version

Summary of OsREG628 (All List)

OrganismOryza sativa  
IDOsREG628  
SequenceGGCCCACC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count5439  

Entry Sequences (5439 entries)

LocusGene modelSequenceDescription
Os01g0103600006-072-A01GTGGTGGGCCCCCACNONE 
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK102848GTGGTGGGCCCCCACNONE 
J033036P20GTGGTGGGCCCCCACNONE 
J065171N21GTGGTGGGCCCCCACNONE 
J065209M02GTGGTGGGCCCCCACNONE 
J075067A03GTGGTGGGCCCCCACNONE 
J075110C09GTGGTGGGCCCCCACNONE 
Os01g0131600006-030-A03GGGTGGGCCCACGCGTNONE 
006-030-A03GTGGCCCACCCGNONE 
006-049-C10GGGTGGGCCCACGCGTNONE 
006-049-C10GTGGCCCACCCGNONE 
006-054-E02GGGTGGGCCCACGCGTNONE 
006-054-E02GTGGCCCACCCGNONE 
011-035-H02GGGTGGGCCCACGCGTNONE 
011-035-H02GTGGCCCACCCGNONE 
011-036-E04GGGTGGGCCCACGCGTNONE 
011-036-E04GTGGCCCACCCGNONE 
012-047-C08GGGTGGGCCCACGCGTNONE 
012-047-C08GTGGCCCACCCGNONE 
012-079-F08GGGTGGGCCCACGCGTNONE 
012-079-F08GTGGCCCACCCGNONE 
012-097-C02GGGTGGGCCCACGCGTNONE 
012-097-C02GTGGCCCACCCGNONE 
012-100-A07GGGTGGGCCCACGCGTNONE 
012-100-A07GTGGCCCACCCGNONE 
013-015-H05GGGTGGGCCCACGCGTNONE 
013-015-H05GTGGCCCACCCGNONE 
013-047-A03GGGTGGGCCCACGCGTNONE 
013-047-A03GTGGCCCACCCGNONE 
013-051-B05GGGTGGGCCCACGCGTNONE 
013-051-B05GTGGCCCACCCGNONE 
013-061-G02GGGTGGGCCCACGCGTNONE 
013-061-G02GTGGCCCACCCGNONE 
013-077-H02GGGTGGGCCCACGCGTNONE 
013-077-H02GTGGCCCACCCGNONE 
015-005-D04GGGTGGGCCCACGCGTNONE 
015-005-D04GTGGCCCACCCGNONE 
015-064-B06GGGTGGGCCCACGCGTNONE 
015-064-B06GTGGCCCACCCGNONE 
015-072-D02GGGTGGGCCCACGCGTNONE 
015-072-D02GTGGCCCACCCGNONE 
016-073-E09GGGTGGGCCCACGCGTNONE 
016-073-E09GTGGCCCACCCGNONE 
016-088-H03GGGTGGGCCCACGCGTNONE 
016-088-H03GTGGCCCACCCGNONE 
AK062063GGGTGGGCCCACGCGTNONE 
AK062063GTGGCCCACCCGNONE 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GTGGCCCACCCGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277GGGTGGGCCCACGCGTNONE 
AK102277GTGGCCCACCCGNONE 
AK119645GGGTGGGCCCACGCGTNONE 
AK119645GTGGCCCACCCGNONE 
AY341828GGGTGGGCCCACGCGTNONE 
AY341828GTGGCCCACCCGNONE 
J013036O08GGGTGGGCCCACGCGTNONE 
J013036O08GTGGCCCACCCGNONE 
J013037M17GGGTGGGCCCACGCGTNONE 
J013037M17GTGGCCCACCCGNONE 
J013039B11GGGTGGGCCCACGCGTNONE 
J013039B11GTGGCCCACCCGNONE 
J013039L20GGGTGGGCCCACGCGTNONE 
J013039L20GTGGCCCACCCGNONE 
J013047B20GGGTGGGCCCACGCGTNONE 
J013047B20GTGGCCCACCCGNONE 
J013048E23GGGTGGGCCCACGCGTNONE 
J013048E23GTGGCCCACCCGNONE 
J013051E12GGGTGGGCCCACGCGTNONE 
J013051E12GTGGCCCACCCGNONE 
J013051F12GGGTGGGCCCACGCGTNONE 
J013051F12GTGGCCCACCCGNONE 
J013056B05GGGTGGGCCCACGCGTNONE 
J013056B05GTGGCCCACCCGNONE 
J013057N24GGGTGGGCCCACGCGTNONE 
J013057N24GTGGCCCACCCGNONE 
J013064D21GGGTGGGCCCACGCGTNONE 
J013064D21GTGGCCCACCCGNONE 
J013065G24GGGTGGGCCCACGCGTNONE 
J013065G24GTGGCCCACCCGNONE 
J013075L13GGGTGGGCCCACGCGTNONE 
J013075L13GTGGCCCACCCGNONE 
J013075L24GGGTGGGCCCACGCGTNONE 
J013075L24GTGGCCCACCCGNONE 
J013092F04GGGTGGGCCCACGCGTNONE 
J013092F04GTGGCCCACCCGNONE 
J013092F10GGGTGGGCCCACGCGTNONE 
J013092F10GTGGCCCACCCGNONE 
J013092M16GGGTGGGCCCACGCGTNONE 
J013092M16GTGGCCCACCCGNONE 
J013096K06GGGTGGGCCCACGCGTNONE 
J013096K06GTGGCCCACCCGNONE 
J013111F10GGGTGGGCCCACGCGTNONE 
J013111F10GTGGCCCACCCGNONE 
J013120B17GGGTGGGCCCACGCGTNONE 
J013120B17GTGGCCCACCCGNONE 
J013120P07GGGTGGGCCCACGCGTNONE 
J013120P07GTGGCCCACCCGNONE 
J013122F18GGGTGGGCCCACGCGTNONE 
J013122F18GTGGCCCACCCGNONE 
J013122H23GGGTGGGCCCACGCGTNONE 
J013122H23GTGGCCCACCCGNONE 
J013126I15GGGTGGGCCCACGCGTNONE 
J013126I15GTGGCCCACCCGNONE 
J013126L17GGGTGGGCCCACGCGTNONE 
J013126L17GTGGCCCACCCGNONE 
J013129C15GGGTGGGCCCACGCGTNONE 
J013129C15GTGGCCCACCCGNONE 
J013146A04GGGTGGGCCCACGCGTNONE 
J013146A04GTGGCCCACCCGNONE 
J013146A06GGGTGGGCCCACGCGTNONE 
J013146A06GTGGCCCACCCGNONE 
J013153F01GGGTGGGCCCACGCGTNONE 
J013153F01GTGGCCCACCCGNONE 
J013156O06GGGTGGGCCCACGCGTNONE 
J013156O06GTGGCCCACCCGNONE 
J013162D05GGGTGGGCCCACGCGTNONE 
J013162D05GTGGCCCACCCGNONE 
J023008N04GGGTGGGCCCACGCGTNONE 
J023008N04GTGGCCCACCCGNONE 
J023010D06GGGTGGGCCCACGCGTNONE 
J023010D06GTGGCCCACCCGNONE 
J023011I23GGGTGGGCCCACGCGTNONE 
J023011I23GTGGCCCACCCGNONE 
J023023I15GGGTGGGCCCACGCGTNONE 
J023023I15GTGGCCCACCCGNONE 
J023025C08GGGTGGGCCCACGCGTNONE 
J023025C08GTGGCCCACCCGNONE 
J023029H02GGGTGGGCCCACGCGTNONE 
J023029H02GTGGCCCACCCGNONE 
J023033C18GGGTGGGCCCACGCGTNONE 
J023033C18GTGGCCCACCCGNONE 
J023037D21GGGTGGGCCCACGCGTNONE 
J023037D21GTGGCCCACCCGNONE 
J023049F17GGGTGGGCCCACGCGTNONE 
J023049F17GTGGCCCACCCGNONE 
J023052B15GGGTGGGCCCACGCGTNONE 
J023052B15GTGGCCCACCCGNONE 
J023061D03GGGTGGGCCCACGCGTNONE 
J023061D03GTGGCCCACCCGNONE 
J023062M01GGGTGGGCCCACGCGTNONE 
J023062M01GTGGCCCACCCGNONE 
J023089D24GGGTGGGCCCACGCGTNONE 
J023089D24GTGGCCCACCCGNONE 
J023109J20GGGTGGGCCCACGCGTNONE 
J023109J20GTGGCCCACCCGNONE 
J023109M21GGGTGGGCCCACGCGTNONE 
J023109M21GTGGCCCACCCGNONE 
J023120N04GGGTGGGCCCACGCGTNONE 
J023120N04GTGGCCCACCCGNONE 
J023122A04GGGTGGGCCCACGCGTNONE 
J023122A04GTGGCCCACCCGNONE 
J023134F23GGGTGGGCCCACGCGTNONE 
J023134F23GTGGCCCACCCGNONE 
J023149E20GGGTGGGCCCACGCGTNONE 
J023149E20GTGGCCCACCCGNONE 
J033022A12GGGTGGGCCCACGCGTNONE 
J033022A12GTGGCCCACCCGNONE 
J033022C04GGGTGGGCCCACGCGTNONE 
J033022C04GTGGCCCACCCGNONE 
J033024K06GGGTGGGCCCACGCGTNONE 
J033024K06GTGGCCCACCCGNONE 
J033026F23GGGTGGGCCCACGCGTNONE 
J033026F23GTGGCCCACCCGNONE 
J033029J19GGGTGGGCCCACGCGTNONE 
J033029J19GTGGCCCACCCGNONE 
J033040H20GGGTGGGCCCACGCGTNONE 
J033040H20GTGGCCCACCCGNONE 
J033042P21GGGTGGGCCCACGCGTNONE 
J033042P21GTGGCCCACCCGNONE 
J033043F14GGGTGGGCCCACGCGTNONE 
J033043F14GTGGCCCACCCGNONE 
J033044G11GGGTGGGCCCACGCGTNONE 
J033044G11GTGGCCCACCCGNONE 
J033052L10GGGTGGGCCCACGCGTNONE 
J033052L10GTGGCCCACCCGNONE 
J033052O03GGGTGGGCCCACGCGTNONE 
J033052O03GTGGCCCACCCGNONE 
J033052P03GGGTGGGCCCACGCGTNONE 
J033052P03GTGGCCCACCCGNONE 
J033079B20GGGTGGGCCCACGCGTNONE 
J033079B20GTGGCCCACCCGNONE 
J033089D21GGGTGGGCCCACGCGTNONE 
J033089D21GTGGCCCACCCGNONE 
J033094P04GGGTGGGCCCACGCGTNONE 
J033094P04GTGGCCCACCCGNONE 
J033103N02GGGTGGGCCCACGCGTNONE 
J033103N02GTGGCCCACCCGNONE 
J033110J19GGGTGGGCCCACGCGTNONE 
J033110J19GTGGCCCACCCGNONE 
J033114E17GGGTGGGCCCACGCGTNONE 
J033114E17GTGGCCCACCCGNONE 
J033115K04GGGTGGGCCCACGCGTNONE 
J033115K04GTGGCCCACCCGNONE 
J033119I06GGGTGGGCCCACGCGTNONE 
J033119I06GTGGCCCACCCGNONE 
J033121L10GGGTGGGCCCACGCGTNONE 
J033121L10GTGGCCCACCCGNONE 
J033123H14GGGTGGGCCCACGCGTNONE 
J033123H14GTGGCCCACCCGNONE 
J033136H10GGGTGGGCCCACGCGTNONE 
J033136H10GTGGCCCACCCGNONE 
J033139L07GGGTGGGCCCACGCGTNONE 
J033139L07GTGGCCCACCCGNONE 
J033143G23GGGTGGGCCCACGCGTNONE 
J033143G23GTGGCCCACCCGNONE 
J043021F16GGGTGGGCCCACGCGTNONE 
J043021F16GTGGCCCACCCGNONE 
J080304G01GGGTGGGCCCACGCGTNONE 
J080304G01GTGGCCCACCCGNONE 
J080305H24GGGTGGGCCCACGCGTNONE 
J080305H24GTGGCCCACCCGNONE 
J080309B11GGGTGGGCCCACGCGTNONE 
J080309B11GTGGCCCACCCGNONE 
J080315N09GGGTGGGCCCACGCGTNONE 
J080315N09GTGGCCCACCCGNONE 
J080319J20GGGTGGGCCCACGCGTNONE 
J080319J20GTGGCCCACCCGNONE 
J090014D01GGGTGGGCCCACGCGTNONE 
J090014D01GTGGCCCACCCGNONE 
J090067F08GGGTGGGCCCACGCGTNONE 
J090067F08GTGGCCCACCCGNONE 
J090079P18GGGTGGGCCCACGCGTNONE 
J090079P18GTGGCCCACCCGNONE 
J090082K13GGGTGGGCCCACGCGTNONE 
J090082K13GTGGCCCACCCGNONE 
J090093K17GGGTGGGCCCACGCGTNONE 
J090093K17GTGGCCCACCCGNONE 
J090099G18GGGTGGGCCCACGCGTNONE 
J090099G18GTGGCCCACCCGNONE 
J100022K14GGGTGGGCCCACGCGTNONE 
J100022K14GTGGCCCACCCGNONE 
J100052G17GGGTGGGCCCACGCGTNONE 
J100052G17GTGGCCCACCCGNONE 
Os01g0150100J023078H07CTTGGGCCCACCTGTCNONE 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
Os01g0164500AK068747GCGGCCCACCASimilar to ATP-dependent RNA helicase-like protein. 
AK103737GCGGCCCACCANONE 
Os01g0169800006-062-A02GGTGGGCCGGCNONE 
AK061054GGTGGGCCGGCAllinase, C-terminal domain containing protein. 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
J033107B12CAGGTGGGCCCCACCNONE 
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK102544CACTGACAGCCCGGGCCCACCNONE 
J023047L21CACTGACAGCCCGGGCCCACCNONE 
J023135I09CACTGACAGCCCGGGCCCACCNONE 
J033028G17CACTGACAGCCCGGGCCCACCNONE 
J065164L07CACTGACAGCCCGGGCCCACCNONE 
J065193F22CACTGACAGCCCGGGCCCACCNONE 
J075035I10CACTGACAGCCCGGGCCCACCNONE 
J075168H15CACTGACAGCCCGGGCCCACCNONE 
Os01g0185200009-146-B06CCCGTGGGCCCACCCNONE 
009-163-F01CCCGTGGGCCCACCCNONE 
AK062984CCCGTGGGCCCACCCNONE 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222CCCGTGGGCCCACCCNONE 
AK111284CCCGTGGGCCCACCCNONE 
Os01g0191800AK061360AGCCCATAAAGGCCCACCTNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
Os01g0270100006-096-H09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-009-C10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-054-E06GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
014-085-F09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK073275GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK104155GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J033025K21GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075065H10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075143G10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J100059J02GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
Os01g0273300Os01g0273300CTGGGGCCCACCCBSD domain containing protein. 
Os01g0273800AK109645CAGGTGGGCCCCAFAD dependent oxidoreductase family protein. 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0277700006-081-F10AGGTGGGCCCCACCNONE 
014-013-D02AGGTGGGCCCCACCNONE 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
AK099198AGGTGGGCCCCACCNONE 
J023115B14AGGTGGGCCCCACCNONE 
J065017F22AGGTGGGCCCCACCNONE 
J065090C03AGGTGGGCCCCACCNONE 
J065165H07AGGTGGGCCCCACCNONE 
Os01g0286600AB057749GGTGGGCCATSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
AK104939TTTTGGGCCCACCACNONE 
J033044B03TTTTGGGCCCACCACNONE 
J033060E12TTTTGGGCCCACCACNONE 
J043037E21TTTTGGGCCCACCACNONE 
J065019O18TTTTGGGCCCACCACNONE 
J065025P22TTTTGGGCCCACCACNONE 
J065042P06TTTTGGGCCCACCACNONE 
J065074C19TTTTGGGCCCACCACNONE 
J065074E13TTTTGGGCCCACCACNONE 
J065094E05TTTTGGGCCCACCACNONE 
J065108N08TTTTGGGCCCACCACNONE 
J065134L13TTTTGGGCCCACCACNONE 
J065152N24TTTTGGGCCCACCACNONE 
J065162N24TTTTGGGCCCACCACNONE 
J065170P16TTTTGGGCCCACCACNONE 
J065177M20TTTTGGGCCCACCACNONE 
J065187N01TTTTGGGCCCACCACNONE 
J075012N12TTTTGGGCCCACCACNONE 
J075046C17TTTTGGGCCCACCACNONE 
J075055N06TTTTGGGCCCACCACNONE 
J075141H03TTTTGGGCCCACCACNONE 
J075150M11TTTTGGGCCCACCACNONE 
J090005B16TTTTGGGCCCACCACNONE 
J090079L11TTTTGGGCCCACCACNONE 
J100039F16TTTTGGGCCCACCACNONE 
Os01g0323600J023095C13GGGTGGGCCCCACTCCNONE 
Os01g0332100AK120720CAGGTGGGCCCAGCSimilar to Neutral invertase-like protein (Fragment). 
AY187621CAGGTGGGCCCAGCNONE 
J080021I24CAGGTGGGCCCAGCNONE 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
AK069619GGGGCCCACCCGProtein of unknown function DUF789 family protein. 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
AK104278CTGACAGGTGGGCCCTNONE 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
J013033M01GGGTGGGCCCCACACGNONE 
J013159H24GGGTGGGCCCCACACGNONE 
J023008E13GGGTGGGCCCCACACGNONE 
J023030I11GGGTGGGCCCCACACGNONE 
J065137G08GGGTGGGCCCCACACGNONE 
J065139H16GGGTGGGCCCCACACGNONE 
J065154K13GGGTGGGCCCCACACGNONE 
J075176C02GGGTGGGCCCCACACGNONE 
Os01g0558600006-120-G12GGGTGGGCCCCACGNONE 
J013100N20GGGTGGGCCCCACGNONE 
J033043P09GGGTGGGCCCCACGNONE 
J033125M18GGGTGGGCCCCACGNONE 
J053043N11GGGTGGGCCCCACGNONE 
J065008E07GGGTGGGCCCCACGNONE 
J065080O16GGGTGGGCCCCACGNONE 
J075002G24GGGTGGGCCCCACGNONE 
J075123C09GGGTGGGCCCCACGNONE 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0560200AK102003GGGTGGGCCCACCSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06GGGTGGGCCCACCNONE 
J065092F14GGGTGGGCCCACCNONE 
J065106D04GGGTGGGCCCACCNONE 
J065194K23GGGTGGGCCCACCNONE 
Os01g0590300014-089-E04CGGGTGGGCCGGGNONE 
AK063740CGGGTGGGCCGGGConserved hypothetical protein. 
Os01g0593700Os01g0593700GCGGCCCACCSulphate anion transporter family protein. 
Os01g0618200AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0618500011-019-D03GAGGCCCACTACGGCCCACCTNONE 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
J013020E19GAGGCCCACTACGGCCCACCTNONE 
J033046J12GAGGCCCACTACGGCCCACCTNONE 
J033055D06GAGGCCCACTACGGCCCACCTNONE 
Os01g0704100AK072215ATGGCCCACCACSimilar to Membrane transporter. 
AK109776ATGGCCCACCACNONE 
J080037E03ATGGCCCACCACNONE 
J080041H13ATGGCCCACCACNONE 
J080046B15ATGGCCCACCACNONE 
J080058K14ATGGCCCACCACNONE 
J080065E14ATGGCCCACCACNONE 
J080079C08ATGGCCCACCACNONE 
J080088J12ATGGCCCACCACNONE 
J080088M19ATGGCCCACCACNONE 
J100043G11ATGGCCCACCACNONE 
J100059M22ATGGCCCACCACNONE 
Os01g0707300AK059962TGCGGGCCCACCTNONE 
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0725900AK108128TCGGCCCACCTPollen Ole e 1 allergen and extensin domain containing protein. 
J075119G24TCGGCCCACCTNONE 
J075150F06TCGGCCCACCTNONE 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
AK109542CAGGTGGGCCCACGGNONE 
Os01g0757200AB092485GAGGCCCACCCNONE 
AK060666GAGGCCCACCCNONE 
AK060714GAGGCCCACCCNONE 
AK099350GAGGCCCACCCNONE 
AK101713GAGGCCCACCCSimilar to GA 2-oxidase 4. 
Os01g0764000006-021-G03GACGGCCCACCCACCAACNONE 
006-025-C07GACGGCCCACCCACCAACNONE 
006-029-G11GACGGCCCACCCACCAACNONE 
006-030-C04GACGGCCCACCCACCAACNONE 
006-035-E05GACGGCCCACCCACCAACNONE 
006-037-G01GACGGCCCACCCACCAACNONE 
006-038-C01GACGGCCCACCCACCAACNONE 
006-039-G05GACGGCCCACCCACCAACNONE 
006-042-E11GACGGCCCACCCACCAACNONE 
006-044-H04GACGGCCCACCCACCAACNONE 
006-045-A10GACGGCCCACCCACCAACNONE 
006-045-C05GACGGCCCACCCACCAACNONE 
006-047-A11GACGGCCCACCCACCAACNONE 
006-048-H10GACGGCCCACCCACCAACNONE 
006-050-C01GACGGCCCACCCACCAACNONE 
006-050-H11GACGGCCCACCCACCAACNONE 
006-051-G10GACGGCCCACCCACCAACNONE 
006-051-G11GACGGCCCACCCACCAACNONE 
006-056-B04GACGGCCCACCCACCAACNONE 
006-063-F04GACGGCCCACCCACCAACNONE 
006-063-H12GACGGCCCACCCACCAACNONE 
006-065-G09GACGGCCCACCCACCAACNONE 
006-067-F11GACGGCCCACCCACCAACNONE 
006-073-D10GACGGCCCACCCACCAACNONE 
006-074-G09GACGGCCCACCCACCAACNONE 
006-075-D04GACGGCCCACCCACCAACNONE 
006-077-C10GACGGCCCACCCACCAACNONE 
006-082-A10GACGGCCCACCCACCAACNONE 
006-084-C12GACGGCCCACCCACCAACNONE 
006-085-F05GACGGCCCACCCACCAACNONE 
006-087-H12GACGGCCCACCCACCAACNONE 
006-092-E10GACGGCCCACCCACCAACNONE 
006-094-C06GACGGCCCACCCACCAACNONE 
006-096-G11GACGGCCCACCCACCAACNONE 
006-097-H11GACGGCCCACCCACCAACNONE 
006-101-A07GACGGCCCACCCACCAACNONE 
006-101-G08GACGGCCCACCCACCAACNONE 
006-110-E08GACGGCCCACCCACCAACNONE 
006-111-D04GACGGCCCACCCACCAACNONE 
006-116-H04GACGGCCCACCCACCAACNONE 
AK058894GACGGCCCACCCACCAACNONE 
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GACGGCCCACCCACCAACNONE 
J013119N15GACGGCCCACCCACCAACNONE 
J013123P15GACGGCCCACCCACCAACNONE 
J023055F24GACGGCCCACCCACCAACNONE 
J023125K17GACGGCCCACCCACCAACNONE 
J053050A20GACGGCCCACCCACCAACNONE 
J053056P10GACGGCCCACCCACCAACNONE 
J053074D19GACGGCCCACCCACCAACNONE 
J053078A14GACGGCCCACCCACCAACNONE 
J053086P10GACGGCCCACCCACCAACNONE 
J053094N23GACGGCCCACCCACCAACNONE 
J053095M23GACGGCCCACCCACCAACNONE 
J065006D02GACGGCCCACCCACCAACNONE 
J065030A17GACGGCCCACCCACCAACNONE 
J065030K04GACGGCCCACCCACCAACNONE 
J065035L12GACGGCCCACCCACCAACNONE 
J065046E12GACGGCCCACCCACCAACNONE 
J065065H19GACGGCCCACCCACCAACNONE 
J065073C01GACGGCCCACCCACCAACNONE 
J065105F01GACGGCCCACCCACCAACNONE 
J065131N16GACGGCCCACCCACCAACNONE 
J065144O13GACGGCCCACCCACCAACNONE 
J065160E12GACGGCCCACCCACCAACNONE 
J065160K02GACGGCCCACCCACCAACNONE 
J065163F09GACGGCCCACCCACCAACNONE 
J065165E18GACGGCCCACCCACCAACNONE 
J065174E04GACGGCCCACCCACCAACNONE 
J065175O08GACGGCCCACCCACCAACNONE 
J065191N24GACGGCCCACCCACCAACNONE 
J065193D19GACGGCCCACCCACCAACNONE 
J065198D04GACGGCCCACCCACCAACNONE 
J065200G09GACGGCCCACCCACCAACNONE 
J075016L06GACGGCCCACCCACCAACNONE 
J075017J11GACGGCCCACCCACCAACNONE 
J075019L08GACGGCCCACCCACCAACNONE 
J075028M08GACGGCCCACCCACCAACNONE 
J075029K05GACGGCCCACCCACCAACNONE 
J075039K04GACGGCCCACCCACCAACNONE 
J075047J22GACGGCCCACCCACCAACNONE 
J075079H13GACGGCCCACCCACCAACNONE 
J075095K14GACGGCCCACCCACCAACNONE 
J075111D21GACGGCCCACCCACCAACNONE 
J075131A19GACGGCCCACCCACCAACNONE 
J075147G20GACGGCCCACCCACCAACNONE 
J075158F11GACGGCCCACCCACCAACNONE 
J075166N10GACGGCCCACCCACCAACNONE 
J075196G09GACGGCCCACCCACCAACNONE 
J075198I24GACGGCCCACCCACCAACNONE 
J090001L08GACGGCCCACCCACCAACNONE 
J090026G07GACGGCCCACCCACCAACNONE 
J090050M15GACGGCCCACCCACCAACNONE 
J090071A01GACGGCCCACCCACCAACNONE 
J090072P16GACGGCCCACCCACCAACNONE 
J090078D22GACGGCCCACCCACCAACNONE 
J090089C18GACGGCCCACCCACCAACNONE 
J100019B07GACGGCCCACCCACCAACNONE 
J100019H15GACGGCCCACCCACCAACNONE 
J100019P09GACGGCCCACCCACCAACNONE 
J100023A16GACGGCCCACCCACCAACNONE 
J100023B09GACGGCCCACCCACCAACNONE 
J100026O18GACGGCCCACCCACCAACNONE 
J100027E09GACGGCCCACCCACCAACNONE 
J100028F22GACGGCCCACCCACCAACNONE 
J100029P05GACGGCCCACCCACCAACNONE 
J100031M19GACGGCCCACCCACCAACNONE 
J100032A11GACGGCCCACCCACCAACNONE 
J100036G19GACGGCCCACCCACCAACNONE 
J100038E22GACGGCCCACCCACCAACNONE 
J100040A12GACGGCCCACCCACCAACNONE 
J100040L02GACGGCCCACCCACCAACNONE 
J100043O13GACGGCCCACCCACCAACNONE 
J100045E20GACGGCCCACCCACCAACNONE 
J100046H18GACGGCCCACCCACCAACNONE 
J100047E08GACGGCCCACCCACCAACNONE 
J100050E08GACGGCCCACCCACCAACNONE 
J100050P14GACGGCCCACCCACCAACNONE 
J100051G10GACGGCCCACCCACCAACNONE 
J100052L12GACGGCCCACCCACCAACNONE 
J100056G24GACGGCCCACCCACCAACNONE 
J100066B15GACGGCCCACCCACCAACNONE 
J100068O15GACGGCCCACCCACCAACNONE 
J100070J16GACGGCCCACCCACCAACNONE 
J100074I22GACGGCCCACCCACCAACNONE 
J100075M12GACGGCCCACCCACCAACNONE 
J100077M09GACGGCCCACCCACCAACNONE 
J100077O14GACGGCCCACCCACCAACNONE 
J100079J08GACGGCCCACCCACCAACNONE 
J100080I16GACGGCCCACCCACCAACNONE 
Os01g0764300J090053G03TCAGGCCCACCProtein of unknown function DUF155 family protein. 
J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
Os01g0767100AK109493GGGGCCCACCTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0770400006-112-B08GTGCGGTGGGCCGGTNONE 
AK061253GTGCGGTGGGCCGGTNONE 
AK061585GTGCGGTGGGCCGGTCyclin-like F-box domain containing protein. 
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein. 
AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
Os01g0811100006-061-F11TGGTGGGCCGCNONE 
AB026562TGGTGGGCCGCNONE 
AK061784TGGTGGGCCGCNONE 
AK103541TGGTGGGCCGCProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
J013020B12TGGTGGGCCGCNONE 
J013022J21TGGTGGGCCGCNONE 
J013056G19TGGTGGGCCGCNONE 
J013060O07TGGTGGGCCGCNONE 
J013110I07TGGTGGGCCGCNONE 
J013160D19TGGTGGGCCGCNONE 
J090035A13TGGTGGGCCGCNONE 
Os01g0812200003-009-E06GGTGGGGCCCACCTNONE 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AK104334GGTGGGGCCCACCTNONE 
J013030E13GGTGGGGCCCACCTNONE 
J013169M21GGTGGGGCCCACCTNONE 
J023012J16GGTGGGGCCCACCTNONE 
J023103F22GGTGGGGCCCACCTNONE 
J023123A01GGTGGGGCCCACCTNONE 
J023131F07GGTGGGGCCCACCTNONE 
J023146I01GGTGGGGCCCACCTNONE 
J033040K02GGTGGGGCCCACCTNONE 
J033079F06GGTGGGGCCCACCTNONE 
J033105G06GGTGGGGCCCACCTNONE 
J033117E08GGTGGGGCCCACCTNONE 
J043030C01GGTGGGGCCCACCTNONE 
J053043H16GGTGGGGCCCACCTNONE 
J053061H01GGTGGGGCCCACCTNONE 
J065044A03GGTGGGGCCCACCTNONE 
J065068E12GGTGGGGCCCACCTNONE 
J065069D09GGTGGGGCCCACCTNONE 
J065143M19GGTGGGGCCCACCTNONE 
J065193C10GGTGGGGCCCACCTNONE 
J065209D07GGTGGGGCCCACCTNONE 
J090083C17GGTGGGGCCCACCTNONE 
J090086G06GGTGGGGCCCACCTNONE 
J090093I09GGTGGGGCCCACCTNONE 
J100023G21GGTGGGGCCCACCTNONE 
J100025D15GGTGGGGCCCACCTNONE 
J100034B13GGTGGGGCCCACCTNONE 
J100040F10GGTGGGGCCCACCTNONE 
J100051E15GGTGGGGCCCACCTNONE 
J100056L08GGTGGGGCCCACCTNONE 
J100057H04GGTGGGGCCCACCTNONE 
J100085K20GGTGGGGCCCACCTNONE 
J100088G21GGTGGGGCCCACCTNONE 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0830500006-117-F06GTGGCCCACCACNONE 
AK061475GTGGCCCACCACNONE 
AK105801GTGGCCCACCAC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17GTGGCCCACCACNONE 
J065211O10GTGGCCCACCACNONE 
Os01g0832200004-009-E08GGTGGGCCCATCANONE 
009-103-F06GGTGGGCCCATCANONE 
AK060017GGTGGGCCCATCANONE 
AK068980GGTGGGCCCATCAConserved hypothetical protein. 
J023085I24GGTGGGCCCATCANONE 
J090016I03GGTGGGCCCATCANONE 
J090078K06GGTGGGCCCATCANONE 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
J065005C19CGGGTGGGCCCGGCNONE 
J065025H20CGGGTGGGCCCGGCNONE 
J065061E22CGGGTGGGCCCGGCNONE 
J065065F14CGGGTGGGCCCGGCNONE 
J065083O21CGGGTGGGCCCGGCNONE 
J065201G05CGGGTGGGCCCGGCNONE 
Os01g0846300AK065949CGGGTGGGCCCCSimilar to Protein phosphatase 2C. 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0865600AK068033GGTGGGCCGTCNONE 
AK099677GGTGGGCCGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J090007G21GGTGGGCCGTCNONE 
J090023C20GGTGGGCCGTCNONE 
J090039J16GGTGGGCCGTCNONE 
J090054K15GGTGGGCCGTCNONE 
Os01g0867900AK061366CGGCCCACCCGProtein of unknown function DUF502 family protein. 
Os01g0869000AK067351CGGGTGGGGCCCACCGCCCACGCCCAAACNONE 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0877500AK101067GGTGGGCCCGGAProtein of unknown function UPF0054 family protein. 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0896400AK107067CGTGTGGCCCACCCGConserved hypothetical protein. 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0913800011-060-B02AACTGGGCCCACCANONE 
016-088-H02AACTGGGCCCACCAProtein prenyltransferase domain containing protein. 
Os01g0923300AK067520GGGGCCCACCCBS domain containing protein. 
Os01g0937300AK062872AGGTGGGCCGTCNONE 
J033136K12AGGTGGGCCGTCNONE 
J053048E20AGGTGGGCCGTCNONE 
J053088K08AGGTGGGCCGTCNONE 
J065011G23AGGTGGGCCGTCNONE 
J065202J09AGGTGGGCCGTCNONE 
Os01g0949200AK102412CGGACGGCCCACCANONE 
J033093A04CGGACGGCCCACCANONE 
J065053P06CGGACGGCCCACCANONE 
J100086D18CGGACGGCCCACCANONE 
Os01g0952600AK067525ACCGGGCCCACCCNONE 
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment). 
Os01g0961200011-099-H06CTGGCCCACCAACNONE 
AK105424CTGGCCCACCAACCBS domain containing protein. 
J065169J18CTGGCCCACCAACNONE 
J075109H12CTGGCCCACCAACNONE 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0976300AK111354TGGTGGGCCTAHeavy metal transport/detoxification protein domain containing protein. 
Os02g0103700009-031-C12AACGGCCCACCANONE 
AK062502AACGGCCCACCANONE 
AK102186AACGGCCCACCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17AACGGCCCACCANONE 
J065161I07AACGGCCCACCANONE 
J065184G15AACGGCCCACCANONE 
J075123E02AACGGCCCACCANONE 
Os02g0115700AK065094CCCGGGCCCACCACatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231CCCGGGCCCACCANONE 
AK099923CCCGGGCCCACCANONE 
X61626CCCGGGCCCACCANONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0122800AK062255CAGGTGGGCCCACANONE 
AK121372CAGGTGGGCCCACANucleotide-binding, alpha-beta plait domain containing protein. 
J013056N24CAGGTGGGCCCACANONE 
J023037M12CAGGTGGGCCCACANONE 
J023099B21CAGGTGGGCCCACANONE 
J023126J16CAGGTGGGCCCACANONE 
J033031J05CAGGTGGGCCCACANONE 
J033048L07CAGGTGGGCCCACANONE 
J033052J23CAGGTGGGCCCACANONE 
J033076F24CAGGTGGGCCCACANONE 
J033085F01CAGGTGGGCCCACANONE 
J033101I11CAGGTGGGCCCACANONE 
J033128E01CAGGTGGGCCCACANONE 
J100070N12CAGGTGGGCCCACANONE 
Os02g0123200016-017-F04AGGTGGGCCCCACCTGNONE 
J033057C03AGGTGGGCCCCACCTGNONE 
J033087C11AGGTGGGCCCCACCTGNONE 
J033108J20AGGTGGGCCCCACCTGNONE 
J043015P08AGGTGGGCCCCACCTGNONE 
Os02g0129700AK065610GTGGGGGCCCACCTHypothetical protein. 
J013031M24GTGGGGGCCCACCTNONE 
J075043J08GTGGGGGCCCACCTNONE 
J075142N23GTGGGGGCCCACCTNONE 
Os02g0130300011-005-D07CATGGGCCCACCTNONE 
011-041-B06CATGGGCCCACCTNONE 
015-099-D11CATGGGCCCACCTNONE 
016-049-D06CATGGGCCCACCTNONE 
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein. 
Os02g0133900AK107180CTGGCCCACCProtein of unknown function DUF829, eukaryotic family protein. 
Os02g0135700AK100570GGTGGGCCCCAGDNA polymerase V family protein. 
Os02g0143200AK070600AGGTGGGCCAGArmadillo-like helical domain containing protein. 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0169300006-023-D12CCGTGGGCCCACCACNONE 
006-062-B01CCGTGGGCCCACCACNONE 
015-049-F11CCGTGGGCCCACCACNONE 
015-057-G02CCGTGGGCCCACCACNONE 
015-092-F04CCGTGGGCCCACCACNONE 
015-095-H02CCGTGGGCCCACCACNONE 
015-097-B07CCGTGGGCCCACCACNONE 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07CCGTGGGCCCACCACNONE 
J013134H23CCGTGGGCCCACCACNONE 
J013134J23CCGTGGGCCCACCACNONE 
J023036N24CCGTGGGCCCACCACNONE 
J023049C06CCGTGGGCCCACCACNONE 
J023077E10CCGTGGGCCCACCACNONE 
J023077F10CCGTGGGCCCACCACNONE 
J023105N12CCGTGGGCCCACCACNONE 
J033036O12CCGTGGGCCCACCACNONE 
J033064P11CCGTGGGCCCACCACNONE 
J033079F01CCGTGGGCCCACCACNONE 
J033123M22CCGTGGGCCCACCACNONE 
J033143E10CCGTGGGCCCACCACNONE 
J075013D12CCGTGGGCCCACCACNONE 
Os02g0190950J075001E02GTGGCCCACCCConserved hypothetical protein. 
J075117E23GTGGCCCACCCNONE 
J075117F23GTGGCCCACCCNONE 
J075144M12GTGGCCCACCCNONE 
J075145H10GTGGCCCACCCNONE 
J075186B15GTGGCCCACCCNONE 
Os02g0194000015-020-A08TGGTGGGCCGCNONE 
AK064096TGGTGGGCCGCMyb, DNA-binding domain containing protein. 
J090092L06TGGTGGGCCGCNONE 
Os02g0197600003-113-H08CCCGGGCCCACCCNONE 
003-129-H06CCCGGGCCCACCCNONE 
006-021-H09CCCGGGCCCACCCNONE 
006-022-B05CCCGGGCCCACCCNONE 
006-022-G12CCCGGGCCCACCCNONE 
006-023-A02CCCGGGCCCACCCNONE 
006-023-C02CCCGGGCCCACCCNONE 
006-023-G09CCCGGGCCCACCCNONE 
006-024-D12CCCGGGCCCACCCNONE 
006-025-C09CCCGGGCCCACCCNONE 
006-025-E01CCCGGGCCCACCCNONE 
006-026-A11CCCGGGCCCACCCNONE 
006-026-A12CCCGGGCCCACCCNONE 
006-028-E11CCCGGGCCCACCCNONE 
006-028-G03CCCGGGCCCACCCNONE 
006-029-A09CCCGGGCCCACCCNONE 
006-029-A12CCCGGGCCCACCCNONE 
006-029-D01CCCGGGCCCACCCNONE 
006-029-F12CCCGGGCCCACCCNONE 
006-029-G12CCCGGGCCCACCCNONE 
006-030-A08CCCGGGCCCACCCNONE 
006-030-C09CCCGGGCCCACCCNONE 
006-030-G06CCCGGGCCCACCCNONE 
006-031-D06CCCGGGCCCACCCNONE 
006-032-C01CCCGGGCCCACCCNONE 
006-034-B07CCCGGGCCCACCCNONE 
006-035-G01CCCGGGCCCACCCNONE 
006-036-H12CCCGGGCCCACCCNONE 
006-040-C01CCCGGGCCCACCCNONE 
006-041-G12CCCGGGCCCACCCNONE 
006-041-H02CCCGGGCCCACCCNONE 
006-041-H11CCCGGGCCCACCCNONE 
006-042-B01CCCGGGCCCACCCNONE 
006-042-F10CCCGGGCCCACCCNONE 
006-043-C04CCCGGGCCCACCCNONE 
006-044-D10CCCGGGCCCACCCNONE 
006-048-D11CCCGGGCCCACCCNONE 
006-049-D07CCCGGGCCCACCCNONE 
006-050-H05CCCGGGCCCACCCNONE 
006-051-D10CCCGGGCCCACCCNONE 
006-051-E05CCCGGGCCCACCCNONE 
006-053-C07CCCGGGCCCACCCNONE 
006-054-B10CCCGGGCCCACCCNONE 
006-054-C12CCCGGGCCCACCCNONE 
006-054-G08CCCGGGCCCACCCNONE 
006-055-D12CCCGGGCCCACCCNONE 
006-056-C04CCCGGGCCCACCCNONE 
006-056-H06CCCGGGCCCACCCNONE 
006-057-E07CCCGGGCCCACCCNONE 
006-058-C12CCCGGGCCCACCCNONE 
006-059-B06CCCGGGCCCACCCNONE 
006-059-B09CCCGGGCCCACCCNONE 
006-059-D05CCCGGGCCCACCCNONE 
006-060-D07CCCGGGCCCACCCNONE 
006-061-D01CCCGGGCCCACCCNONE 
006-061-G09CCCGGGCCCACCCNONE 
006-062-A12CCCGGGCCCACCCNONE 
006-062-D04CCCGGGCCCACCCNONE 
006-062-G01CCCGGGCCCACCCNONE 
006-063-C10CCCGGGCCCACCCNONE 
006-064-A10CCCGGGCCCACCCNONE 
006-067-E04CCCGGGCCCACCCNONE 
006-067-H11CCCGGGCCCACCCNONE 
006-069-G08CCCGGGCCCACCCNONE 
006-071-G06CCCGGGCCCACCCNONE 
006-073-E06CCCGGGCCCACCCNONE 
006-074-B12CCCGGGCCCACCCNONE 
006-074-F06CCCGGGCCCACCCNONE 
006-074-H01CCCGGGCCCACCCNONE 
006-076-D12CCCGGGCCCACCCNONE 
006-077-C08CCCGGGCCCACCCNONE 
006-083-H01CCCGGGCCCACCCNONE 
006-083-H09CCCGGGCCCACCCNONE 
006-084-C02CCCGGGCCCACCCNONE 
006-086-D05CCCGGGCCCACCCNONE 
006-086-E09CCCGGGCCCACCCNONE 
006-087-D04CCCGGGCCCACCCNONE 
006-087-E12CCCGGGCCCACCCNONE 
006-088-A01CCCGGGCCCACCCNONE 
006-088-H09CCCGGGCCCACCCNONE 
006-089-G01CCCGGGCCCACCCNONE 
006-090-G01CCCGGGCCCACCCNONE 
006-092-H10CCCGGGCCCACCCNONE 
006-096-G12CCCGGGCCCACCCNONE 
006-097-C04CCCGGGCCCACCCNONE 
006-098-B06CCCGGGCCCACCCNONE 
006-099-A02CCCGGGCCCACCCNONE 
006-099-B05CCCGGGCCCACCCNONE 
006-100-F02CCCGGGCCCACCCNONE 
006-100-F07CCCGGGCCCACCCNONE 
006-104-A01CCCGGGCCCACCCNONE 
006-107-F06CCCGGGCCCACCCNONE 
006-109-A05CCCGGGCCCACCCNONE 
006-110-G03CCCGGGCCCACCCNONE 
006-111-A06CCCGGGCCCACCCNONE 
006-111-C12CCCGGGCCCACCCNONE 
006-112-B03CCCGGGCCCACCCNONE 
006-113-A02CCCGGGCCCACCCNONE 
006-113-H06CCCGGGCCCACCCNONE 
006-115-D11CCCGGGCCCACCCNONE 
006-116-F11CCCGGGCCCACCCNONE 
006-117-A10CCCGGGCCCACCCNONE 
006-117-C01CCCGGGCCCACCCNONE 
006-117-D08CCCGGGCCCACCCNONE 
006-118-B12CCCGGGCCCACCCNONE 
006-118-D08CCCGGGCCCACCCNONE 
006-118-E11CCCGGGCCCACCCNONE 
006-118-H08CCCGGGCCCACCCNONE 
006-119-C10CCCGGGCCCACCCNONE 
006-120-H11CCCGGGCCCACCCNONE 
009-025-G09CCCGGGCCCACCCNONE 
009-061-H06CCCGGGCCCACCCNONE 
009-070-E02CCCGGGCCCACCCNONE 
009-077-A07CCCGGGCCCACCCNONE 
009-114-A07CCCGGGCCCACCCNONE 
009-115-G02CCCGGGCCCACCCNONE 
009-123-C06CCCGGGCCCACCCNONE 
009-125-H03CCCGGGCCCACCCNONE 
009-127-H11CCCGGGCCCACCCNONE 
009-136-G03CCCGGGCCCACCCNONE 
009-154-B05CCCGGGCCCACCCNONE 
009-162-B02CCCGGGCCCACCCNONE 
009-176-D09CCCGGGCCCACCCNONE 
009-178-F10CCCGGGCCCACCCNONE 
009-190-F05CCCGGGCCCACCCNONE 
009-200-C08CCCGGGCCCACCCNONE 
011-064-H10CCCGGGCCCACCCNONE 
AK060143CCCGGGCCCACCCNONE 
AK060970CCCGGGCCCACCCNONE 
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK104096CCCGGGCCCACCCNONE 
AK104215CCCGGGCCCACCCNONE 
AK104348CCCGGGCCCACCCNONE 
AK104385CCCGGGCCCACCCNONE 
AK104392CCCGGGCCCACCCNONE 
AK104446CCCGGGCCCACCCNONE 
AK104458CCCGGGCCCACCCNONE 
AK104469CCCGGGCCCACCCNONE 
AK104522CCCGGGCCCACCCNONE 
AK104535CCCGGGCCCACCCNONE 
AK104557CCCGGGCCCACCCNONE 
AK104636CCCGGGCCCACCCNONE 
AK104646CCCGGGCCCACCCNONE 
AK104734CCCGGGCCCACCCNONE 
AK106085CCCGGGCCCACCCNONE 
AK109398CCCGGGCCCACCCNONE 
AK119554CCCGGGCCCACCCNONE 
J013044I21CCCGGGCCCACCCNONE 
J013090N21CCCGGGCCCACCCNONE 
J013130I24CCCGGGCCCACCCNONE 
J023038D09CCCGGGCCCACCCNONE 
J023064C23CCCGGGCCCACCCNONE 
J023088A09CCCGGGCCCACCCNONE 
J023105K12CCCGGGCCCACCCNONE 
J065022M15CCCGGGCCCACCCNONE 
J075062L23CCCGGGCCCACCCNONE 
J075069B05CCCGGGCCCACCCNONE 
J075072D15CCCGGGCCCACCCNONE 
J075090E24CCCGGGCCCACCCNONE 
J075126D14CCCGGGCCCACCCNONE 
J075154L21CCCGGGCCCACCCNONE 
J075165F23CCCGGGCCCACCCNONE 
J075166D04CCCGGGCCCACCCNONE 
J080003O05CCCGGGCCCACCCNONE 
J080005L07CCCGGGCCCACCCNONE 
J080008K15CCCGGGCCCACCCNONE 
J080009A07CCCGGGCCCACCCNONE 
J080009F05CCCGGGCCCACCCNONE 
J080010M06CCCGGGCCCACCCNONE 
J080011E06CCCGGGCCCACCCNONE 
J080011H20CCCGGGCCCACCCNONE 
J080018I05CCCGGGCCCACCCNONE 
J080021N17CCCGGGCCCACCCNONE 
J080036E20CCCGGGCCCACCCNONE 
J080040E22CCCGGGCCCACCCNONE 
J080044D19CCCGGGCCCACCCNONE 
J080045C21CCCGGGCCCACCCNONE 
J080047B08CCCGGGCCCACCCNONE 
J080048E24CCCGGGCCCACCCNONE 
J080053D19CCCGGGCCCACCCNONE 
J080053N09CCCGGGCCCACCCNONE 
J080054A19CCCGGGCCCACCCNONE 
J080061O16CCCGGGCCCACCCNONE 
J080064P15CCCGGGCCCACCCNONE 
J080065M06CCCGGGCCCACCCNONE 
J080067G11CCCGGGCCCACCCNONE 
J080072M09CCCGGGCCCACCCNONE 
J080079I15CCCGGGCCCACCCNONE 
J080082I12CCCGGGCCCACCCNONE 
J080083K21CCCGGGCCCACCCNONE 
J080096H12CCCGGGCCCACCCNONE 
J080096J10CCCGGGCCCACCCNONE 
J080097O13CCCGGGCCCACCCNONE 
J080305P05CCCGGGCCCACCCNONE 
J080311C21CCCGGGCCCACCCNONE 
J080317C16CCCGGGCCCACCCNONE 
Os02g0301100006-029-F04GGGTGGGCCCGGCNONE 
012-005-F07GGGTGGGCCCGGCNONE 
013-093-H10GGGTGGGCCCGGCNONE 
015-042-B01GGGTGGGCCCGGCNONE 
016-017-F09GGGTGGGCCCGGCNONE 
016-079-B07GGGTGGGCCCGGCNONE 
016-079-G03GGGTGGGCCCGGCNONE 
016-087-F11GGGTGGGCCCGGCNONE 
AK071676GGGTGGGCCCGGCNONE 
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein. 
AK104411GGGTGGGCCCGGCNONE 
AK104467GGGTGGGCCCGGCNONE 
J023069G02GGGTGGGCCCGGCNONE 
J023108F17GGGTGGGCCCGGCNONE 
J033042B04GGGTGGGCCCGGCNONE 
J033128D06GGGTGGGCCCGGCNONE 
J033138I12GGGTGGGCCCGGCNONE 
J053064K16GGGTGGGCCCGGCNONE 
J065088A12GGGTGGGCCCGGCNONE 
J065102L08GGGTGGGCCCGGCNONE 
J065104L14GGGTGGGCCCGGCNONE 
J065117M20GGGTGGGCCCGGCNONE 
J065117N14GGGTGGGCCCGGCNONE 
J065120H23GGGTGGGCCCGGCNONE 
J065135F06GGGTGGGCCCGGCNONE 
J065138J17GGGTGGGCCCGGCNONE 
J065138P06GGGTGGGCCCGGCNONE 
J065156G16GGGTGGGCCCGGCNONE 
J065163M20GGGTGGGCCCGGCNONE 
J065176A14GGGTGGGCCCGGCNONE 
J065182C02GGGTGGGCCCGGCNONE 
J065200C05GGGTGGGCCCGGCNONE 
J065213J22GGGTGGGCCCGGCNONE 
J065217D24GGGTGGGCCCGGCNONE 
J075009H03GGGTGGGCCCGGCNONE 
J075020D10GGGTGGGCCCGGCNONE 
J075026L24GGGTGGGCCCGGCNONE 
J075028L01GGGTGGGCCCGGCNONE 
J075057O09GGGTGGGCCCGGCNONE 
J075089A20GGGTGGGCCCGGCNONE 
J075094J15GGGTGGGCCCGGCNONE 
J075103B11GGGTGGGCCCGGCNONE 
J075143L13GGGTGGGCCCGGCNONE 
J075153K15GGGTGGGCCCGGCNONE 
J075161P22GGGTGGGCCCGGCNONE 
J075166J06GGGTGGGCCCGGCNONE 
J075177G06GGGTGGGCCCGGCNONE 
J075198N06GGGTGGGCCCGGCNONE 
Os02g0461900009-042-C04GGTGGGCCCGACTCGACNONE 
AF140492GGTGGGCCCGACTCGACNONE 
AK072619GGTGGGCCCGACTCGACNONE 
AK104969GGTGGGCCCGACTCGACConserved hypothetical protein. 
AK119466GGTGGGCCCGACTCGACNONE 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0517531AK121247GGGTGGGCCGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0528500J053035P18GACAGGTGGGCCATNONE 
J053046L13GACAGGTGGGCCATNONE 
J053099F11GACAGGTGGGCCATNONE 
Os02g0564000AJ486976GGTGGGGCCCACCTGTCNONE 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
J065021E14GGTGGGGCCCACCTGTCNONE 
J065139E02GGTGGGGCCCACCTGTCNONE 
J065165G05GGTGGGGCCCACCTGTCNONE 
J065181H16GGTGGGGCCCACCTGTCNONE 
J065217K07GGTGGGGCCCACCTGTCNONE 
J065218L13GGTGGGGCCCACCTGTCNONE 
J100082K21GGTGGGGCCCACCTGTCNONE 
J100084K19GGTGGGGCCCACCTGTCNONE 
Os02g0564100006-072-A11GACAGGTGGGCCCCACCNONE 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK105951GACAGGTGGGCCCCACCNONE 
J100045C15GACAGGTGGGCCCCACCNONE 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
009-199-B01GGGACCCACCTGGGGCCCACCANONE 
011-015-G12GGGACCCACCTGGGGCCCACCANONE 
J023113C24GGGACCCACCTGGGGCCCACCANONE 
Os02g0602300AK065609GCCCGGCCGGCCCACCTGNONE 
AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCCGGCCGGCCCACCTGNONE 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23GCCCGGCCGGCCCACCTGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0606900J023065M01TGGTGGGCCTANONE 
J075046E14TGGTGGGCCTANONE 
Os02g0626100003-107-B06CAGGTGGGCCACGCGTCGCGNONE 
AK120127CAGGTGGGCCACGCGTCGCGNONE 
Os02g0658500AK120166CTGGCCCACCANONE 
Os02g0661300016-077-C09GAGGCCCACCTNONE 
AK106503GAGGCCCACCTConserved hypothetical protein. 
Os02g0666200006-021-D11CTGGCCCACCAGGGCCCACGCNONE 
006-022-F02CTGGCCCACCAGGGCCCACGCNONE 
006-022-H11CTGGCCCACCAGGGCCCACGCNONE 
006-024-C03CTGGCCCACCAGGGCCCACGCNONE 
006-026-G05CTGGCCCACCAGGGCCCACGCNONE 
006-027-F11CTGGCCCACCAGGGCCCACGCNONE 
006-028-G06CTGGCCCACCAGGGCCCACGCNONE 
006-028-H05CTGGCCCACCAGGGCCCACGCNONE 
006-030-H06CTGGCCCACCAGGGCCCACGCNONE 
006-030-H12CTGGCCCACCAGGGCCCACGCNONE 
006-031-C07CTGGCCCACCAGGGCCCACGCNONE 
006-031-G01CTGGCCCACCAGGGCCCACGCNONE 
006-033-F09CTGGCCCACCAGGGCCCACGCNONE 
006-035-A01CTGGCCCACCAGGGCCCACGCNONE 
006-035-A12CTGGCCCACCAGGGCCCACGCNONE 
006-035-F04CTGGCCCACCAGGGCCCACGCNONE 
006-036-G09CTGGCCCACCAGGGCCCACGCNONE 
006-038-A01CTGGCCCACCAGGGCCCACGCNONE 
006-038-A03CTGGCCCACCAGGGCCCACGCNONE 
006-039-D08CTGGCCCACCAGGGCCCACGCNONE 
006-042-C11CTGGCCCACCAGGGCCCACGCNONE 
006-042-H06CTGGCCCACCAGGGCCCACGCNONE 
006-044-E01CTGGCCCACCAGGGCCCACGCNONE 
006-045-E05CTGGCCCACCAGGGCCCACGCNONE 
006-046-G05CTGGCCCACCAGGGCCCACGCNONE 
006-047-A03CTGGCCCACCAGGGCCCACGCNONE 
006-048-H08CTGGCCCACCAGGGCCCACGCNONE 
006-052-A07CTGGCCCACCAGGGCCCACGCNONE 
006-053-A05CTGGCCCACCAGGGCCCACGCNONE 
006-054-G06CTGGCCCACCAGGGCCCACGCNONE 
006-056-D10CTGGCCCACCAGGGCCCACGCNONE 
006-057-B07CTGGCCCACCAGGGCCCACGCNONE 
006-058-F12CTGGCCCACCAGGGCCCACGCNONE 
006-060-D01CTGGCCCACCAGGGCCCACGCNONE 
006-061-A12CTGGCCCACCAGGGCCCACGCNONE 
006-062-E02CTGGCCCACCAGGGCCCACGCNONE 
006-063-F11CTGGCCCACCAGGGCCCACGCNONE 
006-063-H02CTGGCCCACCAGGGCCCACGCNONE 
006-066-F12CTGGCCCACCAGGGCCCACGCNONE 
006-067-H12CTGGCCCACCAGGGCCCACGCNONE 
006-068-B09CTGGCCCACCAGGGCCCACGCNONE 
006-068-D08CTGGCCCACCAGGGCCCACGCNONE 
006-071-A12CTGGCCCACCAGGGCCCACGCNONE 
006-072-H06CTGGCCCACCAGGGCCCACGCNONE 
006-074-A02CTGGCCCACCAGGGCCCACGCNONE 
006-074-F10CTGGCCCACCAGGGCCCACGCNONE 
006-077-H10CTGGCCCACCAGGGCCCACGCNONE 
006-078-G02CTGGCCCACCAGGGCCCACGCNONE 
006-081-B03CTGGCCCACCAGGGCCCACGCNONE 
006-084-H01CTGGCCCACCAGGGCCCACGCNONE 
006-084-H02CTGGCCCACCAGGGCCCACGCNONE 
006-084-H04CTGGCCCACCAGGGCCCACGCNONE 
006-087-H08CTGGCCCACCAGGGCCCACGCNONE 
006-090-B08CTGGCCCACCAGGGCCCACGCNONE 
006-091-E10CTGGCCCACCAGGGCCCACGCNONE 
006-093-G02CTGGCCCACCAGGGCCCACGCNONE 
006-094-B12CTGGCCCACCAGGGCCCACGCNONE 
006-094-E03CTGGCCCACCAGGGCCCACGCNONE 
006-095-G07CTGGCCCACCAGGGCCCACGCNONE 
006-095-H07CTGGCCCACCAGGGCCCACGCNONE 
006-097-G08CTGGCCCACCAGGGCCCACGCNONE 
006-098-E12CTGGCCCACCAGGGCCCACGCNONE 
006-099-A04CTGGCCCACCAGGGCCCACGCNONE 
006-099-E08CTGGCCCACCAGGGCCCACGCNONE 
006-103-F12CTGGCCCACCAGGGCCCACGCNONE 
006-104-G02CTGGCCCACCAGGGCCCACGCNONE 
006-105-F02CTGGCCCACCAGGGCCCACGCNONE 
006-107-D12CTGGCCCACCAGGGCCCACGCNONE 
006-108-F10CTGGCCCACCAGGGCCCACGCNONE 
006-108-H05CTGGCCCACCAGGGCCCACGCNONE 
006-110-G11CTGGCCCACCAGGGCCCACGCNONE 
006-111-D10CTGGCCCACCAGGGCCCACGCNONE 
006-111-E03CTGGCCCACCAGGGCCCACGCNONE 
006-111-H01CTGGCCCACCAGGGCCCACGCNONE 
006-113-C12CTGGCCCACCAGGGCCCACGCNONE 
006-114-C10CTGGCCCACCAGGGCCCACGCNONE 
006-115-B02CTGGCCCACCAGGGCCCACGCNONE 
006-117-D11CTGGCCCACCAGGGCCCACGCNONE 
006-117-E01CTGGCCCACCAGGGCCCACGCNONE 
009-131-C02CTGGCCCACCAGGGCCCACGCNONE 
009-133-G05CTGGCCCACCAGGGCCCACGCNONE 
009-152-E01CTGGCCCACCAGGGCCCACGCNONE 
009-154-E08CTGGCCCACCAGGGCCCACGCNONE 
009-196-C11CTGGCCCACCAGGGCCCACGCNONE 
012-010-E10CTGGCCCACCAGGGCCCACGCNONE 
013-018-C05CTGGCCCACCAGGGCCCACGCNONE 
013-074-A06CTGGCCCACCAGGGCCCACGCNONE 
013-078-E06CTGGCCCACCAGGGCCCACGCNONE 
AB009665CTGGCCCACCAGGGCCCACGCNONE 
AF022737CTGGCCCACCAGGGCCCACGCNONE 
AJ224327CTGGCCCACCAGGGCCCACGCNONE 
AK061769CTGGCCCACCAGGGCCCACGCNONE 
AK103807CTGGCCCACCAGGGCCCACGCAquaporin. 
AK104658CTGGCCCACCAGGGCCCACGCNONE 
J013065I12CTGGCCCACCAGGGCCCACGCNONE 
J013067L09CTGGCCCACCAGGGCCCACGCNONE 
J013089I10CTGGCCCACCAGGGCCCACGCNONE 
J013095N22CTGGCCCACCAGGGCCCACGCNONE 
J013130E17CTGGCCCACCAGGGCCCACGCNONE 
J013131A06CTGGCCCACCAGGGCCCACGCNONE 
J013154E06CTGGCCCACCAGGGCCCACGCNONE 
J023004D16CTGGCCCACCAGGGCCCACGCNONE 
J023010A15CTGGCCCACCAGGGCCCACGCNONE 
J023010H04CTGGCCCACCAGGGCCCACGCNONE 
J023049K10CTGGCCCACCAGGGCCCACGCNONE 
J023056H24CTGGCCCACCAGGGCCCACGCNONE 
J023064J12CTGGCCCACCAGGGCCCACGCNONE 
J023078I06CTGGCCCACCAGGGCCCACGCNONE 
J023081D05CTGGCCCACCAGGGCCCACGCNONE 
J023099I19CTGGCCCACCAGGGCCCACGCNONE 
J023100F05CTGGCCCACCAGGGCCCACGCNONE 
J023131F16CTGGCCCACCAGGGCCCACGCNONE 
J033025F16CTGGCCCACCAGGGCCCACGCNONE 
J033028F10CTGGCCCACCAGGGCCCACGCNONE 
J033058H13CTGGCCCACCAGGGCCCACGCNONE 
J033064P18CTGGCCCACCAGGGCCCACGCNONE 
J033070H04CTGGCCCACCAGGGCCCACGCNONE 
J033107P20CTGGCCCACCAGGGCCCACGCNONE 
J033114E09CTGGCCCACCAGGGCCCACGCNONE 
J033125G23CTGGCCCACCAGGGCCCACGCNONE 
J033136G05CTGGCCCACCAGGGCCCACGCNONE 
J033147A07CTGGCCCACCAGGGCCCACGCNONE 
J053048M24CTGGCCCACCAGGGCCCACGCNONE 
J053056K02CTGGCCCACCAGGGCCCACGCNONE 
J053057N24CTGGCCCACCAGGGCCCACGCNONE 
J053060C13CTGGCCCACCAGGGCCCACGCNONE 
J065053C22CTGGCCCACCAGGGCCCACGCNONE 
J065067J11CTGGCCCACCAGGGCCCACGCNONE 
J065085A01CTGGCCCACCAGGGCCCACGCNONE 
J065189K01CTGGCCCACCAGGGCCCACGCNONE 
J075024G24CTGGCCCACCAGGGCCCACGCNONE 
J075060O04CTGGCCCACCAGGGCCCACGCNONE 
J075075M07CTGGCCCACCAGGGCCCACGCNONE 
J075090A10CTGGCCCACCAGGGCCCACGCNONE 
J075110P11CTGGCCCACCAGGGCCCACGCNONE 
J075114H02CTGGCCCACCAGGGCCCACGCNONE 
J075127L13CTGGCCCACCAGGGCCCACGCNONE 
J075151B19CTGGCCCACCAGGGCCCACGCNONE 
J075187M17CTGGCCCACCAGGGCCCACGCNONE 
J075198E22CTGGCCCACCAGGGCCCACGCNONE 
J080006J20CTGGCCCACCAGGGCCCACGCNONE 
J080081J10CTGGCCCACCAGGGCCCACGCNONE 
J080087C03CTGGCCCACCAGGGCCCACGCNONE 
J090029E22CTGGCCCACCAGGGCCCACGCNONE 
J090037C19CTGGCCCACCAGGGCCCACGCNONE 
J090037P10CTGGCCCACCAGGGCCCACGCNONE 
J090047M10CTGGCCCACCAGGGCCCACGCNONE 
J090055K05CTGGCCCACCAGGGCCCACGCNONE 
J090057N19CTGGCCCACCAGGGCCCACGCNONE 
J090062M13CTGGCCCACCAGGGCCCACGCNONE 
J090066F22CTGGCCCACCAGGGCCCACGCNONE 
J090066N12CTGGCCCACCAGGGCCCACGCNONE 
J090071K08CTGGCCCACCAGGGCCCACGCNONE 
J090080F16CTGGCCCACCAGGGCCCACGCNONE 
J090081J21CTGGCCCACCAGGGCCCACGCNONE 
J090083F22CTGGCCCACCAGGGCCCACGCNONE 
J090083I12CTGGCCCACCAGGGCCCACGCNONE 
J090088B16CTGGCCCACCAGGGCCCACGCNONE 
J090088E01CTGGCCCACCAGGGCCCACGCNONE 
J090091C11CTGGCCCACCAGGGCCCACGCNONE 
J090091F17CTGGCCCACCAGGGCCCACGCNONE 
J090097A05CTGGCCCACCAGGGCCCACGCNONE 
J090098B15CTGGCCCACCAGGGCCCACGCNONE 
J100018B04CTGGCCCACCAGGGCCCACGCNONE 
J100021J08CTGGCCCACCAGGGCCCACGCNONE 
J100026M12CTGGCCCACCAGGGCCCACGCNONE 
J100032F02CTGGCCCACCAGGGCCCACGCNONE 
J100034B03CTGGCCCACCAGGGCCCACGCNONE 
J100037D13CTGGCCCACCAGGGCCCACGCNONE 
J100041C16CTGGCCCACCAGGGCCCACGCNONE 
J100044D14CTGGCCCACCAGGGCCCACGCNONE 
J100044E21CTGGCCCACCAGGGCCCACGCNONE 
J100047M16CTGGCCCACCAGGGCCCACGCNONE 
J100051D22CTGGCCCACCAGGGCCCACGCNONE 
J100056M13CTGGCCCACCAGGGCCCACGCNONE 
J100061J12CTGGCCCACCAGGGCCCACGCNONE 
J100065A22CTGGCCCACCAGGGCCCACGCNONE 
J100067L12CTGGCCCACCAGGGCCCACGCNONE 
J100068F06CTGGCCCACCAGGGCCCACGCNONE 
J100070C24CTGGCCCACCAGGGCCCACGCNONE 
J100072N09CTGGCCCACCAGGGCCCACGCNONE 
J100073A10CTGGCCCACCAGGGCCCACGCNONE 
J100073B15CTGGCCCACCAGGGCCCACGCNONE 
J100077F05CTGGCCCACCAGGGCCCACGCNONE 
J100078B03CTGGCCCACCAGGGCCCACGCNONE 
J100078F01CTGGCCCACCAGGGCCCACGCNONE 
J100079B08CTGGCCCACCAGGGCCCACGCNONE 
J100083J06CTGGCCCACCAGGGCCCACGCNONE 
Os02g0672500AK109266CCACGGCCCACCTNONE 
Os02g0686700AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04CTGACAGGTGGGCCTANONE 
Os02g0741500AK068867CAGGCCCACCARibbon-helix-helix domain containing protein. 
Os02g0744700AF395537ATGGCCCACCCNONE 
AJ308110ATGGCCCACCCNONE 
AK066446ATGGCCCACCCSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0755900011-077-A03AGGTGGGCCATNONE 
015-066-D06AGGTGGGCCATNONE 
AK073587AGGTGGGCCATNONE 
AK104985AGGTGGGCCATSimilar to Glucosyltransferase (Fragment). 
J033052B15AGGTGGGCCATNONE 
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE 
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE 
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE 
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE 
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE 
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE 
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE 
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE 
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE 
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE 
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE 
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE 
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE 
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE 
Os02g0761600AK120494GGTGGGCCCCConserved hypothetical protein. 
Os02g0767900009-154-G01AGGTGGGCCTAGCCCATCGNONE 
009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-172-H09AGGTGGGCCTAGCCCATCGNONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
AK099885AGGTGGGCCTAGCCCATCGGlutaredoxin 2 family protein. 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
Os02g0768600006-034-F01AGGTGGGCCGGANONE 
006-034-F01GGGTGGGCCCACCTGNONE 
006-046-G07AGGTGGGCCGGANONE 
006-046-G07GGGTGGGCCCACCTGNONE 
006-054-C07AGGTGGGCCGGANONE 
006-054-C07GGGTGGGCCCACCTGNONE 
006-056-F07AGGTGGGCCGGANONE 
006-056-F07GGGTGGGCCCACCTGNONE 
006-100-C02AGGTGGGCCGGANONE 
006-100-C02GGGTGGGCCCACCTGNONE 
AK059725AGGTGGGCCGGANONE 
AK059725GGGTGGGCCCACCTGNONE 
AK098996AGGTGGGCCGGANONE 
AK098996GGGTGGGCCCACCTGNONE 
AK099120AGGTGGGCCGGANONE 
AK099120GGGTGGGCCCACCTGNONE 
AK104659AGGTGGGCCGGANONE 
AK104659GGGTGGGCCCACCTGNONE 
J065043H04AGGTGGGCCGGANONE 
J065043H04GGGTGGGCCCACCTGNONE 
J075034N21AGGTGGGCCGGANONE 
J075034N21GGGTGGGCCCACCTGNONE 
J075145C18AGGTGGGCCGGANONE 
J075145C18GGGTGGGCCCACCTGNONE 
J080016H01AGGTGGGCCGGANONE 
J080016H01GGGTGGGCCCACCTGNONE 
J080040F01AGGTGGGCCGGANONE 
J080040F01GGGTGGGCCCACCTGNONE 
J080047L23AGGTGGGCCGGANONE 
J080047L23GGGTGGGCCCACCTGNONE 
J080049B22AGGTGGGCCGGANONE 
J080049B22GGGTGGGCCCACCTGNONE 
J080062J16AGGTGGGCCGGANONE 
J080062J16GGGTGGGCCCACCTGNONE 
J080064C23AGGTGGGCCGGANONE 
J080064C23GGGTGGGCCCACCTGNONE 
J080064L22AGGTGGGCCGGANONE 
J080064L22GGGTGGGCCCACCTGNONE 
J080077N01AGGTGGGCCGGANONE 
J080077N01GGGTGGGCCCACCTGNONE 
J080097G17AGGTGGGCCGGANONE 
J080097G17GGGTGGGCCCACCTGNONE 
J100065L15AGGTGGGCCGGANONE 
J100065L15GGGTGGGCCCACCTGNONE 
J100066K23AGGTGGGCCGGANONE 
J100066K23GGGTGGGCCCACCTGNONE 
J100088C07AGGTGGGCCGGANONE 
J100088C07GGGTGGGCCCACCTGNONE 
J100090H09AGGTGGGCCGGANONE 
J100090H09GGGTGGGCCCACCTGNONE 
Os02g0776800AB042415AGATGGGCCGGCCCACCCGNONE 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK101212AGATGGGCCGGCCCACCCGNONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0797600004-004-A08GGGGCCCACCTNONE 
006-050-H07GGGGCCCACCTNONE 
006-092-B02GGGGCCCACCTNONE 
006-100-B08GGGGCCCACCTNONE 
013-037-D09GGGGCCCACCTNONE 
013-068-H02GGGGCCCACCTNONE 
AK060857GGGGCCCACCTNONE 
AK098882GGGGCCCACCTNONE 
AK104474GGGGCCCACCTNONE 
AK120644GGGGCCCACCTConserved hypothetical protein. 
J013001F21GGGGCCCACCTNONE 
J013074D07GGGGCCCACCTNONE 
J013096H23GGGGCCCACCTNONE 
J013098H07GGGGCCCACCTNONE 
J013132L13GGGGCCCACCTNONE 
J013134K05GGGGCCCACCTNONE 
J013155B15GGGGCCCACCTNONE 
J023002L17GGGGCCCACCTNONE 
J023013B08GGGGCCCACCTNONE 
J023087I01GGGGCCCACCTNONE 
J033071O04GGGGCCCACCTNONE 
J065161N23GGGGCCCACCTNONE 
J075055G11GGGGCCCACCTNONE 
J075106J02GGGGCCCACCTNONE 
J080009D06GGGGCCCACCTNONE 
J080009N22GGGGCCCACCTNONE 
J080016L03GGGGCCCACCTNONE 
J080023E17GGGGCCCACCTNONE 
J080027A12GGGGCCCACCTNONE 
J080036M24GGGGCCCACCTNONE 
J080038N07GGGGCCCACCTNONE 
J080041A04GGGGCCCACCTNONE 
J080042K11GGGGCCCACCTNONE 
J080050A04GGGGCCCACCTNONE 
J080053G16GGGGCCCACCTNONE 
J080063D03GGGGCCCACCTNONE 
J080063F07GGGGCCCACCTNONE 
J080067H13GGGGCCCACCTNONE 
J080068F12GGGGCCCACCTNONE 
J080072G17GGGGCCCACCTNONE 
J080072I06GGGGCCCACCTNONE 
J080072J24GGGGCCCACCTNONE 
J080076G09GGGGCCCACCTNONE 
J080085H10GGGGCCCACCTNONE 
J080092I17GGGGCCCACCTNONE 
J080092N20GGGGCCCACCTNONE 
J080093G10GGGGCCCACCTNONE 
J090074C23GGGGCCCACCTNONE 
J090083O18GGGGCCCACCTNONE 
J100046M05GGGGCCCACCTNONE 
J100050N16GGGGCCCACCTNONE 
J100054D07GGGGCCCACCTNONE 
J100054O11GGGGCCCACCTNONE 
J100055F04GGGGCCCACCTNONE 
J100055H22GGGGCCCACCTNONE 
J100063A05GGGGCCCACCTNONE 
J100063I24GGGGCCCACCTNONE 
J100067I12GGGGCCCACCTNONE 
J100074A22GGGGCCCACCTNONE 
J100078B22GGGGCCCACCTNONE 
J100079B03GGGGCCCACCTNONE 
Os02g0802400J065054M13AGGTGGGCCTGGNONE 
J065061I04AGGTGGGCCTGGNONE 
J065112M15AGGTGGGCCTGGEF-Hand type domain containing protein. 
J100050L24AGGTGGGCCTGGNONE 
J100059D20AGGTGGGCCTGGNONE 
Os02g0803200AK063404GCTGGGCCGGCCCACCSimilar to 30S ribosomal protein S15. 
Os02g0803600AK064750ACAGGTGGGCCCCLongin-like domain containing protein. 
Os02g0805200AK071591CAGGTGGGCCCGProliferating cell nuclear antigen (PCNA) (Cyclin). 
J023105C08CAGGTGGGCCCGNONE 
J033030H07CAGGTGGGCCCGNONE 
J033050M24CAGGTGGGCCCGNONE 
J033069B10CAGGTGGGCCCGNONE 
J033121A16CAGGTGGGCCCGNONE 
J053023M14CAGGTGGGCCCGNONE 
J053033A15CAGGTGGGCCCGNONE 
J053054H14CAGGTGGGCCCGNONE 
J053055H24CAGGTGGGCCCGNONE 
J053082B18CAGGTGGGCCCGNONE 
J065001N03CAGGTGGGCCCGNONE 
J065011O16CAGGTGGGCCCGNONE 
J065026K24CAGGTGGGCCCGNONE 
J065056C09CAGGTGGGCCCGNONE 
J065067H11CAGGTGGGCCCGNONE 
J065097E19CAGGTGGGCCCGNONE 
J065118O11CAGGTGGGCCCGNONE 
J065124N09CAGGTGGGCCCGNONE 
J065143A02CAGGTGGGCCCGNONE 
J065213P06CAGGTGGGCCCGNONE 
J065215E24CAGGTGGGCCCGNONE 
J075051B11CAGGTGGGCCCGNONE 
J075065K05CAGGTGGGCCCGNONE 
J080306E10CAGGTGGGCCCGNONE 
J090042I16CAGGTGGGCCCGNONE 
J090066J24CAGGTGGGCCCGNONE 
J090092K17CAGGTGGGCCCGNONE 
J100029A17CAGGTGGGCCCGNONE 
J100052N08CAGGTGGGCCCGNONE 
J100071I23CAGGTGGGCCCGNONE 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
J013068E03AGCCCACGGCCCACCTNONE 
J033066K03AGCCCACGGCCCACCTNONE 
J033092C14AGCCCACGGCCCACCTNONE 
J065020G11AGCCCACGGCCCACCTNONE 
J065098E16AGCCCACGGCCCACCTNONE 
J065124L06AGCCCACGGCCCACCTNONE 
J065134M23AGCCCACGGCCCACCTNONE 
J065187M23AGCCCACGGCCCACCTNONE 
J065208G07AGCCCACGGCCCACCTNONE 
J075002G10AGCCCACGGCCCACCTNONE 
J075004L01AGCCCACGGCCCACCTNONE 
J075051K23AGCCCACGGCCCACCTNONE 
J090063C03AGCCCACGGCCCACCTNONE 
J090071J21AGCCCACGGCCCACCTNONE 
J100078K12AGCCCACGGCCCACCTNONE 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
J013130C06AGGTGGGCCGTGGGCTNONE 
J013154L12AGGTGGGCCGTGGGCTNONE 
J023135J07AGGTGGGCCGTGGGCTNONE 
J065038E23AGGTGGGCCGTGGGCTNONE 
J065042C10AGGTGGGCCGTGGGCTNONE 
J090075B11AGGTGGGCCGTGGGCTNONE 
J100033J17AGGTGGGCCGTGGGCTNONE 
Os02g0817500AK072707ATGGCCCACCTGTCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135ATGGCCCACCTGTCNONE 
AK104135GACAGGTGGGCCCCNONE 
U46758ATGGCCCACCTGTCNONE 
U46758GACAGGTGGGCCCCNONE 
Os02g0818000005-003-E01TGGTGGGCCAGNONE 
006-055-D08TGGTGGGCCAGNONE 
006-060-D05TGGTGGGCCAGNONE 
006-086-H02TGGTGGGCCAGNONE 
006-091-B04TGGTGGGCCAGNONE 
009-152-H12TGGTGGGCCAGNONE 
009-184-D08TGGTGGGCCAGNONE 
AK071580TGGTGGGCCAGNONE 
AK104103TGGTGGGCCAGNONE 
AK104525TGGTGGGCCAGNONE 
AK104684TGGTGGGCCAGNONE 
AK104947TGGTGGGCCAGNONE 
J013032M21TGGTGGGCCAGNONE 
J013032M22TGGTGGGCCAGNONE 
J013044P09TGGTGGGCCAGNONE 
J013056P03TGGTGGGCCAGNONE 
J013070P08TGGTGGGCCAGNONE 
J013106H15TGGTGGGCCAGNONE 
J013146O03TGGTGGGCCAGNONE 
J013170F21TGGTGGGCCAGNONE 
J023038I01TGGTGGGCCAGNONE 
J023049P19TGGTGGGCCAGNONE 
J023106O04TGGTGGGCCAGNONE 
J053100K06TGGTGGGCCAGNONE 
J075026E09TGGTGGGCCAGNONE 
J075043L03TGGTGGGCCAGNONE 
J075049B11TGGTGGGCCAGNONE 
J080301G04TGGTGGGCCAGNONE 
J080305H10TGGTGGGCCAGNONE 
J080308H05TGGTGGGCCAGNONE 
J080311I19TGGTGGGCCAGNONE 
J080315G02TGGTGGGCCAGNONE 
J080315J24TGGTGGGCCAGNONE 
J080316D10TGGTGGGCCAGNONE 
J080317H09TGGTGGGCCAGNONE 
J080317J05TGGTGGGCCAGNONE 
J080318H15TGGTGGGCCAGNONE 
J090047M14TGGTGGGCCAGNONE 
J100025F05TGGTGGGCCAGNONE 
J100060C16TGGTGGGCCAGNONE 
J100064H07TGGTGGGCCAGNONE 
J100075N11TGGTGGGCCAGNONE 
J100081E01TGGTGGGCCAGNONE 
J100085G12TGGTGGGCCAGNONE 
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein. 
Os02g0830100J013032G02CGATGGGCCCACCACNONE 
J013052O21CGATGGGCCCACCACNONE 
J023078A05CGATGGGCCCACCACNONE 
J033114C07CGATGGGCCCACCACNONE 
J033125M07CGATGGGCCCACCACNONE 
J053045C11CGATGGGCCCACCACNONE 
J100055G05CGATGGGCCCACCACNONE 
J100080J22CGATGGGCCCACCACNONE 
Os02g0831800009-150-D09GTTGGTGGGCCATNONE 
AK060519GTTGGTGGGCCATSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2. 
J075143E03GTTGGTGGGCCATNONE 
J100077H12GTTGGTGGGCCATNONE 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
J013047E20CGGGTGGGCCCCAGNONE 
J065026F21CGGGTGGGCCCCAGNONE 
J065047B03CGGGTGGGCCCCAGNONE 
J065054J12CGGGTGGGCCCCAGNONE 
J065079M24CGGGTGGGCCCCAGNONE 
J065093M07CGGGTGGGCCCCAGNONE 
J065153F02CGGGTGGGCCCCAGNONE 
J065155E21CGGGTGGGCCCCAGNONE 
J065179H15CGGGTGGGCCCCAGNONE 
J075019N02CGGGTGGGCCCCAGNONE 
J075089E01CGGGTGGGCCCCAGNONE 
J090066I18CGGGTGGGCCCCAGNONE 
J090087K20CGGGTGGGCCCCAGNONE 
J100079F05CGGGTGGGCCCCAGNONE 
Os03g0131300015-095-G06GGTCCACGTGGGGGCCCACCCNONE 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
J033140O12GGTCCACGTGGGGGCCCACCCNONE 
J065112C14GGTCCACGTGGGGGCCCACCCNONE 
J090070D10GGTCCACGTGGGGGCCCACCCNONE 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGGGTGGGCCCACACGNONE 
Os03g0133300AK064510GGTGGGCCCACAConserved hypothetical protein. 
Os03g0135700AK060029CTCGCGCGGCCCACCNONE 
AK103779CTCGCGCGGCCCACCSimilar to Transcriptional activator Rb homolog (Fragment). 
J033145C17CTCGCGCGGCCCACCNONE 
J043021B17CTCGCGCGGCCCACCNONE 
Os03g0146500006-036-F10AAGGCCCACCTNONE 
006-036-F10TTGGCCCACCTGNONE 
006-082-C03AAGGCCCACCTNONE 
006-082-C03TTGGCCCACCTGNONE 
006-098-E04AAGGCCCACCTNONE 
006-098-E04TTGGCCCACCTGNONE 
006-110-C03AAGGCCCACCTNONE 
006-110-C03TTGGCCCACCTGNONE 
009-057-C11AAGGCCCACCTNONE 
009-057-C11TTGGCCCACCTGNONE 
009-182-D02AAGGCCCACCTNONE 
009-182-D02TTGGCCCACCTGNONE 
AK059776AAGGCCCACCTGalactose-binding like domain containing protein. 
AK059776TTGGCCCACCTGGalactose-binding like domain containing protein. 
AK071628AAGGCCCACCTNONE 
AK071628TTGGCCCACCTGNONE 
AK104105AAGGCCCACCTNONE 
AK104105TTGGCCCACCTGNONE 
AK104220AAGGCCCACCTNONE 
AK104220TTGGCCCACCTGNONE 
J065168B02AAGGCCCACCTNONE 
J065168B02TTGGCCCACCTGNONE 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
J065192P15AGGTGGGCCCCACGAANONE 
Os03g0156500011-075-F02CGCGGGGGGGTGGGCCCCACACNONE 
012-077-G10CGCGGGGGGGTGGGCCCCACACNONE 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
J013088H17CGCGGGGGGGTGGGCCCCACACNONE 
J013135G21CGCGGGGGGGTGGGCCCCACACNONE 
J033050E10CGCGGGGGGGTGGGCCCCACACNONE 
J033050J01CGCGGGGGGGTGGGCCCCACACNONE 
J033129N23CGCGGGGGGGTGGGCCCCACACNONE 
J065085L16CGCGGGGGGGTGGGCCCCACACNONE 
J065101B19CGCGGGGGGGTGGGCCCCACACNONE 
J065167N03CGCGGGGGGGTGGGCCCCACACNONE 
J090009O21CGCGGGGGGGTGGGCCCCACACNONE 
J090049D11CGCGGGGGGGTGGGCCCCACACNONE 
J100017F23CGCGGGGGGGTGGGCCCCACACNONE 
J100040E12CGCGGGGGGGTGGGCCCCACACNONE 
J100055O18CGCGGGGGGGTGGGCCCCACACNONE 
J100061K08CGCGGGGGGGTGGGCCCCACACNONE 
J100072M05CGCGGGGGGGTGGGCCCCACACNONE 
J100077B08CGCGGGGGGGTGGGCCCCACACNONE 
J100086G03CGCGGGGGGGTGGGCCCCACACNONE 
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0171700J065192H12GGTGGGCCCATCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0181600AK067807AGCCCAAGCGGCCCACCASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197AGCCCAAGCGGCCCACCANONE 
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein. 
Os03g0192700012-005-H03GGTGGGCCCGNONE 
012-006-B05GGTGGGCCCGNONE 
012-006-E07GGTGGGCCCGNONE 
012-051-D10GGTGGGCCCGNONE 
014-089-H06GGTGGGCCCGNONE 
015-034-C05GGTGGGCCCGNONE 
015-042-C06GGTGGGCCCGNONE 
015-059-E09GGTGGGCCCGNONE 
015-096-A08GGTGGGCCCGNONE 
016-030-D06GGTGGGCCCGNONE 
016-053-H07GGTGGGCCCGNONE 
016-064-D02GGTGGGCCCGNONE 
AB012107GGTGGGCCCGNONE 
AK058750GGTGGGCCCGSimilar to Myo-inositol-1-phosphate synthase. 
AK103501GGTGGGCCCGNONE 
J023102F09GGTGGGCCCGNONE 
J023103H09GGTGGGCCCGNONE 
J023107F22GGTGGGCCCGNONE 
J033031E17GGTGGGCCCGNONE 
J033090C03GGTGGGCCCGNONE 
J033090C17GGTGGGCCCGNONE 
J033091K19GGTGGGCCCGNONE 
J033131B11GGTGGGCCCGNONE 
J033133D04GGTGGGCCCGNONE 
J053050C09GGTGGGCCCGNONE 
J053078O12GGTGGGCCCGNONE 
J075037B10GGTGGGCCCGNONE 
J090021M23GGTGGGCCCGNONE 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0201600AK067825GGTGGGGCCCACCTGTCNONE 
Os03g0206400AK066494GGGTGGGCCCGCConserved hypothetical protein. 
AK107011GGGTGGGCCCGCNONE 
J065162G04GGGTGGGCCCGCNONE 
Os03g0213600AK100407TGTGGGGCCCACCConserved hypothetical protein. 
Os03g0232600AK068218TATGGGCCCACCTU box domain containing protein. 
J013114N10TATGGGCCCACCTNONE 
J013146E12TATGGGCCCACCTNONE 
J023034C23TATGGGCCCACCTNONE 
J033030J03TATGGGCCCACCTNONE 
J033050L03TATGGGCCCACCTNONE 
J033122E16TATGGGCCCACCTNONE 
J090018C20TATGGGCCCACCTNONE 
J090053P15TATGGGCCCACCTNONE 
J090096C17TATGGGCCCACCTNONE 
Os03g0244700011-100-F11CCCACGGGCCCACCTNONE 
015-065-B06CCCACGGGCCCACCTNONE 
AK100399CCCACGGGCCCACCTNONE 
AK100620CCCACGGGCCCACCTArmadillo-like helical domain containing protein. 
J023086N09CCCACGGGCCCACCTNONE 
J100032P14CCCACGGGCCCACCTNONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0248600AK073611CGGGTGGGCCCTSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CGGGTGGGCCCTNONE 
AK104877CGGGTGGGCCCTNONE 
J013026L10CGGGTGGGCCCTNONE 
J013055P12CGGGTGGGCCCTNONE 
J023091A14CGGGTGGGCCCTNONE 
J033034G07CGGGTGGGCCCTNONE 
J033048H19CGGGTGGGCCCTNONE 
J033128D07CGGGTGGGCCCTNONE 
J065060L24CGGGTGGGCCCTNONE 
J065176A19CGGGTGGGCCCTNONE 
J090018K08CGGGTGGGCCCTNONE 
J090023C03CGGGTGGGCCCTNONE 
Os03g0255200AK058212AGGGCCCACCTGNONE 
AK071625AGGGCCCACCTGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0270700AK119531TGGTGGGCCAANONE 
Os03g0271500AK068546GCGGGCCCACCCACCGCACGCGNONE 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
J013157P04GCGGGCCCACCCACCGCACGCGNONE 
J075041K23GCGGGCCCACCCACCGCACGCGNONE 
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein. 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0279200009-097-C06CGGGCCCACCACNONE 
013-007-B07CGGGCCCACCACNONE 
AK121750CGGGCCCACCACSimilar to Histone H2A. 
J033087I02CGGGCCCACCACNONE 
J065002G20CGGGCCCACCACNONE 
J065102M04CGGGCCCACCACNONE 
J065139A02CGGGCCCACCACNONE 
J075109D21CGGGCCCACCACNONE 
J075191L12CGGGCCCACCACNONE 
J090096C03CGGGCCCACCACNONE 
J100036C23CGGGCCCACCACNONE 
Os03g0288400Os03g0288400GCGGGCCCACCAConserved hypothetical protein. 
Os03g0288900AK100329GGCCCGGCCCACCConserved hypothetical protein. 
J023080H15GGCCCGGCCCACCNONE 
J033136I21GGCCCGGCCCACCNONE 
J065036A16GGCCCGGCCCACCNONE 
J065186A16GGCCCGGCCCACCNONE 
J065187B08GGCCCGGCCCACCNONE 
J065202E24GGCCCGGCCCACCNONE 
Os03g0294200AK069285GCTGGGCCCACCTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0302900011-005-H01GGGGCCCACCTNONE 
AK069222GGGGCCCACCTConserved hypothetical protein. 
J023014L15GGGGCCCACCTNONE 
J033023G12GGGGCCCACCTNONE 
J090008H16GGGGCCCACCTNONE 
Os03g0305400009-198-D04GGTGGGGCCCACCTGTCNONE 
013-012-C06GGTGGGGCCCACCTGTCNONE 
014-034-D01GGTGGGGCCCACCTGTCNONE 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
J023012O22GGTGGGGCCCACCTGTCNONE 
J023097A13GGTGGGGCCCACCTGTCNONE 
J023107P16GGTGGGGCCCACCTGTCNONE 
J023113C14GGTGGGGCCCACCTGTCNONE 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0327800J023133J12GGGGCCCACCCCCGCGNONE 
J065118C24GGGGCCCACCCCCGCGNONE 
J065136O13GGGGCCCACCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
J065184M03GGGGCCCACCCCCGCGNONE 
J075105K14GGGGCCCACCCCCGCGNONE 
J075115E14GGGGCCCACCCCCGCGNONE 
J075166M18GGGGCCCACCCCCGCGNONE 
J075178F01GGGGCCCACCCCCGCGNONE 
J090008O14GGGGCCCACCCCCGCGNONE 
J090075F12GGGGCCCACCCCCGCGNONE 
J100019F12GGGGCCCACCCCCGCGNONE 
J100074P18GGGGCCCACCCCCGCGNONE 
J100075D15GGGGCCCACCCCCGCGNONE 
Os03g0335300AK098846GGTGGGGCCCACCCNONE 
AK098891GGTGGGGCCCACCCNONE 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847GGTGGGGCCCACCCNONE 
AK121413GGTGGGGCCCACCCNONE 
Os03g0342900006-032-D01AGGTGGGCCACCCCACGTGNONE 
006-032-D01CTGGCCCACCTCGCCCCACGNONE 
006-033-E10AGGTGGGCCACCCCACGTGNONE 
006-033-E10CTGGCCCACCTCGCCCCACGNONE 
006-051-G06AGGTGGGCCACCCCACGTGNONE 
006-051-G06CTGGCCCACCTCGCCCCACGNONE 
006-053-E05AGGTGGGCCACCCCACGTGNONE 
006-053-E05CTGGCCCACCTCGCCCCACGNONE 
006-056-B05AGGTGGGCCACCCCACGTGNONE 
006-056-B05CTGGCCCACCTCGCCCCACGNONE 
006-058-F04AGGTGGGCCACCCCACGTGNONE 
006-058-F04CTGGCCCACCTCGCCCCACGNONE 
006-059-E05AGGTGGGCCACCCCACGTGNONE 
006-059-E05CTGGCCCACCTCGCCCCACGNONE 
006-060-F10AGGTGGGCCACCCCACGTGNONE 
006-060-F10CTGGCCCACCTCGCCCCACGNONE 
006-104-D12AGGTGGGCCACCCCACGTGNONE 
006-104-D12CTGGCCCACCTCGCCCCACGNONE 
009-129-C12AGGTGGGCCACCCCACGTGNONE 
009-129-C12CTGGCCCACCTCGCCCCACGNONE 
AK060136AGGTGGGCCACCCCACGTGNONE 
AK060136CTGGCCCACCTCGCCCCACGNONE 
AK060980AGGTGGGCCACCCCACGTGNONE 
AK060980CTGGCCCACCTCGCCCCACGNONE 
AK064815AGGTGGGCCACCCCACGTGDormancyauxin associated family protein. 
AK064815CTGGCCCACCTCGCCCCACGDormancyauxin associated family protein. 
AK104244AGGTGGGCCACCCCACGTGNONE 
AK104244CTGGCCCACCTCGCCCCACGNONE 
AK104391AGGTGGGCCACCCCACGTGNONE 
AK104391CTGGCCCACCTCGCCCCACGNONE 
AK104590AGGTGGGCCACCCCACGTGNONE 
AK104590CTGGCCCACCTCGCCCCACGNONE 
AK104744AGGTGGGCCACCCCACGTGNONE 
AK104744CTGGCCCACCTCGCCCCACGNONE 
AK106100AGGTGGGCCACCCCACGTGNONE 
AK106100CTGGCCCACCTCGCCCCACGNONE 
J013000E10AGGTGGGCCACCCCACGTGNONE 
J013000E10CTGGCCCACCTCGCCCCACGNONE 
J075027O22AGGTGGGCCACCCCACGTGNONE 
J075027O22CTGGCCCACCTCGCCCCACGNONE 
J075052J03AGGTGGGCCACCCCACGTGNONE 
J075052J03CTGGCCCACCTCGCCCCACGNONE 
J075066E15AGGTGGGCCACCCCACGTGNONE 
J075066E15CTGGCCCACCTCGCCCCACGNONE 
J075095C17AGGTGGGCCACCCCACGTGNONE 
J075095C17CTGGCCCACCTCGCCCCACGNONE 
J075118N05AGGTGGGCCACCCCACGTGNONE 
J075118N05CTGGCCCACCTCGCCCCACGNONE 
J075187K22AGGTGGGCCACCCCACGTGNONE 
J075187K22CTGGCCCACCTCGCCCCACGNONE 
J090026L04AGGTGGGCCACCCCACGTGNONE 
J090026L04CTGGCCCACCTCGCCCCACGNONE 
J090059G16AGGTGGGCCACCCCACGTGNONE 
J090059G16CTGGCCCACCTCGCCCCACGNONE 
J100055P20AGGTGGGCCACCCCACGTGNONE 
J100055P20CTGGCCCACCTCGCCCCACGNONE 
J100062A10AGGTGGGCCACCCCACGTGNONE 
J100062A10CTGGCCCACCTCGCCCCACGNONE 
J100068G20AGGTGGGCCACCCCACGTGNONE 
J100068G20CTGGCCCACCTCGCCCCACGNONE 
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein. 
J100033H02CCATGGGCCCACCNONE 
Os03g0370000AK100033GGTGGGGCCCACCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0374400016-027-B12GGTGGGCCCACCTNONE 
AK069719GGTGGGCCCACCTConserved hypothetical protein. 
J023020L05GGTGGGCCCACCTNONE 
J023026H16GGTGGGCCCACCTNONE 
J033025P22GGTGGGCCCACCTNONE 
J075016I21GGTGGGCCCACCTNONE 
J090015G21GGTGGGCCCACCTNONE 
Os03g0374500Os03g0374500GGTGGGCCCACCTHypothetical protein. 
Os03g0379300006-039-F11CTGGCCCACCACNONE 
006-039-F11GACAGGTGGGCCCGTTNONE 
AK061515CTGGCCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704CTGGCCCACCACNONE 
AK068704GACAGGTGGGCCCGTTNONE 
J013159M16CTGGCCCACCACNONE 
J013159M16GACAGGTGGGCCCGTTNONE 
J090067F01CTGGCCCACCACNONE 
J090067F01GACAGGTGGGCCCGTTNONE 
J090083F21CTGGCCCACCACNONE 
J090083F21GACAGGTGGGCCCGTTNONE 
J100040M08CTGGCCCACCACNONE 
J100040M08GACAGGTGGGCCCGTTNONE 
J100048C03CTGGCCCACCACNONE 
J100048C03GACAGGTGGGCCCGTTNONE 
J100056M07CTGGCCCACCACNONE 
J100056M07GACAGGTGGGCCCGTTNONE 
J100062N22CTGGCCCACCACNONE 
J100062N22GACAGGTGGGCCCGTTNONE 
J100086L07CTGGCCCACCACNONE 
J100086L07GACAGGTGGGCCCGTTNONE 
Os03g0379500AK064760TAGGCCCACCASimilar to 40S ribosomal protein S9. 
J080024D11TAGGCCCACCANONE 
J080044J02TAGGCCCACCANONE 
J080050F01TAGGCCCACCANONE 
J080063D21TAGGCCCACCANONE 
J080063G04TAGGCCCACCANONE 
J080078E02TAGGCCCACCANONE 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0398900AK107457GCGGCCCACCConserved hypothetical protein. 
Os03g0413000009-180-E02CGGGCCCACCCNONE 
009-188-B06CGGGCCCACCCNONE 
AK060225CGGGCCCACCCNONE 
AY062181CGGGCCCACCCSimilar to Potential histone-like transcription factor. 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12TGGTGGGCCCTGGCCCATCANONE 
Os03g0586300AK100442CAGGTGGGCCCCReticulon family protein. 
J023031G06CAGGTGGGCCCCNONE 
J023089N19CAGGTGGGCCCCNONE 
J023099N13CAGGTGGGCCCCNONE 
J065026N17CAGGTGGGCCCCNONE 
J065045N16CAGGTGGGCCCCNONE 
J065163L12CAGGTGGGCCCCNONE 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0647800003-103-H03ACCGGCCCACCAACNONE 
006-104-G09ACCGGCCCACCAACNONE 
AK070243ACCGGCCCACCAACConserved hypothetical protein. 
J100056F22ACCGGCCCACCAACNONE 
Os03g0669200J013037D23CAGGTGGGCCCCACANONE 
J023026K09CAGGTGGGCCCCACANONE 
J075008E21CAGGTGGGCCCCACANONE 
J075061B21CAGGTGGGCCCCACANONE 
J075151B13CAGGTGGGCCCCACANONE 
J075195L02CAGGTGGGCCCCACANONE 
J090061B07CAGGTGGGCCCCACANONE 
Os03g0670700009-028-B03GTGGTGGGCCGCNONE 
009-036-H12GTGGTGGGCCGCNONE 
009-053-H05GTGGTGGGCCGCNONE 
009-126-B02GTGGTGGGCCGCNONE 
009-135-D07GTGGTGGGCCGCNONE 
009-148-A03GTGGTGGGCCGCNONE 
009-148-A12GTGGTGGGCCGCNONE 
009-152-B02GTGGTGGGCCGCNONE 
009-153-B06GTGGTGGGCCGCNONE 
009-166-G05GTGGTGGGCCGCNONE 
009-181-A09GTGGTGGGCCGCNONE 
011-061-D07GTGGTGGGCCGCNONE 
012-043-C04GTGGTGGGCCGCNONE 
013-001-A02GTGGTGGGCCGCNONE 
013-004-F05GTGGTGGGCCGCNONE 
013-008-C08GTGGTGGGCCGCNONE 
013-015-B09GTGGTGGGCCGCNONE 
013-016-G05GTGGTGGGCCGCNONE 
013-023-A06GTGGTGGGCCGCNONE 
013-023-B06GTGGTGGGCCGCNONE 
013-032-F09GTGGTGGGCCGCNONE 
013-059-C07GTGGTGGGCCGCNONE 
013-071-E09GTGGTGGGCCGCNONE 
013-073-D06GTGGTGGGCCGCNONE 
013-077-C02GTGGTGGGCCGCNONE 
013-078-B12GTGGTGGGCCGCNONE 
013-093-A01GTGGTGGGCCGCNONE 
014-002-B12GTGGTGGGCCGCNONE 
014-003-E08GTGGTGGGCCGCNONE 
014-004-D06GTGGTGGGCCGCNONE 
014-007-C11GTGGTGGGCCGCNONE 
014-007-G10GTGGTGGGCCGCNONE 
014-019-C04GTGGTGGGCCGCNONE 
014-021-F05GTGGTGGGCCGCNONE 
014-024-G06GTGGTGGGCCGCNONE 
014-027-C07GTGGTGGGCCGCNONE 
014-027-D03GTGGTGGGCCGCNONE 
014-029-E07GTGGTGGGCCGCNONE 
014-031-B04GTGGTGGGCCGCNONE 
014-033-B05GTGGTGGGCCGCNONE 
014-033-C03GTGGTGGGCCGCNONE 
014-033-C12GTGGTGGGCCGCNONE 
014-036-F01GTGGTGGGCCGCNONE 
014-037-C04GTGGTGGGCCGCNONE 
014-040-H02GTGGTGGGCCGCNONE 
014-045-H04GTGGTGGGCCGCNONE 
014-045-H06GTGGTGGGCCGCNONE 
014-052-A08GTGGTGGGCCGCNONE 
014-076-G01GTGGTGGGCCGCNONE 
014-083-F04GTGGTGGGCCGCNONE 
014-086-E01GTGGTGGGCCGCNONE 
014-091-D02GTGGTGGGCCGCNONE 
014-091-F05GTGGTGGGCCGCNONE 
014-093-E10GTGGTGGGCCGCNONE 
014-100-C10GTGGTGGGCCGCNONE 
015-011-H02GTGGTGGGCCGCNONE 
015-073-B03GTGGTGGGCCGCNONE 
AF010579GTGGTGGGCCGCNONE 
AK059164GTGGTGGGCCGCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GTGGTGGGCCGCNONE 
AK119238GTGGTGGGCCGCNONE 
AK119242GTGGTGGGCCGCNONE 
J023037K17GTGGTGGGCCGCNONE 
J033136F11GTGGTGGGCCGCNONE 
J065008C13GTGGTGGGCCGCNONE 
J065032K18GTGGTGGGCCGCNONE 
J065043N10GTGGTGGGCCGCNONE 
J065045E06GTGGTGGGCCGCNONE 
J065046P21GTGGTGGGCCGCNONE 
J065048J17GTGGTGGGCCGCNONE 
J065053I23GTGGTGGGCCGCNONE 
J065053P03GTGGTGGGCCGCNONE 
J065054C13GTGGTGGGCCGCNONE 
J065058I17GTGGTGGGCCGCNONE 
J065061I12GTGGTGGGCCGCNONE 
J065062E09GTGGTGGGCCGCNONE 
J065063P04GTGGTGGGCCGCNONE 
J065068J07GTGGTGGGCCGCNONE 
J065076D02GTGGTGGGCCGCNONE 
J065083O07GTGGTGGGCCGCNONE 
J065090J02GTGGTGGGCCGCNONE 
J065093N08GTGGTGGGCCGCNONE 
J065097F02GTGGTGGGCCGCNONE 
J065112H17GTGGTGGGCCGCNONE 
J065121B01GTGGTGGGCCGCNONE 
J065124F12GTGGTGGGCCGCNONE 
J065130L03GTGGTGGGCCGCNONE 
J065131K05GTGGTGGGCCGCNONE 
J065132C06GTGGTGGGCCGCNONE 
J065135J18GTGGTGGGCCGCNONE 
J065138J22GTGGTGGGCCGCNONE 
J065140G21GTGGTGGGCCGCNONE 
J065161B19GTGGTGGGCCGCNONE 
J065162F22GTGGTGGGCCGCNONE 
J065162M09GTGGTGGGCCGCNONE 
J065163D03GTGGTGGGCCGCNONE 
J065163O21GTGGTGGGCCGCNONE 
J065165H11GTGGTGGGCCGCNONE 
J065165O16GTGGTGGGCCGCNONE 
J065167N06GTGGTGGGCCGCNONE 
J065168I08GTGGTGGGCCGCNONE 
J065170A14GTGGTGGGCCGCNONE 
J065170L03GTGGTGGGCCGCNONE 
J065171C08GTGGTGGGCCGCNONE 
J065173G11GTGGTGGGCCGCNONE 
J065173M09GTGGTGGGCCGCNONE 
J065176P07GTGGTGGGCCGCNONE 
J065178K24GTGGTGGGCCGCNONE 
J065185O12GTGGTGGGCCGCNONE 
J065191E02GTGGTGGGCCGCNONE 
J065204H10GTGGTGGGCCGCNONE 
J075033C23GTGGTGGGCCGCNONE 
J075041M21GTGGTGGGCCGCNONE 
J075043F13GTGGTGGGCCGCNONE 
J075044D02GTGGTGGGCCGCNONE 
J075044J15GTGGTGGGCCGCNONE 
J075048L07GTGGTGGGCCGCNONE 
J075054G12GTGGTGGGCCGCNONE 
J075055J10GTGGTGGGCCGCNONE 
J075059F09GTGGTGGGCCGCNONE 
J075066M23GTGGTGGGCCGCNONE 
J075071O09GTGGTGGGCCGCNONE 
J075085G23GTGGTGGGCCGCNONE 
J075086B21GTGGTGGGCCGCNONE 
J075087L18GTGGTGGGCCGCNONE 
J075087L21GTGGTGGGCCGCNONE 
J075087N14GTGGTGGGCCGCNONE 
J075088O13GTGGTGGGCCGCNONE 
J075089B06GTGGTGGGCCGCNONE 
J075089E20GTGGTGGGCCGCNONE 
J075090J01GTGGTGGGCCGCNONE 
J075090L05GTGGTGGGCCGCNONE 
J075091G05GTGGTGGGCCGCNONE 
J075091N06GTGGTGGGCCGCNONE 
J075093G08GTGGTGGGCCGCNONE 
J075094C13GTGGTGGGCCGCNONE 
J075095K01GTGGTGGGCCGCNONE 
J075096C02GTGGTGGGCCGCNONE 
J075097L16GTGGTGGGCCGCNONE 
J075097O10GTGGTGGGCCGCNONE 
J075098H24GTGGTGGGCCGCNONE 
J075099H02GTGGTGGGCCGCNONE 
J075099J11GTGGTGGGCCGCNONE 
J075099L08GTGGTGGGCCGCNONE 
J075109I11GTGGTGGGCCGCNONE 
J075114F03GTGGTGGGCCGCNONE 
J075121G07GTGGTGGGCCGCNONE 
J075122D23GTGGTGGGCCGCNONE 
J075132O07GTGGTGGGCCGCNONE 
J075141L21GTGGTGGGCCGCNONE 
J075142I08GTGGTGGGCCGCNONE 
J075145A06GTGGTGGGCCGCNONE 
J075147J15GTGGTGGGCCGCNONE 
J075150B09GTGGTGGGCCGCNONE 
J075151E07GTGGTGGGCCGCNONE 
J075161M16GTGGTGGGCCGCNONE 
J075190I16GTGGTGGGCCGCNONE 
J075192L05GTGGTGGGCCGCNONE 
J075192O03GTGGTGGGCCGCNONE 
J075192O08GTGGTGGGCCGCNONE 
J075193L12GTGGTGGGCCGCNONE 
J080001M24GTGGTGGGCCGCNONE 
J080004E20GTGGTGGGCCGCNONE 
J080005K15GTGGTGGGCCGCNONE 
J080005L05GTGGTGGGCCGCNONE 
J080014P20GTGGTGGGCCGCNONE 
J080029D12GTGGTGGGCCGCNONE 
J080030H09GTGGTGGGCCGCNONE 
J080039G05GTGGTGGGCCGCNONE 
J080040E18GTGGTGGGCCGCNONE 
J080041B02GTGGTGGGCCGCNONE 
J080041E06GTGGTGGGCCGCNONE 
J080041G05GTGGTGGGCCGCNONE 
J080041G24GTGGTGGGCCGCNONE 
J080041H07GTGGTGGGCCGCNONE 
J080041K03GTGGTGGGCCGCNONE 
J080047G01GTGGTGGGCCGCNONE 
J080052E07GTGGTGGGCCGCNONE 
J080053B15GTGGTGGGCCGCNONE 
J080053N01GTGGTGGGCCGCNONE 
J080054I01GTGGTGGGCCGCNONE 
J080054N02GTGGTGGGCCGCNONE 
J080063P03GTGGTGGGCCGCNONE 
J080064E13GTGGTGGGCCGCNONE 
J080064G13GTGGTGGGCCGCNONE 
J080065F02GTGGTGGGCCGCNONE 
J080065G03GTGGTGGGCCGCNONE 
J080065K17GTGGTGGGCCGCNONE 
J080067D06GTGGTGGGCCGCNONE 
J080067H23GTGGTGGGCCGCNONE 
J080067M15GTGGTGGGCCGCNONE 
J080068B20GTGGTGGGCCGCNONE 
J080068G24GTGGTGGGCCGCNONE 
J080072K19GTGGTGGGCCGCNONE 
J080076I24GTGGTGGGCCGCNONE 
J080092F05GTGGTGGGCCGCNONE 
J080092K14GTGGTGGGCCGCNONE 
J080092N22GTGGTGGGCCGCNONE 
J080093K02GTGGTGGGCCGCNONE 
J080094C08GTGGTGGGCCGCNONE 
J080094E09GTGGTGGGCCGCNONE 
J080094E20GTGGTGGGCCGCNONE 
J080094G08GTGGTGGGCCGCNONE 
J080094H18GTGGTGGGCCGCNONE 
J080094P22GTGGTGGGCCGCNONE 
J080095J23GTGGTGGGCCGCNONE 
J080096F14GTGGTGGGCCGCNONE 
J080097A21GTGGTGGGCCGCNONE 
J080097I07GTGGTGGGCCGCNONE 
J080097J02GTGGTGGGCCGCNONE 
J080097K01GTGGTGGGCCGCNONE 
J080097K03GTGGTGGGCCGCNONE 
J080305H18GTGGTGGGCCGCNONE 
J080306G01GTGGTGGGCCGCNONE 
J080306O08GTGGTGGGCCGCNONE 
J080311I01GTGGTGGGCCGCNONE 
J080315N24GTGGTGGGCCGCNONE 
J090003K21GTGGTGGGCCGCNONE 
J090008C20GTGGTGGGCCGCNONE 
J090008K19GTGGTGGGCCGCNONE 
J090008P13GTGGTGGGCCGCNONE 
J090015H22GTGGTGGGCCGCNONE 
J090016M01GTGGTGGGCCGCNONE 
J090018E13GTGGTGGGCCGCNONE 
J090018G03GTGGTGGGCCGCNONE 
J090018L17GTGGTGGGCCGCNONE 
J090019H11GTGGTGGGCCGCNONE 
J090021B19GTGGTGGGCCGCNONE 
J090021K02GTGGTGGGCCGCNONE 
J090023H15GTGGTGGGCCGCNONE 
J090034E03GTGGTGGGCCGCNONE 
J090045D16GTGGTGGGCCGCNONE 
J090045I06GTGGTGGGCCGCNONE 
J090047L09GTGGTGGGCCGCNONE 
J090048B05GTGGTGGGCCGCNONE 
J090048D11GTGGTGGGCCGCNONE 
J090048N11GTGGTGGGCCGCNONE 
J090050F20GTGGTGGGCCGCNONE 
J090052M20GTGGTGGGCCGCNONE 
J090083H03GTGGTGGGCCGCNONE 
J090084C12GTGGTGGGCCGCNONE 
J090095B05GTGGTGGGCCGCNONE 
J090095M18GTGGTGGGCCGCNONE 
J100024I22GTGGTGGGCCGCNONE 
J100024J12GTGGTGGGCCGCNONE 
J100024J22GTGGTGGGCCGCNONE 
J100025F07GTGGTGGGCCGCNONE 
J100026B13GTGGTGGGCCGCNONE 
J100027N03GTGGTGGGCCGCNONE 
J100029F14GTGGTGGGCCGCNONE 
J100029L20GTGGTGGGCCGCNONE 
J100032C22GTGGTGGGCCGCNONE 
J100032I08GTGGTGGGCCGCNONE 
J100032O05GTGGTGGGCCGCNONE 
J100033J24GTGGTGGGCCGCNONE 
J100033L12GTGGTGGGCCGCNONE 
J100034K06GTGGTGGGCCGCNONE 
J100037D09GTGGTGGGCCGCNONE 
J100038H02GTGGTGGGCCGCNONE 
J100039A12GTGGTGGGCCGCNONE 
J100039N12GTGGTGGGCCGCNONE 
J100039O21GTGGTGGGCCGCNONE 
J100040K05GTGGTGGGCCGCNONE 
J100042A02GTGGTGGGCCGCNONE 
J100042A17GTGGTGGGCCGCNONE 
J100043C15GTGGTGGGCCGCNONE 
J100044A17GTGGTGGGCCGCNONE 
J100044E18GTGGTGGGCCGCNONE 
J100044I11GTGGTGGGCCGCNONE 
J100044J15GTGGTGGGCCGCNONE 
J100045E23GTGGTGGGCCGCNONE 
J100049B18GTGGTGGGCCGCNONE 
J100050G04GTGGTGGGCCGCNONE 
J100051D06GTGGTGGGCCGCNONE 
J100051H20GTGGTGGGCCGCNONE 
J100052J01GTGGTGGGCCGCNONE 
J100052K07GTGGTGGGCCGCNONE 
J100055I01GTGGTGGGCCGCNONE 
J100057D02GTGGTGGGCCGCNONE 
J100059G14GTGGTGGGCCGCNONE 
J100059G21GTGGTGGGCCGCNONE 
J100059H03GTGGTGGGCCGCNONE 
J100059H15GTGGTGGGCCGCNONE 
J100063E13GTGGTGGGCCGCNONE 
J100063M02GTGGTGGGCCGCNONE 
J100064B17GTGGTGGGCCGCNONE 
J100064F11GTGGTGGGCCGCNONE 
J100066G12GTGGTGGGCCGCNONE 
J100066H09GTGGTGGGCCGCNONE 
J100068B12GTGGTGGGCCGCNONE 
J100068L16GTGGTGGGCCGCNONE 
J100068M23GTGGTGGGCCGCNONE 
J100069A02GTGGTGGGCCGCNONE 
J100069D07GTGGTGGGCCGCNONE 
J100069M13GTGGTGGGCCGCNONE 
J100070C07GTGGTGGGCCGCNONE 
J100070J11GTGGTGGGCCGCNONE 
J100070L20GTGGTGGGCCGCNONE 
J100071H10GTGGTGGGCCGCNONE 
J100072L14GTGGTGGGCCGCNONE 
J100072N12GTGGTGGGCCGCNONE 
J100073A21GTGGTGGGCCGCNONE 
J100074K17GTGGTGGGCCGCNONE 
J100074M04GTGGTGGGCCGCNONE 
J100075F11GTGGTGGGCCGCNONE 
J100076E23GTGGTGGGCCGCNONE 
J100076G03GTGGTGGGCCGCNONE 
J100077K01GTGGTGGGCCGCNONE 
J100077N23GTGGTGGGCCGCNONE 
J100079H17GTGGTGGGCCGCNONE 
J100081N01GTGGTGGGCCGCNONE 
J100082E04GTGGTGGGCCGCNONE 
J100082K11GTGGTGGGCCGCNONE 
J100085H23GTGGTGGGCCGCNONE 
J100086O18GTGGTGGGCCGCNONE 
J100087F21GTGGTGGGCCGCNONE 
J100088E02GTGGTGGGCCGCNONE 
J100088F08GTGGTGGGCCGCNONE 
J100088G24GTGGTGGGCCGCNONE 
J100088K20GTGGTGGGCCGCNONE 
J100089B19GTGGTGGGCCGCNONE 
J100089K22GTGGTGGGCCGCNONE 
J100089N22GTGGTGGGCCGCNONE 
J100089O17GTGGTGGGCCGCNONE 
J100090N05GTGGTGGGCCGCNONE 
Os03g0701000J075172J23CCCGGGCCCACCCGNONE 
Os03g0712600015-008-G03TGGTGGGCCCAGANONE 
AK103705TGGTGGGCCCAGAHypothetical protein. 
J033136N14TGGTGGGCCCAGANONE 
Os03g0713100J013039M09CCCACTCCCTGGGGCCCACCTGNONE 
J023007K01CCCACTCCCTGGGGCCCACCTGNONE 
J023073H01CCCACTCCCTGGGGCCCACCTGNONE 
J023087M20CCCACTCCCTGGGGCCCACCTGNONE 
J023142E01CCCACTCCCTGGGGCCCACCTGNONE 
J033048E03CCCACTCCCTGGGGCCCACCTGNONE 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCACTCCCTGGGGCCCACCTGNONE 
J033074M20CCCACTCCCTGGGGCCCACCTGNONE 
J033084M11CCCACTCCCTGGGGCCCACCTGNONE 
J033091I23CCCACTCCCTGGGGCCCACCTGNONE 
J033100C08CCCACTCCCTGGGGCCCACCTGNONE 
J033123K19CCCACTCCCTGGGGCCCACCTGNONE 
J090006P21CCCACTCCCTGGGGCCCACCTGNONE 
J090045O16CCCACTCCCTGGGGCCCACCTGNONE 
J100087M13CCCACTCCCTGGGGCCCACCTGNONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0746800AK101718GGTGGGCCCAACWD-40 repeat containing protein. 
Os03g0749900006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0752800AB041020ATGGCCCACCCNONE 
AF058697ATGGCCCACCCMADS14 protein. 
AF139664ATGGCCCACCCNONE 
AK121171ATGGCCCACCCNONE 
AY332478ATGGCCCACCCNONE 
AY551916ATGGCCCACCCNONE 
J023081C04ATGGCCCACCCNONE 
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE 
009-100-H11GGTGGGCCCTNONE 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
AK120423GGTGGGCCCTProtein of unknown function UPF0139 family protein. 
J013095D02CCGTGGGCCGGTGGGCCCGNONE 
J013095D02GGTGGGCCCTNONE 
J023091G12CCGTGGGCCGGTGGGCCCGNONE 
J023091G12GGTGGGCCCTNONE 
J065207J17CCGTGGGCCGGTGGGCCCGNONE 
J065207J17GGTGGGCCCTNONE 
J100067G13CCGTGGGCCGGTGGGCCCGNONE 
J100067G13GGTGGGCCCTNONE 
J100089L11CCGTGGGCCGGTGGGCCCGNONE 
J100089L11GGTGGGCCCTNONE 
Os03g0758800AJ252135GCCGTTGGGTGGGCCCCACGTNONE 
AJ312906GCCGTTGGGTGGGCCCCACGTNONE 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GCCGTTGGGTGGGCCCCACGTNONE 
J023109G09GCCGTTGGGTGGGCCCCACGTNONE 
J033038B14GCCGTTGGGTGGGCCCCACGTNONE 
J043013C09GCCGTTGGGTGGGCCCCACGTNONE 
J053096E21GCCGTTGGGTGGGCCCCACGTNONE 
J065026B08GCCGTTGGGTGGGCCCCACGTNONE 
J065062B16GCCGTTGGGTGGGCCCCACGTNONE 
J065066E03GCCGTTGGGTGGGCCCCACGTNONE 
J065091J12GCCGTTGGGTGGGCCCCACGTNONE 
J065164A06GCCGTTGGGTGGGCCCCACGTNONE 
J075014I20GCCGTTGGGTGGGCCCCACGTNONE 
J075117N07GCCGTTGGGTGGGCCCCACGTNONE 
J075142M03GCCGTTGGGTGGGCCCCACGTNONE 
J075175D04GCCGTTGGGTGGGCCCCACGTNONE 
J075188M01GCCGTTGGGTGGGCCCCACGTNONE 
J075199I20GCCGTTGGGTGGGCCCCACGTNONE 
J090010J12GCCGTTGGGTGGGCCCCACGTNONE 
J090025O16GCCGTTGGGTGGGCCCCACGTNONE 
J090041H05GCCGTTGGGTGGGCCCCACGTNONE 
J090078P07GCCGTTGGGTGGGCCCCACGTNONE 
J100031K10GCCGTTGGGTGGGCCCCACGTNONE 
J100055F23GCCGTTGGGTGGGCCCCACGTNONE 
J100064G05GCCGTTGGGTGGGCCCCACGTNONE 
J100080C24GCCGTTGGGTGGGCCCCACGTNONE 
J100080O07GCCGTTGGGTGGGCCCCACGTNONE 
J100090F01GCCGTTGGGTGGGCCCCACGTNONE 
Os03g0780600AK120180CAGGTGGGCCCCNONE 
D13224CAGGTGGGCCCCTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CAGGTGGGCCCCNONE 
J033022G05CAGGTGGGCCCCNONE 
J033028A16CAGGTGGGCCCCNONE 
J033050M08CAGGTGGGCCCCNONE 
J090053F04CAGGTGGGCCCCNONE 
J090064E19CAGGTGGGCCCCNONE 
J090083J24CAGGTGGGCCCCNONE 
J100024I23CAGGTGGGCCCCNONE 
Os03g0780800AK059874GGCCCGGGCCCACCACNONE 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
J065214L21GGCCCGGGCCCACCACNONE 
J075178I24GGCCCGGGCCCACCACNONE 
J075197K14GGCCCGGGCCCACCACNONE 
Os03g0784500AK109744GGTGGGCCCCACCACNONE 
Os03g0788800AK071670CAGGTGGGCCCCZinc finger, RING-type domain containing protein. 
J013090J22CAGGTGGGCCCCNONE 
J023050M06CAGGTGGGCCCCNONE 
J023073A12CAGGTGGGCCCCNONE 
J023075P21CAGGTGGGCCCCNONE 
J023106F04CAGGTGGGCCCCNONE 
J075181H19CAGGTGGGCCCCNONE 
J090009C24CAGGTGGGCCCCNONE 
J100027L24CAGGTGGGCCCCNONE 
J100055F06CAGGTGGGCCCCNONE 
J100081C22CAGGTGGGCCCCNONE 
J100084I21CAGGTGGGCCCCNONE 
Os03g0789200015-015-H03CCCGGGCCCACCANONE 
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein. 
AY224542CCCGGGCCCACCANONE 
J023110P10CCCGGGCCCACCANONE 
J075039H19CCCGGGCCCACCANONE 
Os03g0791800013-037-A12CAGGTGGGCCATNONE 
013-037-A12GACAGGTGGGCCCATGGNONE 
AB079798CAGGTGGGCCATNONE 
AB079798GACAGGTGGGCCCATGGNONE 
AK067703CAGGTGGGCCATRad6 (Ubiquitin carrier protein). 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK120251CAGGTGGGCCATNONE 
AK120251GACAGGTGGGCCCATGGNONE 
J013045G10CAGGTGGGCCATNONE 
J013045G10GACAGGTGGGCCCATGGNONE 
J023102B18CAGGTGGGCCATNONE 
J023102B18GACAGGTGGGCCCATGGNONE 
J065020J23CAGGTGGGCCATNONE 
J065020J23GACAGGTGGGCCCATGGNONE 
J065127I21CAGGTGGGCCATNONE 
J065127I21GACAGGTGGGCCCATGGNONE 
J065151E11CAGGTGGGCCATNONE 
J065151E11GACAGGTGGGCCCATGGNONE 
J075076B05CAGGTGGGCCATNONE 
J075076B05GACAGGTGGGCCCATGGNONE 
J075116C15CAGGTGGGCCATNONE 
J075116C15GACAGGTGGGCCCATGGNONE 
J075136A07CAGGTGGGCCATNONE 
J075136A07GACAGGTGGGCCCATGGNONE 
J100029G21CAGGTGGGCCATNONE 
J100029G21GACAGGTGGGCCCATGGNONE 
J100030K01CAGGTGGGCCATNONE 
J100030K01GACAGGTGGGCCCATGGNONE 
J100041J02CAGGTGGGCCATNONE 
J100041J02GACAGGTGGGCCCATGGNONE 
J100049C22CAGGTGGGCCATNONE 
J100049C22GACAGGTGGGCCCATGGNONE 
J100057G17CAGGTGGGCCATNONE 
J100057G17GACAGGTGGGCCCATGGNONE 
J100086L12CAGGTGGGCCATNONE 
J100086L12GACAGGTGGGCCCATGGNONE 
Os03g0800500006-075-C12GGTGGGCCCACACNONE 
AK061104GGTGGGCCCACACNONE 
AK070229GGTGGGCCCACACPutative small multi-drug export family protein. 
J065152L13GGTGGGCCCACACNONE 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
J013059D03CAGGTGGGCCCCACCNONE 
J013099J05CAGGTGGGCCCCACCNONE 
J013106M06CAGGTGGGCCCCACCNONE 
J013151H03CAGGTGGGCCCCACCNONE 
J023003G18CAGGTGGGCCCCACCNONE 
J023038M11CAGGTGGGCCCCACCNONE 
J023056M17CAGGTGGGCCCCACCNONE 
J023105F22CAGGTGGGCCCCACCNONE 
J033023F17CAGGTGGGCCCCACCNONE 
J033028J21CAGGTGGGCCCCACCNONE 
J033131J19CAGGTGGGCCCCACCNONE 
J033132E06CAGGTGGGCCCCACCNONE 
J090007L14CAGGTGGGCCCCACCNONE 
J090011H02CAGGTGGGCCCCACCNONE 
J090026D20CAGGTGGGCCCCACCNONE 
J090029H09CAGGTGGGCCCCACCNONE 
J090033B18CAGGTGGGCCCCACCNONE 
J090039J02CAGGTGGGCCCCACCNONE 
J090050D17CAGGTGGGCCCCACCNONE 
J090050I15CAGGTGGGCCCCACCNONE 
J090063G20CAGGTGGGCCCCACCNONE 
J090064J21CAGGTGGGCCCCACCNONE 
J090071E19CAGGTGGGCCCCACCNONE 
J090075F10CAGGTGGGCCCCACCNONE 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
Os03g0822700005-010-E01AGGTGGGCCCAATNONE 
005-010-E01TCCGGGCCCACCANONE 
006-088-H12AGGTGGGCCCAATNONE 
006-088-H12TCCGGGCCCACCANONE 
AK061682AGGTGGGCCCAATNONE 
AK061682TCCGGGCCCACCANONE 
AK101448AGGTGGGCCCAATArmadillo-like helical domain containing protein. 
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein. 
J023091N05AGGTGGGCCCAATNONE 
J023091N05TCCGGGCCCACCANONE 
Os03g0824500AK058990TTGGCCCACCAConserved hypothetical protein. 
J065057L18TTGGCCCACCANONE 
J065083L02TTGGCCCACCANONE 
J065086L24TTGGCCCACCANONE 
J065121L10TTGGCCCACCANONE 
J065168N03TTGGCCCACCANONE 
J100035J22TTGGCCCACCANONE 
J100050G18TTGGCCCACCANONE 
J100055F15TTGGCCCACCANONE 
Os03g0832600AK120137GGTGGGCCCCACASimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0836200009-165-F07GGGTGGGCCCCACCTGNONE 
015-092-G01GGGTGGGCCCCACCTGNONE 
AK058443GGGTGGGCCCCACCTGNONE 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
AK101225GGGTGGGCCCCACCTGNONE 
J013092A03GGGTGGGCCCCACCTGNONE 
J013095N17GGGTGGGCCCCACCTGNONE 
J013147J18GGGTGGGCCCCACCTGNONE 
J023019O10GGGTGGGCCCCACCTGNONE 
J023065N18GGGTGGGCCCCACCTGNONE 
J033113E18GGGTGGGCCCCACCTGNONE 
J033133E03GGGTGGGCCCCACCTGNONE 
J065059J15GGGTGGGCCCCACCTGNONE 
J065075O11GGGTGGGCCCCACCTGNONE 
J065119I07GGGTGGGCCCCACCTGNONE 
J065171J03GGGTGGGCCCCACCTGNONE 
J090016D21GGGTGGGCCCCACCTGNONE 
J090081O03GGGTGGGCCCCACCTGNONE 
J100040G18GGGTGGGCCCCACCTGNONE 
J100040L10GGGTGGGCCCCACCTGNONE 
J100055H13GGGTGGGCCCCACCTGNONE 
J100059I22GGGTGGGCCCCACCTGNONE 
J100078A08GGGTGGGCCCCACCTGNONE 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0846400AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
Os03g0854000009-186-C03GCGGGCCCACCTNONE 
AK061374GCGGGCCCACCTProtein of unknown function UPF0131 family protein. 
J065138B11GCGGGCCCACCTNONE 
Os03g0859500AK070637AGGTGGGCCCTABC transporter related domain containing protein. 
J023056J01AGGTGGGCCCTNONE 
J043003A05AGGTGGGCCCTNONE 
J065021L12AGGTGGGCCCTNONE 
J065022K11AGGTGGGCCCTNONE 
J065215B13AGGTGGGCCCTNONE 
J075025N20AGGTGGGCCCTNONE 
J075090B03AGGTGGGCCCTNONE 
J075090B04AGGTGGGCCCTNONE 
J075118C07AGGTGGGCCCTNONE 
J090026E21AGGTGGGCCCTNONE 
J090085D18AGGTGGGCCCTNONE 
J100028H06AGGTGGGCCCTNONE 
J100051L23AGGTGGGCCCTNONE 
J100052G02AGGTGGGCCCTNONE 
J100061O13AGGTGGGCCCTNONE 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
J013051M12CAAGTGGGCCGGCCCACCTNONE 
J013104N13CAAGTGGGCCGGCCCACCTNONE 
J065052E12CAAGTGGGCCGGCCCACCTNONE 
Os03g0861800AF358762AGGTGGGCCGGCCCACTTGNONE 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK109388AGGTGGGCCGGCCCACTTGNONE 
J013154L15AGGTGGGCCGGCCCACTTGNONE 
J013170I23AGGTGGGCCGGCCCACTTGNONE 
J023031D05AGGTGGGCCGGCCCACTTGNONE 
J023082E07AGGTGGGCCGGCCCACTTGNONE 
J023095M10AGGTGGGCCGGCCCACTTGNONE 
J023127D14AGGTGGGCCGGCCCACTTGNONE 
J023138M15AGGTGGGCCGGCCCACTTGNONE 
J023138M16AGGTGGGCCGGCCCACTTGNONE 
J033060B18AGGTGGGCCGGCCCACTTGNONE 
J033060F13AGGTGGGCCGGCCCACTTGNONE 
J033096J11AGGTGGGCCGGCCCACTTGNONE 
J033122C07AGGTGGGCCGGCCCACTTGNONE 
J053029A10AGGTGGGCCGGCCCACTTGNONE 
J053062O16AGGTGGGCCGGCCCACTTGNONE 
J053064J08AGGTGGGCCGGCCCACTTGNONE 
J053086F22AGGTGGGCCGGCCCACTTGNONE 
J065036C04AGGTGGGCCGGCCCACTTGNONE 
J065072J23AGGTGGGCCGGCCCACTTGNONE 
J065120D04AGGTGGGCCGGCCCACTTGNONE 
J065161D04AGGTGGGCCGGCCCACTTGNONE 
J065172H02AGGTGGGCCGGCCCACTTGNONE 
J065207B01AGGTGGGCCGGCCCACTTGNONE 
J075019H18AGGTGGGCCGGCCCACTTGNONE 
J075082E16AGGTGGGCCGGCCCACTTGNONE 
J075089A10AGGTGGGCCGGCCCACTTGNONE 
J075099G02AGGTGGGCCGGCCCACTTGNONE 
J075134M04AGGTGGGCCGGCCCACTTGNONE 
J075144K19AGGTGGGCCGGCCCACTTGNONE 
J075147F17AGGTGGGCCGGCCCACTTGNONE 
J090004O14AGGTGGGCCGGCCCACTTGNONE 
J090013A07AGGTGGGCCGGCCCACTTGNONE 
J090047K14AGGTGGGCCGGCCCACTTGNONE 
Os04g0253000005-012-H08ACCGGCCCACCNONE 
009-095-D01ACCGGCCCACCNONE 
016-090-D11ACCGGCCCACCNONE 
AK073668ACCGGCCCACCSimilar to Histone H1. 
J013088G23ACCGGCCCACCNONE 
J013162C07ACCGGCCCACCNONE 
J023031N06ACCGGCCCACCNONE 
J023039N07ACCGGCCCACCNONE 
J023083I01ACCGGCCCACCNONE 
J023083O14ACCGGCCCACCNONE 
J023122B19ACCGGCCCACCNONE 
J023133L08ACCGGCCCACCNONE 
J033052L06ACCGGCCCACCNONE 
J033080E10ACCGGCCCACCNONE 
J090032L14ACCGGCCCACCNONE 
J100022N05ACCGGCCCACCNONE 
J100029A08ACCGGCCCACCNONE 
J100029H18ACCGGCCCACCNONE 
J100066D09ACCGGCCCACCNONE 
J100077M22ACCGGCCCACCNONE 
Os04g0266400AK065632GTGGTGGGCCCCACCACNONE 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK072046GTGGTGGGCCCCACCACNONE 
AK105688GTGGTGGGCCCCACCACNONE 
Os04g0266900011-064-A07CTGGGGCCCACCNONE 
AK069447CTGGGGCCCACCBacterial transketolase family protein. 
J023019B19CTGGGGCCCACCNONE 
Os04g0303950J065204E07GGGTGGGCCGAANONE 
J075044A07GGGTGGGCCGAANONE 
Os04g0367400006-079-G12AGGGCCCACCTGTCAGNONE 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK100139AGGGCCCACCTGTCAGNONE 
J065009F13AGGGCCCACCTGTCAGNONE 
J065032N11AGGGCCCACCTGTCAGNONE 
J065039P10AGGGCCCACCTGTCAGNONE 
J065124I05AGGGCCCACCTGTCAGNONE 
J065197E16AGGGCCCACCTGTCAGNONE 
Os04g0387600009-148-E01ATGGCCCACCCGNONE 
009-155-A11ATGGCCCACCCGNONE 
009-175-F04ATGGCCCACCCGNONE 
AK063862ATGGCCCACCCGConserved hypothetical protein. 
J065035F12ATGGCCCACCCGNONE 
J065162C13ATGGCCCACCCGNONE 
J065169L19ATGGCCCACCCGNONE 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0434800011-033-F12GCGGCCCACCACNONE 
011-049-F07GCGGCCCACCACNONE 
AB114855GCGGCCCACCACNONE 
AK063934GCGGCCCACCACNONE 
AK103344GCGGCCCACCACSimilar to Thylakoid-bound ascorbate peroxidase (EC 1.11.1.11) (Fragment). 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
Os04g0456700009-080-F10CAGGTGGGCCCCACCCGNONE 
009-143-C10CAGGTGGGCCCCACCCGNONE 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
J013002D12CAGGTGGGCCCCACCCGNONE 
J065027N14CAGGTGGGCCCCACCCGNONE 
J065139E16CAGGTGGGCCCCACCCGNONE 
J065165D09CAGGTGGGCCCCACCCGNONE 
J065179D14CAGGTGGGCCCCACCCGNONE 
J065198C03CAGGTGGGCCCCACCCGNONE 
J065198L22CAGGTGGGCCCCACCCGNONE 
J075139M08CAGGTGGGCCCCACCCGNONE 
J075150D14CAGGTGGGCCCCACCCGNONE 
J075172F01CAGGTGGGCCCCACCCGNONE 
J075197F03CAGGTGGGCCCCACCCGNONE 
J090059E16CAGGTGGGCCCCACCCGNONE 
J100063J01CAGGTGGGCCCCACCCGNONE 
J100085F13CAGGTGGGCCCCACCCGNONE 
J100088O10CAGGTGGGCCCCACCCGNONE 
Os04g0463400AK059730AGGGCCCACCAProtein of unknown function DUF125, transmembrane family protein. 
Os04g0475500Os04g0475500CTGGCCCACCCConserved hypothetical protein. 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0479800AK121430TGGTGGGCCATCyclin-like F-box domain containing protein. 
J033099N03TGGTGGGCCATNONE 
J090035E10TGGTGGGCCATNONE 
Os04g0482300015-088-C07GGTGGGCCCAAACNONE 
AK064143GGTGGGCCCAAACBTB domain containing protein. 
J065053L16GGTGGGCCCAAACNONE 
J065053N15GGTGGGCCCAAACNONE 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
AK111976TCCGGCCCACCTSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0502900AK059306GAGGCCCACCCGEF-Hand type domain containing protein. 
AK099122GAGGCCCACCCGNONE 
Os04g0509600012-081-D04GGTGGGCCCCNONE 
AF001505GGTGGGCCCCNONE 
AK073718GGTGGGCCCCSimilar to Ammonium transporter Amt1;2 (Fragment). 
AK105667GGTGGGCCCCNONE 
AY569614GGTGGGCCCCNONE 
J033060L01GGTGGGCCCCNONE 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
J100049D17TGGTGGGCCCCACCNONE 
J100080K12TGGTGGGCCCCACCNONE 
Os04g0528100009-090-G06TACGGCCCACCCNONE 
009-168-C11TACGGCCCACCCNONE 
AK065957TACGGCCCACCCConserved hypothetical protein. 
J013039G20TACGGCCCACCCNONE 
J013044D08TACGGCCCACCCNONE 
J065013L14TACGGCCCACCCNONE 
J065143H08TACGGCCCACCCNONE 
J065146C14TACGGCCCACCCNONE 
J065149K22TACGGCCCACCCNONE 
J065156B18TACGGCCCACCCNONE 
J065201A04TACGGCCCACCCNONE 
J065209A04TACGGCCCACCCNONE 
Os04g0530000009-106-E11TTCGGCCCACCANONE 
011-012-E12TTCGGCCCACCANONE 
AK066169TTCGGCCCACCAConserved hypothetical protein. 
J013052P20TTCGGCCCACCANONE 
J090060G12TTCGGCCCACCANONE 
J100073H10TTCGGCCCACCANONE 
Os04g0531300016-006-E10TGGTGGGCCACNONE 
AK072647TGGTGGGCCACDihydrouridine synthase, DuS family protein. 
AK103911TGGTGGGCCACNONE 
J013038P22TGGTGGGCCACNONE 
J023130D01TGGTGGGCCACNONE 
J033150P13TGGTGGGCCACNONE 
J043026L14TGGTGGGCCACNONE 
J065049A08TGGTGGGCCACNONE 
J065215C17TGGTGGGCCACNONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0585100012-055-B08GTGGGGCCCACCNONE 
AK105286GTGGGGCCCACCZinc finger, DHHC-type domain containing protein. 
Os04g0589600011-100-F04CAAGTGGGCCCACCNONE 
AK061833CAAGTGGGCCCACCGlycosyl transferase, group 1 domain containing protein. 
AK098964CAAGTGGGCCCACCNONE 
AK100053CAAGTGGGCCCACCNONE 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AB042115TCCGACGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK099008TCCGACGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427TCCGACGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02TCCGACGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23TCCGACGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21TCCGACGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21TCCGACGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08TCCGACGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16TCCGACGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08TCCGACGGGCCCACCTNONE 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
Os04g0653100014-075-B07GGGGCCCACCCNONE 
016-077-E05GGGGCCCACCCNONE 
AK067094GGGGCCCACCCProtein of unknown function UPF0136, Transmembrane family protein. 
AK111420GGGGCCCACCCNONE 
J013098P05GGGGCCCACCCNONE 
J075001K22GGGGCCCACCCNONE 
J075198O04GGGGCCCACCCNONE 
Os04g0668900AF085174ACCGGCCCACCNONE 
AK067891ACCGGCCCACCSimilar to Plastid terminal oxidase. 
Os04g0674100J080097J12AAGGCCCACCAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TGGTGGGCCTTNONE 
AK103795TGGTGGGCCTTCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TGGTGGGCCTTNONE 
J065020P20TGGTGGGCCTTNONE 
J065057I21TGGTGGGCCTTNONE 
J065059P11TGGTGGGCCTTNONE 
J065083A22TGGTGGGCCTTNONE 
J065093K10TGGTGGGCCTTNONE 
J065097D03TGGTGGGCCTTNONE 
J065103P05TGGTGGGCCTTNONE 
J065113K09TGGTGGGCCTTNONE 
J065118F23TGGTGGGCCTTNONE 
J065119M06TGGTGGGCCTTNONE 
J065146K17TGGTGGGCCTTNONE 
J065161N12TGGTGGGCCTTNONE 
J065169L02TGGTGGGCCTTNONE 
J065189H12TGGTGGGCCTTNONE 
J065192E24TGGTGGGCCTTNONE 
J065193K17TGGTGGGCCTTNONE 
J065197O21TGGTGGGCCTTNONE 
J065214D09TGGTGGGCCTTNONE 
J065217B11TGGTGGGCCTTNONE 
J075132K07TGGTGGGCCTTNONE 
J100059D14TGGTGGGCCTTNONE 
Os04g0679800AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK099987GACAGGTGGGCCCCACCNONE 
J013130B11GACAGGTGGGCCCCACCNONE 
J065049C17GACAGGTGGGCCCCACCNONE 
J075191N12GACAGGTGGGCCCCACCNONE 
J075191P12GACAGGTGGGCCCCACCNONE 
J100031C07GACAGGTGGGCCCCACCNONE 
Os04g0683500AK071538TGGTGGGCCGAANONE 
AK105871TGGTGGGCCGAANONE 
AK106642TGGTGGGCCGAASimilar to Adenosine deaminase acting on tRNA 1. 
J023095A13TGGTGGGCCGAANONE 
J023099G11TGGTGGGCCGAANONE 
J075125A03TGGTGGGCCGAANONE 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345CGGGCCCACCTGTCAGNONE 
J023069G19CGGGCCCACCTGTCAGNONE 
J023097E09CGGGCCCACCTGTCAGNONE 
J065071A01CGGGCCCACCTGTCAGNONE 
J065186F08CGGGCCCACCTGTCAGNONE 
J075044B21CGGGCCCACCTGTCAGNONE 
J075120N18CGGGCCCACCTGTCAGNONE 
J075131B22CGGGCCCACCTGTCAGNONE 
J100041H18CGGGCCCACCTGTCAGNONE 
J100042P13CGGGCCCACCTGTCAGNONE 
Os05g0102500009-183-E08GGGGCCCACCCNONE 
AK063894GGGGCCCACCCNONE 
AK073341GGGGCCCACCCConserved hypothetical protein. 
J023022C11GGGGCCCACCCNONE 
J065095B14GGGGCCCACCCNONE 
J065130O12GGGGCCCACCCNONE 
J065142P07GGGGCCCACCCNONE 
J065155L18GGGGCCCACCCNONE 
Os05g0111200009-033-A06CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
J065006E13CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075001D12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075005J18CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075009L08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075012M21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075019K17CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075020D07CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075041D11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075051C03CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075060C05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075079N09CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075094B04CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075108E08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075115G05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075147L21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075161G12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168J11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168L11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075174F22CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
Os05g0115200AK106709CACTGACAAGGTGGGCCCTConserved hypothetical protein. 
AK106709GTTGGTGGGCCConserved hypothetical protein. 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
J033091I05GTTTGGGCCTAGGCCCACCCGNONE 
Os05g0137400AK065206GGTGGGCCCACCTSimilar to Aspartic protease precursor. 
D12777GGTGGGCCCACCTNONE 
J013002F13GGTGGGCCCACCTNONE 
J013029I15GGTGGGCCCACCTNONE 
J013033A10GGTGGGCCCACCTNONE 
J013035H24GGTGGGCCCACCTNONE 
J013051H21GGTGGGCCCACCTNONE 
J013098H05GGTGGGCCCACCTNONE 
J023060B04GGTGGGCCCACCTNONE 
J023130D23GGTGGGCCCACCTNONE 
J033140N08GGTGGGCCCACCTNONE 
J053039L22GGTGGGCCCACCTNONE 
J080007K21GGTGGGCCCACCTNONE 
Os05g0148600003-016-C11CGGGTGGGCCCCACACACACCNONE 
AK066168CGGGTGGGCCCCACACACACCNONE 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
AY360145CGGGTGGGCCCCACACACACCNONE 
J013055J22CGGGTGGGCCCCACACACACCNONE 
J013057M24CGGGTGGGCCCCACACACACCNONE 
J013074N03CGGGTGGGCCCCACACACACCNONE 
J013158A22CGGGTGGGCCCCACACACACCNONE 
J075118H09CGGGTGGGCCCCACACACACCNONE 
Os05g0152400Os05g0152400AGGGCCCACCACGlycosyl transferase, family 14 protein. 
Os05g0152400AGGGCCCACCTGlycosyl transferase, family 14 protein. 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK101218TTCGGCCCACCACNONE 
J065061E13TTCGGCCCACCACNONE 
J090089F18TTCGGCCCACCACNONE 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0164100AF456329CGGGTGGGGCCCACCCGNONE 
AK065086CGGGTGGGGCCCACCCGNONE 
AK072243CGGGTGGGGCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CGGGTGGGGCCCACCCGNONE 
J013132O12CGGGTGGGGCCCACCCGNONE 
J023003N09CGGGTGGGGCCCACCCGNONE 
Os05g0172800AK108688CCTGGGCCCACCTGConserved hypothetical protein. 
J075027E19CCTGGGCCCACCTGNONE 
J075174L13CCTGGGCCCACCTGNONE 
Os05g0176100AF030052CCCGGGCCCACCCNONE 
AK067850CCCGGGCCCACCCNONE 
AK067967CCCGGGCCCACCCNONE 
AK098978CCCGGGCCCACCCNONE 
AK099228CCCGGGCCCACCCNONE 
AK099281CCCGGGCCCACCCNONE 
AK100188CCCGGGCCCACCCSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140CCCGGGCCCACCCNONE 
Os05g0207700AK102665TGCGGGCCCACCCCCACTCCNONE 
AK103861TGCGGGCCCACCCCCACTCCSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE 
AK063666CCCACGGGCCCACCTGTCAGTNONE 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
Os05g0213500003-114-G10GGGTGGGCCCCACCACNONE 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
J013002L23GGGTGGGCCCCACCACNONE 
J023056H04GGGTGGGCCCCACCACNONE 
J075051G09GGGTGGGCCCCACCACNONE 
J075139N23GGGTGGGCCCCACCACNONE 
J100031B01GGGTGGGCCCCACCACNONE 
J100075M20GGGTGGGCCCCACCACNONE 
Os05g0217000AK062517GGTGGGGCCCACCProtein of unknown function DUF1070 family protein. 
J075142D02GGTGGGGCCCACCNONE 
Os05g0311000AK099633ATGGCCCACCANONE 
AK100201ATGGCCCACCANONE 
AK100520ATGGCCCACCAClathrin adaptor complex, medium chain family protein. 
J013047M12ATGGCCCACCANONE 
J013052M03ATGGCCCACCANONE 
J013059B15ATGGCCCACCANONE 
J023099C22ATGGCCCACCANONE 
J023100E05ATGGCCCACCANONE 
J023100J17ATGGCCCACCANONE 
J023101D04ATGGCCCACCANONE 
J023119B18ATGGCCCACCANONE 
J033024B03ATGGCCCACCANONE 
J033036M20ATGGCCCACCANONE 
J033071J05ATGGCCCACCANONE 
J033071O20ATGGCCCACCANONE 
J033111K10ATGGCCCACCANONE 
J033144C21ATGGCCCACCANONE 
J033145C21ATGGCCCACCANONE 
J100043L14ATGGCCCACCANONE 
J100079C01ATGGCCCACCANONE 
Os05g0350500013-071-D05GTGGCCCACCCNONE 
AF020787GTGGCCCACCCNONE 
AK061712GTGGCCCACCCNONE 
AK102897GTGGCCCACCCProliferation-associated protein 1 family protein. 
J033060G23GTGGCCCACCCNONE 
J033112P14GTGGCCCACCCNONE 
J033127J04GTGGCCCACCCNONE 
J090015L18GTGGCCCACCCNONE 
J090047K03GTGGCCCACCCNONE 
J090097J17GTGGCCCACCCNONE 
Os05g0354400AK065144CAGGTGGGCCCACCCProtein of unknown function DUF231, plant domain containing protein. 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962CAGGTGGGCCCCACCTGTCAGNONE 
J065083M07CAGGTGGGCCCCACCTGTCAGNONE 
Os05g0395300AK066212GTGGCCCACCCProtein of unknown function DUF21 domain containing protein. 
Os05g0401300009-111-H03AGGGCCCACCANONE 
AK060678AGGGCCCACCATwin-arginine translocation pathway signal domain containing protein. 
Os05g0406100AK070068GGGGCCCACCACNONE 
J023041D03GGGGCCCACCACNONE 
Os05g0407500AK074026GTGGGGGCCCACCTEsterase/lipase/thioesterase domain containing protein. 
Os05g0408200AK100057GCGGGCCCACCCGSBP domain containing protein. 
J065182F20GCGGGCCCACCCGNONE 
Os05g0423500015-048-C11AGGTGGGCCCCACCTGTCNONE 
015-048-C11CACGTGGGCCCACCTNONE 
AK066000AGGTGGGCCCCACCTGTCProtein kinase-like domain containing protein. 
AK066000CACGTGGGCCCACCTProtein kinase-like domain containing protein. 
J013049L02AGGTGGGCCCCACCTGTCNONE 
J013049L02CACGTGGGCCCACCTNONE 
Os05g0429900AK066834GCGGGCCCACCACNONE 
AK099108GCGGGCCCACCACNONE 
AK104053GCGGGCCCACCACNONE 
D88617GCGGGCCCACCACSimilar to MybHv5 (Fragment). 
J090031E22GCGGGCCCACCACNONE 
Os05g0430200J090095K16ACCGGGCCCACCTGTCNONE 
Os05g0435400AK109595CCAGGCCCACCAAGCCCConserved hypothetical protein. 
Os05g0438500006-102-F01GCGGCCCACCCNONE 
AK059951GCGGCCCACCCSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
Os05g0440100015-006-F06GAGGCCCACCANONE 
015-076-D04GAGGCCCACCANONE 
AK073094GAGGCCCACCANONE 
AK102786GAGGCCCACCAHistone deacetylase superfamily protein. 
J033107M16GAGGCCCACCANONE 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0458100006-084-A05ATGGCCCACCACNONE 
009-091-H05ATGGCCCACCACNONE 
AJ557547ATGGCCCACCACNONE 
AK059467ATGGCCCACCACNONE 
AK061127ATGGCCCACCACNONE 
AK101652ATGGCCCACCACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06ATGGCCCACCACNONE 
J033057B20ATGGCCCACCACNONE 
J033087A05ATGGCCCACCACNONE 
J043009C05ATGGCCCACCACNONE 
J090009E10ATGGCCCACCACNONE 
Os05g0460000011-074-F09GGGGCCCACCAACGCGTCCNONE 
J023002L01GGGGCCCACCAACGCGTCCNONE 
J023060I12GGGGCCCACCAACGCGTCCNONE 
J023060O12GGGGCCCACCAACGCGTCCNONE 
J023106P08GGGGCCCACCAACGCGTCCNONE 
J023141D17GGGGCCCACCAACGCGTCCNONE 
J023150E11GGGGCCCACCAACGCGTCCSimilar to 70 kDa heat shock cognate protein 1. 
J033030A20GGGGCCCACCAACGCGTCCNONE 
J033039H14GGGGCCCACCAACGCGTCCNONE 
J033101B11GGGGCCCACCAACGCGTCCNONE 
J033101B12GGGGCCCACCAACGCGTCCNONE 
J033114A09GGGGCCCACCAACGCGTCCNONE 
J090037G06GGGGCCCACCAACGCGTCCNONE 
J090048G13GGGGCCCACCAACGCGTCCNONE 
J090090F15GGGGCCCACCAACGCGTCCNONE 
Os05g0461300AK111917CTGGCCCACCAACSimilar to RAB8C. 
AK111946CTGGCCCACCAACNONE 
AK111972CTGGCCCACCAACNONE 
AK112021CTGGCCCACCAACNONE 
J033135H16CTGGCCCACCAACNONE 
J043036O11CTGGCCCACCAACNONE 
Os05g0467300006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0469900AK109700AGGTGGGCCGAGConserved hypothetical protein. 
Os05g0473300AK102559TGGTGGGCCCACCTGNONE 
AK103822TGGTGGGCCCACCTGNONE 
AK109855TGGTGGGCCCACCTGSimilar to Ethylene response factor 1. 
Os05g0478200J023113C02GCCCAACCTGGCCCACCANONE 
J023150G23GCCCAACCTGGCCCACCANONE 
J033101K13GCCCAACCTGGCCCACCANONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0493800AK110589CTGGCCCACCCSimilar to MtN21 nodulin protein-like. 
Os05g0503000AK068335CCTGGGCCCACCSimilar to Secretory carrier membrane protein. 
AK104049CCTGGGCCCACCNONE 
J013149D04CCTGGGCCCACCNONE 
J075085A06CCTGGGCCCACCNONE 
Os05g0512500009-036-D05GTGGTGGGCCGGTNONE 
009-036-D05GTGGTGGGCCTCNONE 
AK062441GTGGTGGGCCGGTCT20 family protein. 
AK062441GTGGTGGGCCTCCT20 family protein. 
J080003C10GTGGTGGGCCGGTNONE 
J080003C10GTGGTGGGCCTCNONE 
J080046G11GTGGTGGGCCGGTNONE 
J080046G11GTGGTGGGCCTCNONE 
Os05g0524500AK073571TAGGCCCACCCGProtein kinase-like domain containing protein. 
Os05g0543700AK071113TGGTGGGCCCACCTSimilar to Chaperone protein dnaJ. 
AK103912TGGTGGGCCCACCTNONE 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0566800AK065748GGTGGGCCGTGCold acclimation protein COR413-TM1. 
AY181210GGTGGGCCGTGNONE 
Os05g0567500AK073046CGGGTGGGCCCACGCGNONE 
AK121133CGGGTGGGCCCACGCGDNA glycosylase family protein. 
J023075P20CGGGTGGGCCCACGCGNONE 
Os05g0568600009-024-B09GGTGGGGCCCACCTGTCNONE 
009-024-B09GTGGCCCACCNONE 
009-024-B09GTGGCCCACCTNONE 
AK063781GGTGGGGCCCACCTGTCProtein of unknown function DUF1645 family protein. 
AK063781GTGGCCCACCProtein of unknown function DUF1645 family protein. 
AK063781GTGGCCCACCTProtein of unknown function DUF1645 family protein. 
J080049H14GGTGGGGCCCACCTGTCNONE 
J080049H14GTGGCCCACCNONE 
J080049H14GTGGCCCACCTNONE 
J080062M08GGTGGGGCCCACCTGTCNONE 
J080062M08GTGGCCCACCNONE 
J080062M08GTGGCCCACCTNONE 
J080064I07GGTGGGGCCCACCTGTCNONE 
J080064I07GTGGCCCACCNONE 
J080064I07GTGGCCCACCTNONE 
J080068A12GGTGGGGCCCACCTGTCNONE 
J080068A12GTGGCCCACCNONE 
J080068A12GTGGCCCACCTNONE 
J080086J10GGTGGGGCCCACCTGTCNONE 
J080086J10GTGGCCCACCNONE 
J080086J10GTGGCCCACCTNONE 
Os05g0585900AK062575CGGGCCCACCCGMitochondrial substrate carrier family protein. 
AK062575GACAGGTGGGCCCCMitochondrial substrate carrier family protein. 
AK098854CGGGCCCACCCGNONE 
AK098854GACAGGTGGGCCCCNONE 
J013000H16CGGGCCCACCCGNONE 
J013000H16GACAGGTGGGCCCCNONE 
J033118D07CGGGCCCACCCGNONE 
J033118D07GACAGGTGGGCCCCNONE 
Os05g0586600AB096011GGTGGGCCCAGGGACCCGPlastid sigma factor SIG5. 
AB096071GGTGGGCCCAGGGACCCGNONE 
AK105697GGTGGGCCCAGGGACCCGNONE 
Os05g0589000AK061980GTGGCCCACCANONE 
AK099181GTGGCCCACCAConserved hypothetical protein. 
Os05g0591600Os05g0591600AGGGCCCACCASimilar to Lysine decarboxylase-like protein. 
Os06g0101600AF093636GTGTGGGGGTGGGCCCACCTNONE 
AK070447GTGTGGGGGTGGGCCCACCTPlastocyanin, chloroplast precursor. 
J065001A20GTGTGGGGGTGGGCCCACCTNONE 
J065019M17GTGTGGGGGTGGGCCCACCTNONE 
J065021H18GTGTGGGGGTGGGCCCACCTNONE 
J065061A17GTGTGGGGGTGGGCCCACCTNONE 
J065073L02GTGTGGGGGTGGGCCCACCTNONE 
J065099F17GTGTGGGGGTGGGCCCACCTNONE 
J065101C23GTGTGGGGGTGGGCCCACCTNONE 
J065121E23GTGTGGGGGTGGGCCCACCTNONE 
J065122N04GTGTGGGGGTGGGCCCACCTNONE 
J065141N05GTGTGGGGGTGGGCCCACCTNONE 
J065143N21GTGTGGGGGTGGGCCCACCTNONE 
J065161H09GTGTGGGGGTGGGCCCACCTNONE 
J065161J04GTGTGGGGGTGGGCCCACCTNONE 
J065162P20GTGTGGGGGTGGGCCCACCTNONE 
J065182K10GTGTGGGGGTGGGCCCACCTNONE 
J065184M05GTGTGGGGGTGGGCCCACCTNONE 
J065186H24GTGTGGGGGTGGGCCCACCTNONE 
J065189G21GTGTGGGGGTGGGCCCACCTNONE 
J065190N14GTGTGGGGGTGGGCCCACCTNONE 
J065191H08GTGTGGGGGTGGGCCCACCTNONE 
J065205H17GTGTGGGGGTGGGCCCACCTNONE 
J075001E03GTGTGGGGGTGGGCCCACCTNONE 
J075001H21GTGTGGGGGTGGGCCCACCTNONE 
J075003J23GTGTGGGGGTGGGCCCACCTNONE 
J075003K01GTGTGGGGGTGGGCCCACCTNONE 
J075005I11GTGTGGGGGTGGGCCCACCTNONE 
J075007F16GTGTGGGGGTGGGCCCACCTNONE 
J075017I11GTGTGGGGGTGGGCCCACCTNONE 
J075018O05GTGTGGGGGTGGGCCCACCTNONE 
J075019G24GTGTGGGGGTGGGCCCACCTNONE 
J075032D04GTGTGGGGGTGGGCCCACCTNONE 
J075032N13GTGTGGGGGTGGGCCCACCTNONE 
J075033C09GTGTGGGGGTGGGCCCACCTNONE 
J075033D11GTGTGGGGGTGGGCCCACCTNONE 
J075039A20GTGTGGGGGTGGGCCCACCTNONE 
J075058P12GTGTGGGGGTGGGCCCACCTNONE 
J075062E10GTGTGGGGGTGGGCCCACCTNONE 
J075062P16GTGTGGGGGTGGGCCCACCTNONE 
J075063C17GTGTGGGGGTGGGCCCACCTNONE 
J075066E07GTGTGGGGGTGGGCCCACCTNONE 
J075066I20GTGTGGGGGTGGGCCCACCTNONE 
J075075K21GTGTGGGGGTGGGCCCACCTNONE 
J075078F03GTGTGGGGGTGGGCCCACCTNONE 
J075082F10GTGTGGGGGTGGGCCCACCTNONE 
J075086G16GTGTGGGGGTGGGCCCACCTNONE 
J075087E07GTGTGGGGGTGGGCCCACCTNONE 
J075087K06GTGTGGGGGTGGGCCCACCTNONE 
J075087L04GTGTGGGGGTGGGCCCACCTNONE 
J075088B16GTGTGGGGGTGGGCCCACCTNONE 
J075088D02GTGTGGGGGTGGGCCCACCTNONE 
J075094H21GTGTGGGGGTGGGCCCACCTNONE 
J075094I24GTGTGGGGGTGGGCCCACCTNONE 
J075094K10GTGTGGGGGTGGGCCCACCTNONE 
J075095C18GTGTGGGGGTGGGCCCACCTNONE 
J075097B05GTGTGGGGGTGGGCCCACCTNONE 
J075099C13GTGTGGGGGTGGGCCCACCTNONE 
J075099H22GTGTGGGGGTGGGCCCACCTNONE 
J075099L16GTGTGGGGGTGGGCCCACCTNONE 
J075104K08GTGTGGGGGTGGGCCCACCTNONE 
J075118O06GTGTGGGGGTGGGCCCACCTNONE 
J075119E15GTGTGGGGGTGGGCCCACCTNONE 
J075124N06GTGTGGGGGTGGGCCCACCTNONE 
J075126G02GTGTGGGGGTGGGCCCACCTNONE 
J075127L24GTGTGGGGGTGGGCCCACCTNONE 
J075131E23GTGTGGGGGTGGGCCCACCTNONE 
J075140H06GTGTGGGGGTGGGCCCACCTNONE 
J075146I20GTGTGGGGGTGGGCCCACCTNONE 
J075146N24GTGTGGGGGTGGGCCCACCTNONE 
J075147I19GTGTGGGGGTGGGCCCACCTNONE 
J075155K07GTGTGGGGGTGGGCCCACCTNONE 
J075156C05GTGTGGGGGTGGGCCCACCTNONE 
J075161G07GTGTGGGGGTGGGCCCACCTNONE 
J075164G01GTGTGGGGGTGGGCCCACCTNONE 
J075170J18GTGTGGGGGTGGGCCCACCTNONE 
J075172G17GTGTGGGGGTGGGCCCACCTNONE 
J075176G10GTGTGGGGGTGGGCCCACCTNONE 
J075178C05GTGTGGGGGTGGGCCCACCTNONE 
J075179G01GTGTGGGGGTGGGCCCACCTNONE 
J075181E24GTGTGGGGGTGGGCCCACCTNONE 
J080029D19GTGTGGGGGTGGGCCCACCTNONE 
J080034L11GTGTGGGGGTGGGCCCACCTNONE 
J080039G07GTGTGGGGGTGGGCCCACCTNONE 
J080062M23GTGTGGGGGTGGGCCCACCTNONE 
J080302A01GTGTGGGGGTGGGCCCACCTNONE 
J100042I15GTGTGGGGGTGGGCCCACCTNONE 
J100043G22GTGTGGGGGTGGGCCCACCTNONE 
J100056L12GTGTGGGGGTGGGCCCACCTNONE 
J100061A12GTGTGGGGGTGGGCCCACCTNONE 
J100073O20GTGTGGGGGTGGGCCCACCTNONE 
J100082I08GTGTGGGGGTGGGCCCACCTNONE 
Os06g0103400009-138-H04AAGGCCCAGGCCCACCANONE 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCAGGCCCACCANONE 
J080307A01AAGGCCCAGGCCCACCANONE 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0114700AK061552GACAGGTGGGCCCGGGProtein of unknown function DUF1218 family protein. 
AK098848GACAGGTGGGCCCGGGNONE 
AK122142GACAGGTGGGCCCGGGNONE 
J013000D16GACAGGTGGGCCCGGGNONE 
Os06g0128400AK064390GTGGCCCACCNONE 
AK121983GTGGCCCACCWD40-like domain containing protein. 
Os06g0128500AK058563GACAGGTGGGCCCGRibosomal protein L47, mitochondrial family protein. 
AK122132GACAGGTGGGCCCGNONE 
J033133F04GACAGGTGGGCCCGNONE 
J065094M24GACAGGTGGGCCCGNONE 
J065122J07GACAGGTGGGCCCGNONE 
J065137G10GACAGGTGGGCCCGNONE 
J065178L09GACAGGTGGGCCCGNONE 
J080011E11GACAGGTGGGCCCGNONE 
J080020G21GACAGGTGGGCCCGNONE 
J080039H03GACAGGTGGGCCCGNONE 
J080039J04GACAGGTGGGCCCGNONE 
Os06g0134000AK102796AGGTGGGCCAANONE 
AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0136900AK107405TGGTGGGCCCCACTCCProtein of unknown function DUF296 domain containing protein. 
Os06g0153200AK072625GCCCCCACCGGGTGGGGCCCACCCCCACCACNONE 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0157800AK121504GGTGGGCCATSimilar to CG7224 (Fragment). 
J033022L20GGTGGGCCATNONE 
J075033D09GGTGGGCCATNONE 
Os06g0161800AK064664TGCGGGCCCACCTGTCProtein of unknown function DUF569 family protein. 
Os06g0199300J065045H01GTGGTGGGCCCCACCCGNONE 
J075177C22GTGGTGGGCCCCACCCGNONE 
J080068H06GTGGTGGGCCCCACCCGNONE 
J090048F01GTGGTGGGCCCCACCCGNONE 
J100066F17GTGGTGGGCCCCACCCGNONE 
Os06g0225200005-009-B07ATGGCCCACCAACNONE 
AK067095ATGGCCCACCAACMitochodrial transcription termination factor-related family protein. 
AK104692ATGGCCCACCAACNONE 
J013096A05ATGGCCCACCAACNONE 
J090092C03ATGGCCCACCAACNONE 
Os06g0232000006-109-B11ACCGGCCCACCNONE 
011-080-C04ACCGGCCCACCNONE 
016-019-G01ACCGGCCCACCNONE 
AB110192ACCGGCCCACCNONE 
AK068966ACCGGCCCACCNONE 
AK071776ACCGGCCCACCConserved hypothetical protein. 
AK106053ACCGGCCCACCNONE 
J013146K14ACCGGCCCACCNONE 
J023013A10ACCGGCCCACCNONE 
J023029O20ACCGGCCCACCNONE 
J023110G05ACCGGCCCACCNONE 
J023135H04ACCGGCCCACCNONE 
J033125H14ACCGGCCCACCNONE 
J043009N01ACCGGCCCACCNONE 
J090096E06ACCGGCCCACCNONE 
J100070G19ACCGGCCCACCNONE 
Os06g0233000009-177-C07CAGGTGGGCCCGCNONE 
AK063118CAGGTGGGCCCGCConserved hypothetical protein. 
Os06g0326400AK065052GGTGGGCCCACCCNONE 
AK121116GGTGGGCCCACCCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23GGTGGGCCCACCCNONE 
J013129K13GGTGGGCCCACCCNONE 
J023010F22GGTGGGCCCACCCNONE 
J023120K19GGTGGGCCCACCCNONE 
Os06g0332600AK121615GCCGGCCCACCAConserved hypothetical protein. 
J033044B19GCCGGCCCACCANONE 
Os06g0526100Os06g0526100TGGTGGGCCCACACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0531600AK120456TGGTGGGCCTGANONE 
J013105I19TGGTGGGCCTGANONE 
J090006G02TGGTGGGCCTGANONE 
Os06g0555500016-056-B08GAGGCCCACCANONE 
AK102375GAGGCCCACCANONE 
AK106546GAGGCCCACCAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08GAGGCCCACCANONE 
J033091P04GAGGCCCACCANONE 
J090082P16GAGGCCCACCANONE 
Os06g0568200AK060816ATGGCCCACCTNONE 
J013048K13ATGGCCCACCTNONE 
J013050A11ATGGCCCACCTNONE 
J013051L22ATGGCCCACCTNONE 
J013061N20ATGGCCCACCTNONE 
J013065H06ATGGCCCACCTNONE 
J013068P08ATGGCCCACCTNONE 
J013069C22ATGGCCCACCTNONE 
J013070P14ATGGCCCACCTNONE 
J013074I20ATGGCCCACCTNONE 
J013106C16ATGGCCCACCTNONE 
J013122H02ATGGCCCACCTNONE 
J013129N22ATGGCCCACCTNONE 
J013129P06ATGGCCCACCTNONE 
J013147C12ATGGCCCACCTNONE 
J013152K21ATGGCCCACCTNONE 
J013155C14ATGGCCCACCTNONE 
J023001M10ATGGCCCACCTNONE 
J023012G04ATGGCCCACCTNONE 
J023012H22ATGGCCCACCTNONE 
J023012N11ATGGCCCACCTNONE 
J023013I23ATGGCCCACCTNONE 
J023014L11ATGGCCCACCTNONE 
J023022G16ATGGCCCACCTNONE 
J023031K09ATGGCCCACCTNONE 
J023042N15ATGGCCCACCTNONE 
J023044D09ATGGCCCACCTNONE 
J023063L08ATGGCCCACCTNONE 
J023074C24ATGGCCCACCTNONE 
J023079O11ATGGCCCACCTNONE 
J023107B12ATGGCCCACCTNONE 
J023114B10ATGGCCCACCTNONE 
J023120P15ATGGCCCACCTNONE 
J023123D20ATGGCCCACCTNONE 
J023130G12ATGGCCCACCTNONE 
J023131L13ATGGCCCACCTNONE 
J023135O11ATGGCCCACCTNONE 
J023138M14ATGGCCCACCTNONE 
J023149G07ATGGCCCACCTNONE 
J033024F07ATGGCCCACCTNONE 
J033026C20ATGGCCCACCTNONE 
J033036M14ATGGCCCACCTNONE 
J033038A18ATGGCCCACCTNONE 
J033043B18ATGGCCCACCTNONE 
J033043L05ATGGCCCACCTNONE 
J033064A07ATGGCCCACCTNONE 
J033087H21ATGGCCCACCTNONE 
<