version

Summary of OsREG629 (All List)

OrganismOryza sativa  
IDOsREG629  
SequenceGGCCCAGA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1720  

Entry Sequences (1720 entries)

LocusGene modelSequenceDescription
Os01g0139600AK073130TTGGCCCAGATSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0193400AK069948ATCTGGGCCGGANONE 
AK069948TGCGGCCCAGANONE 
AK099271ATCTGGGCCGGANONE 
AK099271TGCGGCCCAGANONE 
AK107005ATCTGGGCCGGAConserved hypothetical protein. 
AK107005TGCGGCCCAGAConserved hypothetical protein. 
Os01g0201000J080015E02TCTGGGCCTCHypothetical protein. 
Os01g0253500J100088F12TCTGGGCCCACGAConserved hypothetical protein. 
Os01g0273300Os01g0273300TTGGCCCAGATBSD domain containing protein. 
Os01g0549400AK122104ATCTGGGCCCAGASimilar to RNA helicase-like protein DB10. 
Os01g0585400AK103584AGGGCCCATAGGCCCAGAConserved hypothetical protein. 
J033133B01AGGGCCCATAGGCCCAGANONE 
Os01g0633000006-075-A01TCTGGGCCAGNONE 
009-064-A11TCTGGGCCAGNONE 
009-153-F07TCTGGGCCAGNONE 
AK062051TCTGGGCCAGSimilar to 50S ribosomal protein L31. 
J013073B08TCTGGGCCAGNONE 
J065006K19TCTGGGCCAGNONE 
J065053P08TCTGGGCCAGNONE 
J065057D08TCTGGGCCAGNONE 
J065086P07TCTGGGCCAGNONE 
J065095C14TCTGGGCCAGNONE 
J065116B05TCTGGGCCAGNONE 
J065164L20TCTGGGCCAGNONE 
J065185K19TCTGGGCCAGNONE 
J065191E21TCTGGGCCAGNONE 
J065199P21TCTGGGCCAGNONE 
J065216M12TCTGGGCCAGNONE 
J075002M09TCTGGGCCAGNONE 
J075016N10TCTGGGCCAGNONE 
J075041K05TCTGGGCCAGNONE 
J075094E04TCTGGGCCAGNONE 
J075154O04TCTGGGCCAGNONE 
J075176D22TCTGGGCCAGNONE 
J075186M09TCTGGGCCAGNONE 
J075191H20TCTGGGCCAGNONE 
Os01g0680400AK067914TCGGCCCAGATAFII28-like protein family protein. 
J065039K13TCGGCCCAGANONE 
J065042K22TCGGCCCAGANONE 
J080016E23TCGGCCCAGANONE 
J080064E22TCGGCCCAGANONE 
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0730500AK100064GTGGCCCAGASimilar to Ferredoxin (Bacterial type ferredoxin family). 
Os01g0748100AK071261TCTGGGCCGGAHypothetical protein. 
J023084C08TCTGGGCCGGANONE 
J065058A07TCTGGGCCGGANONE 
Os01g0782200AK072068TCTGGGCCGCANONE 
AK107062TCTGGGCCGCADiacylglycerol kinase, catalytic region domain containing protein. 
Os01g0807000AK109751GACGGCCCAGAConserved hypothetical protein. 
Os01g0816700AK100654GCCGGCCCAGASimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0839700006-051-C07TCTGGGCCTGNONE 
006-068-C11TCTGGGCCTGNONE 
006-110-B10TCTGGGCCTGNONE 
006-116-G06TCTGGGCCTGNONE 
009-105-F07TCTGGGCCTGNONE 
AK099038TCTGGGCCTGNONE 
AK104148TCTGGGCCTGNONE 
AK112030TCTGGGCCTGSimilar to Ubiquitin carrier protein. 
J013042A08TCTGGGCCTGNONE 
J013135H01TCTGGGCCTGNONE 
J033058E09TCTGGGCCTGNONE 
J043020K17TCTGGGCCTGNONE 
J065034F06TCTGGGCCTGNONE 
J065057B21TCTGGGCCTGNONE 
J065075F07TCTGGGCCTGNONE 
J065076D08TCTGGGCCTGNONE 
J065084E10TCTGGGCCTGNONE 
J065109L12TCTGGGCCTGNONE 
J065114J04TCTGGGCCTGNONE 
J065159L23TCTGGGCCTGNONE 
J075009L02TCTGGGCCTGNONE 
J075178P14TCTGGGCCTGNONE 
J075197L07TCTGGGCCTGNONE 
J090060O04TCTGGGCCTGNONE 
J100076I20TCTGGGCCTGNONE 
Os01g0841000009-005-A12ATCTGGGCCGTCCNONE 
AK059601ATCTGGGCCGTCCENTH/VHS domain containing protein. 
AK103342ATCTGGGCCGTCCNONE 
J023022C02ATCTGGGCCGTCCNONE 
J023030C09ATCTGGGCCGTCCNONE 
J033075D24ATCTGGGCCGTCCNONE 
J033123O16ATCTGGGCCGTCCNONE 
J033126C16ATCTGGGCCGTCCNONE 
J065120M23ATCTGGGCCGTCCNONE 
J065190I23ATCTGGGCCGTCCNONE 
J090090G01ATCTGGGCCGTCCNONE 
Os01g0844800AK099801ATCTGGGCCGTCSimilar to Pumilio RBD (Fragment). 
AK102882ATCTGGGCCGTCNONE 
AK103686ATCTGGGCCGTCNONE 
Os01g0867600AK102226CGGACGGCCCAGATSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0885200AK059113TCTGGGCCTCNONE 
Os01g0887700AF045571TCTGGGCCTTGGGCCTTNONE 
AF047428TCTGGGCCTTGGGCCTTNONE 
AK071139TCTGGGCCTTGGGCCTTZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05TCTGGGCCTTGGGCCTTNONE 
J065062L19TCTGGGCCTTGGGCCTTNONE 
J065116H15TCTGGGCCTTGGGCCTTNONE 
J065194N09TCTGGGCCTTGGGCCTTNONE 
J100074C19TCTGGGCCTTGGGCCTTNONE 
Os01g0911700012-079-H01AGTGGGCCCAGANONE 
012-088-G05AGTGGGCCCAGANONE 
012-099-A01AGTGGGCCCAGANONE 
015-009-H07AGTGGGCCCAGANONE 
015-035-H12AGTGGGCCCAGANONE 
016-054-G03AGTGGGCCCAGANONE 
AK073805AGTGGGCCCAGASimilar to Regulatory protein viviparous-1. 
AK105441AGTGGGCCCAGANONE 
J033069I02AGTGGGCCCAGANONE 
J033086K01AGTGGGCCCAGANONE 
Os01g0948100AK111411CAAGGCCCAGATERCC4 domain containing protein. 
J090089O16CAAGGCCCAGATNONE 
Os01g0952600AK067525AAGGCCCAGANONE 
AK067525CAGGTGGGGCCCAGATNONE 
AK070047AAGGCCCAGASimilar to LacZ (Fragment). 
AK070047CAGGTGGGGCCCAGATSimilar to LacZ (Fragment). 
Os01g0959100009-163-G12ATCTGGGCCGGCNONE 
AK063053ATCTGGGCCGGCSimilar to Abscisic stress ripening protein 1. 
Os01g0960300AK100099TCTGGGCCGTASimilar to Glucose inhibited division protein A. 
Os01g0962600009-104-A04GAGGCCCAGANONE 
AK073846GAGGCCCAGASimilar to 40S ribosomal protein S10-1. 
J033070I05GAGGCCCAGANONE 
J065079N18GAGGCCCAGANONE 
J065122H12GAGGCCCAGANONE 
J065197O14GAGGCCCAGANONE 
Os01g0971900AK067739ATCCGACGGCCCAGASimilar to BPM. 
Os01g0976200006-044-A09ATCTGGGCCGGCNONE 
AK061022ATCTGGGCCGGC11-S plant seed storage protein family protein. 
J023012H20ATCTGGGCCGGCNONE 
J023025O07ATCTGGGCCGGCNONE 
J023082A14ATCTGGGCCGGCNONE 
J023115H15ATCTGGGCCGGCNONE 
J023133H14ATCTGGGCCGGCNONE 
J023133L21ATCTGGGCCGGCNONE 
J023136B16ATCTGGGCCGGCNONE 
J023145P17ATCTGGGCCGGCNONE 
J023146N03ATCTGGGCCGGCNONE 
Os02g0138600AK071778GGGCCGGCGGCCCAGAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023113L07GGGCCGGCGGCCCAGANONE 
Os02g0148600AK059287GACGGCCCAGAConserved hypothetical protein. 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0220600AK103901GAGGCCCAGANONE 
J013058O03GAGGCCCAGANONE 
J013124E21GAGGCCCAGANONE 
J023023L03GAGGCCCAGANONE 
J023023L21GAGGCCCAGANONE 
J023061N01GAGGCCCAGANONE 
J023065O09GAGGCCCAGANONE 
J023106J17GAGGCCCAGANONE 
J023119N08GAGGCCCAGANONE 
J033058A19GAGGCCCAGANONE 
J033098O13GAGGCCCAGANONE 
J033100M18GAGGCCCAGANONE 
J033125A21GAGGCCCAGANONE 
J033148C12GAGGCCCAGANONE 
J043017F03GAGGCCCAGANONE 
J043032J02GAGGCCCAGANONE 
J053047N10GAGGCCCAGANONE 
J053089P04GAGGCCCAGANONE 
J065051K09GAGGCCCAGANONE 
J065064H24GAGGCCCAGANONE 
J090001L06GAGGCCCAGANONE 
J090017C24GAGGCCCAGANONE 
J090058G15GAGGCCCAGANONE 
J090058H23GAGGCCCAGANONE 
J090061G20GAGGCCCAGANONE 
J090069N23GAGGCCCAGANONE 
J090071A08GAGGCCCAGANONE 
J090074A08GAGGCCCAGANONE 
J090077B15GAGGCCCAGANONE 
J090081K06GAGGCCCAGANONE 
J090083I05GAGGCCCAGANONE 
J090091O22GAGGCCCAGANONE 
J090097L10GAGGCCCAGANONE 
J100026B11GAGGCCCAGANONE 
J100044M01GAGGCCCAGANONE 
J100046F10GAGGCCCAGANONE 
J100051K14GAGGCCCAGANONE 
J100060D22GAGGCCCAGANONE 
J100060H18GAGGCCCAGANONE 
J100070I06GAGGCCCAGANONE 
J100071C04GAGGCCCAGANONE 
J100078M13GAGGCCCAGANONE 
J100080E17GAGGCCCAGANONE 
J100083I09GAGGCCCAGANONE 
Os02g0478700AK099723AAGGCCCAGATRibosomal protein S27. 
AK099723GACGGCCCAGATRibosomal protein S27. 
J013089A06AAGGCCCAGATNONE 
J013089A06GACGGCCCAGATNONE 
J065068E01AAGGCCCAGATNONE 
J065068E01GACGGCCCAGATNONE 
J065217F15AAGGCCCAGATNONE 
J065217F15GACGGCCCAGATNONE 
Os02g0510100AK058487ATCTGGGCCCGCNONE 
AK122107ATCTGGGCCCGCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06ATCTGGGCCCGCNONE 
J053077L04ATCTGGGCCCGCNONE 
J065010C11ATCTGGGCCCGCNONE 
J075104O14ATCTGGGCCCGCNONE 
J080003G03ATCTGGGCCCGCNONE 
J080014K05ATCTGGGCCCGCNONE 
J080026F03ATCTGGGCCCGCNONE 
J080027O05ATCTGGGCCCGCNONE 
J080037K15ATCTGGGCCCGCNONE 
J080039D24ATCTGGGCCCGCNONE 
J080043G19ATCTGGGCCCGCNONE 
J080047P05ATCTGGGCCCGCNONE 
J080048D22ATCTGGGCCCGCNONE 
J080049F23ATCTGGGCCCGCNONE 
J080062A21ATCTGGGCCCGCNONE 
J080063H20ATCTGGGCCCGCNONE 
J080067P15ATCTGGGCCCGCNONE 
J080068P19ATCTGGGCCCGCNONE 
J080079J15ATCTGGGCCCGCNONE 
J080092K19ATCTGGGCCCGCNONE 
J080096M04ATCTGGGCCCGCNONE 
Os02g0530600012-040-G06TCTGGGCCTGNONE 
AK105277TCTGGGCCTGNONE 
J075004K11TCTGGGCCTGNONE 
J075024O04TCTGGGCCTGNONE 
J075031K02TCTGGGCCTGNONE 
J075067K01TCTGGGCCTGNONE 
J075087G22TCTGGGCCTGNONE 
J075097A07TCTGGGCCTGNONE 
J075109O12TCTGGGCCTGNONE 
J075110K07TCTGGGCCTGNONE 
J075117C17TCTGGGCCTGNONE 
J075143O07TCTGGGCCTGNONE 
J075146F13TCTGGGCCTGNONE 
J075166I18TCTGGGCCTGNONE 
J075176N09TCTGGGCCTGNONE 
J075182F16TCTGGGCCTGNONE 
Os02g0533800009-149-F12TAGGCCCAGANONE 
013-058-H02TAGGCCCAGANONE 
014-017-G07TAGGCCCAGANONE 
014-028-F04TAGGCCCAGANONE 
014-050-G04TAGGCCCAGANONE 
014-095-F04TAGGCCCAGANONE 
014-099-C08TAGGCCCAGANONE 
016-046-F05TAGGCCCAGANONE 
AK121139TAGGCCCAGAConserved hypothetical protein. 
J013104A14TAGGCCCAGANONE 
J023077F13TAGGCCCAGANONE 
J023145I11TAGGCCCAGANONE 
J065033D14TAGGCCCAGANONE 
J065079I15TAGGCCCAGANONE 
J065104E21TAGGCCCAGANONE 
J065128E06TAGGCCCAGANONE 
J065174F07TAGGCCCAGANONE 
J065195B12TAGGCCCAGANONE 
J065207B12TAGGCCCAGANONE 
J080304M24TAGGCCCAGANONE 
J090040A13TAGGCCCAGANONE 
J090054B18TAGGCCCAGANONE 
J100037A06TAGGCCCAGANONE 
J100042F24TAGGCCCAGANONE 
J100043N23TAGGCCCAGANONE 
J100044H14TAGGCCCAGANONE 
J100056K24TAGGCCCAGANONE 
J100063O22TAGGCCCAGANONE 
J100071G05TAGGCCCAGANONE 
J100078G15TAGGCCCAGANONE 
Os02g0533900AB062681TCTGGGCCTANONE 
AK061722TCTGGGCCTANONE 
AK106147TCTGGGCCTANONE 
AK121892TCTGGGCCTASimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0537700006-053-C10GAGGCCCAGANONE 
006-055-F06GAGGCCCAGANONE 
006-059-E11GAGGCCCAGANONE 
006-088-G01GAGGCCCAGANONE 
006-088-G12GAGGCCCAGANONE 
009-094-G12GAGGCCCAGANONE 
009-181-C07GAGGCCCAGANONE 
AK068919GAGGCCCAGASimilar to 2-cys peroxiredoxin BAS1, chloroplast precursor (EC 1.11.1.15) (Thiol- specific antioxidant protein) (Fragment). 
AK104703GAGGCCCAGANONE 
J013070I22GAGGCCCAGANONE 
J013169M13GAGGCCCAGANONE 
J013170F14GAGGCCCAGANONE 
J023010P12GAGGCCCAGANONE 
J023095B04GAGGCCCAGANONE 
J090043L04GAGGCCCAGANONE 
Os02g0555000015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0586900013-044-D08AACGGGCCCAGANONE 
014-087-D07AACGGGCCCAGANONE 
AK063583AACGGGCCCAGASimilar to Glycine rich protein (Fragment). 
AK105378AACGGGCCCAGANONE 
Os02g0631000AK068667ATCTGGGCCGTGConserved hypothetical protein. 
J013159L03ATCTGGGCCGTGNONE 
J023119O20ATCTGGGCCGTGNONE 
J090098N20ATCTGGGCCGTGNONE 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
Os02g0673600009-071-C12AGGGCCCAGANONE 
J023037G24AGGGCCCAGANONE 
J023038E07AGGGCCCAGAORMDL family protein. 
J023142L24AGGGCCCAGANONE 
J033115B14AGGGCCCAGANONE 
J075004B15AGGGCCCAGANONE 
J075067J21AGGGCCCAGANONE 
J075072K07AGGGCCCAGANONE 
J075147H21AGGGCCCAGANONE 
J075154F03AGGGCCCAGANONE 
Os02g0677300006-102-D12GAGGCCCAGAGCGGCCCACTNONE 
AK060550GAGGCCCAGAGCGGCCCACTNONE 
AK106041GAGGCCCAGAGCGGCCCACTSimilar to CRT/DRE binding factor 1. 
Os02g0679200AK110789AGATGGGCCTCTGGGCCTCTetratricopeptide-like helical domain containing protein. 
Os02g0689200011-024-D04CTGGCCCAGANONE 
AK071254CTGGCCCAGANONE 
AK072660CTGGCCCAGAProtein of unknown function DUF250 domain containing protein. 
J023087G23CTGGCCCAGANONE 
J023134O11CTGGCCCAGANONE 
J033095E21CTGGCCCAGANONE 
J033113F12CTGGCCCAGANONE 
J033124F02CTGGCCCAGANONE 
J065070A01CTGGCCCAGANONE 
J065129C05CTGGCCCAGANONE 
J065165M19CTGGCCCAGANONE 
J090015K07CTGGCCCAGANONE 
J090066D21CTGGCCCAGANONE 
J090075M20CTGGCCCAGANONE 
Os02g0717100014-089-G06TTATGGGCCCAGATNONE 
AK063741TTATGGGCCCAGATEsterase/lipase/thioesterase domain containing protein. 
J065052A22TTATGGGCCCAGATNONE 
Os02g0729400J075028G02GTGGCCCAGANONE 
Os02g0740300AK067833TCTGGGCCTGAAA ATPase domain containing protein. 
Os02g0751300J033055P08CGGACGGCCCAGATProtein of unknown function DUF581 family protein. 
Os02g0767100011-054-E05TCTGGGCCTANONE 
AK063351TCTGGGCCTANONE 
AK103640TCTGGGCCTAConserved hypothetical protein. 
J090022G11TCTGGGCCTANONE 
J090072L18TCTGGGCCTANONE 
Os02g0778200AK065948TCTGGGCCCCACCAminoacyl-tRNA synthetase, class I family protein. 
Os02g0778600AK100098TCTGGGCCGAANONE 
AK100190TCTGGGCCGAANONE 
AK106971TCTGGGCCGAASimilar to CEL5=CELLULASE 5 (Fragment). 
J065021O09TCTGGGCCGAANONE 
Os02g0780500AK072784GGGGCCCAGANONE 
AK121143GGGGCCCAGAConserved hypothetical protein. 
J023075M13GGGGCCCAGANONE 
J023077P14GGGGCCCAGANONE 
J023123C16GGGGCCCAGANONE 
J023142P06GGGGCCCAGANONE 
Os02g0782200AK070439TACGGCCCAGANONE 
AK101869TACGGCCCAGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0783700AK064521AAGGCCCAGANONE 
AK120371AAGGCCCAGASimilar to Lysine-ketoglutarate reductase/saccharopine dehydrogenase bifunctional enzyme. 
J013070J19AAGGCCCAGANONE 
J033095H21AAGGCCCAGANONE 
J065038I07AAGGCCCAGANONE 
J065044C13AAGGCCCAGANONE 
J065060L11AAGGCCCAGANONE 
J065082G20AAGGCCCAGANONE 
J065146N24AAGGCCCAGANONE 
J065147B10AAGGCCCAGANONE 
J065181L07AAGGCCCAGANONE 
J065202K06AAGGCCCAGANONE 
J065219J12AAGGCCCAGANONE 
J075107D03AAGGCCCAGANONE 
J090020F02AAGGCCCAGANONE 
Os02g0791300J100026B09TCTCGGCCCAGANONE 
J100039D05TCTCGGCCCAGAHelix-loop-helix DNA-binding domain containing protein. 
Os02g0805600006-054-D07ATCTGGGCCAANONE 
AK059822ATCTGGGCCAANONE 
AK099516ATCTGGGCCAASimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587ATCTGGGCCAANONE 
J065037H22ATCTGGGCCAANONE 
J090015P17ATCTGGGCCAANONE 
Os02g0823400AK105029ATCTGGGCCCACASimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment). 
J033140N12ATCTGGGCCCACANONE 
J075104C12ATCTGGGCCCACANONE 
J075120E03ATCTGGGCCCACANONE 
J075126M18ATCTGGGCCCACANONE 
J075189P21ATCTGGGCCCACANONE 
Os02g0828200AK071199TACGGCCCAGANONE 
Os03g0100400AK068556TCTGGGCCGGCNONE 
AK121880TCTGGGCCGGCSimilar to DNA repair endonuclease UVH1 (EC 3.1.-.-) (Ultraviolet hypersensitive 1) (AtRAD1) (DNA excision repair protein XP-F homolog). 
Os03g0131400015-012-D11TCTGGGCCCATGANONE 
AK103714TCTGGGCCCATGAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TCATGGGCCCAGAVitamin K epoxide reductase domain containing protein. 
Os03g0176800AK103848ATCTGGGCCGCConserved hypothetical protein. 
J033148K19ATCTGGGCCGCNONE 
J090079G01ATCTGGGCCGCNONE 
Os03g0213800AK103114ATCTGGGCCTCMitochondrial substrate carrier family protein. 
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein. 
Os03g0232500AK110980TCTGGGCCTAGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TCTGGGCCTANONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0268300AK102684ATCTGGGCCCTSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22ATCTGGGCCCTNONE 
J013057J23ATCTGGGCCCTNONE 
J013149I10ATCTGGGCCCTNONE 
J013149M20ATCTGGGCCCTNONE 
J013151D14ATCTGGGCCCTNONE 
J013162O11ATCTGGGCCCTNONE 
J023001F12ATCTGGGCCCTNONE 
J023031B21ATCTGGGCCCTNONE 
J023080A07ATCTGGGCCCTNONE 
J023081N04ATCTGGGCCCTNONE 
J023090C08ATCTGGGCCCTNONE 
J023134G05ATCTGGGCCCTNONE 
J023139G17ATCTGGGCCCTNONE 
J023143I10ATCTGGGCCCTNONE 
J023147D04ATCTGGGCCCTNONE 
J023147O15ATCTGGGCCCTNONE 
J033102K23ATCTGGGCCCTNONE 
J033106C17ATCTGGGCCCTNONE 
J075033G19ATCTGGGCCCTNONE 
J075039J18ATCTGGGCCCTNONE 
J075050K20ATCTGGGCCCTNONE 
J075075J03ATCTGGGCCCTNONE 
J075080E16ATCTGGGCCCTNONE 
J075086L08ATCTGGGCCCTNONE 
J075091K19ATCTGGGCCCTNONE 
J075099O20ATCTGGGCCCTNONE 
J075104I06ATCTGGGCCCTNONE 
J075137C16ATCTGGGCCCTNONE 
J075152G03ATCTGGGCCCTNONE 
J075176N12ATCTGGGCCCTNONE 
J100086K11ATCTGGGCCCTNONE 
Os03g0287900009-074-B07TCTGGGCCCAATANONE 
014-027-E07TCTGGGCCCAATANONE 
AK063663TCTGGGCCCAATASimilar to Protein disulfide isomerase. 
J065009N21TCTGGGCCCAATANONE 
Os03g0288900AK100329GAGGCCCAGATConserved hypothetical protein. 
J023080H15GAGGCCCAGATNONE 
J033136I21GAGGCCCAGATNONE 
J065036A16GAGGCCCAGATNONE 
J065186A16GAGGCCCAGATNONE 
J065187B08GAGGCCCAGATNONE 
J065202E24GAGGCCCAGATNONE 
Os03g0292800012-077-B05ATCTGGGCCAANONE 
AK069970ATCTGGGCCAASimilar to Ran binding protein 1 homolog. 
J065138F22ATCTGGGCCAANONE 
Os03g0299600009-037-H11TCTCGGCCCAGACTGACAGNONE 
011-072-E02TCTCGGCCCAGACTGACAGNONE 
AK068151TCTCGGCCCAGACTGACAGWound-induced WI12 family protein. 
J013132L05TCTCGGCCCAGACTGACAGNONE 
J023012P15TCTCGGCCCAGACTGACAGNONE 
J023022H03TCTCGGCCCAGACTGACAGNONE 
J023026N15TCTCGGCCCAGACTGACAGNONE 
J023056A21TCTCGGCCCAGACTGACAGNONE 
J023093P10TCTCGGCCCAGACTGACAGNONE 
J075143J10TCTCGGCCCAGACTGACAGNONE 
J075166I19TCTCGGCCCAGACTGACAGNONE 
J090010G13TCTCGGCCCAGACTGACAGNONE 
J090033D23TCTCGGCCCAGACTGACAGNONE 
J090090L22TCTCGGCCCAGACTGACAGNONE 
Os03g0310600AK109731TCTGGGCCAAProtein of unknown function DUF247, plant family protein. 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0584300009-018-H09GGGCTTTTCTGGGCCCTNONE 
AK105133GGGCTTTTCTGGGCCCTProtein of unknown function UPF0136, Transmembrane family protein. 
J065053M11GGGCTTTTCTGGGCCCTNONE 
Os03g0587600Os03g0587600GCGGCCCAGAZinc finger, CCHC-type domain containing protein. 
Os03g0643300AK099445CAAGTGGGCCCAGASimilar to AER123Wp. 
AK108010CAAGTGGGCCCAGANONE 
Os03g0681900006-042-F08ATCTGGGCCTTGNONE 
009-043-F12ATCTGGGCCTTGNONE 
AK061750ATCTGGGCCTTGNONE 
AK062094ATCTGGGCCTTGSimilar to RGP-3 (Fragment). 
J033034F01ATCTGGGCCTTGNONE 
J033131F11ATCTGGGCCTTGNONE 
J033143N03ATCTGGGCCTTGNONE 
Os03g0684400AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
Os03g0711400AK100286CCAACGGCCCAGATSimilar to Coatomer alpha subunit. 
Os03g0712600015-008-G03TGGTGGGCCCAGANONE 
AK103705TGGTGGGCCCAGAHypothetical protein. 
J033136N14TGGTGGGCCCAGANONE 
Os03g0747300006-120-B12GACGGCCCAGATNONE 
AK060347GACGGCCCAGATNONE 
AK071214GACGGCCCAGATProtein of unknown function DUF124 family protein. 
J023082F22GACGGCCCAGATNONE 
J043034I22GACGGCCCAGATNONE 
J053037D23GACGGCCCAGATNONE 
J053043C01GACGGCCCAGATNONE 
J053083D14GACGGCCCAGATNONE 
J053100J21GACGGCCCAGATNONE 
J065008H11GACGGCCCAGATNONE 
J065024G19GACGGCCCAGATNONE 
J065030G05GACGGCCCAGATNONE 
J065073N07GACGGCCCAGATNONE 
J065101N18GACGGCCCAGATNONE 
J065129O04GACGGCCCAGATNONE 
J065152M14GACGGCCCAGATNONE 
J065161L08GACGGCCCAGATNONE 
J065191G23GACGGCCCAGATNONE 
J090008A11GACGGCCCAGATNONE 
J090047J20GACGGCCCAGATNONE 
J090047J23GACGGCCCAGATNONE 
J090064C23GACGGCCCAGATNONE 
J090087H06GACGGCCCAGATNONE 
J100027M11GACGGCCCAGATNONE 
J100081M15GACGGCCCAGATNONE 
J100084C22GACGGCCCAGATNONE 
J100086C11GACGGCCCAGATNONE 
Os03g0747700AK058795TCTGGGCCTCConserved hypothetical protein. 
Os03g0751400AK069033AGGGCCCAGASimilar to 50S ribosomal protein l6. 
J023004G24AGGGCCCAGANONE 
J065176D08AGGGCCCAGANONE 
Os03g0752800AB041020TCGGCCCAGAAAAGCCCACGANONE 
AF058697TCGGCCCAGAAAAGCCCACGAMADS14 protein. 
AF139664TCGGCCCAGAAAAGCCCACGANONE 
AK121171TCGGCCCAGAAAAGCCCACGANONE 
AY332478TCGGCCCAGAAAAGCCCACGANONE 
AY551916TCGGCCCAGAAAAGCCCACGANONE 
J023081C04TCGGCCCAGAAAAGCCCACGANONE 
Os03g0785500AK067718GAGGCCCAGATProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0798600AK121716TCTGGGCCCGSimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18TCTGGGCCCGNONE 
J033079G18TCTGGGCCCGNONE 
J043038B19TCTGGGCCCGNONE 
J065091E15TCTGGGCCCGNONE 
J065092P10TCTGGGCCCGNONE 
J065189F18TCTGGGCCCGNONE 
J065189L12TCTGGGCCCGNONE 
J075021B11TCTGGGCCCGNONE 
J075022L15TCTGGGCCCGNONE 
J075046G12TCTGGGCCCGNONE 
J075080H15TCTGGGCCCGNONE 
J090045H01TCTGGGCCCGNONE 
J090077H16TCTGGGCCCGNONE 
J090083D22TCTGGGCCCGNONE 
J100021D24TCTGGGCCCGNONE 
J100023G04TCTGGGCCCGNONE 
J100049J23TCTGGGCCCGNONE 
J100075K23TCTGGGCCCGNONE 
J100077G22TCTGGGCCCGNONE 
Os03g0800400AK071430CAGGCCCAGAProtein of unknown function DUF1618 domain containing protein. 
J023019H20CAGGCCCAGANONE 
J023097A10CAGGCCCAGANONE 
J023100K15CAGGCCCAGANONE 
J075095I09CAGGCCCAGANONE 
J090014B19CAGGCCCAGANONE 
J090072D02CAGGCCCAGANONE 
J100029E17CAGGCCCAGANONE 
J100047F04CAGGCCCAGANONE 
Os03g0809300011-024-C02TATTGGGCCCAGATNONE 
016-071-E09TATTGGGCCCAGATNONE 
AK103140TATTGGGCCCAGATProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCCCAGATNONE 
J013108D19TATTGGGCCCAGATNONE 
J013124D15TATTGGGCCCAGATNONE 
J013128F17TATTGGGCCCAGATNONE 
J013146J06TATTGGGCCCAGATNONE 
J013149D12TATTGGGCCCAGATNONE 
J013154P12TATTGGGCCCAGATNONE 
J013162N01TATTGGGCCCAGATNONE 
J013170G15TATTGGGCCCAGATNONE 
J013170H16TATTGGGCCCAGATNONE 
J023022I09TATTGGGCCCAGATNONE 
J023072B19TATTGGGCCCAGATNONE 
J023106H09TATTGGGCCCAGATNONE 
J023135C03TATTGGGCCCAGATNONE 
J023141C09TATTGGGCCCAGATNONE 
J033091K23TATTGGGCCCAGATNONE 
J033107I05TATTGGGCCCAGATNONE 
J033112M18TATTGGGCCCAGATNONE 
J033120G10TATTGGGCCCAGATNONE 
J033144G06TATTGGGCCCAGATNONE 
J043017L21TATTGGGCCCAGATNONE 
J043024O10TATTGGGCCCAGATNONE 
J053023K04TATTGGGCCCAGATNONE 
J053035D01TATTGGGCCCAGATNONE 
J053037P10TATTGGGCCCAGATNONE 
J053042K15TATTGGGCCCAGATNONE 
J053047C14TATTGGGCCCAGATNONE 
J053054A06TATTGGGCCCAGATNONE 
J053071H03TATTGGGCCCAGATNONE 
J053073G08TATTGGGCCCAGATNONE 
J053090D04TATTGGGCCCAGATNONE 
J053095E17TATTGGGCCCAGATNONE 
J090007O03TATTGGGCCCAGATNONE 
J090024G24TATTGGGCCCAGATNONE 
J090042M08TATTGGGCCCAGATNONE 
J090045I16TATTGGGCCCAGATNONE 
J090051E13TATTGGGCCCAGATNONE 
J090073B15TATTGGGCCCAGATNONE 
J090096F19TATTGGGCCCAGATNONE 
J100030M23TATTGGGCCCAGATNONE 
Os03g0822900AK099787CGGGCCCAGAZinc finger, BED-type predicted domain containing protein. 
J013042C24CGGGCCCAGANONE 
J013096O21CGGGCCCAGANONE 
J023109I23CGGGCCCAGANONE 
J033106N09CGGGCCCAGANONE 
J033107H03CGGGCCCAGANONE 
J033118G03CGGGCCCAGANONE 
J033145I24CGGGCCCAGANONE 
J065138D15CGGGCCCAGANONE 
J065140L13CGGGCCCAGANONE 
J065179M13CGGGCCCAGANONE 
J065200F05CGGGCCCAGANONE 
J075104F20CGGGCCCAGANONE 
J075143A15CGGGCCCAGANONE 
J075197J11CGGGCCCAGANONE 
Os03g0837900AK068346GCCACGTCGGCCCAGAStreptomyces cyclase/dehydrase family protein. 
Os03g0846400AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0848300AK059137AGGGCCCAGATNONE 
AK059137TCTGGGCCGGCNONE 
AK102089AGGGCCCAGATSimilar to Actin-related protein 2/3 complex subunit 4 (ARP2/3 complex 20 kDa subunit) (p20-ARC). 
J033037E05AGGGCCCAGATNONE 
J033082P03AGGGCCCAGATNONE 
J065110J17AGGGCCCAGATNONE 
J065110J17TCTGGGCCGGCNONE 
J075012L14AGGGCCCAGATNONE 
J075013G06AGGGCCCAGATNONE 
J075021D21AGGGCCCAGATNONE 
J075162K12AGGGCCCAGATNONE 
Os03g0855600006-029-G09TCTGGGCCGTANONE 
006-033-E02TCTGGGCCGTANONE 
006-069-G07TCTGGGCCGTANONE 
006-083-A02TCTGGGCCGTANONE 
006-098-H04TCTGGGCCGTANONE 
009-054-C04TCTGGGCCGTANONE 
AK060030TCTGGGCCGTANONE 
AK061467TCTGGGCCGTAConserved hypothetical protein. 
AK067858TCTGGGCCGTANONE 
AK106030TCTGGGCCGTANONE 
J013123A10TCTGGGCCGTANONE 
J065001I24TCTGGGCCGTANONE 
J065015N21TCTGGGCCGTANONE 
J065016H07TCTGGGCCGTANONE 
J065040A05TCTGGGCCGTANONE 
J065040F01TCTGGGCCGTANONE 
J065066G17TCTGGGCCGTANONE 
J065077I09TCTGGGCCGTANONE 
J065099M22TCTGGGCCGTANONE 
J065135B13TCTGGGCCGTANONE 
J065144H19TCTGGGCCGTANONE 
J065146I03TCTGGGCCGTANONE 
J065169E02TCTGGGCCGTANONE 
J065177D21TCTGGGCCGTANONE 
J065189L20TCTGGGCCGTANONE 
J065207H13TCTGGGCCGTANONE 
J065210D24TCTGGGCCGTANONE 
J065212I03TCTGGGCCGTANONE 
J075007E21TCTGGGCCGTANONE 
J075013H07TCTGGGCCGTANONE 
J075023K06TCTGGGCCGTANONE 
J075031D23TCTGGGCCGTANONE 
J075038K09TCTGGGCCGTANONE 
J075084C08TCTGGGCCGTANONE 
J075098K20TCTGGGCCGTANONE 
J090028E04TCTGGGCCGTANONE 
J090031E20TCTGGGCCGTANONE 
J090042F06TCTGGGCCGTANONE 
J090049L05TCTGGGCCGTANONE 
J090086G03TCTGGGCCGTANONE 
J090096J04TCTGGGCCGTANONE 
J100035O03TCTGGGCCGTANONE 
J100053H24TCTGGGCCGTANONE 
J100056L17TCTGGGCCGTANONE 
J100058K06TCTGGGCCGTANONE 
J100059G09TCTGGGCCGTANONE 
J100081C15TCTGGGCCGTANONE 
Os04g0350000011-080-B03ATCTGGGCCATNONE 
AK063387ATCTGGGCCATNONE 
AK121263ATCTGGGCCATNONE 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0445200009-034-A06ATCTGGGCCACNONE 
AK062427ATCTGGGCCACProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720ATCTGGGCCACNONE 
J065022E20ATCTGGGCCACNONE 
J065062D16ATCTGGGCCACNONE 
J065081I02ATCTGGGCCACNONE 
J065087C10ATCTGGGCCACNONE 
J065116N16ATCTGGGCCACNONE 
J065132F10ATCTGGGCCACNONE 
J065140F18ATCTGGGCCACNONE 
J065143M22ATCTGGGCCACNONE 
J065158K17ATCTGGGCCACNONE 
J065162D07ATCTGGGCCACNONE 
J065207H19ATCTGGGCCACNONE 
J075155B20ATCTGGGCCACNONE 
J075167E24ATCTGGGCCACNONE 
J075178B19ATCTGGGCCACNONE 
J080301D22ATCTGGGCCACNONE 
J080301J15ATCTGGGCCACNONE 
J080308J02ATCTGGGCCACNONE 
Os04g0446500015-073-B06AAGGCCCAGANONE 
AB118009AAGGCCCAGANONE 
AK073743AAGGCCCAGANONE 
AK103814AAGGCCCAGASimilar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
J033055H15AAGGCCCAGANONE 
J033067L09AAGGCCCAGANONE 
J033147C19AAGGCCCAGANONE 
J033147C20AAGGCCCAGANONE 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0498600006-068-G08AGGGCCCAGATNONE 
006-095-H08AGGGCCCAGATNONE 
006-108-E12AGGGCCCAGATNONE 
009-194-E05AGGGCCCAGATNONE 
AK062001AGGGCCCAGATNONE 
Os04g0504600J065162K24TCTGGGCCCATGANONE 
Os04g0538400AK108230ATCTGGGCCCTSimilar to Nodulin 21 (N-21). 
J090006J20ATCTGGGCCCTNONE 
Os04g0539000009-165-H09TTGGCCCAGANONE 
014-012-F10TTGGCCCAGANONE 
AK105343TTGGCCCAGALambda integrase-like, N-terminal domain containing protein. 
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein. 
J013057N16CCACCAACGGCCCAGATNONE 
Os04g0577500006-039-C03TCTGGGCCCACGANONE 
006-043-H01TCTGGGCCCACGANONE 
AK061538TCTGGGCCCACGANONE 
AK065648TCTGGGCCCACGATatD-related deoxyribonuclease family protein. 
AK104763TCTGGGCCCACGANONE 
J013035E21TCTGGGCCCACGANONE 
J013066M11TCTGGGCCCACGANONE 
J100026B02TCTGGGCCCACGANONE 
Os04g0592500AK066893ATCTGGGCCCATCCPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ATCTGGGCCCATCCNONE 
Os04g0625000J065157C10CCAGGCCCAGATNONE 
Os04g0640800AK065522GTGGCCCAGAProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0644100AK106954CGGACGGCCCAGATSterile alpha motif homology domain containing protein. 
Os04g0650500AK066690TTCGGCCCAGAConserved hypothetical protein. 
AK104273TTCGGCCCAGANONE 
Os04g0660600009-113-A11CAAGGCCCAGATNONE 
AK120899CAAGGCCCAGATATPase, V0 complex, subunit H family protein. 
J023030J05CAAGGCCCAGATNONE 
J065068M07CAAGGCCCAGATNONE 
J065120G22CAAGGCCCAGATNONE 
J065168J18CAAGGCCCAGATNONE 
J065211M10CAAGGCCCAGATNONE 
J075175E21CAAGGCCCAGATNONE 
J090021C06CAAGGCCCAGATNONE 
J090032P15CAAGGCCCAGATNONE 
J090082E05CAAGGCCCAGATNONE 
J100090O11CAAGGCCCAGATNONE 
Os04g0668700012-043-D01ATCTGGGCCGTCCNONE 
AK065237ATCTGGGCCGTCCPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
J013002G17ATCTGGGCCGTCCNONE 
J013002I02ATCTGGGCCGTCCNONE 
J013059C11ATCTGGGCCGTCCNONE 
J013059D22ATCTGGGCCGTCCNONE 
J013063G18ATCTGGGCCGTCCNONE 
J013088O04ATCTGGGCCGTCCNONE 
J013095K03ATCTGGGCCGTCCNONE 
J013096K15ATCTGGGCCGTCCNONE 
J013100O17ATCTGGGCCGTCCNONE 
J013102F10ATCTGGGCCGTCCNONE 
J013111L07ATCTGGGCCGTCCNONE 
J013127E24ATCTGGGCCGTCCNONE 
J013130A10ATCTGGGCCGTCCNONE 
J013134L13ATCTGGGCCGTCCNONE 
J023109G08ATCTGGGCCGTCCNONE 
J033022E17ATCTGGGCCGTCCNONE 
J033022N13ATCTGGGCCGTCCNONE 
J033026D04ATCTGGGCCGTCCNONE 
J033028M05ATCTGGGCCGTCCNONE 
J033037E04ATCTGGGCCGTCCNONE 
J033042D11ATCTGGGCCGTCCNONE 
J033044N20ATCTGGGCCGTCCNONE 
J033046K11ATCTGGGCCGTCCNONE 
J033046M21ATCTGGGCCGTCCNONE 
J033076E19ATCTGGGCCGTCCNONE 
J033076J24ATCTGGGCCGTCCNONE 
J033086N03ATCTGGGCCGTCCNONE 
J033095F22ATCTGGGCCGTCCNONE 
J033115F17ATCTGGGCCGTCCNONE 
J033117M06ATCTGGGCCGTCCNONE 
J033125D22ATCTGGGCCGTCCNONE 
J033129J10ATCTGGGCCGTCCNONE 
J033145E18ATCTGGGCCGTCCNONE 
J043021F24ATCTGGGCCGTCCNONE 
J053046G14ATCTGGGCCGTCCNONE 
J053090P03ATCTGGGCCGTCCNONE 
J065042N10ATCTGGGCCGTCCNONE 
J065053B13ATCTGGGCCGTCCNONE 
J065085G03ATCTGGGCCGTCCNONE 
J065173J11ATCTGGGCCGTCCNONE 
J090014M14ATCTGGGCCGTCCNONE 
J090027J07ATCTGGGCCGTCCNONE 
J090039E23ATCTGGGCCGTCCNONE 
J090051C15ATCTGGGCCGTCCNONE 
J090055H06ATCTGGGCCGTCCNONE 
J090062L03ATCTGGGCCGTCCNONE 
J100017L21ATCTGGGCCGTCCNONE 
J100024B07ATCTGGGCCGTCCNONE 
J100032G07ATCTGGGCCGTCCNONE 
J100040N09ATCTGGGCCGTCCNONE 
J100062N03ATCTGGGCCGTCCNONE 
J100078E07ATCTGGGCCGTCCNONE 
J100080E14ATCTGGGCCGTCCNONE 
J100084D07ATCTGGGCCGTCCNONE 
Os04g0669300AK071148TCTGGGCCGCDynamin family protein. 
Os04g0673400Os04g0673400TCTGGGCCAASimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0674600AK069645TGTGGGGCCCAGAOligopeptide transporter OPT superfamily protein. 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os05g0110700AK102486ATCTGGGCCTAAGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12ATCTGGGCCTAAGCCCAATANONE 
Os05g0123400AK069521TCTGGGCCCTConserved hypothetical protein. 
J023022O05TCTGGGCCCTNONE 
Os05g0125900009-168-E11TCGGCCCAGATGCCCACCTNONE 
AK063078TCGGCCCAGATGCCCACCTConserved hypothetical protein. 
AK119230TCGGCCCAGATGCCCACCTNONE 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0150600011-043-D06TACGGCCCAGATNONE 
AK072977TACGGCCCAGATATP-dependent DNA helicase RecQ family protein. 
AY180331TACGGCCCAGATNONE 
J090053A16TACGGCCCAGATNONE 
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE 
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein. 
AK103412CCGATCCGACGGCCCAGANONE 
J023045H21CCGATCCGACGGCCCAGANONE 
J033128G01CCGATCCGACGGCCCAGANONE 
J065017O10CCGATCCGACGGCCCAGANONE 
J065032H11CCGATCCGACGGCCCAGANONE 
J065120G09CCGATCCGACGGCCCAGANONE 
Os05g0317300AK064846ATGGCCCAGATFAR1 domain containing protein. 
AK122018ATGGCCCAGATNONE 
J013000G11ATGGCCCAGATNONE 
J023041M02ATGGCCCAGATNONE 
J023056G01ATGGCCCAGATNONE 
J023064M23ATGGCCCAGATNONE 
J023107F08ATGGCCCAGATNONE 
J033060K06ATGGCCCAGATNONE 
J033097H11ATGGCCCAGATNONE 
J065139C02ATGGCCCAGATNONE 
J090034K18ATGGCCCAGATNONE 
J090048K22ATGGCCCAGATNONE 
J090067G18ATGGCCCAGATNONE 
J090089F08ATGGCCCAGATNONE 
Os05g0411300014-098-D05TTGTGGGCCCAGATNONE 
015-093-F04TTGTGGGCCCAGATNONE 
AK071931TTGTGGGCCCAGATConserved hypothetical protein. 
AK073142TTGTGGGCCCAGATNONE 
Os05g0413000AK058277TCTGGGCCGTGMitochodrial transcription termination factor-related family protein. 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0446900AK101748CTTGGGCCTCTGGGCCTAGlycoside hydrolase, starch-binding domain containing protein. 
Os05g0455500AK101985TCTGGGCCAANONE 
AK102633TCTGGGCCAADelta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AY574031TCTGGGCCAANONE 
D49714TCTGGGCCAANONE 
J013002F07TCTGGGCCAANONE 
J033085C02TCTGGGCCAANONE 
Os05g0465000AK111286CCCGGCCCAGAConserved hypothetical protein. 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
Os05g0501300006-075-B11ATCTGGGCCGTTGNONE 
006-083-H08ATCTGGGCCGTTGNONE 
AK059889ATCTGGGCCGTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02ATCTGGGCCGTTGNONE 
Os05g0512500009-036-D05ATCTGGGCCTANONE 
AK062441ATCTGGGCCTACT20 family protein. 
J080003C10ATCTGGGCCTANONE 
J080046G11ATCTGGGCCTANONE 
Os05g0533600AK067577GGTGGGGCCCAGASimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560GGTGGGGCCCAGANONE 
AY373258GGTGGGGCCCAGANONE 
Os05g0547850009-102-F03GAGGCCCAGATNONE 
013-076-H08GAGGCCCAGATNONE 
AK058330GAGGCCCAGATNONE 
AK122158GAGGCCCAGATDNA-binding TFAR19-related protein family protein. 
AY626826GAGGCCCAGATNONE 
J043012O19GAGGCCCAGATNONE 
J043038O15GAGGCCCAGATNONE 
J053094L06GAGGCCCAGATNONE 
Os05g0548100AK060333GCGGCCCAGATConserved hypothetical protein. 
AK100682GCGGCCCAGATNONE 
J013151E01GCGGCCCAGATNONE 
J023113L22GCGGCCCAGATNONE 
J043027A19GCGGCCCAGATNONE 
J075093E06GCGGCCCAGATNONE 
J090060D15GCGGCCCAGATNONE 
J090082J03GCGGCCCAGATNONE 
J100050E01GCGGCCCAGATNONE 
Os05g0554100AK073023TCTGGGCCAARibosomal protein L7/L12 family protein. 
AK101756TCTGGGCCAANONE 
Os05g0567500AK073046TTATGGGCCCAGATCACGGCCCGNONE 
AK121133TTATGGGCCCAGATCACGGCCCGDNA glycosylase family protein. 
J023075P20TTATGGGCCCAGATCACGGCCCGNONE 
Os05g0571400009-019-B04GTGGCCCAGATNONE 
009-043-H02GTGGCCCAGATNONE 
AK062369GTGGCCCAGATConserved hypothetical protein. 
Os05g0592800AK067627CAACGGCCCAGASimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CAACGGCCCAGANONE 
AK104323CAACGGCCCAGANONE 
Os06g0101600AF093636TCCGGCCCAGANONE 
AK070447TCCGGCCCAGAPlastocyanin, chloroplast precursor. 
J065001A20TCCGGCCCAGANONE 
J065019M17TCCGGCCCAGANONE 
J065021H18TCCGGCCCAGANONE 
J065061A17TCCGGCCCAGANONE 
J065073L02TCCGGCCCAGANONE 
J065099F17TCCGGCCCAGANONE 
J065101C23TCCGGCCCAGANONE 
J065121E23TCCGGCCCAGANONE 
J065122N04TCCGGCCCAGANONE 
J065141N05TCCGGCCCAGANONE 
J065143N21TCCGGCCCAGANONE 
J065161H09TCCGGCCCAGANONE 
J065161J04TCCGGCCCAGANONE 
J065162P20TCCGGCCCAGANONE 
J065182K10TCCGGCCCAGANONE 
J065184M05TCCGGCCCAGANONE 
J065186H24TCCGGCCCAGANONE 
J065189G21TCCGGCCCAGANONE 
J065190N14TCCGGCCCAGANONE 
J065191H08TCCGGCCCAGANONE 
J065205H17TCCGGCCCAGANONE 
J075001E03TCCGGCCCAGANONE 
J075001H21TCCGGCCCAGANONE 
J075003J23TCCGGCCCAGANONE 
J075003K01TCCGGCCCAGANONE 
J075005I11TCCGGCCCAGANONE 
J075007F16TCCGGCCCAGANONE 
J075017I11TCCGGCCCAGANONE 
J075018O05TCCGGCCCAGANONE 
J075019G24TCCGGCCCAGANONE 
J075032D04TCCGGCCCAGANONE 
J075032N13TCCGGCCCAGANONE 
J075033C09TCCGGCCCAGANONE 
J075033D11TCCGGCCCAGANONE 
J075039A20TCCGGCCCAGANONE 
J075058P12TCCGGCCCAGANONE 
J075062E10TCCGGCCCAGANONE 
J075062P16TCCGGCCCAGANONE 
J075063C17TCCGGCCCAGANONE 
J075066E07TCCGGCCCAGANONE 
J075066I20TCCGGCCCAGANONE 
J075075K21TCCGGCCCAGANONE 
J075078F03TCCGGCCCAGANONE 
J075082F10TCCGGCCCAGANONE 
J075086G16TCCGGCCCAGANONE 
J075087E07TCCGGCCCAGANONE 
J075087K06TCCGGCCCAGANONE 
J075087L04TCCGGCCCAGANONE 
J075088B16TCCGGCCCAGANONE 
J075088D02TCCGGCCCAGANONE 
J075094H21TCCGGCCCAGANONE 
J075094I24TCCGGCCCAGANONE 
J075094K10TCCGGCCCAGANONE 
J075095C18TCCGGCCCAGANONE 
J075097B05TCCGGCCCAGANONE 
J075099C13TCCGGCCCAGANONE 
J075099H22TCCGGCCCAGANONE 
J075099L16TCCGGCCCAGANONE 
J075104K08TCCGGCCCAGANONE 
J075118O06TCCGGCCCAGANONE 
J075119E15TCCGGCCCAGANONE 
J075124N06TCCGGCCCAGANONE 
J075126G02TCCGGCCCAGANONE 
J075127L24TCCGGCCCAGANONE 
J075131E23TCCGGCCCAGANONE 
J075140H06TCCGGCCCAGANONE 
J075146I20TCCGGCCCAGANONE 
J075146N24TCCGGCCCAGANONE 
J075147I19TCCGGCCCAGANONE 
J075155K07TCCGGCCCAGANONE 
J075156C05TCCGGCCCAGANONE 
J075161G07TCCGGCCCAGANONE 
J075164G01TCCGGCCCAGANONE 
J075170J18TCCGGCCCAGANONE 
J075172G17TCCGGCCCAGANONE 
J075176G10TCCGGCCCAGANONE 
J075178C05TCCGGCCCAGANONE 
J075179G01TCCGGCCCAGANONE 
J075181E24TCCGGCCCAGANONE 
J080029D19TCCGGCCCAGANONE 
J080034L11TCCGGCCCAGANONE 
J080039G07TCCGGCCCAGANONE 
J080062M23TCCGGCCCAGANONE 
J080302A01TCCGGCCCAGANONE 
J100042I15TCCGGCCCAGANONE 
J100043G22TCCGGCCCAGANONE 
J100056L12TCCGGCCCAGANONE 
J100061A12TCCGGCCCAGANONE 
J100073O20TCCGGCCCAGANONE 
J100082I08TCCGGCCCAGANONE 
Os06g0128400AK064390AACGGGCCCAGATNONE 
AK121983AACGGGCCCAGATWD40-like domain containing protein. 
Os06g0134300AK071534TCTGGGCCCATAAConserved hypothetical protein. 
J023106E03TCTGGGCCCATAANONE 
J075172D02TCTGGGCCCATAANONE 
J100047B13TCTGGGCCCATAANONE 
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
AK064640ATCTGGGCCGTCCSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
J075086I24ATCCGACGGCCCAGATNONE 
J075086I24ATCTGGGCCGTCCNONE 
J075127E23ATCCGACGGCCCAGATNONE 
J075127E23ATCTGGGCCGTCCNONE 
J075157B19ATCCGACGGCCCAGATNONE 
J075157B19ATCTGGGCCGTCCNONE 
J090038E06ATCCGACGGCCCAGATNONE 
J090038E06ATCTGGGCCGTCCNONE 
Os06g0246500AK105105ATCTGGGCCACSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0309000AK121021AAGGCCCAGACAGCCCAACZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0326400AK065052CCAACGGCCCAGATCTCTCCGCNONE 
AK121116CCAACGGCCCAGATCTCTCCGCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23CCAACGGCCCAGATCTCTCCGCNONE 
J013129K13CCAACGGCCCAGATCTCTCCGCNONE 
J023010F22CCAACGGCCCAGATCTCTCCGCNONE 
J023120K19CCAACGGCCCAGATCTCTCCGCNONE 
Os06g0476200AK065566CCCGGGCCCAGANONE 
AK068502CCCGGGCCCAGASimilar to Phosphoglucomutase precursor (EC 5.4.2.2). 
Os06g0601000AK071330AAATGGGCCCAGAHomeodomain-like containing protein. 
AY224485AAATGGGCCCAGANONE 
Os06g0642900AK073896ATCTGGGCCCACCTGTCUbiquitin system component Cue domain containing protein. 
J033042P11ATCTGGGCCCACCTGTCNONE 
J033072G12ATCTGGGCCCACCTGTCNONE 
J090050C02ATCTGGGCCCACCTGTCNONE 
Os06g0647900AK073750ACCGGCCCAGATConserved hypothetical protein. 
J033029K17ACCGGCCCAGATNONE 
J033070L21ACCGGCCCAGATNONE 
Os06g0656800AK109762ATCTGGGCCGTABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0667400AK065424GACGGCCCAGATConserved hypothetical protein. 
AK065580GACGGCCCAGATNONE 
Os06g0673500J100018J12TATGGGCCCAGANONE 
J100072F13TATGGGCCCAGASimilar to Ubiquitin. 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os06g0701400013-010-G06CTGGCCCAGANONE 
AK121229CTGGCCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16CTGGCCCAGANONE 
J033023L12CTGGCCCAGANONE 
J065043I07CTGGCCCAGANONE 
J065049E09CTGGCCCAGANONE 
J065054I05CTGGCCCAGANONE 
J065072H13CTGGCCCAGANONE 
J065073L10CTGGCCCAGANONE 
J065079P09CTGGCCCAGANONE 
J065112I06CTGGCCCAGANONE 
J065167C03CTGGCCCAGANONE 
J065167I03CTGGCCCAGANONE 
J065176P13CTGGCCCAGANONE 
J065205M07CTGGCCCAGANONE 
J075018E13CTGGCCCAGANONE 
J075021E04CTGGCCCAGANONE 
J075038F13CTGGCCCAGANONE 
J075051E05CTGGCCCAGANONE 
J075067C10CTGGCCCAGANONE 
J075079A12CTGGCCCAGANONE 
J075084A13CTGGCCCAGANONE 
J075103E20CTGGCCCAGANONE 
J075116E09CTGGCCCAGANONE 
J075118F15CTGGCCCAGANONE 
J075121I15CTGGCCCAGANONE 
J075129B01CTGGCCCAGANONE 
J075138A22CTGGCCCAGANONE 
J075159B22CTGGCCCAGANONE 
J075165I11CTGGCCCAGANONE 
J075186E09CTGGCCCAGANONE 
J075190J09CTGGCCCAGANONE 
J075191I07CTGGCCCAGANONE 
J080301C05CTGGCCCAGANONE 
J080302L02CTGGCCCAGANONE 
J100035C19CTGGCCCAGANONE 
J100059P06CTGGCCCAGANONE 
Os06g0702800009-039-E05ATGGCCCAGAAGGCCCACCANONE 
AK073948ATGGCCCAGAAGGCCCACCAHypothetical protein. 
J023108K23ATGGCCCAGAAGGCCCACCANONE 
J033072H04ATGGCCCAGAAGGCCCACCANONE 
J065008G05ATGGCCCAGAAGGCCCACCANONE 
J065128J12ATGGCCCAGAAGGCCCACCANONE 
J065131A01ATGGCCCAGAAGGCCCACCANONE 
J065173B12ATGGCCCAGAAGGCCCACCANONE 
Os06g0704300AK107008ATCTGGGCCGGGCCCZinc finger, CCCH-type domain containing protein. 
J065038I12ATCTGGGCCGGGCCCNONE 
J065079E03ATCTGGGCCGGGCCCNONE 
J075035B15ATCTGGGCCGGGCCCNONE 
J090072D21ATCTGGGCCGGGCCCNONE 
Os06g0708600009-019-C12ATCTGGGCCGCNONE 
013-092-H09ATCTGGGCCGCNONE 
014-031-G05ATCTGGGCCGCNONE 
AK100915ATCTGGGCCGCConserved hypothetical protein. 
J065065F24ATCTGGGCCGCNONE 
J065208J10ATCTGGGCCGCNONE 
J100068H01ATCTGGGCCGCNONE 
J100084D18ATCTGGGCCGCNONE 
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GATCCGACGGCCCAGATNONE 
J053032B13GATCCGACGGCCCAGATNONE 
X82036GATCCGACGGCCCAGATNONE 
Os07g0101500AK059667ATCTGGGCCCCACNONE 
AK071749ATCTGGGCCCCACSimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07ATCTGGGCCCCACNONE 
J065050F03ATCTGGGCCCCACNONE 
J090015C05ATCTGGGCCCCACNONE 
J090045C11ATCTGGGCCCCACNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0146600J075074M15GCGGCCCAGAConserved hypothetical protein. 
J075120F11GCGGCCCAGANONE 
J075170L13GCGGCCCAGANONE 
J080302A21GCGGCCCAGANONE 
J080304J04GCGGCCCAGANONE 
J080308I12GCGGCCCAGANONE 
J080312F11GCGGCCCAGANONE 
J080315M22GCGGCCCAGANONE 
Os07g0160300AK065685TCTGGGCCGTGConserved hypothetical protein. 
J013020G13TCTGGGCCGTGNONE 
J013024B14TCTGGGCCGTGNONE 
J013040D10TCTGGGCCGTGNONE 
J043024N02TCTGGGCCGTGNONE 
J065063E19TCTGGGCCGTGNONE 
J065200G01TCTGGGCCGTGNONE 
J090098A05TCTGGGCCGTGNONE 
J100089M23TCTGGGCCGTGNONE 
Os07g0170900015-094-H05CGTGTGGGTCTGGGCCTCNONE 
AK106442CGTGTGGGTCTGGGCCTCConserved hypothetical protein. 
Os07g0185200AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK071379TTGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
AK103440TTGGCCCAGANONE 
Os07g0191700AK066389GAGGCCCAGASimilar to AT.I.24-9 protein (Fragment). 
AK103768GAGGCCCAGANONE 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319GATCGGACGGCCCAGATNONE 
Os07g0300900AK061941TCTGGGCCAASimilar to Lysine-sensitive aspartate kinase. 
AK102162TCTGGGCCAANONE 
Os07g0410300AK108503ATCTGGGCCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0513200015-004-B02TCTGGGCCTANONE 
AK101410TCTGGGCCTANONE 
AK106227TCTGGGCCTANONE 
AK119451TCTGGGCCTAProtein prenyltransferase domain containing protein. 
Os07g0516900009-108-C10GCGGCCCAGATNONE 
AK062798GCGGCCCAGATNONE 
Os07g0546000AF188065ATGGCCCAGATNONE 
AK061800ATGGCCCAGATNONE 
AK065871ATGGCCCAGATSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02ATGGCCCAGATNONE 
J013035F03ATGGCCCAGATNONE 
J013044J20ATGGCCCAGATNONE 
Os07g0563700AK121078GGACGGCCCAGATIKI3 family protein. 
Os07g0564400Os07g0564400CTCGGCCCAGANucleic acid-binding, OB-fold domain containing protein. 
Os07g0573600AK073925ATCTGGGCCTAREX1 DNA Repair family protein. 
J033072E11ATCTGGGCCTANONE 
Os07g0585800006-106-A05GCCGGCCCAGATNONE 
006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419GCCGGCCCAGATNONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064GCCGGCCCAGATSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01GCCGGCCCAGATNONE 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08GCCGGCCCAGATNONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23GCCGGCCCAGATNONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01GCCGGCCCAGATNONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13GCCGGCCCAGATNONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18GCCGGCCCAGATNONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04GCCGGCCCAGATNONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09GCCGGCCCAGATNONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02GCCGGCCCAGATNONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10GCCGGCCCAGATNONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11GCCGGCCCAGATNONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10GCCGGCCCAGATNONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04GCCGGCCCAGATNONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01GCCGGCCCAGATNONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02GCCGGCCCAGATNONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0586500AK072668GAGGCCCAGANONE 
AK120683GAGGCCCAGASimilar to SUMO activating enzyme 2. 
J065033L18GAGGCCCAGANONE 
J065038H20GAGGCCCAGANONE 
J065045M20GAGGCCCAGANONE 
J065046E10GAGGCCCAGANONE 
J065055A10GAGGCCCAGANONE 
J065098P14GAGGCCCAGANONE 
J065156B19GAGGCCCAGANONE 
J065195P22GAGGCCCAGANONE 
J075002O06GAGGCCCAGANONE 
J075003D13GAGGCCCAGANONE 
J075004K05GAGGCCCAGANONE 
J075010C10GAGGCCCAGANONE 
J075011C14GAGGCCCAGANONE 
J075026E16GAGGCCCAGANONE 
J075041L23GAGGCCCAGANONE 
J075044C21GAGGCCCAGANONE 
J075071M16GAGGCCCAGANONE 
J075076O13GAGGCCCAGANONE 
J075080G12GAGGCCCAGANONE 
J075091A03GAGGCCCAGANONE 
J075091A21GAGGCCCAGANONE 
J075106K17GAGGCCCAGANONE 
J075120G20GAGGCCCAGANONE 
J075125H10GAGGCCCAGANONE 
J075129E05GAGGCCCAGANONE 
J075143B18GAGGCCCAGANONE 
J075153P22GAGGCCCAGANONE 
J075156A12GAGGCCCAGANONE 
J075156E19GAGGCCCAGANONE 
J075159E16GAGGCCCAGANONE 
J075165E16GAGGCCCAGANONE 
J075174L21GAGGCCCAGANONE 
J075176N06GAGGCCCAGANONE 
J075176N13GAGGCCCAGANONE 
J075179L20GAGGCCCAGANONE 
J075186P20GAGGCCCAGANONE 
J090044I17GAGGCCCAGANONE 
J090051K13GAGGCCCAGANONE 
Os07g0614100AB032062TCTGGGCCCACTCCNONE 
AK058885TCTGGGCCCACTCCNONE 
AK069145TCTGGGCCCACTCCNONE 
AK102448TCTGGGCCCACTCCAlpha 1-2 subunit of 20S proteasome. 
J023007E07TCTGGGCCCACTCCNONE 
J033093O06TCTGGGCCCACTCCNONE 
Os07g0639800AK074012ATCTGGGCCTCSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592ATCTGGGCCTCNONE 
AK104739ATCTGGGCCTCNONE 
Os07g0647100AK065269TCTGGGCCCACCTGTCAGArmadillo-like helical domain containing protein. 
J013002K24TCTGGGCCCACCTGTCAGNONE 
Os07g0647800AK102332TCTGGGCCAGConserved hypothetical protein. 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os07g0681500AK103662GATCGGACGGCCCAGATNONE 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os07g0689300AK068511TCTGGGCCACNONE 
J013153J24TCTGGGCCACNONE 
Os07g0695100AB189039AGATGGGCCGGATAGGCCCAGANONE 
AB189042AGATGGGCCGGATAGGCCCAGANONE 
AK059514AGATGGGCCGGATAGGCCCAGANONE 
AK066112AGATGGGCCGGATAGGCCCAGACheY-like domain containing protein. 
J013051N02AGATGGGCCGGATAGGCCCAGANONE 
J013127M02AGATGGGCCGGATAGGCCCAGANONE 
J023007I05AGATGGGCCGGATAGGCCCAGANONE 
Os08g0119500J080315K03TCTGGGCCACMethyltransferase type 11 domain containing protein. 
Os08g0129700AB099292CTGGCCCAGANONE 
AK065715CTGGCCCAGAUDP-glucose 4-epimerase family protein. 
AK099222CTGGCCCAGANONE 
J013041C03CTGGCCCAGANONE 
J023061B05CTGGCCCAGANONE 
J033036N10CTGGCCCAGANONE 
Os08g0162500AK121633ATCTGGGCCTGGConserved hypothetical protein. 
J033105E19ATCTGGGCCTGGNONE 
J080012K11ATCTGGGCCTGGNONE 
J080041I12ATCTGGGCCTGGNONE 
J080049G05ATCTGGGCCTGGNONE 
J080050P09ATCTGGGCCTGGNONE 
J080051A10ATCTGGGCCTGGNONE 
J080054G05ATCTGGGCCTGGNONE 
J080058M08ATCTGGGCCTGGNONE 
J080064N23ATCTGGGCCTGGNONE 
J080072L15ATCTGGGCCTGGNONE 
J080096H09ATCTGGGCCTGGNONE 
J100079I08ATCTGGGCCTGGNONE 
Os08g0175200AK072367TACGGCCCAGATProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16TACGGCCCAGATNONE 
J023075K04TACGGCCCAGATNONE 
J023082L15TACGGCCCAGATNONE 
J043015G07TACGGCCCAGATNONE 
J065052L17TACGGCCCAGATNONE 
J065202P07TACGGCCCAGATNONE 
J075061D17TACGGCCCAGATNONE 
J100088P13TACGGCCCAGATNONE 
Os08g0192800AK059490ATCTGGGCCGTCCGATCNONE 
AK101678ATCTGGGCCGTCCGATCNONE 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
J080039B22ATCTGGGCCGTCCGATCNONE 
J080039I23ATCTGGGCCGTCCGATCNONE 
J080074D19ATCTGGGCCGTCCGATCNONE 
J080086N13ATCTGGGCCGTCCGATCNONE 
Os08g0230000014-096-F01AAGGCCCAGANONE 
AK067127AAGGCCCAGAConserved hypothetical protein. 
J013096C05AAGGCCCAGANONE 
J100032D12AAGGCCCAGANONE 
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein. 
J065039C07ATCCGACGGCCCAGATNONE 
J065098N11ATCCGACGGCCCAGATNONE 
J065120J15ATCCGACGGCCCAGATNONE 
J075076H12ATCCGACGGCCCAGATNONE 
J075101N16ATCCGACGGCCCAGATNONE 
J080010A07ATCCGACGGCCCAGATNONE 
J080023C16ATCCGACGGCCCAGATNONE 
J080027G22ATCCGACGGCCCAGATNONE 
J080053D02ATCCGACGGCCCAGATNONE 
J080065E17ATCCGACGGCCCAGATNONE 
J080068C15ATCCGACGGCCCAGATNONE 
J090061J10ATCCGACGGCCCAGATNONE 
Os08g0440500AK058761TCTGGGCCCCAGMIR domain containing protein. 
Os08g0449850J075182C20TCTGGGCCGAConserved hypothetical protein. 
Os08g0478500AK099704GATCCGACGGCCCAGAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0495300Os08g0495300TTGGCCCAGAConserved hypothetical protein. 
Os08g0540000AK070813GATCCGACGGCCCAGATProtein of unknown function DUF914, eukaryotic family protein. 
J090058N13GATCCGACGGCCCAGATNONE 
Os08g0547000AK120698CCACGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK120698GCGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0281800AK105291GGACGGCCCAGATConserved hypothetical protein. 
Os09g0307800AK060843TCTGGGCCGGGNuclear protein SET domain containing protein. 
Os09g0313500AK065687TAGGCCCAGADisease resistance protein family protein. 
J013039H12TAGGCCCAGANONE 
J090060B10TAGGCCCAGANONE 
Os09g0367900011-030-A03CCGATCCGACGGCCCAGATNONE 
AK061601CCGATCCGACGGCCCAGATNONE 
AK063310CCGATCCGACGGCCCAGATHypothetical protein. 
J100063G01CCGATCCGACGGCCCAGATNONE 
Os09g0406900012-044-F05GCGGCCCAGANONE 
AK063485GCGGCCCAGANONE 
AK067460GCGGCCCAGAConserved hypothetical protein. 
Os09g0453000AK120561TCTCGGCCCAGAProtein of unknown function UPF0220 family protein. 
AK121475TCTCGGCCCAGANONE 
J013132I06TCTCGGCCCAGANONE 
J023148P12TCTCGGCCCAGANONE 
J033147G24TCTCGGCCCAGANONE 
J053089L13TCTCGGCCCAGANONE 
J053097D02TCTCGGCCCAGANONE 
J065013M20TCTCGGCCCAGANONE 
J075148M10TCTCGGCCCAGANONE 
J075153M04TCTCGGCCCAGANONE 
J075197C14TCTCGGCCCAGANONE 
J080311M12TCTCGGCCCAGANONE 
J090022J07TCTCGGCCCAGANONE 
J090026D19TCTCGGCCCAGANONE 
J090033D10TCTCGGCCCAGANONE 
J090084N05TCTCGGCCCAGANONE 
J090087H04TCTCGGCCCAGANONE 
J100028I02TCTCGGCCCAGANONE 
J100088N15TCTCGGCCCAGANONE 
Os09g0458400AK070055ACCGGCCCAGAConserved hypothetical protein. 
AK120321ACCGGCCCAGANONE 
J065064N11ACCGGCCCAGANONE 
J065083J06ACCGGCCCAGANONE 
J065121D24ACCGGCCCAGANONE 
J065156I22ACCGGCCCAGANONE 
J065163J24ACCGGCCCAGANONE 
J075001I02ACCGGCCCAGANONE 
J090088O06ACCGGCCCAGANONE 
Os09g0480600AK107853ATCTGGGCCGTCCHypothetical protein. 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
Os09g0516300AK065222ATCTGGGCCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0545700009-127-C10TCTGGGCCATNONE 
AK062898TCTGGGCCATSimilar to Auxin induced protein. 
Os09g0565200004-007-A08TACGGCCCAGATNONE 
006-045-E10TACGGCCCAGATNONE 
006-051-A01TACGGCCCAGATNONE 
006-079-G03TACGGCCCAGATNONE 
006-097-C05TACGGCCCAGATNONE 
006-097-E11TACGGCCCAGATNONE 
006-111-E07TACGGCCCAGATNONE 
AK069121TACGGCCCAGATSimilar to Nucleic acid-binding protein precursor. 
AK104354TACGGCCCAGATNONE 
J013090J23TACGGCCCAGATNONE 
J013093C19TACGGCCCAGATNONE 
J023007A14TACGGCCCAGATNONE 
J023099J21TACGGCCCAGATNONE 
J065023L09TACGGCCCAGATNONE 
J075060J06TACGGCCCAGATNONE 
J075092C03TACGGCCCAGATNONE 
Os09g0567700AK065913ATCTGGGCCGCWD40-like domain containing protein. 
Os09g0571100AK106869CAGGCCCAGAVirulence factor, pectin lyase fold family protein. 
Os11g0148600AK100066CAGGCCCAGATConserved hypothetical protein. 
AK102442CAGGCCCAGATNONE 
J065167F17CAGGCCCAGATNONE 
Os11g0219400AK069850GCGGCCCAGAAnkyrin repeat containing protein. 
AK099123GCGGCCCAGANONE 
J023143G18GCGGCCCAGANONE 
Os11g0595200009-005-A06TACGGCCCAGANONE 
AK071115TACGGCCCAGANONE 
AK106159TACGGCCCAGAPAP fibrillin family protein. 
AY387683TACGGCCCAGANONE 
AY387684TACGGCCCAGANONE 
J065166K17TACGGCCCAGANONE 
Os11g0660500009-031-D10ATCTGGGCCGTCCNONE 
009-031-D10GCGGCCCAGATNONE 
009-100-G09ATCTGGGCCGTCCNONE 
009-100-G09GCGGCCCAGATNONE 
009-162-G10ATCTGGGCCGTCCNONE 
009-162-G10GCGGCCCAGATNONE 
009-183-H11ATCTGGGCCGTCCNONE 
009-183-H11GCGGCCCAGATNONE 
013-010-B11ATCTGGGCCGTCCNONE 
013-010-B11GCGGCCCAGATNONE 
013-050-A05ATCTGGGCCGTCCNONE 
013-050-A05GCGGCCCAGATNONE 
013-070-E10ATCTGGGCCGTCCNONE 
013-070-E10GCGGCCCAGATNONE 
AK105453ATCTGGGCCGTCCSimilar to Translationally controlled tumor protein (Fragment). 
AK105453GCGGCCCAGATSimilar to Translationally controlled tumor protein (Fragment). 
D12626ATCTGGGCCGTCCNONE 
D12626GCGGCCCAGATNONE 
J013128M15ATCTGGGCCGTCCNONE 
J013128M15GCGGCCCAGATNONE 
J023004I19ATCTGGGCCGTCCNONE 
J023004I19GCGGCCCAGATNONE 
J033114F08ATCTGGGCCGTCCNONE 
J033114F08GCGGCCCAGATNONE 
J033147I20ATCTGGGCCGTCCNONE 
J033147I20GCGGCCCAGATNONE 
J065031M04ATCTGGGCCGTCCNONE 
J065031M04GCGGCCCAGATNONE 
J065033J03ATCTGGGCCGTCCNONE 
J065033J03GCGGCCCAGATNONE 
J065038E01ATCTGGGCCGTCCNONE 
J065038E01GCGGCCCAGATNONE 
J065048O06ATCTGGGCCGTCCNONE 
J065048O06GCGGCCCAGATNONE 
J065054E01ATCTGGGCCGTCCNONE 
J065054E01GCGGCCCAGATNONE 
J065075N08ATCTGGGCCGTCCNONE 
J065075N08GCGGCCCAGATNONE 
J065080C07ATCTGGGCCGTCCNONE 
J065080C07GCGGCCCAGATNONE 
J065096A12ATCTGGGCCGTCCNONE 
J065096A12GCGGCCCAGATNONE 
J065115P22ATCTGGGCCGTCCNONE 
J065115P22GCGGCCCAGATNONE 
J065122I21ATCTGGGCCGTCCNONE 
J065122I21GCGGCCCAGATNONE 
J065127A13ATCTGGGCCGTCCNONE 
J065127A13GCGGCCCAGATNONE 
J065158B06ATCTGGGCCGTCCNONE 
J065158B06GCGGCCCAGATNONE 
J065162E04ATCTGGGCCGTCCNONE 
J065162E04GCGGCCCAGATNONE 
J065162E05ATCTGGGCCGTCCNONE 
J065162E05GCGGCCCAGATNONE 
J065163L06ATCTGGGCCGTCCNONE 
J065163L06GCGGCCCAGATNONE 
J065177B16ATCTGGGCCGTCCNONE 
J065177B16GCGGCCCAGATNONE 
J065181M15ATCTGGGCCGTCCNONE 
J065181M15GCGGCCCAGATNONE 
J065201G15ATCTGGGCCGTCCNONE 
J065201G15GCGGCCCAGATNONE 
J065202J06ATCTGGGCCGTCCNONE 
J065202J06GCGGCCCAGATNONE 
J075002B19ATCTGGGCCGTCCNONE 
J075002B19GCGGCCCAGATNONE 
J075008G19ATCTGGGCCGTCCNONE 
J075008G19GCGGCCCAGATNONE 
J075010P05ATCTGGGCCGTCCNONE 
J075010P05GCGGCCCAGATNONE 
J075018H23ATCTGGGCCGTCCNONE 
J075018H23GCGGCCCAGATNONE 
J075051E18ATCTGGGCCGTCCNONE 
J075051E18GCGGCCCAGATNONE 
J075053C24ATCTGGGCCGTCCNONE 
J075053C24GCGGCCCAGATNONE 
J075077B06ATCTGGGCCGTCCNONE 
J075077B06GCGGCCCAGATNONE 
J075080B11ATCTGGGCCGTCCNONE 
J075080B11GCGGCCCAGATNONE 
J075083M04ATCTGGGCCGTCCNONE 
J075083M04GCGGCCCAGATNONE 
J075085H01ATCTGGGCCGTCCNONE 
J075085H01GCGGCCCAGATNONE 
J075109E11ATCTGGGCCGTCCNONE 
J075109E11GCGGCCCAGATNONE 
J075111O09ATCTGGGCCGTCCNONE 
J075111O09GCGGCCCAGATNONE 
J075130D13ATCTGGGCCGTCCNONE 
J075130D13GCGGCCCAGATNONE 
J075132H13ATCTGGGCCGTCCNONE 
J075132H13GCGGCCCAGATNONE 
J075147H19ATCTGGGCCGTCCNONE 
J075147H19GCGGCCCAGATNONE 
J075148J01ATCTGGGCCGTCCNONE 
J075148J01GCGGCCCAGATNONE 
J075159A18ATCTGGGCCGTCCNONE 
J075159A18GCGGCCCAGATNONE 
J075166F03ATCTGGGCCGTCCNONE 
J075166F03GCGGCCCAGATNONE 
J075191F09ATCTGGGCCGTCCNONE 
J075191F09GCGGCCCAGATNONE 
J075192K09ATCTGGGCCGTCCNONE 
J075192K09GCGGCCCAGATNONE 
J080006P15ATCTGGGCCGTCCNONE 
J080006P15GCGGCCCAGATNONE 
J080013J18ATCTGGGCCGTCCNONE 
J080013J18GCGGCCCAGATNONE 
J080023O06ATCTGGGCCGTCCNONE 
J080023O06GCGGCCCAGATNONE 
J080024I17ATCTGGGCCGTCCNONE 
J080024I17GCGGCCCAGATNONE 
J080029P03ATCTGGGCCGTCCNONE 
J080029P03GCGGCCCAGATNONE 
J080030C14ATCTGGGCCGTCCNONE 
J080030C14GCGGCCCAGATNONE 
J080038K15ATCTGGGCCGTCCNONE 
J080038K15GCGGCCCAGATNONE 
J080042I15ATCTGGGCCGTCCNONE 
J080042I15GCGGCCCAGATNONE 
J080053L07ATCTGGGCCGTCCNONE 
J080053L07GCGGCCCAGATNONE 
J080061H12ATCTGGGCCGTCCNONE 
J080061H12GCGGCCCAGATNONE 
J080064H24ATCTGGGCCGTCCNONE 
J080064H24GCGGCCCAGATNONE 
J080066J20ATCTGGGCCGTCCNONE 
J080066J20GCGGCCCAGATNONE 
J080074N07ATCTGGGCCGTCCNONE 
J080074N07GCGGCCCAGATNONE 
J080079F16ATCTGGGCCGTCCNONE 
J080079F16GCGGCCCAGATNONE 
J080079O07ATCTGGGCCGTCCNONE 
J080079O07GCGGCCCAGATNONE 
J080092E15ATCTGGGCCGTCCNONE 
J080092E15GCGGCCCAGATNONE 
J080301F19ATCTGGGCCGTCCNONE 
J080301F19GCGGCCCAGATNONE 
J080302O21ATCTGGGCCGTCCNONE 
J080302O21GCGGCCCAGATNONE 
J080306L02ATCTGGGCCGTCCNONE 
J080306L02GCGGCCCAGATNONE 
J080307F16ATCTGGGCCGTCCNONE 
J080307F16GCGGCCCAGATNONE 
J080307G01ATCTGGGCCGTCCNONE 
J080307G01GCGGCCCAGATNONE 
J080307K01ATCTGGGCCGTCCNONE 
J080307K01GCGGCCCAGATNONE 
J080309O22ATCTGGGCCGTCCNONE 
J080309O22GCGGCCCAGATNONE 
J080311E17ATCTGGGCCGTCCNONE 
J080311E17GCGGCCCAGATNONE 
J080311N08ATCTGGGCCGTCCNONE 
J080311N08GCGGCCCAGATNONE 
J080312O12ATCTGGGCCGTCCNONE 
J080312O12GCGGCCCAGATNONE 
J080315C08ATCTGGGCCGTCCNONE 
J080315C08GCGGCCCAGATNONE 
J080316D07ATCTGGGCCGTCCNONE 
J080316D07GCGGCCCAGATNONE 
J080318C17ATCTGGGCCGTCCNONE 
J080318C17GCGGCCCAGATNONE 
J090004B08ATCTGGGCCGTCCNONE 
J090004B08GCGGCCCAGATNONE 
J090009K02ATCTGGGCCGTCCNONE 
J090009K02GCGGCCCAGATNONE 
J090025O15ATCTGGGCCGTCCNONE 
J090025O15GCGGCCCAGATNONE 
J090026L03ATCTGGGCCGTCCNONE 
J090026L03GCGGCCCAGATNONE 
J090036P17ATCTGGGCCGTCCNONE 
J090036P17GCGGCCCAGATNONE 
J090047A21ATCTGGGCCGTCCNONE 
J090047A21GCGGCCCAGATNONE 
J090053O03ATCTGGGCCGTCCNONE 
J090053O03GCGGCCCAGATNONE 
J090059C04ATCTGGGCCGTCCNONE 
J090059C04GCGGCCCAGATNONE 
J090062O21ATCTGGGCCGTCCNONE 
J090062O21GCGGCCCAGATNONE 
J090064M11ATCTGGGCCGTCCNONE 
J090064M11GCGGCCCAGATNONE 
J090070C14ATCTGGGCCGTCCNONE 
J090070C14GCGGCCCAGATNONE 
J090075I03ATCTGGGCCGTCCNONE 
J090075I03GCGGCCCAGATNONE 
J090081G22ATCTGGGCCGTCCNONE 
J090081G22GCGGCCCAGATNONE 
J090083E18ATCTGGGCCGTCCNONE 
J090083E18GCGGCCCAGATNONE 
J090084A05ATCTGGGCCGTCCNONE 
J090084A05GCGGCCCAGATNONE 
J100019L11ATCTGGGCCGTCCNONE 
J100019L11GCGGCCCAGATNONE 
J100022D16ATCTGGGCCGTCCNONE 
J100022D16GCGGCCCAGATNONE 
J100042F09ATCTGGGCCGTCCNONE 
J100042F09GCGGCCCAGATNONE 
J100051J12ATCTGGGCCGTCCNONE 
J100051J12GCGGCCCAGATNONE 
J100065G21ATCTGGGCCGTCCNONE 
J100065G21GCGGCCCAGATNONE 
J100066D08ATCTGGGCCGTCCNONE 
J100066D08GCGGCCCAGATNONE 
J100069H04ATCTGGGCCGTCCNONE 
J100069H04GCGGCCCAGATNONE 
J100078I16ATCTGGGCCGTCCNONE 
J100078I16GCGGCCCAGATNONE 
J100090D15ATCTGGGCCGTCCNONE 
J100090D15GCGGCCCAGATNONE 
Os11g0677400AK069580TCTGGGCCCACAPectinesterase inhibitor domain containing protein. 
J023020A19TCTGGGCCCACANONE 
Os12g0109600AK107606TCTGGGCCGACGGCCCATGGCCCAGProtein of unknown function DUF1677, Oryza sativa family protein. 
J053026B13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053033C09TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053059G21TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053071A13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075007L19TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075071J20TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075110F18TCTGGGCCGACGGCCCATGGCCCAGNONE 
Os12g0145200AK111428CTGGCCCAGASimilar to Protein MONOCULM 1. 
J065208D22CTGGCCCAGANONE 
Os12g0194700AK121912AACGGCCCAGATDNA-directed RNA polymerase, 13 to 16 kDa subunit family protein. 
J033106A07AACGGCCCAGATNONE 
Os12g0194800011-016-B07ATCTGGGCCGTTNONE 
AK101810ATCTGGGCCGTTtRNA pseudouridine synthase family protein. 
AK107780ATCTGGGCCGTTNONE 
J043034C07ATCTGGGCCGTTNONE 
Os12g0233500Os12g0233500TTGGCCCAGANONE 
Os12g0433200AK058760CTGGGGCCCAGAConserved hypothetical protein. 
Os12g0506500AK119779TAGGCCCAGAGalactokinase/homoserine kinase family protein. 
Os12g0516300AK065092ATCTGGGCCAGNONE 
J013001M05ATCTGGGCCAGNONE 
Os12g0533500AK068646TCGGCCCGGCCCGGCCCAGAConserved hypothetical protein. 
J013158L10TCGGCCCGGCCCGGCCCAGANONE 
J065083J02TCGGCCCGGCCCGGCCCAGANONE 
J075079D02TCGGCCCGGCCCGGCCCAGANONE 
J100037H16TCGGCCCGGCCCGGCCCAGANONE 
J100075P13TCGGCCCGGCCCGGCCCAGANONE 
Os12g0554400AK072345TAGGCCCAGATetratricopeptide-like helical domain containing protein. 
Os12g0580600AK108584TCTGGGCCTCConserved hypothetical protein. 
Os12g0609600AK111050TCTGGGCCCCAHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.