCCACANONE 
J080011E10ATGGCCCACANONE 
J080016M21ATGGCCCACANONE 
J080017A17ATGGCCCACANONE 
J080031O09ATGGCCCACANONE 
J080039G21ATGGCCCACANONE 
J080041B01ATGGCCCACANONE 
J080050G20ATGGCCCACANONE 
J080054A12ATGGCCCACANONE 
J080058O08ATGGCCCACANONE 
J080061N04ATGGCCCACANONE 
J080064L23ATGGCCCACANONE 
J080064P05ATGGCCCACANONE 
J080069I17ATGGCCCACANONE 
J080070E07ATGGCCCACANONE 
J080071B20ATGGCCCACANONE 
J080074L08ATGGCCCACANONE 
J080076N08ATGGCCCACANONE 
J080081A14ATGGCCCACANONE 
J080081J17ATGGCCCACANONE 
J080085N14ATGGCCCACANONE 
J080090B09ATGGCCCACANONE 
J080097L11ATGGCCCACANONE 
J080306H13ATGGCCCACANONE 
J080307H13ATGGCCCACANONE 
J080311F12ATGGCCCACANONE 
J080316L23ATGGCCCACANONE 
J080318H02ATGGCCCACANONE 
J090016L15ATGGCCCACANONE 
J090019I02ATGGCCCACANONE 
J090031G21ATGGCCCACANONE 
J090066C15ATGGCCCACANONE 
J100032I02ATGGCCCACANONE 
J100032N07ATGGCCCACANONE 
J100032N16ATGGCCCACANONE 
J100041P21ATGGCCCACANONE 
J100048M04ATGGCCCACANONE 
J100048M14ATGGCCCACANONE 
J100063B08ATGGCCCACANONE 
J100088E20ATGGCCCACANONE 
J100090I08ATGGCCCACANONE 
Os08g0118900AK109749AAGGCCCACAAAdenylate kinase family protein. 
Os08g0120000006-042-E02CCCGGGCCCACANONE 
006-051-F06CCCGGGCCCACANONE 
006-052-G03CCCGGGCCCACANONE 
006-095-B11CCCGGGCCCACANONE 
AB017427CCCGGGCCCACANONE 
AB017428CCCGGGCCCACANONE 
AK059789CCCGGGCCCACANONE 
AK059815CCCGGGCCCACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077CCCGGGCCCACANONE 
AK102607CCCGGGCCCACANONE 
AK104303CCCGGGCCCACANONE 
AK104304CCCGGGCCCACANONE 
AK104421CCCGGGCCCACANONE 
D10414CCCGGGCCCACANONE 
J013170D08CCCGGGCCCACANONE 
J023086D16CCCGGGCCCACANONE 
J033099B04CCCGGGCCCACANONE 
J065042P05CCCGGGCCCACANONE 
J065144E22CCCGGGCCCACANONE 
J065162J20CCCGGGCCCACANONE 
J065196N13CCCGGGCCCACANONE 
J090013B11CCCGGGCCCACANONE 
Os08g0127500AK071322GCCGGGCCCACAAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
J023087N16GCCGGGCCCACANONE 
J065146A20GCCGGGCCCACANONE 
J075043F12GCCGGGCCCACANONE 
J090015B21GCCGGGCCCACANONE 
Os08g0128200AK120428CGTGTGGGCCCGGGConserved hypothetical protein. 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0135100AK108618TTGTGGGCCCAGGSimilar to Phosphate/phosphoenolpyruvate translocator protein-like. 
Os08g0143400015-006-A10TGTGGGCCCACGCNONE 
AK066792TGTGGGCCCACGCNONE 
AK120532TGTGGGCCCACGCSWIRM domain containing protein. 
J100083F02TGTGGGCCCACGCNONE 
Os08g0143500006-072-G06GCGTGGGCCCACANONE 
016-053-H02GCGTGGGCCCACANONE 
AK061094GCGTGGGCCCACANONE 
AK071122GCGTGGGCCCACAGlycosyl transferase, family 14 protein. 
J023081E17GCGTGGGCCCACANONE 
J023106O18GCGTGGGCCCACANONE 
J043001N22GCGTGGGCCCACANONE 
J065062D05GCGTGGGCCCACANONE 
J065099M15GCGTGGGCCCACANONE 
J065180K12GCGTGGGCCCACANONE 
J090045L23GCGTGGGCCCACANONE 
J100088K05GCGTGGGCCCACANONE 
Os08g0150800AK101530AAATGGGCTCGGCCCACASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
AK101530TGTGGGCCACGTCSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0167500006-063-D04AAGGCCCATATGGGCCCACAANONE 
006-066-G09AAGGCCCATATGGGCCCACAANONE 
AK061061AAGGCCCATATGGGCCCACAAConserved hypothetical protein. 
AK071197AAGGCCCATATGGGCCCACAANONE 
J023082N10AAGGCCCATATGGGCCCACAANONE 
Os08g0192800AK059490ATGGCCCACATGTCAGTGNONE 
AK101678ATGGCCCACATGTCAGTGNONE 
AK120613ATGGCCCACATGTCAGTGBromodomain containing protein. 
J080039B22ATGGCCCACATGTCAGTGNONE 
J080039I23ATGGCCCACATGTCAGTGNONE 
J080074D19ATGGCCCACATGTCAGTGNONE 
J080086N13ATGGCCCACATGTCAGTGNONE 
Os08g0195400006-057-E04GCGGCCCACANONE 
006-060-B10GCGGCCCACANONE 
AK070464GCGGCCCACAConserved hypothetical protein. 
AK104389GCGGCCCACANONE 
AK106140GCGGCCCACANONE 
J023013G08GCGGCCCACANONE 
J023054K19GCGGCCCACANONE 
J023089D18GCGGCCCACANONE 
J023092K05GCGGCCCACANONE 
J033025A08GCGGCCCACANONE 
J033067P12GCGGCCCACANONE 
J033098A10GCGGCCCACANONE 
J065219L04GCGGCCCACANONE 
J090021P06GCGGCCCACANONE 
J090062M05GCGGCCCACANONE 
J090079F15GCGGCCCACANONE 
J100041H19GCGGCCCACANONE 
Os08g0196900J065042C13TGTGGGCCATNONE 
J065097A06TGTGGGCCATNONE 
J065164E04TGTGGGCCATNONE 
J075006N16TGTGGGCCATCyclin-like F-box domain containing protein. 
J075007K15TGTGGGCCATNONE 
J075025D24TGTGGGCCATNONE 
J075165A07TGTGGGCCATNONE 
J075176D05TGTGGGCCATNONE 
J075181K09TGTGGGCCATNONE 
J075199B15TGTGGGCCATNONE 
Os08g0224200AK101331GCGGCCCACASimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01GGGGCCCACANONE 
AK067127GGGGCCCACAConserved hypothetical protein. 
J013096C05GGGGCCCACANONE 
J100032D12GGGGCCCACANONE 
Os08g0316900013-024-A06CTGGCCCACANONE 
J033112J20CTGGCCCACANONE 
J065025M22CTGGCCCACANONE 
J065026E15CTGGCCCACANONE 
Os08g0374100006-043-B11TGTGGGCCACNONE 
006-065-D12TGTGGGCCACNONE 
006-071-B11TGTGGGCCACNONE 
006-101-C05TGTGGGCCACNONE 
009-159-A03TGTGGGCCACNONE 
AK070541TGTGGGCCACSimilar to Ubiquitin-conjugating enzyme E2 M (EC 6.3.2.19) (Ubiquitin-protein ligase M) (Ubiquitin carrier protein M) (Nedd8-conjugating enzyme Ubc12). 
AK104158TGTGGGCCACNONE 
AK104511TGTGGGCCACNONE 
J023056A05TGTGGGCCACNONE 
J100059M16TGTGGGCCACNONE 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0389733J065044M19GTGTGGGCCGGCCGTCGGATNONE 
J065104D10GTGTGGGCCGGCCGTCGGATNONE 
J065110F18GTGTGGGCCGGCCGTCGGATNONE 
Os08g0397900006-033-G02TGTGGGCCCACANONE 
009-131-F03TGTGGGCCCACANONE 
AK060114TGTGGGCCCACANONE 
AK098973TGTGGGCCCACANONE 
AK109817TGTGGGCCCACAConserved hypothetical protein. 
J013089E18TGTGGGCCCACANONE 
J100081N17TGTGGGCCCACANONE 
Os08g0408200AK111715GGGGCCCACASimilar to GAMYB-binding protein (Fragment). 
Os08g0416100AK070406TGTGGGCCCACADEAD/DEAH box helicase, N-terminal domain containing protein. 
AY644647TGTGGGCCCACANONE 
Os08g0427900AK103217ACCGGCCCACASimilar to Hin19 (Fragment). 
AK109208ACCGGCCCACANONE 
J080005C08ACCGGCCCACANONE 
J080010B10ACCGGCCCACANONE 
J080013C21ACCGGCCCACANONE 
J080022L12ACCGGCCCACANONE 
J080029C08ACCGGCCCACANONE 
J080029G09ACCGGCCCACANONE 
J080035L14ACCGGCCCACANONE 
J080040M20ACCGGCCCACANONE 
J080043M18ACCGGCCCACANONE 
J080045K15ACCGGCCCACANONE 
J080048I17ACCGGCCCACANONE 
J080051P16ACCGGCCCACANONE 
J080053L16ACCGGCCCACANONE 
J080059P14ACCGGCCCACANONE 
J080063E13ACCGGCCCACANONE 
J080075N18ACCGGCCCACANONE 
J080077E05ACCGGCCCACANONE 
J080080H23ACCGGCCCACANONE 
J080081L16ACCGGCCCACANONE 
J080083F17ACCGGCCCACANONE 
J080085C23ACCGGCCCACANONE 
J080086A12ACCGGCCCACANONE 
J080088N06ACCGGCCCACANONE 
J080092G10ACCGGCCCACANONE 
J080093F04ACCGGCCCACANONE 
J080094C03ACCGGCCCACANONE 
J090032L12ACCGGCCCACANONE 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0452500AK102438TGTGGGCCCCACACNONE 
AK106714TGTGGGCCCCACACAuxin responsive SAUR protein family protein. 
Os08g0465300AK108076CACGGCCCACAConserved hypothetical protein. 
Os08g0474750J075009C13CGTGTGGGCCATNONE 
J075122O14CGTGTGGGCCATHypothetical protein. 
Os08g0474800Os08g0474800CGTGTGGGCCATEsterase/lipase/thioesterase domain containing protein. 
Os08g0478500AK099704CGGGCCCACACPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0499900J033080E06ATTTGGGCGGGCCCACANONE 
Os08g0500900AK102314AAGGCCCACASimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0502700AK064774GCCACGTCGGACGGGTGTGGGCCCCACGAAAminotransferase, class V family protein. 
AK065126GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
AK099206GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013001P06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013033N17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013070L14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013104J15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013159L20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J033068M20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065039M22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065057C23GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065069O15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065080A01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065081F08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065117F05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065178C01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065178C02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065212F12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075015K06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075062J08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075063O17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075072G05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098H11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098J11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098P09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075133G18GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075137G02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075169K02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080007M21GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080009M17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080011J02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080012I10GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080021K10GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080023P13GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080024C08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080025P11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080027B13GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080032P16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080033G07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080041F17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080041N19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080042C20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080046J24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080047L14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080049O11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080051E15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080052F01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080054A08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080054K14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080057G21GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080059L15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080063H12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080070M24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080071D24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080077O19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080078E08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080078N12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080081I08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080082A17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080087A09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080087F22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080088I08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080090F19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080091H16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080091N06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080092H08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080097H19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302C09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302G05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302K14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080303L01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080304D07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080305G03GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080306B12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080307G07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080315A14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080318H14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100029P15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100042C22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100063F24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100087P16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100088A12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
Os08g0503800AK101954AGCCGTCCGATCTGGTGGGCCCACACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
AK101954ATGGCCCACACGSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
AK101954CACTGACATGTGGGCCCCACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0517900015-019-D06AAAAGCCCATTACGGCCCACACNONE 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
Os08g0520100AK059686GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCNONE 
AK059686TTTTGGGCCCACAANONE 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
AK120052TTTTGGGCCCACAAPseudouridine synthase domain containing protein. 
Os08g0530400AB071966AGGGCCCACANONE 
AK068532AGGGCCCACAMoco containing protein (Moco containing protein(OsMCP)). 
J013072G10AGGGCCCACANONE 
J013153N03AGGGCCCACANONE 
J013155E12AGGGCCCACANONE 
J013162P20AGGGCCCACANONE 
J033024H12AGGGCCCACANONE 
J033072L08AGGGCCCACANONE 
J033073N01AGGGCCCACANONE 
J033144B02AGGGCCCACANONE 
J033145B02AGGGCCCACANONE 
J043037G21AGGGCCCACANONE 
J053073F17AGGGCCCACANONE 
J053086E13AGGGCCCACANONE 
J065058B10AGGGCCCACANONE 
J090008H19AGGGCCCACANONE 
J090071C06AGGGCCCACANONE 
J090082L21AGGGCCCACANONE 
J100044B09AGGGCCCACANONE 
J100051N23AGGGCCCACANONE 
J100075O05AGGGCCCACANONE 
J100085H22AGGGCCCACANONE 
J100086O19AGGGCCCACANONE 
Os08g0532300009-122-A05CCTGTCAGTTTGTGGGCCCACCTNONE 
009-129-H05CCTGTCAGTTTGTGGGCCCACCTNONE 
AB011262CCTGTCAGTTTGTGGGCCCACCTNONE 
AK065141CCTGTCAGTTTGTGGGCCCACCTNONE 
AK119730CCTGTCAGTTTGTGGGCCCACCTSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CCTGTCAGTTTGTGGGCCCACCTNONE 
J013042K23CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057J08CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J023113C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J053054E03CCTGTCAGTTTGTGGGCCCACCTNONE 
J053062B07CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075O17CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075P09CCTGTCAGTTTGTGGGCCCACCTNONE 
J065024H05CCTGTCAGTTTGTGGGCCCACCTNONE 
J065049F22CCTGTCAGTTTGTGGGCCCACCTNONE 
J065063L03CCTGTCAGTTTGTGGGCCCACCTNONE 
J065102O07CCTGTCAGTTTGTGGGCCCACCTNONE 
J065104M12CCTGTCAGTTTGTGGGCCCACCTNONE 
J065119E04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065153E10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065168M24CCTGTCAGTTTGTGGGCCCACCTNONE 
J065173I10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065181L04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065184I18CCTGTCAGTTTGTGGGCCCACCTNONE 
J065203M15CCTGTCAGTTTGTGGGCCCACCTNONE 
J075004C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J075047B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J075055F18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075065G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J075094O14CCTGTCAGTTTGTGGGCCCACCTNONE 
J075143C22CCTGTCAGTTTGTGGGCCCACCTNONE 
J075153K18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075164N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J075197C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080001A01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080003B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080006G17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080007J06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080010H12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080014I01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080015C16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080016P19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080020G24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080021E12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080023I11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080024H24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080025G18CCTGTCAGTTTGTGGGCCCACCTNONE 
J080028H08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080030G08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080031H20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080034C20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080040H13CCTGTCAGTTTGTGGGCCCACCTNONE 
J080044M04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080047D02CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049D17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049J17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080050A05CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051K06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053A07CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053I08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080056L12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080061I19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080075G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J080078C23CCTGTCAGTTTGTGGGCCCACCTNONE 
J080080I21CCTGTCAGTTTGTGGGCCCACCTNONE 
J080084F04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080085K16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097A12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097N01CCTGTCAGTTTGTGGGCCCACCTNONE 
J090027L10CCTGTCAGTTTGTGGGCCCACCTNONE 
J100034N17CCTGTCAGTTTGTGGGCCCACCTNONE 
Os08g0532400AK101608AGGTGGGCCCACAAACTGACAGGSimilar to AT.I.24-7 protein. 
Os08g0535600AK121683GAGGCCCACAZinc finger, Tim10/DDP-type family protein. 
J065077E05GAGGCCCACANONE 
J075088M24GAGGCCCACANONE 
J075140B03GAGGCCCACANONE 
J090014B14GAGGCCCACANONE 
Os08g0545700Os08g0545700AGGGCCCACATraB determinant family protein. 
Os08g0549100004-006-D12AGGGCCCACACGNONE 
006-085-H05AGGGCCCACACGNONE 
006-101-B02AGGGCCCACACGNONE 
AK070842AGGGCCCACACGSimilar to Peroxisome type ascorbate peroxidase. 
AK104490AGGGCCCACACGNONE 
J013095F24AGGGCCCACACGNONE 
J013111D10AGGGCCCACACGNONE 
J023031C15AGGGCCCACACGNONE 
J023067J02AGGGCCCACACGNONE 
J023074O14AGGGCCCACACGNONE 
J033058F18AGGGCCCACACGNONE 
J033101F12AGGGCCCACACGNONE 
J053026B20AGGGCCCACACGNONE 
J065070G12AGGGCCCACACGNONE 
J065196H18AGGGCCCACACGNONE 
J075021N20AGGGCCCACACGNONE 
J075069K22AGGGCCCACACGNONE 
J075093E22AGGGCCCACACGNONE 
J075110D17AGGGCCCACACGNONE 
J075119D06AGGGCCCACACGNONE 
J075181H15AGGGCCCACACGNONE 
J090038O15AGGGCCCACACGNONE 
J090043K23AGGGCCCACACGNONE 
J090082E12AGGGCCCACACGNONE 
J100022M19AGGGCCCACACGNONE 
J100027E06AGGGCCCACACGNONE 
J100028G17AGGGCCCACACGNONE 
J100061I16AGGGCCCACACGNONE 
J100065G23AGGGCCCACACGNONE 
J100087C13AGGGCCCACACGNONE 
Os08g0553450Os08g0553450TCCGGCCCACAHypothetical protein. 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os08g0554000AK111661TGCGGGCCCACACWD-40 repeat containing protein. 
AK112044TGCGGGCCCACACNONE 
J013039N12TGCGGGCCCACACNONE 
J013134D02TGCGGGCCCACACNONE 
J013153B06TGCGGGCCCACACNONE 
J033044L16TGCGGGCCCACACNONE 
J033073P14TGCGGGCCCACACNONE 
Os08g0557000AK059917TCGGCCCACAANONE 
AK100496TCGGCCCACAASimilar to Protein-L-isoaspartate O-methyltransferase. 
Os08g0564100AK063258GTGTGGGCCATSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0251800006-100-E12CGTGTGGGCCCCACCNONE 
AK061218CGTGTGGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CGTGTGGGCCCCACCNONE 
J065048A02CGTGTGGGCCCCACCNONE 
J065073P10CGTGTGGGCCCCACCNONE 
J065075B09CGTGTGGGCCCCACCNONE 
J065112B05CGTGTGGGCCCCACCNONE 
J090014H10CGTGTGGGCCCCACCNONE 
Os09g0309500J100027L22TGTGGGCCCCACCCCCCGCGConserved hypothetical protein. 
Os09g0313500AK065687TTGTGGGCCCGDisease resistance protein family protein. 
J013039H12TTGTGGGCCCGNONE 
J090060B10TTGTGGGCCCGNONE 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0361400006-109-H02AGGGCCCACACGNONE 
006-120-G04AGGGCCCACACGNONE 
AK060652AGGGCCCACACGOuter mitochondrial membrane protein porin (Voltage-dependent anion- selective channel protein) (VDAC). 
AK061261AGGGCCCACACGNONE 
AK072129AGGGCCCACACGNONE 
J023109H05AGGGCCCACACGNONE 
J065052I18AGGGCCCACACGNONE 
J065058M16AGGGCCCACACGNONE 
J065079L08AGGGCCCACACGNONE 
J065107J15AGGGCCCACACGNONE 
J065137A03AGGGCCCACACGNONE 
J090013N18AGGGCCCACACGNONE 
J090064O16AGGGCCCACACGNONE 
J100080N15AGGGCCCACACGNONE 
Y18104AGGGCCCACACGNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0401200AK106846GTGTGGGCCATNONE 
Os09g0411700005-017-C05CCAGGCCCACAANONE 
009-163-B01CCAGGCCCACAANONE 
AK058290CCAGGCCCACAAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919CCAGGCCCACAANONE 
AK121091CCAGGCCCACAANONE 
J013039D20CCAGGCCCACAANONE 
J023066F16CCAGGCCCACAANONE 
J023082H09CCAGGCCCACAANONE 
J023088H05CCAGGCCCACAANONE 
J065013G09CCAGGCCCACAANONE 
J065065C12CCAGGCCCACAANONE 
J065111I04CCAGGCCCACAANONE 
J065179H22CCAGGCCCACAANONE 
J075023N14CCAGGCCCACAANONE 
J090041J17CCAGGCCCACAANONE 
J100031J21CCAGGCCCACAANONE 
J100057A18CCAGGCCCACAANONE 
J100068P22CCAGGCCCACAANONE 
Os09g0434200AK062015AAGGCCCACACNONE 
AK103447AAGGCCCACACZinc finger, RING-type domain containing protein. 
Os09g0439600AK100577TGTGGGCCCCACCExo70 exocyst complex subunit family protein. 
J090071K03TGTGGGCCCCACCNONE 
Os09g0451500AK062254GTGTGGGCCCAGTTThioredoxin domain 2 containing protein. 
AK072941GTGTGGGCCCAGTTNONE 
Os09g0463700016-008-D06TTGGCCCACACGNONE 
AK060708TTGGCCCACACGSimilar to AHM1. 
J090013G05TTGGCCCACACGNONE 
Os09g0492700AK101104TGTGGGCCCCACASimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
U95816TGTGGGCCCCACANONE 
Os09g0493700015-091-G11TGTGGGCCCGNONE 
AK068501TGTGGGCCCGSimilar to CUC2. 
AK099237TGTGGGCCCGNONE 
J013155B08TGTGGGCCCGNONE 
J023006E01TGTGGGCCCGNONE 
J023060K23TGTGGGCCCGNONE 
J023100B11TGTGGGCCCGNONE 
J033026L19TGTGGGCCCGNONE 
J033129J12TGTGGGCCCGNONE 
J033149K09TGTGGGCCCGNONE 
J065045I06TGTGGGCCCGNONE 
J065061A10TGTGGGCCCGNONE 
J065101H05TGTGGGCCCGNONE 
J065135A03TGTGGGCCCGNONE 
J065169C16TGTGGGCCCGNONE 
J100047C11TGTGGGCCCGNONE 
J100047K07TGTGGGCCCGNONE 
Os09g0496100J100038B11GGGGCCCACANONE 
J100068N03GGGGCCCACAConserved hypothetical protein. 
Os09g0530700AK058211GCGGGCCCACAConserved hypothetical protein. 
AK100759GCGGGCCCACANONE 
J065039L02GCGGGCCCACANONE 
J065043O03GCGGGCCCACANONE 
J065070M16GCGGGCCCACANONE 
Os09g0542100AK105001TGTGGGCCCCACCPeptidase A1, pepsin family protein. 
J023149B01TGTGGGCCCCACCNONE 
J100043C13TGTGGGCCCCACCNONE 
Os09g0547200016-021-H03CCCGGGCCCACACACCNONE 
AK073078CCCGGGCCCACACACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CCCGGGCCCACACACCNONE 
J065005L05CCCGGGCCCACACACCNONE 
J065039C06CCCGGGCCCACACACCNONE 
J065116H17CCCGGGCCCACACACCNONE 
J100046A17CCCGGGCCCACACACCNONE 
Os09g0551600005-020-H08TGTGGGCCCCACGTGNONE 
006-043-E02TGTGGGCCCCACGTGNONE 
013-043-F03TGTGGGCCCCACGTGNONE 
AK066658TGTGGGCCCCACGTGSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11TGTGGGCCCCACGTGNONE 
J065177J20TGTGGGCCCCACGTGNONE 
J075041D06TGTGGGCCCCACGTGNONE 
J075199H24TGTGGGCCCCACGTGNONE 
J080001G07TGTGGGCCCCACGTGNONE 
J080024A12TGTGGGCCCCACGTGNONE 
J080025B15TGTGGGCCCCACGTGNONE 
J090017G07TGTGGGCCCCACGTGNONE 
J090050G23TGTGGGCCCCACGTGNONE 
J090083G11TGTGGGCCCCACGTGNONE 
Os11g0118000AK100743CTGGCCCACAAEsterase/lipase/thioesterase domain containing protein. 
J023031M08CTGGCCCACAANONE 
J023118F07CTGGCCCACAANONE 
Os11g0132700AK103286TTGTGGGCCTCCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0139100009-099-H06TGTGGGCCCCACGTNONE 
AK121443TGTGGGCCCCACGTSimilar to 50S ribosomal protein L24. 
J023140O18TGTGGGCCCCACGTNONE 
J023143M23TGTGGGCCCCACGTNONE 
J033079G04TGTGGGCCCCACGTNONE 
J043004D20TGTGGGCCCCACGTNONE 
J065097F05TGTGGGCCCCACGTNONE 
Os11g0153700AK058576TAGGCCCATATGTGGGCCCAACASimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0159000AK065738TGTGGGCCCACCCConserved hypothetical protein. 
Os11g0168200005-010-H01TTGTGGGCCAGAGCCCATCCNONE 
009-156-F07TTGTGGGCCAGAGCCCATCCNONE 
012-025-F01TTGTGGGCCAGAGCCCATCCNONE 
012-089-A02TTGTGGGCCAGAGCCCATCCNONE 
016-016-E08TTGTGGGCCAGAGCCCATCCNONE 
AK073392TTGTGGGCCAGAGCCCATCC60S ribosomal protein L3. 
AK099225TTGTGGGCCAGAGCCCATCCNONE 
AK101469TTGTGGGCCAGAGCCCATCCNONE 
AY236158TTGTGGGCCAGAGCCCATCCNONE 
J013152M22TTGTGGGCCAGAGCCCATCCNONE 
J023013N11TTGTGGGCCAGAGCCCATCCNONE 
J023038J11TTGTGGGCCAGAGCCCATCCNONE 
J023054N21TTGTGGGCCAGAGCCCATCCNONE 
J033041E13TTGTGGGCCAGAGCCCATCCNONE 
J033050O09TTGTGGGCCAGAGCCCATCCNONE 
J033093G05TTGTGGGCCAGAGCCCATCCNONE 
J033094J17TTGTGGGCCAGAGCCCATCCNONE 
J033112J24TTGTGGGCCAGAGCCCATCCNONE 
J033113D05TTGTGGGCCAGAGCCCATCCNONE 
J033120K10TTGTGGGCCAGAGCCCATCCNONE 
J033121H19TTGTGGGCCAGAGCCCATCCNONE 
J033129C08TTGTGGGCCAGAGCCCATCCNONE 
J033140H24TTGTGGGCCAGAGCCCATCCNONE 
J065020I18TTGTGGGCCAGAGCCCATCCNONE 
J065058L01TTGTGGGCCAGAGCCCATCCNONE 
J065059G22TTGTGGGCCAGAGCCCATCCNONE 
J065212L09TTGTGGGCCAGAGCCCATCCNONE 
J075047P09TTGTGGGCCAGAGCCCATCCNONE 
J075063C18TTGTGGGCCAGAGCCCATCCNONE 
J075076E07TTGTGGGCCAGAGCCCATCCNONE 
J075077F14TTGTGGGCCAGAGCCCATCCNONE 
J075086C22TTGTGGGCCAGAGCCCATCCNONE 
J075161L09TTGTGGGCCAGAGCCCATCCNONE 
J075177K20TTGTGGGCCAGAGCCCATCCNONE 
J090007L06TTGTGGGCCAGAGCCCATCCNONE 
J090010M02TTGTGGGCCAGAGCCCATCCNONE 
J090013M20TTGTGGGCCAGAGCCCATCCNONE 
J090044I15TTGTGGGCCAGAGCCCATCCNONE 
J090045O06TTGTGGGCCAGAGCCCATCCNONE 
J090060L04TTGTGGGCCAGAGCCCATCCNONE 
J090061C17TTGTGGGCCAGAGCCCATCCNONE 
J090062F10TTGTGGGCCAGAGCCCATCCNONE 
J090066L03TTGTGGGCCAGAGCCCATCCNONE 
J090089E13TTGTGGGCCAGAGCCCATCCNONE 
J090096D21TTGTGGGCCAGAGCCCATCCNONE 
J100039F12TTGTGGGCCAGAGCCCATCCNONE 
J100053N06TTGTGGGCCAGAGCCCATCCNONE 
Os11g0199600AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein. 
AK120040TCATGGGCCCATCACCGGCCCACANONE 
J023047I06TCATGGGCCCATCACCGGCCCACANONE 
J033064L23TCATGGGCCCATCACCGGCCCACANONE 
J033117I01TCATGGGCCCATCACCGGCCCACANONE 
J033123I18TCATGGGCCCATCACCGGCCCACANONE 
J053026H17TCATGGGCCCATCACCGGCCCACANONE 
J053078G05TCATGGGCCCATCACCGGCCCACANONE 
J065102A09TCATGGGCCCATCACCGGCCCACANONE 
J065113G11TCATGGGCCCATCACCGGCCCACANONE 
J065207F20TCATGGGCCCATCACCGGCCCACANONE 
J075027K21TCATGGGCCCATCACCGGCCCACANONE 
Os11g0209100016-063-F03ATGGCCCACGCTTGTGGGCCTGNONE 
AK064391ATGGCCCACGCTTGTGGGCCTGCyclin-like F-box domain containing protein. 
J075027K02ATGGCCCACGCTTGTGGGCCTGNONE 
J075154K15ATGGCCCACGCTTGTGGGCCTGNONE 
Os11g0227600AK101375TTGTGGGCCGCAConserved hypothetical protein. 
AK102193TTGTGGGCCGCANONE 
J033087C03TTGTGGGCCGCANONE 
Os11g0242800006-026-C12CATGGGCCCACAANONE 
006-027-E07CATGGGCCCACAANONE 
006-060-A11CATGGGCCCACAANONE 
006-097-F07CATGGGCCCACAANONE 
006-102-B06CATGGGCCCACAANONE 
009-021-H11CATGGGCCCACAANONE 
009-057-A07CATGGGCCCACAANONE 
AK061295CATGGGCCCACAASimilar to ASCAB9-A (ASCAB9-B) (Fragment). 
AK098872CATGGGCCCACAANONE 
AK104824CATGGGCCCACAANONE 
J013001B10CATGGGCCCACAANONE 
J013046D18CATGGGCCCACAANONE 
J013047P13CATGGGCCCACAANONE 
J013109A01CATGGGCCCACAANONE 
J013155M11CATGGGCCCACAANONE 
J023029I09CATGGGCCCACAANONE 
J023043A13CATGGGCCCACAANONE 
J023050C07CATGGGCCCACAANONE 
J023062G03CATGGGCCCACAANONE 
J023063A04CATGGGCCCACAANONE 
J023067A08CATGGGCCCACAANONE 
J023079D02CATGGGCCCACAANONE 
J023080I10CATGGGCCCACAANONE 
J023112D03CATGGGCCCACAANONE 
J023114E15CATGGGCCCACAANONE 
J023117C14CATGGGCCCACAANONE 
J023120L05CATGGGCCCACAANONE 
J023126C08CATGGGCCCACAANONE 
J023143A07CATGGGCCCACAANONE 
J033107J22CATGGGCCCACAANONE 
J065051P10CATGGGCCCACAANONE 
J065204H19CATGGGCCCACAANONE 
J075004E22CATGGGCCCACAANONE 
J075014D01CATGGGCCCACAANONE 
J075021B03CATGGGCCCACAANONE 
J075024L01CATGGGCCCACAANONE 
J075028K23CATGGGCCCACAANONE 
J075059G21CATGGGCCCACAANONE 
J075072K15CATGGGCCCACAANONE 
J075115M14CATGGGCCCACAANONE 
J075116I04CATGGGCCCACAANONE 
J075117D23CATGGGCCCACAANONE 
J075128N14CATGGGCCCACAANONE 
J075132P13CATGGGCCCACAANONE 
J075134M02CATGGGCCCACAANONE 
J090079D09CATGGGCCCACAANONE 
Os11g0302700AK073931TGTGGGCCCATATRecA bacterial DNA recombination family protein. 
Os11g0414000012-012-F01TCGGCCCACANONE 
AK071277TCGGCCCACAeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
J023082M08TCGGCCCACANONE 
J023083E17TCGGCCCACANONE 
J023128I07TCGGCCCACANONE 
J033098J04TCGGCCCACANONE 
J033135G10TCGGCCCACANONE 
J043007L23TCGGCCCACANONE 
J065011N07TCGGCCCACANONE 
J065016E01TCGGCCCACANONE 
J065162N12TCGGCCCACANONE 
J065164O22TCGGCCCACANONE 
J065173J06TCGGCCCACANONE 
J065200E24TCGGCCCACANONE 
J065203K20TCGGCCCACANONE 
J075033N16TCGGCCCACANONE 
J075047L06TCGGCCCACANONE 
J075064J24TCGGCCCACANONE 
J075100O07TCGGCCCACANONE 
J075121G11TCGGCCCACANONE 
J075134A13TCGGCCCACANONE 
J075190F20TCGGCCCACANONE 
J075190H08TCGGCCCACANONE 
J080033L04TCGGCCCACANONE 
J080045O09TCGGCCCACANONE 
J080064J07TCGGCCCACANONE 
J080066N22TCGGCCCACANONE 
J080075C09TCGGCCCACANONE 
J090002C08TCGGCCCACANONE 
J090058G21TCGGCCCACANONE 
J090074M07TCGGCCCACANONE 
J100090G06TCGGCCCACANONE 
Os11g0417700J075031P16CCTGGGCCCACAConserved hypothetical protein. 
J075034C16CCTGGGCCCACANONE 
J075034J22CCTGGGCCCACANONE 
J075042C07CCTGGGCCCACANONE 
J075046O07CCTGGGCCCACANONE 
J075062O13CCTGGGCCCACANONE 
J075091G08CCTGGGCCCACANONE 
J075135H20CCTGGGCCCACANONE 
J075172B13CCTGGGCCCACANONE 
J075179G14CCTGGGCCCACANONE 
Os11g0448400AB095094ATGGCCCACASimilar to Sigma factor SIG2A. 
J075053H03ATGGCCCACANONE 
J075062F23ATGGCCCACANONE 
J090029D08ATGGCCCACANONE 
Os11g0586300AK072257TGTGGGCCCCACACCCCCCACGConserved hypothetical protein. 
Os11g0595200009-005-A06AGCCCACAATGTGGGCCCCACGNONE 
AK071115AGCCCACAATGTGGGCCCCACGNONE 
AK106159AGCCCACAATGTGGGCCCCACGPAP fibrillin family protein. 
AY387683AGCCCACAATGTGGGCCCCACGNONE 
AY387684AGCCCACAATGTGGGCCCCACGNONE 
J065166K17AGCCCACAATGTGGGCCCCACGNONE 
Os11g0602600006-046-H02TGTGGGCCTANONE 
006-056-H08TGTGGGCCTANONE 
009-116-D05TGTGGGCCTANONE 
AK072671TGTGGGCCTASimilar to 40S ribosomal protein S9. 
AK104660TGTGGGCCTANONE 
J023134P20TGTGGGCCTANONE 
J023141O13TGTGGGCCTANONE 
J033066I15TGTGGGCCTANONE 
J033076A08TGTGGGCCTANONE 
J033150J23TGTGGGCCTANONE 
J065114P19TGTGGGCCTANONE 
J065176B01TGTGGGCCTANONE 
J065207H21TGTGGGCCTANONE 
J080301L21TGTGGGCCTANONE 
J080308A08TGTGGGCCTANONE 
J080318K23TGTGGGCCTANONE 
J080319F17TGTGGGCCTANONE 
J080319I10TGTGGGCCTANONE 
J090028C08TGTGGGCCTANONE 
J090051I24TGTGGGCCTANONE 
J090053L21TGTGGGCCTANONE 
J090069C20TGTGGGCCTANONE 
J100017G08TGTGGGCCTANONE 
J100042B06TGTGGGCCTANONE 
J100045G24TGTGGGCCTANONE 
J100050J19TGTGGGCCTANONE 
J100052D23TGTGGGCCTANONE 
J100053M03TGTGGGCCTANONE 
J100056D08TGTGGGCCTANONE 
J100066B19TGTGGGCCTANONE 
J100071N23TGTGGGCCTANONE 
J100074H01TGTGGGCCTANONE 
J100074H19TGTGGGCCTANONE 
J100077C06TGTGGGCCTANONE 
Os11g0648000AK066444GCCACGTGGCCCACAGGTGGGTCCCACSimilar to Na+/H+ antiporter. 
AK072026GCCACGTGGCCCACAGGTGGGTCCCACNONE 
Os11g0677400AK069580TCTGGGCCCACAPectinesterase inhibitor domain containing protein. 
J023020A19TCTGGGCCCACANONE 
Os12g0111600009-151-A07GCGGCCCACAANONE 
AK119685GCGGCCCACAANONE 
AK120264GCGGCCCACAAHypoxia induced protein conserved region family protein. 
J013047D01GCGGCCCACAANONE 
J023111D22GCGGCCCACAANONE 
J023128C07GCGGCCCACAANONE 
J065170J03GCGGCCCACAANONE 
J065198L01GCGGCCCACAANONE 
J100037I18GCGGCCCACAANONE 
J100073O19GCGGCCCACAANONE 
Os12g0115900AK058318TGTGGGCCTTElongation factor P/YeiP family protein. 
J065078K17TGTGGGCCTTNONE 
J065102G03TGTGGGCCTTNONE 
J065122B14TGTGGGCCTTNONE 
J065122C10TGTGGGCCTTNONE 
J065134I23TGTGGGCCTTNONE 
J065176B12TGTGGGCCTTNONE 
Os12g0133600AK103096TTGTGGGCCTTGConserved hypothetical protein. 
J033118M03TTGTGGGCCTTGNONE 
Os12g0156400012-065-D02CCGTGGGCCCACANONE 
AK072086CCGTGGGCCCACANONE 
AK099278CCGTGGGCCCACADcp1-like decapping family protein. 
J013063H09CCGTGGGCCCACANONE 
J023125D09CCGTGGGCCCACANONE 
J023149G21CCGTGGGCCCACANONE 
J033064E07CCGTGGGCCCACANONE 
J033093C07CCGTGGGCCCACANONE 
J033107E06CCGTGGGCCCACANONE 
J075172A11CCGTGGGCCCACANONE 
J090009E07CCGTGGGCCCACANONE 
J090023F13CCGTGGGCCCACANONE 
J090071N18CCGTGGGCCCACANONE 
Os12g0158700J065021C04TGTGGGCCCGGGNONE 
J090082H20TGTGGGCCCGGGConserved hypothetical protein. 
Os12g0204500011-012-A10TGGGGCCCACAANONE 
011-044-C12TGGGGCCCACAANONE 
AK069867TGGGGCCCACAAProtein of unknown function DUF579, plant family protein. 
J013039L02TGGGGCCCACAANONE 
J023038F14TGGGGCCCACAANONE 
J075123I24TGGGGCCCACAANONE 
Os12g0210200AF309381CGGGCCCACANONE 
AF309381TGTGGGCCCGGGNONE 
AK069105CGGGCCCACASimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
AK069105TGTGGGCCCGGGSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
J023004I03CGGGCCCACANONE 
J023004I03TGTGGGCCCGGGNONE 
J033069C11CGGGCCCACANONE 
J033069C11TGTGGGCCCGGGNONE 
J065087E20CGGGCCCACANONE 
J065087E20TGTGGGCCCGGGNONE 
J065097G21CGGGCCCACANONE 
J065097G21TGTGGGCCCGGGNONE 
Os12g0230600AK072568TGTGGGCCCCACCCACACGProtein of unknown function DUF1685 family protein. 
Os12g0242500J065129F10GTGTGGGCCATNONE 
J090032G12GTGTGGGCCATConserved hypothetical protein. 
Os12g0266000J075093G23TTCGTGGGCCCACACNONE 
Os12g0278900AK106816CACGGCCCACAPeptidase C1A, papain family protein. 
Os12g0408000AK109709ATGGCCCACAAProtein of unknown function DUF594 family protein. 
J075021B20ATGGCCCACAANONE 
J075034G20ATGGCCCACAANONE 
J075087F21ATGGCCCACAANONE 
J075177E12ATGGCCCACAANONE 
J075194D14ATGGCCCACAANONE 
Os12g0557800AK121691CACGGCCCACAProtein prenyltransferase domain containing protein. 
J013095M03CACGGCCCACANONE 
J033071H11CACGGCCCACANONE 
J065101B02CACGGCCCACANONE 
Os12g0566000AK070617TGTGGGCCCTHCO3- transporter, eukaryote family protein. 
AK100510TGTGGGCCCTNONE 
AY339063TGTGGGCCCTNONE 
J023099M11TGTGGGCCCTNONE 
J023110H10TGTGGGCCCTNONE 
Os12g0566900AK109171TGTGGGCCCCACCNONE 
Os12g0572400016-084-F04ATGGCCCACAANONE 
AK065531ATGGCCCACAASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03ATGGCCCACAANONE 
J013034H02ATGGCCCACAANONE 
J033117N05ATGGCCCACAANONE 
J065027L09ATGGCCCACAANONE 
J065037D09ATGGCCCACAANONE 
J065197I09ATGGCCCACAANONE 
J090045C01ATGGCCCACAANONE 
J100031E11ATGGCCCACAANONE 
Os12g0580600AK108584GTGGGGGCCCACACConserved hypothetical protein. 
Os12g0581700AK111563CGTGGGGCCCACAConserved hypothetical protein. 
J023011D12CGTGGGGCCCACANONE 
J065176G05CGTGGGGCCCACANONE 
J065192E06CGTGGGGCCCACANONE 
J100075L05CGTGGGGCCCACANONE 
Os12g0616900AK063753TGTGGGCCCCACCSimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464TGTGGGCCCCACCNONE 
J033126J16TGTGGGCCCCACCNONE 
J065140B05TGTGGGCCCCACCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.