
Summary of OsREG628 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count5439  

Entry Sequences (5439 entries)

LocusGene modelSequenceDescription
AK059848GTGGTGGGCCCCCACEmopamil-binding family protein. 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GTGGCCCACCCGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
Os01g0164500AK068747GCGGCCCACCASimilar to ATP-dependent RNA helicase-like protein. 
AK061054GGTGGGCCGGCAllinase, C-terminal domain containing protein. 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
Os01g0273300Os01g0273300CTGGGGCCCACCCBSD domain containing protein. 
Os01g0273800AK109645CAGGTGGGCCCCAFAD dependent oxidoreductase family protein. 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC (PK). 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
Os01g0286600AB057749GGTGGGCCATSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0314300AK073419TTTTGGGCCCACCACUncharacterized domain 2 containing protein. 
Os01g0332100AK120720CAGGTGGGCCCAGCSimilar to Neutral invertase-like protein (Fragment). 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
AK069619GGGGCCCACCCGProtein of unknown function DUF789 family protein. 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0560200AK102003GGGTGGGCCCACCSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
AK063740CGGGTGGGCCGGGConserved hypothetical protein. 
Os01g0593700Os01g0593700GCGGCCCACCSulphate anion transporter family protein. 
Os01g0618200AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
Os01g0704100AK072215ATGGCCCACCACSimilar to Membrane transporter. 
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0725900AK108128TCGGCCCACCTPollen Ole e 1 allergen and extensin domain containing protein. 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
AK101713GAGGCCCACCCSimilar to GA 2-oxidase 4. 
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC (GST-I) (GST-29) (GST class- phi). 
Os01g0764300J090053G03TCAGGCCCACCProtein of unknown function DUF155 family protein. 
J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0766400AK073493GTGGTGGGCCCCConserved hypothetical protein. 
Os01g0767100AK109493GGGGCCCACCTSimilar to Lysosomal Pro-X carboxypeptidase. 
AK061585GTGCGGTGGGCCGGTCyclin-like F-box domain containing protein. 
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein. 
AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
AK103541TGGTGGGCCGCProteasome subunit alpha type 3 (EC (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
AK105801GTGGCCCACCAC2OG-Fe(II) oxygenase domain containing protein. 
AK068980GGTGGGCCCATCAConserved hypothetical protein. 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
Os01g0846300AK065949CGGGTGGGCCCCSimilar to Protein phosphatase 2C. 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AK099677GGTGGGCCGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os01g0867900AK061366CGGCCCACCCGProtein of unknown function DUF502 family protein. 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
Os01g0877500AK101067GGTGGGCCCGGAProtein of unknown function UPF0054 family protein. 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
Os01g0896400AK107067CGTGTGGCCCACCCGConserved hypothetical protein. 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
016-088-H02AACTGGGCCCACCAProtein prenyltransferase domain containing protein. 
Os01g0923300AK067520GGGGCCCACCCBS domain containing protein. 
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment). 
AK105424CTGGCCCACCAACCBS domain containing protein. 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0976300AK111354TGGTGGGCCTAHeavy metal transport/detoxification protein domain containing protein. 
AK102186AACGGCCCACCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
Os02g0115700AK065094CCCGGGCCCACCACatalase isozyme A (EC (CAT-A). 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK121372CAGGTGGGCCCACANucleotide-binding, alpha-beta plait domain containing protein. 
Os02g0129700AK065610GTGGGGGCCCACCTHypothetical protein. 
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein. 
Os02g0133900AK107180CTGGCCCACCProtein of unknown function DUF829, eukaryotic family protein. 
Os02g0135700AK100570GGTGGGCCCCAGDNA polymerase V family protein. 
Os02g0143200AK070600AGGTGGGCCAGArmadillo-like helical domain containing protein. 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 
Os02g0190950J075001E02GTGGCCCACCCConserved hypothetical protein. 
AK064096TGGTGGGCCGCMyb, DNA-binding domain containing protein. 
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein. 
AK104969GGTGGGCCCGACTCGACConserved hypothetical protein. 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0517531AK121247GGGTGGGCCGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK106503GAGGCCCACCTConserved hypothetical protein. 
Os02g0686700AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
Os02g0741500AK068867CAGGCCCACCARibbon-helix-helix domain containing protein. 
AK066446ATGGCCCACCCSimilar to Starch synthase isoform zSTSII-2 (EC 
AK104985AGGTGGGCCATSimilar to Glucosyltransferase (Fragment). 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
Os02g0761600AK120494GGTGGGCCCCConserved hypothetical protein. 
AK099885AGGTGGGCCTAGCCCATCGGlutaredoxin 2 family protein. 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK120644GGGGCCCACCTConserved hypothetical protein. 
J065112M15AGGTGGGCCTGGEF-Hand type domain containing protein. 
Os02g0803200AK063404GCTGGGCCGGCCCACCSimilar to 30S ribosomal protein S15. 
Os02g0803600AK064750ACAGGTGGGCCCCLongin-like domain containing protein. 
Os02g0805200AK071591CAGGTGGGCCCGProliferating cell nuclear antigen (PCNA) (Cyclin). 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
Os02g0817500AK072707ATGGCCCACCTGTCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein. 
AK060519GTTGGTGGGCCATSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2. 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
Os03g0132000AK105769CGGGTGGGCCCACACGSimilar to 4-coumarate-CoA ligase-like protein. 
Os03g0133300AK064510GGTGGGCCCACAConserved hypothetical protein. 
AK103779CTCGCGCGGCCCACCSimilar to Transcriptional activator Rb homolog (Fragment). 
AK059776AAGGCCCACCTGalactose-binding like domain containing protein. 
AK059776TTGGCCCACCTGGalactose-binding like domain containing protein. 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
Os03g0161200AK066932GTGGTGGGCCCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0171700J065192H12GGTGGGCCCATCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0181600AK067807AGCCCAAGCGGCCCACCASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein. 
AK058750GGTGGGCCCGSimilar to Myo-inositol-1-phosphate synthase. 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0206400AK066494GGGTGGGCCCGCConserved hypothetical protein. 
Os03g0213600AK100407TGTGGGGCCCACCConserved hypothetical protein. 
Os03g0232600AK068218TATGGGCCCACCTU box domain containing protein. 
AK100620CCCACGGGCCCACCTArmadillo-like helical domain containing protein. 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
Os03g0248600AK073611CGGGTGGGCCCTSimilar to Enolase 2 (EC (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK071625AGGGCCCACCTGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein. 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
AK121750CGGGCCCACCACSimilar to Histone H2A. 
Os03g0288400Os03g0288400GCGGGCCCACCAConserved hypothetical protein. 
Os03g0288900AK100329GGCCCGGCCCACCConserved hypothetical protein. 
Os03g0294200AK069285GCTGGGCCCACCTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
AK069222GGGGCCCACCTConserved hypothetical protein. 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065136O13GGGGCCCACCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK064815AGGTGGGCCACCCCACGTGDormancyauxin associated family protein. 
AK064815CTGGCCCACCTCGCCCCACGDormancyauxin associated family protein. 
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein. 
Os03g0370000AK100033GGTGGGGCCCACCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 
AK069719GGTGGGCCCACCTConserved hypothetical protein. 
Os03g0374500Os03g0374500GGTGGGCCCACCTHypothetical protein. 
AK061515CTGGCCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0379500AK064760TAGGCCCACCASimilar to 40S ribosomal protein S9. 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
Os03g0398900AK107457GCGGCCCACCConserved hypothetical protein. 
AY062181CGGGCCCACCCSimilar to Potential histone-like transcription factor. 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
Os03g0586300AK100442CAGGTGGGCCCCReticulon family protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
AK070243ACCGGCCCACCAACConserved hypothetical protein. 
AK059164GTGGTGGGCCGCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK103705TGGTGGGCCCAGAHypothetical protein. 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0746800AK101718GGTGGGCCCAACWD-40 repeat containing protein. 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
AF058697ATGGCCCACCCMADS14 protein. 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
AK120423GGTGGGCCCTProtein of unknown function UPF0139 family protein. 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
D13224CAGGTGGGCCCCTubulin beta-1 chain (Beta-1 tubulin). 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
Os03g0788800AK071670CAGGTGGGCCCCZinc finger, RING-type domain containing protein. 
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein. 
AK067703CAGGTGGGCCATRad6 (Ubiquitin carrier protein). 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK070229GGTGGGCCCACACPutative small multi-drug export family protein. 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
AK101448AGGTGGGCCCAATArmadillo-like helical domain containing protein. 
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein. 
Os03g0824500AK058990TTGGCCCACCAConserved hypothetical protein. 
Os03g0832600AK120137GGTGGGCCCCACASimilar to Galactokinase (EC (Galactose kinase). 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
AK061374GCGGGCCCACCTProtein of unknown function UPF0131 family protein. 
Os03g0859500AK070637AGGTGGGCCCTABC transporter related domain containing protein. 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK073668ACCGGCCCACCSimilar to Histone H1. 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK069447CTGGGGCCCACCBacterial transketolase family protein. 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK063862ATGGCCCACCCGConserved hypothetical protein. 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK103344GCGGCCCACCACSimilar to Thylakoid-bound ascorbate peroxidase (EC (Fragment). 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
Os04g0463400AK059730AGGGCCCACCAProtein of unknown function DUF125, transmembrane family protein. 
Os04g0475500Os04g0475500CTGGCCCACCCConserved hypothetical protein. 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0479800AK121430TGGTGGGCCATCyclin-like F-box domain containing protein. 
AK064143GGTGGGCCCAAACBTB domain containing protein. 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
AK111976TCCGGCCCACCTSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0502900AK059306GAGGCCCACCCGEF-Hand type domain containing protein. 
AK073718GGTGGGCCCCSimilar to Ammonium transporter Amt1;2 (Fragment). 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
AK065957TACGGCCCACCCConserved hypothetical protein. 
AK066169TTCGGCCCACCAConserved hypothetical protein. 
AK072647TGGTGGGCCACDihydrouridine synthase, DuS family protein. 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
AK105286GTGGGGCCCACCZinc finger, DHHC-type domain containing protein. 
AK061833CAAGTGGGCCCACCGlycosyl transferase, group 1 domain containing protein. 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
AK067094GGGGCCCACCCProtein of unknown function UPF0136, Transmembrane family protein. 
AK067891ACCGGCCCACCSimilar to Plastid terminal oxidase. 
Os04g0674100J080097J12AAGGCCCACCAThioredoxin-like fold domain containing protein. 
AK103795TGGTGGGCCTTCoenzyme Q biosynthesis Coq4 family protein. 
Os04g0679800AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK106642TGGTGGGCCGAASimilar to Adenosine deaminase acting on tRNA 1. 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 
AK073341GGGGCCCACCCConserved hypothetical protein. 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
Os05g0115200AK106709CACTGACAAGGTGGGCCCTConserved hypothetical protein. 
AK106709GTTGGTGGGCCConserved hypothetical protein. 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
Os05g0137400AK065206GGTGGGCCCACCTSimilar to Aspartic protease precursor. 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
Os05g0152400Os05g0152400AGGGCCCACCACGlycosyl transferase, family 14 protein. 
Os05g0152400AGGGCCCACCTGlycosyl transferase, family 14 protein. 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK072243CGGGTGGGGCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC (EC (Fragment). 
Os05g0172800AK108688CCTGGGCCCACCTGConserved hypothetical protein. 
AK100188CCCGGGCCCACCCSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK103861TGCGGGCCCACCCCCACTCCSimilar to Serine/threonine-protein kinase PBS1 (EC (AvrPphB susceptible protein 1). 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
Os05g0217000AK062517GGTGGGGCCCACCProtein of unknown function DUF1070 family protein. 
AK100520ATGGCCCACCAClathrin adaptor complex, medium chain family protein. 
AK102897GTGGCCCACCCProliferation-associated protein 1 family protein. 
Os05g0354400AK065144CAGGTGGGCCCACCCProtein of unknown function DUF231, plant domain containing protein. 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
Os05g0395300AK066212GTGGCCCACCCProtein of unknown function DUF21 domain containing protein. 
AK060678AGGGCCCACCATwin-arginine translocation pathway signal domain containing protein. 
Os05g0407500AK074026GTGGGGGCCCACCTEsterase/lipase/thioesterase domain containing protein. 
Os05g0408200AK100057GCGGGCCCACCCGSBP domain containing protein. 
AK066000AGGTGGGCCCCACCTGTCProtein kinase-like domain containing protein. 
AK066000CACGTGGGCCCACCTProtein kinase-like domain containing protein. 
D88617GCGGGCCCACCACSimilar to MybHv5 (Fragment). 
Os05g0435400AK109595CCAGGCCCACCAAGCCCConserved hypothetical protein. 
AK059951GCGGCCCACCCSimilar to Soluble inorganic pyrophosphatase (EC (Pyrophosphate phospho- hydrolase) (PPase). 
AK102786GAGGCCCACCAHistone deacetylase superfamily protein. 
AK101652ATGGCCCACCACSimilar to FK506-binding protein 4 (EC (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J023150E11GGGGCCCACCAACGCGTCCSimilar to 70 kDa heat shock cognate protein 1. 
Os05g0461300AK111917CTGGCCCACCAACSimilar to RAB8C. 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
Os05g0469900AK109700AGGTGGGCCGAGConserved hypothetical protein. 
AK109855TGGTGGGCCCACCTGSimilar to Ethylene response factor 1. 
Os05g0493800AK110589CTGGCCCACCCSimilar to MtN21 nodulin protein-like. 
Os05g0503000AK068335CCTGGGCCCACCSimilar to Secretory carrier membrane protein. 
AK062441GTGGTGGGCCGGTCT20 family protein. 
AK062441GTGGTGGGCCTCCT20 family protein. 
Os05g0524500AK073571TAGGCCCACCCGProtein kinase-like domain containing protein. 
Os05g0543700AK071113TGGTGGGCCCACCTSimilar to Chaperone protein dnaJ. 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC (Stt7 homolog). 
Os05g0566800AK065748GGTGGGCCGTGCold acclimation protein COR413-TM1. 
AK121133CGGGTGGGCCCACGCGDNA glycosylase family protein. 
AK063781GGTGGGGCCCACCTGTCProtein of unknown function DUF1645 family protein. 
AK063781GTGGCCCACCProtein of unknown function DUF1645 family protein. 
AK063781GTGGCCCACCTProtein of unknown function DUF1645 family protein. 
Os05g0585900AK062575CGGGCCCACCCGMitochondrial substrate carrier family protein. 
AK062575GACAGGTGGGCCCCMitochondrial substrate carrier family protein. 
Os05g0586600AB096011GGTGGGCCCAGGGACCCGPlastid sigma factor SIG5. 
AK099181GTGGCCCACCAConserved hypothetical protein. 
Os05g0591600Os05g0591600AGGGCCCACCASimilar to Lysine decarboxylase-like protein. 
AK070447GTGTGGGGGTGGGCCCACCTPlastocyanin, chloroplast precursor. 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0114700AK061552GACAGGTGGGCCCGGGProtein of unknown function DUF1218 family protein. 
AK121983GTGGCCCACCWD40-like domain containing protein. 
Os06g0128500AK058563GACAGGTGGGCCCGRibosomal protein L47, mitochondrial family protein. 
Os06g0136900AK107405TGGTGGGCCCCACTCCProtein of unknown function DUF296 domain containing protein. 
AK106752GCCCCCACCGGGTGGGGCCCACCCCCACCACProtein of unknown function DUF250 domain containing protein. 
Os06g0157800AK121504GGTGGGCCATSimilar to CG7224 (Fragment). 
Os06g0161800AK064664TGCGGGCCCACCTGTCProtein of unknown function DUF569 family protein. 
AK067095ATGGCCCACCAACMitochodrial transcription termination factor-related family protein. 
AK071776ACCGGCCCACCConserved hypothetical protein. 
AK063118CAGGTGGGCCCGCConserved hypothetical protein. 
AK121116GGTGGGCCCACCCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
Os06g0332600AK121615GCCGGCCCACCAConserved hypothetical protein. 
Os06g0526100Os06g0526100TGGTGGGCCCACACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK106546GAGGCCCACCAInitiator tRNA phosphoribosyl transferase family protein. 