version

Summary of OsREG630 (All List)

OrganismOryza sativa  
IDOsREG630  
SequenceGGCCCATA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3108  

Entry Sequences (3108 entries)

LocusGene modelSequenceDescription
Os01g0104400006-026-B08TTATGGGCCGTGGNONE 
006-030-C01TTATGGGCCGTGGNONE 
006-055-E02TTATGGGCCGTGGNONE 
006-061-B12TTATGGGCCGTGGNONE 
006-064-F06TTATGGGCCGTGGNONE 
006-078-G10TTATGGGCCGTGGNONE 
006-079-G09TTATGGGCCGTGGNONE 
006-080-B08TTATGGGCCGTGGNONE 
006-100-E07TTATGGGCCGTGGNONE 
006-110-E01TTATGGGCCGTGGNONE 
006-118-D10TTATGGGCCGTGGNONE 
006-120-C12TTATGGGCCGTGGNONE 
AK060132TTATGGGCCGTGGNONE 
AK071375TTATGGGCCGTGGRicin B-related lectin domain containing protein. 
AK104555TTATGGGCCGTGGNONE 
AK104820TTATGGGCCGTGGNONE 
J023121J21TTATGGGCCGTGGNONE 
Os01g0134500AK111908TAGGCCCATASimilar to Delta-7-sterol-C5(6)-desaturase (EC 1.3.3.-) (Delta-7-C-5 sterol desaturase) (Delta7-sterol-C5-desaturase). 
AK112014TAGGCCCATANONE 
Os01g0155600006-048-F03ATCTCGGCCCATANONE 
AK060171ATCTCGGCCCATANONE 
AK071635ATCTCGGCCCATASimilar to Splicing factor RSZ33. 
J023080A03ATCTCGGCCCATANONE 
J023100L15ATCTCGGCCCATANONE 
J033075I17ATCTCGGCCCATANONE 
J033085O09ATCTCGGCCCATANONE 
J033105E15ATCTCGGCCCATANONE 
J033132N10ATCTCGGCCCATANONE 
J033132P12ATCTCGGCCCATANONE 
J033149H12ATCTCGGCCCATANONE 
J043026M03ATCTCGGCCCATANONE 
J080305J10ATCTCGGCCCATANONE 
J080308K03ATCTCGGCCCATANONE 
J090023M04ATCTCGGCCCATANONE 
J090078F24ATCTCGGCCCATANONE 
J100066P05ATCTCGGCCCATANONE 
Os01g0166800AK073783ATATGGGCCGGAConserved hypothetical protein. 
AK099378ATATGGGCCGGANONE 
J033026H10ATATGGGCCGGANONE 
J033067O18ATATGGGCCGGANONE 
J033108A17ATATGGGCCGGANONE 
J065015J11ATATGGGCCGGANONE 
J065204P09ATATGGGCCGGANONE 
Os01g0191800AK061360GGGGCCCATACNONE 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
012-002-F11ATGGCCCATANONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
013-082-F05ATGGCCCATANONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
AK107453ATGGCCCATASimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065005L22ATGGCCCATANONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065023E21ATGGCCCATANONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065036H21ATGGCCCATANONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065037M24ATGGCCCATANONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065049L04ATGGCCCATANONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065072F17ATGGCCCATANONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065085H10ATGGCCCATANONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065109N19ATGGCCCATANONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065117M19ATGGCCCATANONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065144C15ATGGCCCATANONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065159G24ATGGCCCATANONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J065164N14ATGGCCCATANONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075025K16ATGGCCCATANONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075057L05ATGGCCCATANONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075070I16ATGGCCCATANONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075089D10ATGGCCCATANONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J075138F10ATGGCCCATANONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J090018C11ATGGCCCATANONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100018L19ATGGCCCATANONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100024B14ATGGCCCATANONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100048L02ATGGCCCATANONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100055A22ATGGCCCATANONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
J100069K01ATGGCCCATANONE 
Os01g0270100006-096-H09ATATGGGCCACNONE 
009-009-C10ATATGGGCCACNONE 
009-054-E06ATATGGGCCACNONE 
014-085-F09ATATGGGCCACNONE 
AK073275ATATGGGCCACNONE 
AK104155ATATGGGCCACNONE 
AK119511ATATGGGCCACSimilar to Cysteine protease inhibitor. 
J033025K21ATATGGGCCACNONE 
J075065H10ATATGGGCCACNONE 
J075143G10ATATGGGCCACNONE 
J100059J02ATATGGGCCACNONE 
Os01g0277500AK066984AAGGCCCATASimilar to Dof3 gene (Fragment). 
J013074F19AAGGCCCATANONE 
J013091E10AAGGCCCATANONE 
J023077C19AAGGCCCATANONE 
J033068A02AAGGCCCATANONE 
J065137O05AAGGCCCATANONE 
Os01g0283000AK073165GTATGGGCCAGConserved hypothetical protein. 
J033023G08GTATGGGCCAGNONE 
Os01g0283100004-018-B01CTGGCCCATACNONE 
AK060908CTGGCCCATACNONE 
AK071713CTGGCCCATACSimilar to Ferripyochelin-binding protein-like. 
AK104205CTGGCCCATACNONE 
AK122051CTGGCCCATACNONE 
J023109L19CTGGCCCATACNONE 
Os01g0303100009-049-H10TTATGGGCCATATGGGCCAANONE 
AK062603TTATGGGCCATATGGGCCAASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0306100AK111041TTATGGGCCGAGAPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0316800009-188-E08ACCGGCCCATAANONE 
AK058821ACCGGCCCATAANONE 
AK119788ACCGGCCCATAASimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09ACCGGCCCATAANONE 
J065102J21ACCGGCCCATAANONE 
J065173M10ACCGGCCCATAANONE 
J075066K08ACCGGCCCATAANONE 
J080302B04ACCGGCCCATAANONE 
J080310P14ACCGGCCCATAANONE 
J080311I23ACCGGCCCATAANONE 
J080319N12ACCGGCCCATAANONE 
J100024D14ACCGGCCCATAANONE 
J100055N12ACCGGCCCATAANONE 
Os01g0331900013-026-D04ATATGGGCCTANONE 
AK064784ATATGGGCCTANONE 
AK121761ATATGGGCCTAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15ATATGGGCCTANONE 
J033090D07ATATGGGCCTANONE 
J090006L21ATATGGGCCTANONE 
Os01g0514300AK121086ATATGGGCCGGCLissencephaly type-1-like homology motif domain containing protein. 
Os01g0517800J075194B21TCTGGCCCATAProtein of unknown function DUF597 family protein. 
Os01g0530366J075001P06GCCGGCCCATATAACGGGCCNONE 
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein. 
J075030G13GCCGGCCCATATAACGGGCCNONE 
Os01g0581300AK066182TCCGGCCCATAGCAGCCCATATSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TCCGGCCCATAGCAGCCCATATNONE 
Os01g0585400AK103584AGGGCCCATAGGCCCAGAConserved hypothetical protein. 
J033133B01AGGGCCCATAGGCCCAGANONE 
Os01g0642900009-109-F01AAACGGCCCATATNONE 
AK063836AAACGGCCCATATSingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560AAACGGCCCATATNONE 
J033043K18AAACGGCCCATATNONE 
J100023C05AAACGGCCCATATNONE 
J100038C15AAACGGCCCATATNONE 
J100039C23AAACGGCCCATATNONE 
Os01g0686800006-098-B12TAGGCCCATACNONE 
006-113-H04TAGGCCCATACNONE 
AK060428TAGGCCCATACNONE 
AK098877TAGGCCCATACNONE 
AK098893TAGGCCCATACNONE 
AK121587TAGGCCCATACGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231TAGGCCCATACNONE 
J013001E12TAGGCCCATACNONE 
J013001N15TAGGCCCATACNONE 
J013098G22TAGGCCCATACNONE 
J023004P15TAGGCCCATACNONE 
J023014D09TAGGCCCATACNONE 
J023020G09TAGGCCCATACNONE 
J023034A19TAGGCCCATACNONE 
J023050I11TAGGCCCATACNONE 
J023079D13TAGGCCCATACNONE 
J023091B11TAGGCCCATACNONE 
J023099M03TAGGCCCATACNONE 
J023101H20TAGGCCCATACNONE 
J023106P14TAGGCCCATACNONE 
J023111F19TAGGCCCATACNONE 
J023132C22TAGGCCCATACNONE 
J023139O03TAGGCCCATACNONE 
J023146O10TAGGCCCATACNONE 
J033022G16TAGGCCCATACNONE 
J033030C10TAGGCCCATACNONE 
J033032G18TAGGCCCATACNONE 
J033034N09TAGGCCCATACNONE 
J033037K24TAGGCCCATACNONE 
J033038B22TAGGCCCATACNONE 
J033061E06TAGGCCCATACNONE 
J033065F08TAGGCCCATACNONE 
J033065I24TAGGCCCATACNONE 
J033069L01TAGGCCCATACNONE 
J033086N21TAGGCCCATACNONE 
J033102I06TAGGCCCATACNONE 
J033111N07TAGGCCCATACNONE 
J033118K11TAGGCCCATACNONE 
J033125D08TAGGCCCATACNONE 
J033129P22TAGGCCCATACNONE 
J033131L12TAGGCCCATACNONE 
J033139D08TAGGCCCATACNONE 
J033141J08TAGGCCCATACNONE 
J043024B14TAGGCCCATACNONE 
J053048G19TAGGCCCATACNONE 
J065023B15TAGGCCCATACNONE 
J065082C15TAGGCCCATACNONE 
J065087D24TAGGCCCATACNONE 
J065122D11TAGGCCCATACNONE 
J065128P13TAGGCCCATACNONE 
J065149I19TAGGCCCATACNONE 
J065154E16TAGGCCCATACNONE 
J065156K21TAGGCCCATACNONE 
J065166H09TAGGCCCATACNONE 
J065169F24TAGGCCCATACNONE 
J065194I16TAGGCCCATACNONE 
J065213M20TAGGCCCATACNONE 
J075020F19TAGGCCCATACNONE 
J075051J16TAGGCCCATACNONE 
J075093C18TAGGCCCATACNONE 
J075119H02TAGGCCCATACNONE 
J075120J11TAGGCCCATACNONE 
J075173A15TAGGCCCATACNONE 
J080302B05TAGGCCCATACNONE 
J080304G10TAGGCCCATACNONE 
J080305E13TAGGCCCATACNONE 
J080315L11TAGGCCCATACNONE 
J090005H15TAGGCCCATACNONE 
J090021C24TAGGCCCATACNONE 
J090025H24TAGGCCCATACNONE 
J090025M11TAGGCCCATACNONE 
J090026C22TAGGCCCATACNONE 
J090027H15TAGGCCCATACNONE 
J090034B17TAGGCCCATACNONE 
J090045G11TAGGCCCATACNONE 
J090048H02TAGGCCCATACNONE 
J090051N04TAGGCCCATACNONE 
J090052I06TAGGCCCATACNONE 
J090054L17TAGGCCCATACNONE 
J090060M22TAGGCCCATACNONE 
J090075N17TAGGCCCATACNONE 
J090079K13TAGGCCCATACNONE 
J090086H08TAGGCCCATACNONE 
J090094N20TAGGCCCATACNONE 
J100021F03TAGGCCCATACNONE 
J100031M01TAGGCCCATACNONE 
J100033I18TAGGCCCATACNONE 
J100034P07TAGGCCCATACNONE 
J100043M16TAGGCCCATACNONE 
J100046J12TAGGCCCATACNONE 
J100055F09TAGGCCCATACNONE 
J100057D19TAGGCCCATACNONE 
J100060O10TAGGCCCATACNONE 
J100064G09TAGGCCCATACNONE 
J100077F24TAGGCCCATACNONE 
J100080E12TAGGCCCATACNONE 
J100089J04TAGGCCCATACNONE 
Os01g0710800013-097-E05TTTTGGGCCTTAGGCCCATATNONE 
AK069973TTTTGGGCCTTAGGCCCATATNONE 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
J023081K01TTTTGGGCCTTAGGCCCATATNONE 
J023123E16TTTTGGGCCTTAGGCCCATATNONE 
J033066B11TTTTGGGCCTTAGGCCCATATNONE 
J065144G11TTTTGGGCCTTAGGCCCATATNONE 
Os01g0727400AK065692TGTGGGCCCATATConserved hypothetical protein. 
Os01g0764300J090053G03TTATGGGCCCACCCACCACProtein of unknown function DUF155 family protein. 
Os01g0784600AK067527TCGGCCCATATConserved hypothetical protein. 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0851000AK065338TTGGCCCATATPfkB domain containing protein. 
Os01g0874800016-042-F01AAATGGGCTTTTGGCCCATAANONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK119315AAATGGGCTTTTGGCCCATAANONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
Os01g0888700AK073376GAGGCCCATAAProtein of unknown function RIO1 family protein. 
J033030B16GAGGCCCATAANONE 
J033098D06GAGGCCCATAANONE 
J033112A12GAGGCCCATAANONE 
J043003L24GAGGCCCATAANONE 
Os01g0889800003-107-A06CAAGGCCCATATNONE 
005-016-H12CAAGGCCCATATNONE 
AK070087CAAGGCCCATATRhodanese-like domain containing protein. 
AK104708CAAGGCCCATATNONE 
J013035D13CAAGGCCCATATNONE 
J013068K01CAAGGCCCATATNONE 
J023042J18CAAGGCCCATATNONE 
J053023F13CAAGGCCCATATNONE 
J053026M13CAAGGCCCATATNONE 
J053033N15CAAGGCCCATATNONE 
J053035I16CAAGGCCCATATNONE 
J053039A11CAAGGCCCATATNONE 
J053039K22CAAGGCCCATATNONE 
J053043B08CAAGGCCCATATNONE 
J053068K09CAAGGCCCATATNONE 
J053082D11CAAGGCCCATATNONE 
J053092N12CAAGGCCCATATNONE 
J053099A19CAAGGCCCATATNONE 
J065027F17CAAGGCCCATATNONE 
J065039B13CAAGGCCCATATNONE 
J065139N16CAAGGCCCATATNONE 
J065205B22CAAGGCCCATATNONE 
Os01g0895100AK058611ATATGGGCCTASimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698ATATGGGCCTANONE 
AK099166ATATGGGCCTANONE 
J023065I03ATATGGGCCTANONE 
J023081J06ATATGGGCCTANONE 
J023126H17ATATGGGCCTANONE 
J023126O09ATATGGGCCTANONE 
J033035I06ATATGGGCCTANONE 
J090065C10ATATGGGCCTANONE 
J090095O16ATATGGGCCTANONE 
Os01g0916300011-018-B12TATGGGCCACNONE 
AK063922TATGGGCCACSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TATGGGCCACNONE 
AK121061TATGGGCCACNONE 
AK121997TATGGGCCACNONE 
J033118P14TATGGGCCACNONE 
J065002N16TATGGGCCACNONE 
J065079B04TATGGGCCACNONE 
J065102J07TATGGGCCACNONE 
J065128F16TATGGGCCACNONE 
J065184D11TATGGGCCACNONE 
J065186A07TATGGGCCACNONE 
J075115C07TATGGGCCACNONE 
J075147C04TATGGGCCACNONE 
Os01g0924000004-020-C09GTATGGGCCGGCCCNONE 
005-014-A06GTATGGGCCGGCCCNONE 
009-085-G12GTATGGGCCGGCCCNONE 
009-123-A08GTATGGGCCGGCCCNONE 
009-134-A05GTATGGGCCGGCCCNONE 
009-137-F06GTATGGGCCGGCCCNONE 
016-016-B08GTATGGGCCGGCCCNONE 
AF050674GTATGGGCCGGCCCNONE 
AK061690GTATGGGCCGGCCCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797GTATGGGCCGGCCCNONE 
J013040A15GTATGGGCCGGCCCNONE 
J013104L20GTATGGGCCGGCCCNONE 
J013127E12GTATGGGCCGGCCCNONE 
J013158O05GTATGGGCCGGCCCNONE 
J023012E09GTATGGGCCGGCCCNONE 
J023126L23GTATGGGCCGGCCCNONE 
J023143B03GTATGGGCCGGCCCNONE 
J065005B16GTATGGGCCGGCCCNONE 
J065101J15GTATGGGCCGGCCCNONE 
J065105K16GTATGGGCCGGCCCNONE 
J065155K16GTATGGGCCGGCCCNONE 
J065171M17GTATGGGCCGGCCCNONE 
J065182F07GTATGGGCCGGCCCNONE 
J065187D10GTATGGGCCGGCCCNONE 
J065194I24GTATGGGCCGGCCCNONE 
J065207E24GTATGGGCCGGCCCNONE 
J075001C24GTATGGGCCGGCCCNONE 
J075090O10GTATGGGCCGGCCCNONE 
J075095H17GTATGGGCCGGCCCNONE 
J075109M24GTATGGGCCGGCCCNONE 
J075123C18GTATGGGCCGGCCCNONE 
J075148G22GTATGGGCCGGCCCNONE 
J090009B09GTATGGGCCGGCCCNONE 
J090075K17GTATGGGCCGGCCCNONE 
J090081H23GTATGGGCCGGCCCNONE 
J090097H21GTATGGGCCGGCCCNONE 
J100063P14GTATGGGCCGGCCCNONE 
Os01g0952600AK067525CTTGGGCCCATACNONE 
AK070047CTTGGGCCCATACSimilar to LacZ (Fragment). 
Os01g0959900AK058375ATATGGGCCTTConserved hypothetical protein. 
AK066497ATATGGGCCTTNONE 
Os01g0960300AK100099TTATGGGCCTTSimilar to Glucose inhibited division protein A. 
AK100099TTGGCCCATATSimilar to Glucose inhibited division protein A. 
Os01g0964000AK073599GTATGGGCCCTSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1). 
AK104012GTATGGGCCCTNONE 
AK104190GTATGGGCCCTNONE 
Os02g0119400AK060055GACGGCCCATATNONE 
AK102774GACGGCCCATATSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GACGGCCCATATNONE 
J075175F09GACGGCCCATATNONE 
J090011H05GACGGCCCATATNONE 
J090091O05GACGGCCCATATNONE 
Os02g0136800011-089-E11TTATGGGCCTANONE 
AK070727TTATGGGCCTANONE 
AK103485TTATGGGCCTAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10TTATGGGCCTANONE 
J033140H14TTATGGGCCTANONE 
J033142H14TTATGGGCCTANONE 
J065151O09TTATGGGCCTANONE 
J090076K09TTATGGGCCTANONE 
J090085K04TTATGGGCCTANONE 
Os02g0178400009-151-B08TTGGCCCACGAGGCCCATAANONE 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
AK121516TTGGCCCACGAGGCCCATAANONE 
J033026A17TTGGCCCACGAGGCCCATAANONE 
J065011K14TTGGCCCACGAGGCCCATAANONE 
J065056D01TTGGCCCACGAGGCCCATAANONE 
J065061L22TTGGCCCACGAGGCCCATAANONE 
J065076M01TTGGCCCACGAGGCCCATAANONE 
J075092E14TTGGCCCACGAGGCCCATAANONE 
Os02g0179100AK058557CACGCCACCGGCCCATACMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CACGCCACCGGCCCATACNONE 
Os02g0188500AK102004TCAGGCCCATATNONE 
AK106917TCAGGCCCATATUbiquitin domain containing protein. 
J090039N13TCAGGCCCATATNONE 
Os02g0189100AK111066GAGGCCCATATConserved hypothetical protein. 
J053061N01GAGGCCCATATNONE 
J053088H13GAGGCCCATATNONE 
J065038F12GAGGCCCATATNONE 
J065083I18GAGGCCCATATNONE 
J065085A17GAGGCCCATATNONE 
J065110G06GAGGCCCATATNONE 
J065117J19GAGGCCCATATNONE 
J065120D21GAGGCCCATATNONE 
J065121C23GAGGCCCATATNONE 
J065174E03GAGGCCCATATNONE 
J075182G01GAGGCCCATATNONE 
J080302D10GAGGCCCATATNONE 
J080309F08GAGGCCCATATNONE 
J080310H15GAGGCCCATATNONE 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0226900AK064279AGGGCCCATACProtein prenyltransferase domain containing protein. 
Os02g0230200AK105482TTATGGGCCGCConserved hypothetical protein. 
Os02g0321900AK058256TAGGCCCATAGCCCATCANONE 
AK062103TAGGCCCATAGCCCATCASimilar to 60S ribosomal protein L10a-1. 
AK102574TAGGCCCATAGCCCATCANONE 
J065176M06TAGGCCCATAGCCCATCANONE 
J075112D24TAGGCCCATAGCCCATCANONE 
Os02g0549600009-119-C10ATATGGGCCCATCANONE 
AK066564ATATGGGCCCATCASimilar to 40S ribosomal protein S10-1. 
J013073I17ATATGGGCCCATCANONE 
J013104F19ATATGGGCCCATCANONE 
J013104K21ATATGGGCCCATCANONE 
J013110E05ATATGGGCCCATCANONE 
J023020L11ATATGGGCCCATCANONE 
J023130D08ATATGGGCCCATCANONE 
J033041D03ATATGGGCCCATCANONE 
J033105K14ATATGGGCCCATCANONE 
J065040N14ATATGGGCCCATCANONE 
J065157A09ATATGGGCCCATCANONE 
J075123A20ATATGGGCCCATCANONE 
J075129F06ATATGGGCCCATCANONE 
J075135E04ATATGGGCCCATCANONE 
J075173A10ATATGGGCCCATCANONE 
J080301E09ATATGGGCCCATCANONE 
J080306D10ATATGGGCCCATCANONE 
J080310M21ATATGGGCCCATCANONE 
J080312M09ATATGGGCCCATCANONE 
J080319J08ATATGGGCCCATCANONE 
J090036L14ATATGGGCCCATCANONE 
J090051D01ATATGGGCCCATCANONE 
J090066K07ATATGGGCCCATCANONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK060611TCGGCCCATAABrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
AK102534TCGGCCCATAANONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08TCGGCCCATAANONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18TCGGCCCATAANONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01TCGGCCCATAANONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14TCGGCCCATAANONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17TCGGCCCATAANONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13TCGGCCCATAANONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17TCGGCCCATAANONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07TCGGCCCATAANONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10TCGGCCCATAANONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03TCGGCCCATAANONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20TCGGCCCATAANONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03TCGGCCCATAANONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12TCGGCCCATAANONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07TCGGCCCATAANONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06TCGGCCCATAANONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07TCGGCCCATAANONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08TCGGCCCATAANONE 
Os02g0595400AK069935CTGGCCCATATConserved hypothetical protein. 
AK099175CTGGCCCATATNONE 
AK103993CTGGCCCATATNONE 
J065021M23CTGGCCCATATNONE 
J065021M24CTGGCCCATATNONE 
J065205M09CTGGCCCATATNONE 
J100082C06CTGGCCCATATNONE 
Os02g0643500AK068423AAGGCCCATAAPentapeptide repeat containing protein. 
Os02g0667300009-057-D01GTATGGGCCCAAGNONE 
AK058228GTATGGGCCCAAGAlcohol dehydrogenase superfamily, zinc-containing protein. 
AK099066GTATGGGCCCAAGNONE 
Os02g0679200AK110789TTCGGCCCATACTetratricopeptide-like helical domain containing protein. 
Os02g0689200011-024-D04ATGGCCCATAANONE 
AK071254ATGGCCCATAANONE 
AK072660ATGGCCCATAAProtein of unknown function DUF250 domain containing protein. 
J023087G23ATGGCCCATAANONE 
J023134O11ATGGCCCATAANONE 
J033095E21ATGGCCCATAANONE 
J033113F12ATGGCCCATAANONE 
J033124F02ATGGCCCATAANONE 
J065070A01ATGGCCCATAANONE 
J065129C05ATGGCCCATAANONE 
J065165M19ATGGCCCATAANONE 
J090015K07ATGGCCCATAANONE 
J090066D21ATGGCCCATAANONE 
J090075M20ATGGCCCATAANONE 
Os02g0700100AK102954TAGGCCCATATSimilar to WD-repeat protein. 
Os02g0717100014-089-G06TTATGGGCCCAGATNONE 
AK063741TTATGGGCCCAGATEsterase/lipase/thioesterase domain containing protein. 
J065052A22TTATGGGCCCAGATNONE 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
J013099D16AAGGCCCATAAAAGCCCAACNONE 
Os02g0740300AK067833TTCGGCCCATATAAA ATPase domain containing protein. 
Os02g0753200AK067176TTGGCCCATATConserved hypothetical protein. 
AK067176TTGGCCCATATConserved hypothetical protein. 
J013097D23TTGGCCCATATNONE 
J013097D23TTGGCCCATATNONE 
J065085J01TTGGCCCATATNONE 
J065085J01TTGGCCCATATNONE 
J065152L23TTGGCCCATATNONE 
J065152L23TTGGCCCATATNONE 
J065162F18TTGGCCCATATNONE 
J065162F18TTGGCCCATATNONE 
J075002K17TTGGCCCATATNONE 
J075002K17TTGGCCCATATNONE 
J075047D24TTGGCCCATATNONE 
J075047D24TTGGCCCATATNONE 
J075064A01TTGGCCCATATNONE 
J075064A01TTGGCCCATATNONE 
J075075C09TTGGCCCATATNONE 
J075075C09TTGGCCCATATNONE 
J075088M01TTGGCCCATATNONE 
J075088M01TTGGCCCATATNONE 
J075130K03TTGGCCCATATNONE 
J075130K03TTGGCCCATATNONE 
J075146K03TTGGCCCATATNONE 
J075146K03TTGGCCCATATNONE 
J090049F07TTGGCCCATATNONE 
J090049F07TTGGCCCATATNONE 
Os02g0762300AK106684CAGGCCCATAAProtein of unknown function UPF0021 family protein. 
J090060M09CAGGCCCATAANONE 
J100083E05CAGGCCCATAANONE 
Os02g0763000J065017L09ATATGGGCCAACGGCCNONE 
J065036A05ATATGGGCCAACGGCCNONE 
J065087C01ATATGGGCCAACGGCCNONE 
J065105A14ATATGGGCCAACGGCCNONE 
J065164J03ATATGGGCCAACGGCCNONE 
J065175J19ATATGGGCCAACGGCCNONE 
J065201H07ATATGGGCCAACGGCCProtein of unknown function Cys-rich family protein. 
J075032O12ATATGGGCCAACGGCCNONE 
J075085D24ATATGGGCCAACGGCCNONE 
J075197C17ATATGGGCCAACGGCCNONE 
J100032C19ATATGGGCCAACGGCCNONE 
Os02g0767900009-154-G01TTTTGGGCCCATAANONE 
009-154-G01TTTTGGGCCCATATNONE 
009-172-H09TTTTGGGCCCATAANONE 
009-172-H09TTTTGGGCCCATATNONE 
AK099885TTTTGGGCCCATAAGlutaredoxin 2 family protein. 
AK099885TTTTGGGCCCATATGlutaredoxin 2 family protein. 
Os02g0771200011-006-B07GCCGGCCCATAANONE 
AK066823GCCGGCCCATAAConserved hypothetical protein. 
AK071059GCCGGCCCATAANONE 
J013075K03GCCGGCCCATAANONE 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0777950J090078H24AAACGGCCCATAAConserved hypothetical protein. 
Os02g0810300AK059363CCAGGCCCATAASimilar to NBD-like protein. 
AK099203CCAGGCCCATAANONE 
Os02g0815200AK067252ATGGCCCATASimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK104489ATGGCCCATANONE 
Os02g0819700AK067374TAGGCCCATAZinc finger, Zim17-type family protein. 
AK099160TAGGCCCATANONE 
J100086K17TAGGCCCATANONE 
Os02g0820600AK066549TATGGGCTATGGGCCATConserved hypothetical protein. 
J013070F02TATGGGCTATGGGCCATNONE 
Os02g0820700006-025-E04ATGGCCCATAGCCCATANONE 
006-052-F06ATGGCCCATAGCCCATANONE 
006-082-A05ATGGCCCATAGCCCATANONE 
006-089-B06ATGGCCCATAGCCCATANONE 
AK060869ATGGCCCATAGCCCATASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365ATGGCCCATAGCCCATANONE 
AK103008ATGGCCCATAGCCCATANONE 
AK104724ATGGCCCATAGCCCATANONE 
J013049H21ATGGCCCATAGCCCATANONE 
J043027N22ATGGCCCATAGCCCATANONE 
J075031I15ATGGCCCATAGCCCATANONE 
J075132D23ATGGCCCATAGCCCATANONE 
Os02g0823800AK120318ACCGGCCCATATConserved hypothetical protein. 
J075055J16ACCGGCCCATATNONE 
Os02g0827900AK099911TGATGGGCCAGCGGCCCATACSimilar to Signal peptidase 18 subunit (Fragment). 
Os03g0104000AK063829TTATGGGCCTGSimilar to Centromere protein. 
Os03g0108600AK065776CAGGCCCATAADEAD/DEAH box helicase, N-terminal domain containing protein. 
J013038N14CAGGCCCATAANONE 
Os03g0117100005-014-F09TCAGGCCCATATNONE 
006-027-C07TCAGGCCCATATNONE 
006-036-G11TCAGGCCCATATNONE 
006-038-H10TCAGGCCCATATNONE 
006-044-D08TCAGGCCCATATNONE 
006-105-H12TCAGGCCCATATNONE 
009-190-G08TCAGGCCCATATNONE 
AK070213TCAGGCCCATATPeroxisomal biogenesis factor 11 family protein. 
AK104570TCAGGCCCATATNONE 
AK104706TCAGGCCCATATNONE 
J013055H24TCAGGCCCATATNONE 
J023044I05TCAGGCCCATATNONE 
J075111G05TCAGGCCCATATNONE 
J080002K23TCAGGCCCATATNONE 
J080002N12TCAGGCCCATATNONE 
J080004B01TCAGGCCCATATNONE 
J080007H19TCAGGCCCATATNONE 
J080008M18TCAGGCCCATATNONE 
J080011D18TCAGGCCCATATNONE 
J080012J01TCAGGCCCATATNONE 
J080018C19TCAGGCCCATATNONE 
J080022C20TCAGGCCCATATNONE 
J080022I05TCAGGCCCATATNONE 
J080022M12TCAGGCCCATATNONE 
J080023P03TCAGGCCCATATNONE 
J080025A05TCAGGCCCATATNONE 
J080029C02TCAGGCCCATATNONE 
J080036H08TCAGGCCCATATNONE 
J080039P12TCAGGCCCATATNONE 
J080040H05TCAGGCCCATATNONE 
J080045I23TCAGGCCCATATNONE 
J080057O04TCAGGCCCATATNONE 
J080059K18TCAGGCCCATATNONE 
J080061E04TCAGGCCCATATNONE 
J080062C20TCAGGCCCATATNONE 
J080062F10TCAGGCCCATATNONE 
J080062L05TCAGGCCCATATNONE 
J080068L06TCAGGCCCATATNONE 
J080069N09TCAGGCCCATATNONE 
J080071M14TCAGGCCCATATNONE 
J080072K17TCAGGCCCATATNONE 
J080080A09TCAGGCCCATATNONE 
J080086A18TCAGGCCCATATNONE 
J080088O14TCAGGCCCATATNONE 
J080089O04TCAGGCCCATATNONE 
J080092G21TCAGGCCCATATNONE 
J080094K09TCAGGCCCATATNONE 
Os03g0120300AK066854TTTCGGCCCATATProtein of unknown function DUF1084 family protein. 
AK104882TTTCGGCCCATATNONE 
J013075C10TTTCGGCCCATATNONE 
J090012B18TTTCGGCCCATATNONE 
J090087J08TTTCGGCCCATATNONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0128500AB037900TTATGGGCCTGANONE 
AK067991TTATGGGCCTGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04TTATGGGCCTGANONE 
J090032P09TTATGGGCCTGANONE 
Os03g0139000006-059-C06GTATGGGCCACNONE 
006-059-C06TTGGCCCATANONE 
009-055-F07GTATGGGCCACNONE 
009-055-F07TTGGCCCATANONE 
AK060973GTATGGGCCACConserved hypothetical protein. 
AK060973TTGGCCCATAConserved hypothetical protein. 
AK103850GTATGGGCCACNONE 
AK103850TTGGCCCATANONE 
Os03g0159700012-100-B09GTGACGTGTGGCCCATACNONE 
AK063559GTGACGTGTGGCCCATACProtein prenyltransferase domain containing protein. 
J065197I24GTGACGTGTGGCCCATACNONE 
J090089G20GTGACGTGTGGCCCATACNONE 
Os03g0181600AK067807TCCGGCCCATAASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TCCGGCCCATAANONE 
Os03g0192100AK064747TATGGGCCTTNONE 
AK105523TATGGGCCTTPeptidase S10, serine carboxypeptidase family protein. 
Os03g0232500AK110980TAGGCCCATATGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TAGGCCCATATNONE 
Os03g0232600AK068218TATGGGCCCACCTU box domain containing protein. 
J013114N10TATGGGCCCACCTNONE 
J013146E12TATGGGCCCACCTNONE 
J023034C23TATGGGCCCACCTNONE 
J033030J03TATGGGCCCACCTNONE 
J033050L03TATGGGCCCACCTNONE 
J033122E16TATGGGCCCACCTNONE 
J090018C20TATGGGCCCACCTNONE 
J090053P15TATGGGCCCACCTNONE 
J090096C17TATGGGCCCACCTNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0249900AK058379ATATGGGCCACConserved hypothetical protein. 
Os03g0271500AK068546TATGGGCCGGCNONE 
AK109239TATGGGCCGGCConserved hypothetical protein. 
J013157P04TATGGGCCGGCNONE 
J075041K23TATGGGCCGGCNONE 
Os03g0287900009-074-B07ATATGGGCCTCNONE 
014-027-E07ATATGGGCCTCNONE 
AK063663ATATGGGCCTCSimilar to Protein disulfide isomerase. 
J065009N21ATATGGGCCTCNONE 
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE 
J053029J05TTGGCCCATATAAGGCCCAACTNONE 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
J065024G23TTGGCCCATATAAGGCCCAACTNONE 
J065036F08TTGGCCCATATAAGGCCCAACTNONE 
J065066M11TTGGCCCATATAAGGCCCAACTNONE 
J065143G19TTGGCCCATATAAGGCCCAACTNONE 
Os03g0320900015-016-D07TAGGCCCATANONE 
AK106255TAGGCCCATAGuanylate kinase family protein. 
Os03g0331600009-025-C11TATGGGCCTCNONE 
AK063782TATGGGCCTCConserved hypothetical protein. 
Os03g0332700AK072820AAACGGCCCATAASimilar to ABC Transporter, ATP binding component. 
AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0337600AF119232AGGGCCCATAANONE 
AK070859AGGGCCCATAASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18AGGGCCCATAANONE 
J013147M17AGGGCCCATAANONE 
J065083M01AGGGCCCATAANONE 
J065199H24AGGGCCCATAANONE 
Os03g0344100009-166-F10TATGGGCCCGNONE 
AK061903TATGGGCCCGNONE 
AK065547TATGGGCCCGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24TATGGGCCCGNONE 
J033087C06TATGGGCCCGNONE 
J053073I09TATGGGCCCGNONE 
J065189D11TATGGGCCCGNONE 
J090032B15TATGGGCCCGNONE 
Os03g0346500009-180-F12GTATGGGCCATNONE 
AK063139GTATGGGCCATHypothetical protein. 
Os03g0363350Os03g0363350GTATGGGCCATGAGGCCCAACAProtein of unknown function DUF455 family protein. 
Os03g0364000J065042L07ATGGCCCATANONE 
J065061O16ATGGCCCATANONE 
J065075L02ATGGCCCATANONE 
J065138N02ATGGCCCATANONE 
J065209H20ATGGCCCATANONE 
J075019G03ATGGCCCATANONE 
J075086E23ATGGCCCATANONE 
J075094M12ATGGCCCATANONE 
J075139L07ATGGCCCATANONE 
J075162I16ATGGCCCATANONE 
J075199G20ATGGCCCATANONE 
Os03g0379500AK064760TAGGCCCATAASimilar to 40S ribosomal protein S9. 
J080024D11TAGGCCCATAANONE 
J080044J02TAGGCCCATAANONE 
J080050F01TAGGCCCATAANONE 
J080063D21TAGGCCCATAANONE 
J080063G04TAGGCCCATAANONE 
J080078E02TAGGCCCATAANONE 
Os03g0383100AK107106TCAGGCCCATAConserved hypothetical protein. 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0579000AK061586CCAGGCCCATATNONE 
AK072995CCAGGCCCATATPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0634000014-034-A03GTATGGGCCGGGACCCANONE 
AK063673GTATGGGCCGGGACCCASimilar to THA4. 
Os03g0656900AK066416ATATGGGCCGGTNusB/RsmB/TIM44 domain containing protein. 
J065157L23ATATGGGCCGGTNONE 
J065166P22ATATGGGCCGGTNONE 
Os03g0670700009-028-B03GCGGCCCATAANONE 
009-036-H12GCGGCCCATAANONE 
009-053-H05GCGGCCCATAANONE 
009-126-B02GCGGCCCATAANONE 
009-135-D07GCGGCCCATAANONE 
009-148-A03GCGGCCCATAANONE 
009-148-A12GCGGCCCATAANONE 
009-152-B02GCGGCCCATAANONE 
009-153-B06GCGGCCCATAANONE 
009-166-G05GCGGCCCATAANONE 
009-181-A09GCGGCCCATAANONE 
011-061-D07GCGGCCCATAANONE 
012-043-C04GCGGCCCATAANONE 
013-001-A02GCGGCCCATAANONE 
013-004-F05GCGGCCCATAANONE 
013-008-C08GCGGCCCATAANONE 
013-015-B09GCGGCCCATAANONE 
013-016-G05GCGGCCCATAANONE 
013-023-A06GCGGCCCATAANONE 
013-023-B06GCGGCCCATAANONE 
013-032-F09GCGGCCCATAANONE 
013-059-C07GCGGCCCATAANONE 
013-071-E09GCGGCCCATAANONE 
013-073-D06GCGGCCCATAANONE 
013-077-C02GCGGCCCATAANONE 
013-078-B12GCGGCCCATAANONE 
013-093-A01GCGGCCCATAANONE 
014-002-B12GCGGCCCATAANONE 
014-003-E08GCGGCCCATAANONE 
014-004-D06GCGGCCCATAANONE 
014-007-C11GCGGCCCATAANONE 
014-007-G10GCGGCCCATAANONE 
014-019-C04GCGGCCCATAANONE 
014-021-F05GCGGCCCATAANONE 
014-024-G06GCGGCCCATAANONE 
014-027-C07GCGGCCCATAANONE 
014-027-D03GCGGCCCATAANONE 
014-029-E07GCGGCCCATAANONE 
014-031-B04GCGGCCCATAANONE 
014-033-B05GCGGCCCATAANONE 
014-033-C03GCGGCCCATAANONE 
014-033-C12GCGGCCCATAANONE 
014-036-F01GCGGCCCATAANONE 
014-037-C04GCGGCCCATAANONE 
014-040-H02GCGGCCCATAANONE 
014-045-H04GCGGCCCATAANONE 
014-045-H06GCGGCCCATAANONE 
014-052-A08GCGGCCCATAANONE 
014-076-G01GCGGCCCATAANONE 
014-083-F04GCGGCCCATAANONE 
014-086-E01GCGGCCCATAANONE 
014-091-D02GCGGCCCATAANONE 
014-091-F05GCGGCCCATAANONE 
014-093-E10GCGGCCCATAANONE 
014-100-C10GCGGCCCATAANONE 
015-011-H02GCGGCCCATAANONE 
015-073-B03GCGGCCCATAANONE 
AF010579GCGGCCCATAANONE 
AK059164GCGGCCCATAASimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCGGCCCATAANONE 
AK119238GCGGCCCATAANONE 
AK119242GCGGCCCATAANONE 
J023037K17GCGGCCCATAANONE 
J033136F11GCGGCCCATAANONE 
J065008C13GCGGCCCATAANONE 
J065032K18GCGGCCCATAANONE 
J065043N10GCGGCCCATAANONE 
J065045E06GCGGCCCATAANONE 
J065046P21GCGGCCCATAANONE 
J065048J17GCGGCCCATAANONE 
J065053I23GCGGCCCATAANONE 
J065053P03GCGGCCCATAANONE 
J065054C13GCGGCCCATAANONE 
J065058I17GCGGCCCATAANONE 
J065061I12GCGGCCCATAANONE 
J065062E09GCGGCCCATAANONE 
J065063P04GCGGCCCATAANONE 
J065068J07GCGGCCCATAANONE 
J065076D02GCGGCCCATAANONE 
J065083O07GCGGCCCATAANONE 
J065090J02GCGGCCCATAANONE 
J065093N08GCGGCCCATAANONE 
J065097F02GCGGCCCATAANONE 
J065112H17GCGGCCCATAANONE 
J065121B01GCGGCCCATAANONE 
J065124F12GCGGCCCATAANONE 
J065130L03GCGGCCCATAANONE 
J065131K05GCGGCCCATAANONE 
J065132C06GCGGCCCATAANONE 
J065135J18GCGGCCCATAANONE 
J065138J22GCGGCCCATAANONE 
J065140G21GCGGCCCATAANONE 
J065161B19GCGGCCCATAANONE 
J065162F22GCGGCCCATAANONE 
J065162M09GCGGCCCATAANONE 
J065163D03GCGGCCCATAANONE 
J065163O21GCGGCCCATAANONE 
J065165H11GCGGCCCATAANONE 
J065165O16GCGGCCCATAANONE 
J065167N06GCGGCCCATAANONE 
J065168I08GCGGCCCATAANONE 
J065170A14GCGGCCCATAANONE 
J065170L03GCGGCCCATAANONE 
J065171C08GCGGCCCATAANONE 
J065173G11GCGGCCCATAANONE 
J065173M09GCGGCCCATAANONE 
J065176P07GCGGCCCATAANONE 
J065178K24GCGGCCCATAANONE 
J065185O12GCGGCCCATAANONE 
J065191E02GCGGCCCATAANONE 
J065204H10GCGGCCCATAANONE 
J075033C23GCGGCCCATAANONE 
J075041M21GCGGCCCATAANONE 
J075043F13GCGGCCCATAANONE 
J075044D02GCGGCCCATAANONE 
J075044J15GCGGCCCATAANONE 
J075048L07GCGGCCCATAANONE 
J075054G12GCGGCCCATAANONE 
J075055J10GCGGCCCATAANONE 
J075059F09GCGGCCCATAANONE 
J075066M23GCGGCCCATAANONE 
J075071O09GCGGCCCATAANONE 
J075085G23GCGGCCCATAANONE 
J075086B21GCGGCCCATAANONE 
J075087L18GCGGCCCATAANONE 
J075087L21GCGGCCCATAANONE 
J075087N14GCGGCCCATAANONE 
J075088O13GCGGCCCATAANONE 
J075089B06GCGGCCCATAANONE 
J075089E20GCGGCCCATAANONE 
J075090J01GCGGCCCATAANONE 
J075090L05GCGGCCCATAANONE 
J075091G05GCGGCCCATAANONE 
J075091N06GCGGCCCATAANONE 
J075093G08GCGGCCCATAANONE 
J075094C13GCGGCCCATAANONE 
J075095K01GCGGCCCATAANONE 
J075096C02GCGGCCCATAANONE 
J075097L16GCGGCCCATAANONE 
J075097O10GCGGCCCATAANONE 
J075098H24GCGGCCCATAANONE 
J075099H02GCGGCCCATAANONE 
J075099J11GCGGCCCATAANONE 
J075099L08GCGGCCCATAANONE 
J075109I11GCGGCCCATAANONE 
J075114F03GCGGCCCATAANONE 
J075121G07GCGGCCCATAANONE 
J075122D23GCGGCCCATAANONE 
J075132O07GCGGCCCATAANONE 
J075141L21GCGGCCCATAANONE 
J075142I08GCGGCCCATAANONE 
J075145A06GCGGCCCATAANONE 
J075147J15GCGGCCCATAANONE 
J075150B09GCGGCCCATAANONE 
J075151E07GCGGCCCATAANONE 
J075161M16GCGGCCCATAANONE 
J075190I16GCGGCCCATAANONE 
J075192L05GCGGCCCATAANONE 
J075192O03GCGGCCCATAANONE 
J075192O08GCGGCCCATAANONE 
J075193L12GCGGCCCATAANONE 
J080001M24GCGGCCCATAANONE 
J080004E20GCGGCCCATAANONE 
J080005K15GCGGCCCATAANONE 
J080005L05GCGGCCCATAANONE 
J080014P20GCGGCCCATAANONE 
J080029D12GCGGCCCATAANONE 
J080030H09GCGGCCCATAANONE 
J080039G05GCGGCCCATAANONE 
J080040E18GCGGCCCATAANONE 
J080041B02GCGGCCCATAANONE 
J080041E06GCGGCCCATAANONE 
J080041G05GCGGCCCATAANONE 
J080041G24GCGGCCCATAANONE 
J080041H07GCGGCCCATAANONE 
J080041K03GCGGCCCATAANONE 
J080047G01GCGGCCCATAANONE 
J080052E07GCGGCCCATAANONE 
J080053B15GCGGCCCATAANONE 
J080053N01GCGGCCCATAANONE 
J080054I01GCGGCCCATAANONE 
J080054N02GCGGCCCATAANONE 
J080063P03GCGGCCCATAANONE 
J080064E13GCGGCCCATAANONE 
J080064G13GCGGCCCATAANONE 
J080065F02GCGGCCCATAANONE 
J080065G03GCGGCCCATAANONE 
J080065K17GCGGCCCATAANONE 
J080067D06GCGGCCCATAANONE 
J080067H23GCGGCCCATAANONE 
J080067M15GCGGCCCATAANONE 
J080068B20GCGGCCCATAANONE 
J080068G24GCGGCCCATAANONE 
J080072K19GCGGCCCATAANONE 
J080076I24GCGGCCCATAANONE 
J080092F05GCGGCCCATAANONE 
J080092K14GCGGCCCATAANONE 
J080092N22GCGGCCCATAANONE 
J080093K02GCGGCCCATAANONE 
J080094C08GCGGCCCATAANONE 
J080094E09GCGGCCCATAANONE 
J080094E20GCGGCCCATAANONE 
J080094G08GCGGCCCATAANONE 
J080094H18GCGGCCCATAANONE 
J080094P22GCGGCCCATAANONE 
J080095J23GCGGCCCATAANONE 
J080096F14GCGGCCCATAANONE 
J080097A21GCGGCCCATAANONE 
J080097I07GCGGCCCATAANONE 
J080097J02GCGGCCCATAANONE 
J080097K01GCGGCCCATAANONE 
J080097K03GCGGCCCATAANONE 
J080305H18GCGGCCCATAANONE 
J080306G01GCGGCCCATAANONE 
J080306O08GCGGCCCATAANONE 
J080311I01GCGGCCCATAANONE 
J080315N24GCGGCCCATAANONE 
J090003K21GCGGCCCATAANONE 
J090008C20GCGGCCCATAANONE 
J090008K19GCGGCCCATAANONE 
J090008P13GCGGCCCATAANONE 
J090015H22GCGGCCCATAANONE 
J090016M01GCGGCCCATAANONE 
J090018E13GCGGCCCATAANONE 
J090018G03GCGGCCCATAANONE 
J090018L17GCGGCCCATAANONE 
J090019H11GCGGCCCATAANONE 
J090021B19GCGGCCCATAANONE 
J090021K02GCGGCCCATAANONE 
J090023H15GCGGCCCATAANONE 
J090034E03GCGGCCCATAANONE 
J090045D16GCGGCCCATAANONE 
J090045I06GCGGCCCATAANONE 
J090047L09GCGGCCCATAANONE 
J090048B05GCGGCCCATAANONE 
J090048D11GCGGCCCATAANONE 
J090048N11GCGGCCCATAANONE 
J090050F20GCGGCCCATAANONE 
J090052M20GCGGCCCATAANONE 
J090083H03GCGGCCCATAANONE 
J090084C12GCGGCCCATAANONE 
J090095B05GCGGCCCATAANONE 
J090095M18GCGGCCCATAANONE 
J100024I22GCGGCCCATAANONE 
J100024J12GCGGCCCATAANONE 
J100024J22GCGGCCCATAANONE 
J100025F07GCGGCCCATAANONE 
J100026B13GCGGCCCATAANONE 
J100027N03GCGGCCCATAANONE 
J100029F14GCGGCCCATAANONE 
J100029L20GCGGCCCATAANONE 
J100032C22GCGGCCCATAANONE 
J100032I08GCGGCCCATAANONE 
J100032O05GCGGCCCATAANONE 
J100033J24GCGGCCCATAANONE 
J100033L12GCGGCCCATAANONE 
J100034K06GCGGCCCATAANONE 
J100037D09GCGGCCCATAANONE 
J100038H02GCGGCCCATAANONE 
J100039A12GCGGCCCATAANONE 
J100039N12GCGGCCCATAANONE 
J100039O21GCGGCCCATAANONE 
J100040K05GCGGCCCATAANONE 
J100042A02GCGGCCCATAANONE 
J100042A17GCGGCCCATAANONE 
J100043C15GCGGCCCATAANONE 
J100044A17GCGGCCCATAANONE 
J100044E18GCGGCCCATAANONE 
J100044I11GCGGCCCATAANONE 
J100044J15GCGGCCCATAANONE 
J100045E23GCGGCCCATAANONE 
J100049B18GCGGCCCATAANONE 
J100050G04GCGGCCCATAANONE 
J100051D06GCGGCCCATAANONE 
J100051H20GCGGCCCATAANONE 
J100052J01GCGGCCCATAANONE 
J100052K07GCGGCCCATAANONE 
J100055I01GCGGCCCATAANONE 
J100057D02GCGGCCCATAANONE 
J100059G14GCGGCCCATAANONE 
J100059G21GCGGCCCATAANONE 
J100059H03GCGGCCCATAANONE 
J100059H15GCGGCCCATAANONE 
J100063E13GCGGCCCATAANONE 
J100063M02GCGGCCCATAANONE 
J100064B17GCGGCCCATAANONE 
J100064F11GCGGCCCATAANONE 
J100066G12GCGGCCCATAANONE 
J100066H09GCGGCCCATAANONE 
J100068B12GCGGCCCATAANONE 
J100068L16GCGGCCCATAANONE 
J100068M23GCGGCCCATAANONE 
J100069A02GCGGCCCATAANONE 
J100069D07GCGGCCCATAANONE 
J100069M13GCGGCCCATAANONE 
J100070C07GCGGCCCATAANONE 
J100070J11GCGGCCCATAANONE 
J100070L20GCGGCCCATAANONE 
J100071H10GCGGCCCATAANONE 
J100072L14GCGGCCCATAANONE 
J100072N12GCGGCCCATAANONE 
J100073A21GCGGCCCATAANONE 
J100074K17GCGGCCCATAANONE 
J100074M04GCGGCCCATAANONE 
J100075F11GCGGCCCATAANONE 
J100076E23GCGGCCCATAANONE 
J100076G03GCGGCCCATAANONE 
J100077K01GCGGCCCATAANONE 
J100077N23GCGGCCCATAANONE 
J100079H17GCGGCCCATAANONE 
J100081N01GCGGCCCATAANONE 
J100082E04GCGGCCCATAANONE 
J100082K11GCGGCCCATAANONE 
J100085H23GCGGCCCATAANONE 
J100086O18GCGGCCCATAANONE 
J100087F21GCGGCCCATAANONE 
J100088E02GCGGCCCATAANONE 
J100088F08GCGGCCCATAANONE 
J100088G24GCGGCCCATAANONE 
J100088K20GCGGCCCATAANONE 
J100089B19GCGGCCCATAANONE 
J100089K22GCGGCCCATAANONE 
J100089N22GCGGCCCATAANONE 
J100089O17GCGGCCCATAANONE 
J100090N05GCGGCCCATAANONE 
Os03g0725300011-085-E09GTATGGGCCAANONE 
011-085-E09TGCGGCCCATANONE 
AK063969GTATGGGCCAASimilar to Dbr1-prov protein. 
AK063969TGCGGCCCATASimilar to Dbr1-prov protein. 
AK073636GTATGGGCCAANONE 
AK073636TGCGGCCCATANONE 
J033050L15GTATGGGCCAANONE 
J033050L15TGCGGCCCATANONE 
J053082G03GTATGGGCCAANONE 
J053082G03TGCGGCCCATANONE 
Os03g0743200J065049G14GCGGCCCATAANONE 
J065158O18GCGGCCCATAANONE 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0746400AK063445TTGGCCCATATProtein prenyltransferase domain containing protein. 
AK070923TTGGCCCATATNONE 
J065008K24TTGGCCCATATNONE 
Os03g0755000AK068540ACCGGGCCCATACSimilar to Serine/threonine kinase (Fragment). 
Os03g0766000AK070596TTATGGGCCATNONE 
AK104743TTATGGGCCATNONE 
AK106079TTATGGGCCATNONE 
J013063M09TTATGGGCCATNONE 
J023056A03TTATGGGCCATNONE 
J043038L07TTATGGGCCATNONE 
J053067N16TTATGGGCCATNONE 
J053073G09TTATGGGCCATNONE 
J053075I19TTATGGGCCATNONE 
Os03g0784000AK067337TTATGGGCCAANONE 
AK100003TTATGGGCCAAFAD dependent oxidoreductase family protein. 
J013102O14TTATGGGCCAANONE 
J013135F18TTATGGGCCAANONE 
Os03g0786000AK061286TATGGGCCTCConserved hypothetical protein. 
AK073187TATGGGCCTCNONE 
Os03g0788200AK106623AAGGCCCATAE1 protein and Def2/Der2 allergen family protein. 
J065112K18AAGGCCCATANONE 
J065123A19AAGGCCCATANONE 
J065131C15AAGGCCCATANONE 
J065174D05AAGGCCCATANONE 
J075011P16AAGGCCCATANONE 
J075017N24AAGGCCCATANONE 
J075028P19AAGGCCCATANONE 
J075052I01AAGGCCCATANONE 
J075057H20AAGGCCCATANONE 
J075080F06AAGGCCCATANONE 
J075091A10AAGGCCCATANONE 
J075140L23AAGGCCCATANONE 
J075156J08AAGGCCCATANONE 
J075182D16AAGGCCCATANONE 
J075191O21AAGGCCCATANONE 
J090079E21AAGGCCCATANONE 
Os03g0795800AK102207TCCGGCCCATATProtein of unknown function UPF0005 family protein. 
J023014M02TCCGGCCCATATNONE 
J023026E12TCCGGCCCATATNONE 
J023036I07TCCGGCCCATATNONE 
J023079M08TCCGGCCCATATNONE 
J023129D24TCCGGCCCATATNONE 
J033087H03TCCGGCCCATATNONE 
J033115G02TCCGGCCCATATNONE 
J033122G06TCCGGCCCATATNONE 
J033150J15TCCGGCCCATATNONE 
J065064L16TCCGGCCCATATNONE 
J065065H20TCCGGCCCATATNONE 
J065096I18TCCGGCCCATATNONE 
J065114A10TCCGGCCCATATNONE 
J065164G10TCCGGCCCATATNONE 
J065178L20TCCGGCCCATATNONE 
J075071D20TCCGGCCCATATNONE 
Os03g0795900012-092-G05ATATGGGCCGGANONE 
015-043-D09ATATGGGCCGGANONE 
016-078-G11ATATGGGCCGGANONE 
AK068660ATATGGGCCGGASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14ATATGGGCCGGANONE 
J023001L04ATATGGGCCGGANONE 
J053032K11ATATGGGCCGGANONE 
J065059E10ATATGGGCCGGANONE 
J065095H19ATATGGGCCGGANONE 
J065181M06ATATGGGCCGGANONE 
J100047D11ATATGGGCCGGANONE 
J100068G04ATATGGGCCGGANONE 
Os03g0797000AK073440TCCGGCCCATATSimilar to Indole synthase. 
AK073440TCCGGCCCATATSimilar to Indole synthase. 
Os03g0797600006-034-B06ATATGGGCCTTNONE 
006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01ATATGGGCCTTNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08ATATGGGCCTTNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446ATATGGGCCTTSimilar to Helix-loop-helix protein homolog. 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388ATATGGGCCTTNONE 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412ATATGGGCCTTNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0811800AK063320ATATGGGCCCCARibosomal protein L36 family protein. 
J065094F18ATATGGGCCCCANONE 
J090029B04ATATGGGCCCCANONE 
Os03g0822100AK101094GGGCCGGCCCATATSimilar to Transposase (Fragment). 
J033024N05GGGCCGGCCCATATNONE 
Os03g0828100009-088-D04TTATGGGCCCTNONE 
009-125-F01TTATGGGCCCTNONE 
009-169-C06TTATGGGCCCTNONE 
AK059132TTATGGGCCCTNONE 
AK062799TTATGGGCCCTNONE 
AK099043TTATGGGCCCTSimilar to 50S ribosomal protein L18. 
J013146D01TTATGGGCCCTNONE 
J065057J16TTATGGGCCCTNONE 
Os03g0829000AK071107TTATGGGCCGTAFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTATGGGCCGTANONE 
AK121596TTATGGGCCGTANONE 
J065045C17TTATGGGCCGTANONE 
J065068E23TTATGGGCCGTANONE 
J065083N15TTATGGGCCGTANONE 
J065166P10TTATGGGCCGTANONE 
J065189B13TTATGGGCCGTANONE 
J090082J08TTATGGGCCGTANONE 
J100030P13TTATGGGCCGTANONE 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
009-174-G04ATATGGGCCCGGANONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
AK063101ATATGGGCCCGGAProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J065131H12ATATGGGCCCGGANONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCGGANONE 
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE 
006-069-B11CTGGCCCATATCGGCCCATGTNONE 
006-104-B10CTGGCCCATATCGGCCCATGTNONE 
AK059849CTGGCCCATATCGGCCCATGTNONE 
AK102872CTGGCCCATATCGGCCCATGTNONE 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
J033112B07CTGGCCCATATCGGCCCATGTNONE 
J053059J20CTGGCCCATATCGGCCCATGTNONE 
J065155F15CTGGCCCATATCGGCCCATGTNONE 
Os04g0399300AK105282ATATGGGCCCCACACSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
Os04g0407300AK101793ATGGCCCATACNONE 
AK121980ATGGCCCATACHypothetical protein. 
J033065K23ATGGCCCATACNONE 
J033108L11ATGGCCCATACNONE 
Os04g0412900AK073418ATATGGGCCCCACASec23/Sec24 trunk region domain containing protein. 
J033027C24ATATGGGCCCCACANONE 
J033044C16ATATGGGCCCCACANONE 
J090023G03ATATGGGCCCCACANONE 
J090082C21ATATGGGCCCCACANONE 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0475300AK066351TATTGGGCTTTGAGGCCCATAConserved hypothetical protein. 
J065138J21TATTGGGCTTTGAGGCCCATANONE 
Os04g0486400AJ535489TATGGGCCATNONE 
AK103296TATGGGCCATRML1 protein. 
J013045L03TATGGGCCATNONE 
J013045M03TATGGGCCATNONE 
J033034L24TATGGGCCATNONE 
J033125B02TATGGGCCATNONE 
J075001G08TATGGGCCATNONE 
J075011I16TATGGGCCATNONE 
J075033M08TATGGGCCATNONE 
J075044G01TATGGGCCATNONE 
J075047D04TATGGGCCATNONE 
J075061J09TATGGGCCATNONE 
J075085L07TATGGGCCATNONE 
J075087D20TATGGGCCATNONE 
J075117A04TATGGGCCATNONE 
J075134H06TATGGGCCATNONE 
J075184J12TATGGGCCATNONE 
Os04g0495800003-009-C11TATGGGCCCTNONE 
AK060753TATGGGCCCTNONE 
Os04g0528100009-090-G06TCCGGCCCATATNONE 
009-168-C11TCCGGCCCATATNONE 
AK065957TCCGGCCCATATConserved hypothetical protein. 
J013039G20TCCGGCCCATATNONE 
J013044D08TCCGGCCCATATNONE 
J065013L14TCCGGCCCATATNONE 
J065143H08TCCGGCCCATATNONE 
J065146C14TCCGGCCCATATNONE 
J065149K22TCCGGCCCATATNONE 
J065156B18TCCGGCCCATATNONE 
J065201A04TCCGGCCCATATNONE 
J065209A04TCCGGCCCATATNONE 
Os04g0531300016-006-E10GCCCGGCCCATATNONE 
AK072647GCCCGGCCCATATDihydrouridine synthase, DuS family protein. 
AK103911GCCCGGCCCATATNONE 
J013038P22GCCCGGCCCATATNONE 
J023130D01GCCCGGCCCATATNONE 
J033150P13GCCCGGCCCATATNONE 
J043026L14GCCCGGCCCATATNONE 
J065049A08GCCCGGCCCATATNONE 
J065215C17GCCCGGCCCATATNONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0577000AK073711CTGGCCCATATUbiquitin fusion degradation protein UFD1 family protein. 
AK119957CTGGCCCATATNONE 
J013127H04CTGGCCCATATNONE 
J033035G06CTGGCCCATATNONE 
J033061G23CTGGCCCATATNONE 
J033127L07CTGGCCCATATNONE 
J065015F17CTGGCCCATATNONE 
J065062G08CTGGCCCATATNONE 
J065132M07CTGGCCCATATNONE 
J065155C12CTGGCCCATATNONE 
J075055I08CTGGCCCATATNONE 
J075140D07CTGGCCCATATNONE 
J090055B21CTGGCCCATATNONE 
J100031D23CTGGCCCATATNONE 
Os04g0581300009-171-H01ATATGGGCCTCNONE 
009-171-H01ATGGCCCATAAGGCCCAACANONE 
AK063093ATATGGGCCTCSimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0584100012-063-E01CACGGCCCATAANONE 
AK105292CACGGCCCATAAConserved hypothetical protein. 
Os04g0602800AK100925TATGGGCCCACASimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0607200J065082C16TTATGGGCCTTNONE 
J065167I02TTATGGGCCTTNONE 
Os04g0610500006-115-C07TATGGGCCTCNONE 
AK066289TATGGGCCTCPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817TATGGGCCTCNONE 
J013096N09TATGGGCCTCNONE 
J023054I11TATGGGCCTCNONE 
J023121P20TATGGGCCTCNONE 
J053039O20TATGGGCCTCNONE 
J053071L20TATGGGCCTCNONE 
J053088H23TATGGGCCTCNONE 
J053096J03TATGGGCCTCNONE 
Os04g0661700AK066532GCGGCCCATAConserved hypothetical protein. 
J065083O18GCGGCCCATANONE 
Os04g0667600009-131-H09GTATGGGCCCTNONE 
009-200-A04GTATGGGCCCTNONE 
AK068657GTATGGGCCCTHeavy metal transport/detoxification protein domain containing protein. 
J065013M12GTATGGGCCCTNONE 
J065024H17GTATGGGCCCTNONE 
J065025P10GTATGGGCCCTNONE 
J065028I11GTATGGGCCCTNONE 
J065044K11GTATGGGCCCTNONE 
J065045B14GTATGGGCCCTNONE 
J065052B02GTATGGGCCCTNONE 
J065061F20GTATGGGCCCTNONE 
J065061K16GTATGGGCCCTNONE 
J065063E12GTATGGGCCCTNONE 
J065065E16GTATGGGCCCTNONE 
J065082M02GTATGGGCCCTNONE 
J065084O10GTATGGGCCCTNONE 
J065096H18GTATGGGCCCTNONE 
J065122F02GTATGGGCCCTNONE 
J065131F09GTATGGGCCCTNONE 
J065139P06GTATGGGCCCTNONE 
J065148L17GTATGGGCCCTNONE 
J065164D23GTATGGGCCCTNONE 
J065167M17GTATGGGCCCTNONE 
J065174B15GTATGGGCCCTNONE 
J065176G01GTATGGGCCCTNONE 
J065186K17GTATGGGCCCTNONE 
J065186N05GTATGGGCCCTNONE 
J065213N24GTATGGGCCCTNONE 
J075001P17GTATGGGCCCTNONE 
J075004A15GTATGGGCCCTNONE 
J075007B03GTATGGGCCCTNONE 
J075026D23GTATGGGCCCTNONE 
J075032D17GTATGGGCCCTNONE 
J075058C22GTATGGGCCCTNONE 
J075080L14GTATGGGCCCTNONE 
J075094K18GTATGGGCCCTNONE 
J075097K15GTATGGGCCCTNONE 
J075098E02GTATGGGCCCTNONE 
J075104D11GTATGGGCCCTNONE 
J075120L16GTATGGGCCCTNONE 
J075126A18GTATGGGCCCTNONE 
J075129M08GTATGGGCCCTNONE 
J075143N14GTATGGGCCCTNONE 
J075146D07GTATGGGCCCTNONE 
J075149L10GTATGGGCCCTNONE 
J075171F22GTATGGGCCCTNONE 
J090058C05GTATGGGCCCTNONE 
J100018N19GTATGGGCCCTNONE 
J100024K09GTATGGGCCCTNONE 
J100036F15GTATGGGCCCTNONE 
J100042A15GTATGGGCCCTNONE 
J100042P14GTATGGGCCCTNONE 
J100051N18GTATGGGCCCTNONE 
J100055K14GTATGGGCCCTNONE 
J100056F05GTATGGGCCCTNONE 
J100058L10GTATGGGCCCTNONE 
J100083J17GTATGGGCCCTNONE 
J100086N07GTATGGGCCCTNONE 
Os04g0670800AK073170TAGGCCCATATNONE 
Os04g0687300AK060617TGCGGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04TGCGGCCCATAANONE 
Os05g0101400009-126-G06ATATGGGCCCCNONE 
AK067481ATATGGGCCCCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10ATATGGGCCCCNONE 
J065186D05ATATGGGCCCCNONE 
J065193A14ATATGGGCCCCNONE 
J075082A02ATATGGGCCCCNONE 
J075100F11ATATGGGCCCCNONE 
J075111O16ATATGGGCCCCNONE 
J075172I24ATATGGGCCCCNONE 
Os05g0110100009-015-D08TGCGGCCCATATNONE 
009-023-C09TGCGGCCCATATNONE 
009-031-B11TGCGGCCCATATNONE 
009-034-C02TGCGGCCCATATNONE 
009-050-B08TGCGGCCCATATNONE 
009-065-D12TGCGGCCCATATNONE 
009-090-G08TGCGGCCCATATNONE 
009-111-H07TGCGGCCCATATNONE 
009-136-F12TGCGGCCCATATNONE 
009-138-E06TGCGGCCCATATNONE 
009-138-G12TGCGGCCCATATNONE 
009-141-D08TGCGGCCCATATNONE 
009-143-D01TGCGGCCCATATNONE 
009-179-D09TGCGGCCCATATNONE 
009-179-E03TGCGGCCCATATNONE 
009-196-A09TGCGGCCCATATNONE 
009-199-F04TGCGGCCCATATNONE 
013-021-E05TGCGGCCCATATNONE 
013-076-C04TGCGGCCCATATNONE 
013-096-F06TGCGGCCCATATNONE 
014-071-A05TGCGGCCCATATNONE 
014-077-F09TGCGGCCCATATNONE 
AK099779TGCGGCCCATATNONE 
AK121142TGCGGCCCATATConserved hypothetical protein. 
J013095A16TGCGGCCCATATNONE 
J013111A17TGCGGCCCATATNONE 
J013132G04TGCGGCCCATATNONE 
J023077M04TGCGGCCCATATNONE 
J065001B11TGCGGCCCATATNONE 
J065001E11TGCGGCCCATATNONE 
J065057G10TGCGGCCCATATNONE 
J065057L08TGCGGCCCATATNONE 
J065080E07TGCGGCCCATATNONE 
J065087K10TGCGGCCCATATNONE 
J065091M15TGCGGCCCATATNONE 
J065167A15TGCGGCCCATATNONE 
J075018F02TGCGGCCCATATNONE 
J075063F20TGCGGCCCATATNONE 
J075064F18TGCGGCCCATATNONE 
J075066N19TGCGGCCCATATNONE 
J075073I02TGCGGCCCATATNONE 
J075080P17TGCGGCCCATATNONE 
J075081F11TGCGGCCCATATNONE 
J075085E03TGCGGCCCATATNONE 
J075101G18TGCGGCCCATATNONE 
J075149N08TGCGGCCCATATNONE 
J075158I21TGCGGCCCATATNONE 
J075161M20TGCGGCCCATATNONE 
J075190F12TGCGGCCCATATNONE 
J075194K16TGCGGCCCATATNONE 
J080001E08TGCGGCCCATATNONE 
J080001F21TGCGGCCCATATNONE 
J080001H19TGCGGCCCATATNONE 
J080001O15TGCGGCCCATATNONE 
J080005I22TGCGGCCCATATNONE 
J080006K23TGCGGCCCATATNONE 
J080014D20TGCGGCCCATATNONE 
J080014I05TGCGGCCCATATNONE 
J080014K21TGCGGCCCATATNONE 
J080017I24TGCGGCCCATATNONE 
J080017K11TGCGGCCCATATNONE 
J080018F11TGCGGCCCATATNONE 
J080022L18TGCGGCCCATATNONE 
J080024N23TGCGGCCCATATNONE 
J080027J23TGCGGCCCATATNONE 
J080029B14TGCGGCCCATATNONE 
J080032F14TGCGGCCCATATNONE 
J080032K19TGCGGCCCATATNONE 
J080032O21TGCGGCCCATATNONE 
J080033P17TGCGGCCCATATNONE 
J080034I06TGCGGCCCATATNONE 
J080039F24TGCGGCCCATATNONE 
J080040O13TGCGGCCCATATNONE 
J080042B02TGCGGCCCATATNONE 
J080043E12TGCGGCCCATATNONE 
J080043J15TGCGGCCCATATNONE 
J080043N09TGCGGCCCATATNONE 
J080052J08TGCGGCCCATATNONE 
J080053K01TGCGGCCCATATNONE 
J080053K19TGCGGCCCATATNONE 
J080055J09TGCGGCCCATATNONE 
J080058D07TGCGGCCCATATNONE 
J080062F11TGCGGCCCATATNONE 
J080063J24TGCGGCCCATATNONE 
J080066H04TGCGGCCCATATNONE 
J080066I09TGCGGCCCATATNONE 
J080067B02TGCGGCCCATATNONE 
J080067N09TGCGGCCCATATNONE 
J080068D22TGCGGCCCATATNONE 
J080068K13TGCGGCCCATATNONE 
J080069N19TGCGGCCCATATNONE 
J080070D07TGCGGCCCATATNONE 
J080070E05TGCGGCCCATATNONE 
J080071G04TGCGGCCCATATNONE 
J080077G05TGCGGCCCATATNONE 
J080077O06TGCGGCCCATATNONE 
J080085F05TGCGGCCCATATNONE 
J080086E07TGCGGCCCATATNONE 
J080089G16TGCGGCCCATATNONE 
J080092K15TGCGGCCCATATNONE 
J080094A08TGCGGCCCATATNONE 
J080097A09TGCGGCCCATATNONE 
J080097J07TGCGGCCCATATNONE 
J090027N01TGCGGCCCATATNONE 
J090081J05TGCGGCCCATATNONE 
Os05g0120800AK066865AAACGGCCCATATConserved hypothetical protein. 
AK066865ATATGGGCCGCAConserved hypothetical protein. 
AK066865ATATGGGCCGCAConserved hypothetical protein. 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0129900AK060436TAGGCCCATATTetratricopeptide-like helical domain containing protein. 
AK102515TAGGCCCATATNONE 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0144800AK099724ATGGCCCATAASimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0176600009-151-A09TTATGGGCCGAANONE 
AK071760TTATGGGCCGAAConserved hypothetical protein. 
J023110C14TTATGGGCCGAANONE 
J065116G18TTATGGGCCGAANONE 
J065131I04TTATGGGCCGAANONE 
J065163H12TTATGGGCCGAANONE 
J075088L08TTATGGGCCGAANONE 
J075165F17TTATGGGCCGAANONE 
Os05g0177100AK064652CCAGGCCCATAAConserved hypothetical protein. 
Os05g0198700Os05g0198700ATATGGGCCCTREX1 DNA Repair family protein. 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0244600009-176-H11TTATGGGCCCAAATGAAGCCCACNONE 
AK073979TTATGGGCCCAAATGAAGCCCACNucleic acid-binding, OB-fold domain containing protein. 
J065085L13TTATGGGCCCAAATGAAGCCCACNONE 
J065086F22TTATGGGCCCAAATGAAGCCCACNONE 
J065124H03TTATGGGCCCAAATGAAGCCCACNONE 
J065170C22TTATGGGCCCAAATGAAGCCCACNONE 
J065197K01TTATGGGCCCAAATGAAGCCCACNONE 
J075110M09TTATGGGCCCAAATGAAGCCCACNONE 
J090074F17TTATGGGCCCAAATGAAGCCCACNONE 
J100071O17TTATGGGCCCAAATGAAGCCCACNONE 
Os05g0304200009-059-H05CTCGGCCCATAANONE 
AK099372CTCGGCCCATAANONE 
AK112073CTCGGCCCATAAPAP fibrillin family protein. 
Os05g0437800015-045-B10ATATGGGCCGAGNONE 
015-045-B10TACGGCCCATATNONE 
AK106328ATATGGGCCGAGConserved hypothetical protein. 
AK106328TACGGCCCATATConserved hypothetical protein. 
Os05g0443800AK106590TCAGGCCCATATSimilar to Plastid division protein ftsZ1 precursor. 
Os05g0456000AK058420TATGGGCCGCMitochondrial glycoprotein family protein. 
AK102036TATGGGCCGCNONE 
J065066F02TATGGGCCGCNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0481000AK059369GAGGCCCATAAGCN5-related N-acetyltransferase domain containing protein. 
AK068619GAGGCCCATAANONE 
Os05g0488900AK071883CCCGGCCCATACSimilar to Cytochrome b5 reductase. 
AK073699CCCGGCCCATACNONE 
AK105459CCCGGCCCATACNONE 
J080009C06CCCGGCCCATACNONE 
J080021N09CCCGGCCCATACNONE 
J080041K24CCCGGCCCATACNONE 
J080058H15CCCGGCCCATACNONE 
J080064P06CCCGGCCCATACNONE 
J080077B16CCCGGCCCATACNONE 
Os05g0494200006-042-H12GGGCCGCAGGCCCATANONE 
009-020-F06GGGCCGCAGGCCCATANONE 
009-069-C06GGGCCGCAGGCCCATANONE 
009-118-B01GGGCCGCAGGCCCATANONE 
AK059563GGGCCGCAGGCCCATANONE 
AK061025GGGCCGCAGGCCCATANONE 
J043031L14GGGCCGCAGGCCCATANONE 
J05595GGGCCGCAGGCCCATASimilar to Cysteine proteinase inhibitor-II (Oryzacystatin-II). 
J075068F23GGGCCGCAGGCCCATANONE 
Os05g0502800016-060-H05CAAGGCCCATAANONE 
AK064242CAAGGCCCATAANONE 
AK065486CAAGGCCCATAANAF1 domain containing protein. 
Os05g0519400AK072976GAGGCCCATAASimilar to N-ethylmaleimide sensitive factor NSF (Fragment). 
Os05g0535700009-067-F01CCACTGACATATGGGCCCGNONE 
AK061590CCACTGACATATGGGCCCGNONE 
AK062545CCACTGACATATGGGCCCGConserved hypothetical protein. 
Os05g0540800AK060731TAGGCCCATACNONE 
AK071090TAGGCCCATACHomeodomain-like containing protein. 
J013095F03TAGGCCCATACNONE 
J023079C11TAGGCCCATACNONE 
J033080E08TAGGCCCATACNONE 
Os05g0543800AK072185CCCGGGCCCATATConserved hypothetical protein. 
Os05g0548100AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0552900AK102095TAGGCCCATATMAP65/ASE1 family protein. 
Os05g0553700006-100-D08TCAGGCCCATATNONE 
AK099747TCAGGCCCATATNONE 
AK101606TCAGGCCCATATNONE 
AK103396TCAGGCCCATATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TCAGGCCCATATNONE 
J090086G01TCAGGCCCATATNONE 
Os05g0565200004-015-E06ATATGGGCCAGNONE 
AK067090ATATGGGCCAGSimilar to Urease accessory protein G. 
AK104200ATATGGGCCAGNONE 
AK104368ATATGGGCCAGNONE 
Os05g0567500AK073046TTATGGGCCCAGATCACGGCCCGNONE 
AK121133TTATGGGCCCAGATCACGGCCCGDNA glycosylase family protein. 
J023075P20TTATGGGCCCAGATCACGGCCCGNONE 
Os05g0568600009-024-B09TTATGGGCCGTANONE 
AK063781TTATGGGCCGTAProtein of unknown function DUF1645 family protein. 
J080049H14TTATGGGCCGTANONE 
J080062M08TTATGGGCCGTANONE 
J080064I07TTATGGGCCGTANONE 
J080068A12TTATGGGCCGTANONE 
J080086J10TTATGGGCCGTANONE 
Os05g0571300AK072262TTGGCCCATCTGGCCCATAConserved hypothetical protein. 
AK109853TTGGCCCATCTGGCCCATANONE 
AK111014TTGGCCCATCTGGCCCATANONE 
Os05g0571400009-019-B04TTATGGGCCGANONE 
009-043-H02TTATGGGCCGANONE 
AK062369TTATGGGCCGAConserved hypothetical protein. 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os05g0577900016-028-C02CTGGCCCATANONE 
AK064201CTGGCCCATAConserved hypothetical protein. 
Os05g0578000AK065040TATGGGCCAGSimilar to PEX14 protein. 
J013001H17TATGGGCCAGNONE 
J013036A06TATGGGCCAGNONE 
J033122K08TATGGGCCAGNONE 
Os05g0587400AK102121GACGGCCCATAAPrefoldin domain containing protein. 
J033084N12GACGGCCCATAANONE 
Os05g0588200AK109323TTGGCCCATAARuvA domain 2-like containing protein. 
Os05g0594800AK058332GGGCTTTTATATGGGCCATAdhesion regulating molecule family protein. 
AK068013GGGCTTTTATATGGGCCATNONE 
J013129L24GGGCTTTTATATGGGCCATNONE 
Os06g0113600016-067-E03TTATGGGCCCAACTNONE 
AK062095TTATGGGCCCAACTNONE 
AK101235TTATGGGCCCAACTCyclin-like F-box domain containing protein. 
AK122025TTATGGGCCCAACTNONE 
J013022O19TTATGGGCCCAACTNONE 
J023045P05TTATGGGCCCAACTNONE 
J033031K01TTATGGGCCCAACTNONE 
J033034I09TTATGGGCCCAACTNONE 
J033041O04TTATGGGCCCAACTNONE 
J033071K03TTATGGGCCCAACTNONE 
J033075K16TTATGGGCCCAACTNONE 
J033097M01TTATGGGCCCAACTNONE 
J033099M22TTATGGGCCCAACTNONE 
J033108N15TTATGGGCCCAACTNONE 
J033121D18TTATGGGCCCAACTNONE 
J033125O06TTATGGGCCCAACTNONE 
J033139M16TTATGGGCCCAACTNONE 
J033145P18TTATGGGCCCAACTNONE 
J033149D05TTATGGGCCCAACTNONE 
Os06g0134300AK071534TCTGGGCCCATAAConserved hypothetical protein. 
J023106E03TCTGGGCCCATAANONE 
J075172D02TCTGGGCCCATAANONE 
J100047B13TCTGGGCCCATAANONE 
Os06g0147600AK107817TTATGGGCCGTAConserved hypothetical protein. 
Os06g0192500AK067746ATGGCCCATATATP-dependent helicase, DEAH-box family protein. 
AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06ATGGCCCATATNONE 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08ATGGCCCATATNONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03ATGGCCCATATNONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0220800AK059876GTATGGGCCAANONE 
AY739306GTATGGGCCAAThioredoxin domain 2 containing protein. 
J075093C09GTATGGGCCAANONE 
J100026J18GTATGGGCCAANONE 
J100041O16GTATGGGCCAANONE 
J100089K16GTATGGGCCAANONE 
Os06g0227200AK066970AAGGCCCATAAConserved hypothetical protein. 
AK073517AAGGCCCATAANONE 
J013088F13AAGGCCCATAANONE 
J013089B21AAGGCCCATAANONE 
J013109D18AAGGCCCATAANONE 
J023138G01AAGGCCCATAANONE 
J033040I03AAGGCCCATAANONE 
J033042L14AAGGCCCATAANONE 
J065207L20AAGGCCCATAANONE 
J090019A12AAGGCCCATAANONE 
J090053M23AAGGCCCATAANONE 
Os06g0246500AK105105TTTCGGCCCATASimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0251000J033111L12TCAGGCCCATAANONE 
J043001C08TCAGGCCCATAAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0264700J100028B14TATGGGCCGAAcylphosphatase domain containing protein. 
Os06g0275500AK111743TAGGCCCATATSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0298500AK108252GTATGGGCCTAConserved hypothetical protein. 
J065144C04GTATGGGCCTANONE 
J075054P09GTATGGGCCTANONE 
J075165A13GTATGGGCCTANONE 
J075172E10GTATGGGCCTANONE 
Os06g0555500016-056-B08TAGGCCCATAANONE 
AK102375TAGGCCCATAANONE 
AK106546TAGGCCCATAAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08TAGGCCCATAANONE 
J033091P04TAGGCCCATAANONE 
J090082P16TAGGCCCATAANONE 
Os06g0573700015-015-F02CCAGGCCCATATNONE 
015-015-F02TTATGGGCCCATCCANONE 
AK106254CCAGGCCCATATConserved hypothetical protein. 
AK106254TTATGGGCCCATCCAConserved hypothetical protein. 
J065172G24CCAGGCCCATATNONE 
J065172G24TTATGGGCCCATCCANONE 
Os06g0583500J013034M04TTGGCCCATGAGGCCCATANONE 
J013169I02TTGGCCCATGAGGCCCATANONE 
J023024B09TTGGCCCATGAGGCCCATANONE 
J023132L02TTGGCCCATGAGGCCCATANONE 
J033026C23TTGGCCCATGAGGCCCATANONE 
J033094E23TTGGCCCATGAGGCCCATANONE 
J033101D23TTGGCCCATGAGGCCCATANONE 
J033125B15TTGGCCCATGAGGCCCATANONE 
J033144I11TTGGCCCATGAGGCCCATANONE 
J033145E13TTGGCCCATGAGGCCCATANONE 
J033145I11TTGGCCCATGAGGCCCATANONE 
J065022M23TTGGCCCATGAGGCCCATANONE 
J065043I24TTGGCCCATGAGGCCCATANONE 
J065053G06TTGGCCCATGAGGCCCATANONE 
J065088K03TTGGCCCATGAGGCCCATANONE 
J065121L09TTGGCCCATGAGGCCCATANONE 
J065143M08TTGGCCCATGAGGCCCATANONE 
J065146H02TTGGCCCATGAGGCCCATANONE 
J065206M03TTGGCCCATGAGGCCCATANONE 
J075004L13TTGGCCCATGAGGCCCATANONE 
J075005L17TTGGCCCATGAGGCCCATANONE 
J075007G18TTGGCCCATGAGGCCCATANONE 
J075027E20TTGGCCCATGAGGCCCATANONE 
J075029A19TTGGCCCATGAGGCCCATANONE 
J075041C15TTGGCCCATGAGGCCCATANONE 
J075046M05TTGGCCCATGAGGCCCATANONE 
J075066P21TTGGCCCATGAGGCCCATANONE 
J075069E07TTGGCCCATGAGGCCCATANONE 
J075107P21TTGGCCCATGAGGCCCATANONE 
J075123F03TTGGCCCATGAGGCCCATANONE 
J075124E07TTGGCCCATGAGGCCCATANONE 
J075140J22TTGGCCCATGAGGCCCATANONE 
J075160N03TTGGCCCATGAGGCCCATANONE 
Os06g0607800012-010-G03ATATGGGCCTANONE 
AB070254ATATGGGCCTANONE 
AK063158ATATGGGCCTASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695ATATGGGCCTANONE 
J013074G13ATATGGGCCTANONE 
J090015C16ATATGGGCCTANONE 
J090069H10ATATGGGCCTANONE 
Os06g0646600AB061818AGGGCCCATATKNOX family class 2 homeodomain protein. 
AB061818ATATGGGCCCATTAKNOX family class 2 homeodomain protein. 
J023088C09AGGGCCCATATNONE 
J023088C09ATATGGGCCCATTANONE 
J065162G03AGGGCCCATATNONE 
J065162G03ATATGGGCCCATTANONE 
Os06g0673500J100018J12TATGGGCCCAGANONE 
J100072F13TATGGGCCCAGASimilar to Ubiquitin. 
Os06g0693000AK064280CAAGGCCCATATProtein kinase-like domain containing protein. 
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein. 
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os06g0715400012-007-C01GAGGCCCAAGGCCCATACNONE 
012-038-G03GAGGCCCAAGGCCCATACNONE 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
AK073963GAGGCCCAAGGCCCATACNONE 
J023085J06GAGGCCCAAGGCCCATACNONE 
J033073I09GAGGCCCAAGGCCCATACNONE 
J080316N15GAGGCCCAAGGCCCATACNONE 
J090062N15GAGGCCCAAGGCCCATACNONE 
Os07g0105300AK107419CACGGCCCATAConserved hypothetical protein. 
AK109521CACGGCCCATANONE 
Os07g0122300015-004-G08ATATGGGCCGCANONE 
AK103212ATATGGGCCGCANONE 
AK119295ATATGGGCCGCAProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09ATATGGGCCGCANONE 
J090007P13ATATGGGCCGCANONE 
Os07g0124500012-092-F01ATGGCCCATATNONE 
AK070529ATGGCCCATATSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000ATGGCCCATATNONE 
J090007O11ATGGCCCATATNONE 
J090010E02ATGGCCCATATNONE 
J090078C04ATGGCCCATATNONE 
Os07g0180900006-055-B11ATATGGGCCAANONE 
006-103-F09ATATGGGCCAANONE 
011-009-E03ATATGGGCCAANONE 
011-035-H08ATATGGGCCAANONE 
014-043-F08ATATGGGCCAANONE 
AK060711ATATGGGCCAARibosomal protein L4/L1e family protein. 
AK060963ATATGGGCCAANONE 
AK104447ATATGGGCCAANONE 
AK104504ATATGGGCCAANONE 
AK104629ATATGGGCCAANONE 
J023003P15ATATGGGCCAANONE 
J023075H14ATATGGGCCAANONE 
J033101N17ATATGGGCCAANONE 
J033132M11ATATGGGCCAANONE 
J065081C24ATATGGGCCAANONE 
J080004L10ATATGGGCCAANONE 
J080009H21ATATGGGCCAANONE 
J080013F01ATATGGGCCAANONE 
J080022K24ATATGGGCCAANONE 
J080023C22ATATGGGCCAANONE 
J080024M16ATATGGGCCAANONE 
J080026K06ATATGGGCCAANONE 
J080030J23ATATGGGCCAANONE 
J080030L05ATATGGGCCAANONE 
J080031G03ATATGGGCCAANONE 
J080033C03ATATGGGCCAANONE 
J080033D02ATATGGGCCAANONE 
J080035A11ATATGGGCCAANONE 
J080035A14ATATGGGCCAANONE 
J080039E08ATATGGGCCAANONE 
J080040L15ATATGGGCCAANONE 
J080040M03ATATGGGCCAANONE 
J080041L21ATATGGGCCAANONE 
J080043E09ATATGGGCCAANONE 
J080048B14ATATGGGCCAANONE 
J080048O09ATATGGGCCAANONE 
J080051H01ATATGGGCCAANONE 
J080052H06ATATGGGCCAANONE 
J080065K05ATATGGGCCAANONE 
J080066D10ATATGGGCCAANONE 
J080066E23ATATGGGCCAANONE 
J080069F10ATATGGGCCAANONE 
J080074M06ATATGGGCCAANONE 
J080075D13ATATGGGCCAANONE 
J080076G02ATATGGGCCAANONE 
J080082G15ATATGGGCCAANONE 
J080082K06ATATGGGCCAANONE 
J080082P12ATATGGGCCAANONE 
J080085F01ATATGGGCCAANONE 
J080090H22ATATGGGCCAANONE 
J080092D07ATATGGGCCAANONE 
J080094M03ATATGGGCCAANONE 
J080094O10ATATGGGCCAANONE 
J090008I06ATATGGGCCAANONE 
J100058N20ATATGGGCCAANONE 
J100060M07ATATGGGCCAANONE 
J100062M08ATATGGGCCAANONE 
J100064L07ATATGGGCCAANONE 
J100073H16ATATGGGCCAANONE 
J100074C10ATATGGGCCAANONE 
J100075N06ATATGGGCCAANONE 
J100087P11ATATGGGCCAANONE 
J100088B13ATATGGGCCAANONE 
J100088J16ATATGGGCCAANONE 
J100088L17ATATGGGCCAANONE 
J100088O12ATATGGGCCAANONE 
Os07g0185700012-040-A11GCCCGGCCCATATNONE 
AK070572GCCCGGCCCATATConserved hypothetical protein. 
J065116D10GCCCGGCCCATATNONE 
J065122F20GCCCGGCCCATATNONE 
Os07g0188700011-058-D09ATATGGGCCTANONE 
AK063957ATATGGGCCTANONE 
AK073755ATATGGGCCTASimilar to EXO. 
AK107609ATATGGGCCTANONE 
J033066N03ATATGGGCCTANONE 
Os07g0213400003-104-B01TATGGGCCGGANONE 
AK062273TATGGGCCGGAConserved hypothetical protein. 
J065122P17TATGGGCCGGANONE 
J065160A01TATGGGCCGGANONE 
J090065M11TATGGGCCGGANONE 
Os07g0418100Os07g0418100GTATGGGCCCATGTProtein of unknown function DUF889, eukaryote family protein. 
Os07g0423000AK109714GCCGGCCCATATMitochodrial transcription termination factor-related family protein. 
J065007I23GCCGGCCCATATNONE 
Os07g0435100AB037153TTATGGGCCCACANONE 
AK061383TTATGGGCCCACASimilar to 26S proteasome subunit RPN12. 
AK061408TTATGGGCCCACANONE 
AK101316TTATGGGCCCACANONE 
J023133D07TTATGGGCCCACANONE 
J023136B17TTATGGGCCCACANONE 
J033065M08TTATGGGCCCACANONE 
J033070F05TTATGGGCCCACANONE 
J033070L20TTATGGGCCCACANONE 
J033108J15TTATGGGCCCACANONE 
J053080M19TTATGGGCCCACANONE 
J053091B15TTATGGGCCCACANONE 
J065067J03TTATGGGCCCACANONE 
J065102C02TTATGGGCCCACANONE 
J065135H09TTATGGGCCCACANONE 
J080302K03TTATGGGCCCACANONE 
J090059J11TTATGGGCCCACANONE 
J090074G14TTATGGGCCCACANONE 
J100025F20TTATGGGCCCACANONE 
J100028L08TTATGGGCCCACANONE 
J100049L14TTATGGGCCCACANONE 
J100054O07TTATGGGCCCACANONE 
Os07g0450000009-033-A08TTCGGCCCATANONE 
AK063789TTCGGCCCATANONE 
AK121702TTCGGCCCATASimilar to 60S ribosomal protein L44. 
J033073H17TTCGGCCCATANONE 
J065006A02TTCGGCCCATANONE 
J065009C05TTCGGCCCATANONE 
J065028M04TTCGGCCCATANONE 
J065070D07TTCGGCCCATANONE 
J065072H17TTCGGCCCATANONE 
J065114J23TTCGGCCCATANONE 
J065127A02TTCGGCCCATANONE 
J065146L07TTCGGCCCATANONE 
J065213H17TTCGGCCCATANONE 
J065214B07TTCGGCCCATANONE 
J100045B16TTCGGCCCATANONE 
Os07g0513200015-004-B02TATGGGCCACNONE 
AK101410TATGGGCCACNONE 
AK106227TATGGGCCACNONE 
AK119451TATGGGCCACProtein prenyltransferase domain containing protein. 
Os07g0529600006-066-F05GAGGCCCATACNONE 
009-049-D10GAGGCCCATACNONE 
009-180-A06GAGGCCCATACNONE 
013-001-E04GAGGCCCATACNONE 
013-011-G03GAGGCCCATACNONE 
013-015-D04GAGGCCCATACNONE 
013-016-B02GAGGCCCATACNONE 
013-021-B11GAGGCCCATACNONE 
013-021-F07GAGGCCCATACNONE 
013-022-B02GAGGCCCATACNONE 
013-029-D10GAGGCCCATACNONE 
013-029-E04GAGGCCCATACNONE 
013-032-A07GAGGCCCATACNONE 
013-035-D07GAGGCCCATACNONE 
013-036-B03GAGGCCCATACNONE 
013-036-B10GAGGCCCATACNONE 
013-037-F08GAGGCCCATACNONE 
013-040-B02GAGGCCCATACNONE 
013-040-B10GAGGCCCATACNONE 
013-041-D07GAGGCCCATACNONE 
013-044-H10GAGGCCCATACNONE 
013-046-C06GAGGCCCATACNONE 
013-047-E03GAGGCCCATACNONE 
013-051-E06GAGGCCCATACNONE 
013-055-B07GAGGCCCATACNONE 
013-055-H04GAGGCCCATACNONE 
013-057-G06GAGGCCCATACNONE 
013-060-E04GAGGCCCATACNONE 
013-062-C07GAGGCCCATACNONE 
013-064-B11GAGGCCCATACNONE 
013-065-A09GAGGCCCATACNONE 
013-065-H03GAGGCCCATACNONE 
013-066-C07GAGGCCCATACNONE 
013-069-B03GAGGCCCATACNONE 
013-070-B08GAGGCCCATACNONE 
013-074-A03GAGGCCCATACNONE 
013-082-B08GAGGCCCATACNONE 
013-083-C10GAGGCCCATACNONE 
013-088-H12GAGGCCCATACNONE 
013-089-A10GAGGCCCATACNONE 
013-089-H06GAGGCCCATACNONE 
013-091-B09GAGGCCCATACNONE 
013-095-D09GAGGCCCATACNONE 
013-099-D03GAGGCCCATACNONE 
014-008-H04GAGGCCCATACNONE 
014-015-D12GAGGCCCATACNONE 
014-017-H12GAGGCCCATACNONE 
014-040-C05GAGGCCCATACNONE 
014-045-D07GAGGCCCATACNONE 
014-053-B03GAGGCCCATACNONE 
014-073-B05GAGGCCCATACNONE 
014-098-F10GAGGCCCATACNONE 
AB110170GAGGCCCATACNONE 
AK064916GAGGCCCATACNONE 
AK099918GAGGCCCATACSimilar to Thiazole biosynthetic enzyme 1-1, chloroplast precursor. 
J013000M17GAGGCCCATACNONE 
J013039J16GAGGCCCATACNONE 
J013055B12GAGGCCCATACNONE 
J013059A13GAGGCCCATACNONE 
J013060H05GAGGCCCATACNONE 
J013067A05GAGGCCCATACNONE 
J013071H11GAGGCCCATACNONE 
J013075I24GAGGCCCATACNONE 
J013102B09GAGGCCCATACNONE 
J013123E11GAGGCCCATACNONE 
J013123I22GAGGCCCATACNONE 
J013123L17GAGGCCCATACNONE 
J013156A11GAGGCCCATACNONE 
J013158K17GAGGCCCATACNONE 
J013160E19GAGGCCCATACNONE 
J023022F22GAGGCCCATACNONE 
J023045D15GAGGCCCATACNONE 
J023063E21GAGGCCCATACNONE 
J023078H19GAGGCCCATACNONE 
J023107E18GAGGCCCATACNONE 
J023107O16GAGGCCCATACNONE 
J023108B07GAGGCCCATACNONE 
J023113M14GAGGCCCATACNONE 
J023122K02GAGGCCCATACNONE 
J023134I12GAGGCCCATACNONE 
J033024O07GAGGCCCATACNONE 
J033045E09GAGGCCCATACNONE 
J033050O12GAGGCCCATACNONE 
J033052B16GAGGCCCATACNONE 
J033052F10GAGGCCCATACNONE 
J033052L07GAGGCCCATACNONE 
J033055D16GAGGCCCATACNONE 
J033093C13GAGGCCCATACNONE 
J033107I04GAGGCCCATACNONE 
J033122D23GAGGCCCATACNONE 
J043029H01GAGGCCCATACNONE 
J053043E04GAGGCCCATACNONE 
J053059G17GAGGCCCATACNONE 
J053069L11GAGGCCCATACNONE 
J053095I18GAGGCCCATACNONE 
J065035I11GAGGCCCATACNONE 
J065087P10GAGGCCCATACNONE 
J065124B14GAGGCCCATACNONE 
J065198E12GAGGCCCATACNONE 
J065210N22GAGGCCCATACNONE 
J065210P16GAGGCCCATACNONE 
J080309H11GAGGCCCATACNONE 
J080316C05GAGGCCCATACNONE 
J090039D18GAGGCCCATACNONE 
J090053F06GAGGCCCATACNONE 
J090084D01GAGGCCCATACNONE 
J090085K24GAGGCCCATACNONE 
J090096C10GAGGCCCATACNONE 
J090097N18GAGGCCCATACNONE 
J100045M09GAGGCCCATACNONE 
Os07g0564000AK069806TGCGGCCCATATConserved hypothetical protein. 
Os07g0568900009-083-H02TTATGGGCCCCCACGNONE 
AK062660TTATGGGCCCCCACGConserved hypothetical protein. 
Os07g0569000AK073915CGTGGGGGCCCATAAConserved hypothetical protein. 
Os07g0585800006-106-A05GTATGGGCCTTNONE 
006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419GTATGGGCCTTNONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064GTATGGGCCTTSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01GTATGGGCCTTNONE 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08GTATGGGCCTTNONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23GTATGGGCCTTNONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01GTATGGGCCTTNONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13GTATGGGCCTTNONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18GTATGGGCCTTNONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04GTATGGGCCTTNONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09GTATGGGCCTTNONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02GTATGGGCCTTNONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10GTATGGGCCTTNONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11GTATGGGCCTTNONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10GTATGGGCCTTNONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04GTATGGGCCTTNONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01GTATGGGCCTTNONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02GTATGGGCCTTNONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0598900015-040-C12GTATGGGCCATNONE 
AK102627GTATGGGCCATCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521GTATGGGCCATNONE 
J033087C18GTATGGGCCATNONE 
J033099K03GTATGGGCCATNONE 
J065054E02GTATGGGCCATNONE 
J090055O05GTATGGGCCATNONE 
Os07g0619400009-095-D09TCCGGGCCCATATNONE 
AK062716TCCGGGCCCATATCalcium-binding EF-hand domain containing protein. 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
Os07g0656400011-061-F11CAACGGCCCATAConserved hypothetical protein. 
011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0673100AK060100GAGGCCCATATNONE 
AK103678GAGGCCCATATRibosomal protein S8E family protein. 
AK104794GAGGCCCATATNONE 
Os07g0680300009-195-E06TCAGGCCCATANONE 
009-195-E06TCGGCCCACTTAGGCCCATATNONE 
AK063800TCAGGCCCATASimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCAGGCCCATANONE 
J065093F19TCGGCCCACTTAGGCCCATATNONE 
J075066A20TCAGGCCCATANONE 
J075066A20TCGGCCCACTTAGGCCCATATNONE 
J075088I17TCAGGCCCATANONE 
J075088I17TCGGCCCACTTAGGCCCATATNONE 
J075147M19TCAGGCCCATANONE 
J075147M19TCGGCCCACTTAGGCCCATATNONE 
J075153L02TCAGGCCCATANONE 
J075153L02TCGGCCCACTTAGGCCCATATNONE 
J080013A21TCAGGCCCATANONE 
J080013A21TCGGCCCACTTAGGCCCATATNONE 
J080051B13TCAGGCCCATANONE 
J080051B13TCGGCCCACTTAGGCCCATATNONE 
J080077I24TCAGGCCCATANONE 
J080077I24TCGGCCCACTTAGGCCCATATNONE 
J080302B14TCAGGCCCATANONE 
J080302B14TCGGCCCACTTAGGCCCATATNONE 
J080309D22TCAGGCCCATANONE 
J080309D22TCGGCCCACTTAGGCCCATATNONE 
J100083B16TCAGGCCCATANONE 
J100083B16TCGGCCCACTTAGGCCCATATNONE 
Os07g0682700003-131-G11ATATGGGCCGCNONE 
016-086-E10ATATGGGCCGCNONE 
AK065098ATATGGGCCGCSimilar to Chitin-binding lectin 1 precursor (PL-I). 
AK103680ATATGGGCCGCNONE 
J013001M18ATATGGGCCGCNONE 
J033136D22ATATGGGCCGCNONE 
Os07g0687300AK073043ATTTGGGCCCATAASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os07g0688100AK101635ATATGGGCCGTAProtein prenyltransferase domain containing protein. 
AK101635ATATGGGCCGTCProtein prenyltransferase domain containing protein. 
J033055B02ATATGGGCCGTANONE 
J033055B02ATATGGGCCGTCNONE 
J090013O08ATATGGGCCGTANONE 
J090013O08ATATGGGCCGTCNONE 
J090074A17ATATGGGCCGTANONE 
J090074A17ATATGGGCCGTCNONE 
Os07g0691100AK071728TTATGGGCCGAASimilar to Pectin methylesterase 6 (Fragment). 
J023108P03TTATGGGCCGAANONE 
J023112F11TTATGGGCCGAANONE 
J023143A10TTATGGGCCGAANONE 
Os08g0110200AK068841GAGGCCCATATSimilar to Fertility restorer. 
J090071I18GAGGCCCATATNONE 
Os08g0112800009-113-D03GCCGGCCCATATNONE 
AK121176GCCGGCCCATATRickettsia 17 kDa surface antigen family protein. 
J023083C18GCCGGCCCATATNONE 
J033074M10GCCGGCCCATATNONE 
J033097G10GCCGGCCCATATNONE 
J065090F05GCCGGCCCATATNONE 
J090001J03GCCGGCCCATATNONE 
J090044F23GCCGGCCCATATNONE 
J090078H09GCCGGCCCATATNONE 
J100088G23GCCGGCCCATATNONE 
Os08g0118900AK109749TTATGGGCCGGTAdenylate kinase family protein. 
Os08g0120000006-042-E02GCGGCCCATAANONE 
006-051-F06GCGGCCCATAANONE 
006-052-G03GCGGCCCATAANONE 
006-095-B11GCGGCCCATAANONE 
AB017427GCGGCCCATAANONE 
AB017428GCGGCCCATAANONE 
AK059789GCGGCCCATAANONE 
AK059815GCGGCCCATAASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077GCGGCCCATAANONE 
AK102607GCGGCCCATAANONE 
AK104303GCGGCCCATAANONE 
AK104304GCGGCCCATAANONE 
AK104421GCGGCCCATAANONE 
D10414GCGGCCCATAANONE 
J013170D08GCGGCCCATAANONE 
J023086D16GCGGCCCATAANONE 
J033099B04GCGGCCCATAANONE 
J065042P05GCGGCCCATAANONE 
J065144E22GCGGCCCATAANONE 
J065162J20GCGGCCCATAANONE 
J065196N13GCGGCCCATAANONE 
J090013B11GCGGCCCATAANONE 
Os08g0130500006-024-B12CAAGGCCCATACNONE 
006-032-F11CAAGGCCCATACNONE 
006-047-B12CAAGGCCCATACNONE 
006-058-H06CAAGGCCCATACNONE 
006-062-D07CAAGGCCCATACNONE 
006-083-F11CAAGGCCCATACNONE 
006-084-A11CAAGGCCCATACNONE 
006-096-F12CAAGGCCCATACNONE 
006-105-A04CAAGGCCCATACNONE 
006-110-D11CAAGGCCCATACNONE 
011-022-D11CAAGGCCCATACNONE 
AK064857CAAGGCCCATAC60S acidic ribosomal protein P0. 
D21130CAAGGCCCATACNONE 
J013000H12CAAGGCCCATACNONE 
J013024M17CAAGGCCCATACNONE 
J013028H09CAAGGCCCATACNONE 
J013045N22CAAGGCCCATACNONE 
J013092K19CAAGGCCCATACNONE 
J013106L12CAAGGCCCATACNONE 
J013107A03CAAGGCCCATACNONE 
J013109E12CAAGGCCCATACNONE 
J013114N08CAAGGCCCATACNONE 
J013120J12CAAGGCCCATACNONE 
J013121E21CAAGGCCCATACNONE 
J013135P20CAAGGCCCATACNONE 
J023006J08CAAGGCCCATACNONE 
J023014L16CAAGGCCCATACNONE 
J023020N03CAAGGCCCATACNONE 
J023027M24CAAGGCCCATACNONE 
J023029D18CAAGGCCCATACNONE 
J023030A14CAAGGCCCATACNONE 
J023041G23CAAGGCCCATACNONE 
J023049H05CAAGGCCCATACNONE 
J023060I23CAAGGCCCATACNONE 
J023099D07CAAGGCCCATACNONE 
J023104A20CAAGGCCCATACNONE 
J023105F18CAAGGCCCATACNONE 
J023112D21CAAGGCCCATACNONE 
J023122M18CAAGGCCCATACNONE 
J023139J20CAAGGCCCATACNONE 
J023149L20CAAGGCCCATACNONE 
J023150G04CAAGGCCCATACNONE 
J033036G02CAAGGCCCATACNONE 
J033045P13CAAGGCCCATACNONE 
J033046A22CAAGGCCCATACNONE 
J033086H16CAAGGCCCATACNONE 
J033087D07CAAGGCCCATACNONE 
J033089M14CAAGGCCCATACNONE 
J033095F14CAAGGCCCATACNONE 
J033108M01CAAGGCCCATACNONE 
J033117A17CAAGGCCCATACNONE 
J033122F03CAAGGCCCATACNONE 
J033126A04CAAGGCCCATACNONE 
J033144D13CAAGGCCCATACNONE 
J033145D13CAAGGCCCATACNONE 
J043022M09CAAGGCCCATACNONE 
J053025I11CAAGGCCCATACNONE 
J053027K06CAAGGCCCATACNONE 
J053029D15CAAGGCCCATACNONE 
J053048I22CAAGGCCCATACNONE 
J053055I01CAAGGCCCATACNONE 
J053079P07CAAGGCCCATACNONE 
J053090J23CAAGGCCCATACNONE 
J053094C24CAAGGCCCATACNONE 
J065023F18CAAGGCCCATACNONE 
J065029I12CAAGGCCCATACNONE 
J065044B18CAAGGCCCATACNONE 
J065045C07CAAGGCCCATACNONE 
J065063K22CAAGGCCCATACNONE 
J065093D11CAAGGCCCATACNONE 
J065096P09CAAGGCCCATACNONE 
J065099N04CAAGGCCCATACNONE 
J065103K24CAAGGCCCATACNONE 
J065110H12CAAGGCCCATACNONE 
J065132F24CAAGGCCCATACNONE 
J065157K16CAAGGCCCATACNONE 
J065185D11CAAGGCCCATACNONE 
J065202E16CAAGGCCCATACNONE 
J065217D07CAAGGCCCATACNONE 
J075053I19CAAGGCCCATACNONE 
J075055L24CAAGGCCCATACNONE 
J075056H24CAAGGCCCATACNONE 
J075070D02CAAGGCCCATACNONE 
J075084O15CAAGGCCCATACNONE 
J075090F24CAAGGCCCATACNONE 
J075135E03CAAGGCCCATACNONE 
J075174A01CAAGGCCCATACNONE 
J075188F05CAAGGCCCATACNONE 
J075192C17CAAGGCCCATACNONE 
J080001B02CAAGGCCCATACNONE 
J080001C08CAAGGCCCATACNONE 
J080002D15CAAGGCCCATACNONE 
J080002I03CAAGGCCCATACNONE 
J080003E24CAAGGCCCATACNONE 
J080004M10CAAGGCCCATACNONE 
J080005C18CAAGGCCCATACNONE 
J080006A12CAAGGCCCATACNONE 
J080006F04CAAGGCCCATACNONE 
J080006M11CAAGGCCCATACNONE 
J080008J11CAAGGCCCATACNONE 
J080008J22CAAGGCCCATACNONE 
J080009F14CAAGGCCCATACNONE 
J080010B12CAAGGCCCATACNONE 
J080010G14CAAGGCCCATACNONE 
J080010N07CAAGGCCCATACNONE 
J080011D04CAAGGCCCATACNONE 
J080011G10CAAGGCCCATACNONE 
J080011O19CAAGGCCCATACNONE 
J080013K23CAAGGCCCATACNONE 
J080013M09CAAGGCCCATACNONE 
J080013N12CAAGGCCCATACNONE 
J080013O15CAAGGCCCATACNONE 
J080014C13CAAGGCCCATACNONE 
J080014D21CAAGGCCCATACNONE 
J080014F08CAAGGCCCATACNONE 
J080014N08CAAGGCCCATACNONE 
J080014P19CAAGGCCCATACNONE 
J080015L09CAAGGCCCATACNONE 
J080015P15CAAGGCCCATACNONE 
J080018P10CAAGGCCCATACNONE 
J080020C06CAAGGCCCATACNONE 
J080022C14CAAGGCCCATACNONE 
J080022E01CAAGGCCCATACNONE 
J080022P04CAAGGCCCATACNONE 
J080022P10CAAGGCCCATACNONE 
J080023B20CAAGGCCCATACNONE 
J080023G19CAAGGCCCATACNONE 
J080024N15CAAGGCCCATACNONE 
J080025E11CAAGGCCCATACNONE 
J080025G24CAAGGCCCATACNONE 
J080026B01CAAGGCCCATACNONE 
J080026B05CAAGGCCCATACNONE 
J080027L17CAAGGCCCATACNONE 
J080028K02CAAGGCCCATACNONE 
J080029L23CAAGGCCCATACNONE 
J080030D08CAAGGCCCATACNONE 
J080031C03CAAGGCCCATACNONE 
J080031K02CAAGGCCCATACNONE 
J080032C16CAAGGCCCATACNONE 
J080033F10CAAGGCCCATACNONE 
J080033G12CAAGGCCCATACNONE 
J080033K03CAAGGCCCATACNONE 
J080034B03CAAGGCCCATACNONE 
J080034N21CAAGGCCCATACNONE 
J080034O03CAAGGCCCATACNONE 
J080035G10CAAGGCCCATACNONE 
J080038E14CAAGGCCCATACNONE 
J080039A19CAAGGCCCATACNONE 
J080039G10CAAGGCCCATACNONE 
J080039J01CAAGGCCCATACNONE 
J080039J09CAAGGCCCATACNONE 
J080040F07CAAGGCCCATACNONE 
J080040H18CAAGGCCCATACNONE 
J080041E08CAAGGCCCATACNONE 
J080041E16CAAGGCCCATACNONE 
J080041L08CAAGGCCCATACNONE 
J080042A07CAAGGCCCATACNONE 
J080044E02CAAGGCCCATACNONE 
J080045K03CAAGGCCCATACNONE 
J080046O03CAAGGCCCATACNONE 
J080047F08CAAGGCCCATACNONE 
J080048H01CAAGGCCCATACNONE 
J080048I05CAAGGCCCATACNONE 
J080048N06CAAGGCCCATACNONE 
J080050A07CAAGGCCCATACNONE 
J080050B04CAAGGCCCATACNONE 
J080050E21CAAGGCCCATACNONE 
J080051J01CAAGGCCCATACNONE 
J080051K02CAAGGCCCATACNONE 
J080051L02CAAGGCCCATACNONE 
J080052C20CAAGGCCCATACNONE 
J080052I22CAAGGCCCATACNONE 
J080052J21CAAGGCCCATACNONE 
J080052K22CAAGGCCCATACNONE 
J080055A05CAAGGCCCATACNONE 
J080055I12CAAGGCCCATACNONE 
J080056A21CAAGGCCCATACNONE 
J080056N11CAAGGCCCATACNONE 
J080057D02CAAGGCCCATACNONE 
J080058H21CAAGGCCCATACNONE 
J080058P16CAAGGCCCATACNONE 
J080059M03CAAGGCCCATACNONE 
J080059N17CAAGGCCCATACNONE 
J080060F13CAAGGCCCATACNONE 
J080060H06CAAGGCCCATACNONE 
J080060J03CAAGGCCCATACNONE 
J080060O09CAAGGCCCATACNONE 
J080060P22CAAGGCCCATACNONE 
J080061F06CAAGGCCCATACNONE 
J080061H21CAAGGCCCATACNONE 
J080061O13CAAGGCCCATACNONE 
J080062J07CAAGGCCCATACNONE 
J080063A08CAAGGCCCATACNONE 
J080063F19CAAGGCCCATACNONE 
J080063O18CAAGGCCCATACNONE 
J080065D15CAAGGCCCATACNONE 
J080066E13CAAGGCCCATACNONE 
J080068L01CAAGGCCCATACNONE 
J080068P07CAAGGCCCATACNONE 
J080069I21CAAGGCCCATACNONE 
J080070M04CAAGGCCCATACNONE 
J080071E01CAAGGCCCATACNONE 
J080071J08CAAGGCCCATACNONE 
J080071M23CAAGGCCCATACNONE 
J080072A03CAAGGCCCATACNONE 
J080072G18CAAGGCCCATACNONE 
J080075A04CAAGGCCCATACNONE 
J080075E19CAAGGCCCATACNONE 
J080075P18CAAGGCCCATACNONE 
J080076N11CAAGGCCCATACNONE 
J080077A11CAAGGCCCATACNONE 
J080077D22CAAGGCCCATACNONE 
J080077H18CAAGGCCCATACNONE 
J080077L03CAAGGCCCATACNONE 
J080078D02CAAGGCCCATACNONE 
J080078L05CAAGGCCCATACNONE 
J080078N20CAAGGCCCATACNONE 
J080079I20CAAGGCCCATACNONE 
J080081D04CAAGGCCCATACNONE 
J080082A07CAAGGCCCATACNONE 
J080082E24CAAGGCCCATACNONE 
J080084A22CAAGGCCCATACNONE 
J080084E15CAAGGCCCATACNONE 
J080084G06CAAGGCCCATACNONE 
J080086A05CAAGGCCCATACNONE 
J080086F09CAAGGCCCATACNONE 
J080087B11CAAGGCCCATACNONE 
J080087H12CAAGGCCCATACNONE 
J080088I05CAAGGCCCATACNONE 
J080088N08CAAGGCCCATACNONE 
J080088P07CAAGGCCCATACNONE 
J080089A09CAAGGCCCATACNONE 
J080089D21CAAGGCCCATACNONE 
J080089F24CAAGGCCCATACNONE 
J080089H22CAAGGCCCATACNONE 
J080089I04CAAGGCCCATACNONE 
J080090D01CAAGGCCCATACNONE 
J080091F09CAAGGCCCATACNONE 
J080091G18CAAGGCCCATACNONE 
J080091L24CAAGGCCCATACNONE 
J080091M12CAAGGCCCATACNONE 
J080091N12CAAGGCCCATACNONE 
J080093A15CAAGGCCCATACNONE 
J080093C08CAAGGCCCATACNONE 
J080093I08CAAGGCCCATACNONE 
J080093P21CAAGGCCCATACNONE 
J080094E18CAAGGCCCATACNONE 
J080094F15CAAGGCCCATACNONE 
J080094J21CAAGGCCCATACNONE 
J080095A09CAAGGCCCATACNONE 
J080096G05CAAGGCCCATACNONE 
J080096K07CAAGGCCCATACNONE 
J080097M17CAAGGCCCATACNONE 
J080097P21CAAGGCCCATACNONE 
J080302B15CAAGGCCCATACNONE 
J080306J15CAAGGCCCATACNONE 
J080306O13CAAGGCCCATACNONE 
J080307C15CAAGGCCCATACNONE 
J080307I04CAAGGCCCATACNONE 
J080307L05CAAGGCCCATACNONE 
J080308F11CAAGGCCCATACNONE 
J080311C04CAAGGCCCATACNONE 
J080311I07CAAGGCCCATACNONE 
J080312C01CAAGGCCCATACNONE 
J080312O08CAAGGCCCATACNONE 
J080315F14CAAGGCCCATACNONE 
J080318K13CAAGGCCCATACNONE 
J080319A17CAAGGCCCATACNONE 
J090001I01CAAGGCCCATACNONE 
J090002O18CAAGGCCCATACNONE 
J090007A08CAAGGCCCATACNONE 
J090007F22CAAGGCCCATACNONE 
J090008D09CAAGGCCCATACNONE 
J090008L07CAAGGCCCATACNONE 
J090008O08CAAGGCCCATACNONE 
J090012N11CAAGGCCCATACNONE 
J090013M05CAAGGCCCATACNONE 
J090020E08CAAGGCCCATACNONE 
J090020O20CAAGGCCCATACNONE 
J090021I10CAAGGCCCATACNONE 
J090023D07CAAGGCCCATACNONE 
J090023K22CAAGGCCCATACNONE 
J090023O08CAAGGCCCATACNONE 
J090028D21CAAGGCCCATACNONE 
J090029H14CAAGGCCCATACNONE 
J090029L12CAAGGCCCATACNONE 
J090030C05CAAGGCCCATACNONE 
J090031D18CAAGGCCCATACNONE 
J090032G10CAAGGCCCATACNONE 
J090034J22CAAGGCCCATACNONE 
J090034K16CAAGGCCCATACNONE 
J090036D10CAAGGCCCATACNONE 
J090037N17CAAGGCCCATACNONE 
J090043P17CAAGGCCCATACNONE 
J090044L20CAAGGCCCATACNONE 
J090045N16CAAGGCCCATACNONE 
J090048K03CAAGGCCCATACNONE 
J090048K10CAAGGCCCATACNONE 
J090049O07CAAGGCCCATACNONE 
J090055H23CAAGGCCCATACNONE 
J090056G12CAAGGCCCATACNONE 
J090056G16CAAGGCCCATACNONE 
J090059B16CAAGGCCCATACNONE 
J090066H21CAAGGCCCATACNONE 
J090067D22CAAGGCCCATACNONE 
J090072M07CAAGGCCCATACNONE 
J090073J21CAAGGCCCATACNONE 
J090075A15CAAGGCCCATACNONE 
J090079J09CAAGGCCCATACNONE 
J090080L07CAAGGCCCATACNONE 
J090084A03CAAGGCCCATACNONE 
J090085B07CAAGGCCCATACNONE 
J090088H11CAAGGCCCATACNONE 
J090090J12CAAGGCCCATACNONE 
J090091I21CAAGGCCCATACNONE 
J090091L02CAAGGCCCATACNONE 
J090093G18CAAGGCCCATACNONE 
J090094D23CAAGGCCCATACNONE 
J090098L19CAAGGCCCATACNONE 
J100017I22CAAGGCCCATACNONE 
J100018F08CAAGGCCCATACNONE 
J100018G19CAAGGCCCATACNONE 
J100019B05CAAGGCCCATACNONE 
J100019J18CAAGGCCCATACNONE 
J100019L04CAAGGCCCATACNONE 
J100023M06CAAGGCCCATACNONE 
J100024J23CAAGGCCCATACNONE 
J100024P09CAAGGCCCATACNONE 
J100027I05CAAGGCCCATACNONE 
J100029G03CAAGGCCCATACNONE 
J100029K08CAAGGCCCATACNONE 
J100031J17CAAGGCCCATACNONE 
J100037L16CAAGGCCCATACNONE 
J100038C05CAAGGCCCATACNONE 
J100039D19CAAGGCCCATACNONE 
J100041L02CAAGGCCCATACNONE 
J100045B08CAAGGCCCATACNONE 
J100045B15CAAGGCCCATACNONE 
J100047G07CAAGGCCCATACNONE 
J100047P19CAAGGCCCATACNONE 
J100048I15CAAGGCCCATACNONE 
J100049M16CAAGGCCCATACNONE 
J100049P18CAAGGCCCATACNONE 
J100050E21CAAGGCCCATACNONE 
J100051N02CAAGGCCCATACNONE 
J100052M02CAAGGCCCATACNONE 
J100055M24CAAGGCCCATACNONE 
J100056K11CAAGGCCCATACNONE 
J100059F20CAAGGCCCATACNONE 
J100059J15CAAGGCCCATACNONE 
J100068C19CAAGGCCCATACNONE 
J100068G06CAAGGCCCATACNONE 
J100069N02CAAGGCCCATACNONE 
J100073N04CAAGGCCCATACNONE 
J100074B05CAAGGCCCATACNONE 
J100080P13CAAGGCCCATACNONE 
J100083P09CAAGGCCCATACNONE 
J100084B11CAAGGCCCATACNONE 
J100085B07CAAGGCCCATACNONE 
J100086O20CAAGGCCCATACNONE 
J100087B02CAAGGCCCATACNONE 
J100089B14CAAGGCCCATACNONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0155000004-001-C12TTATGGGCTCGGCCCATATNONE 
014-030-C11TTATGGGCTCGGCCCATATNONE 
AK060859TTATGGGCTCGGCCCATATNONE 
AK099613TTATGGGCTCGGCCCATATBrix domain containing protein. 
J013154C17TTATGGGCTCGGCCCATATNONE 
J033039F14TTATGGGCTCGGCCCATATNONE 
J033126I18TTATGGGCTCGGCCCATATNONE 
J043005A17TTATGGGCTCGGCCCATATNONE 
J053027C13TTATGGGCTCGGCCCATATNONE 
J053033I07TTATGGGCTCGGCCCATATNONE 
J053054P04TTATGGGCTCGGCCCATATNONE 
J053060F22TTATGGGCTCGGCCCATATNONE 
J053061P10TTATGGGCTCGGCCCATATNONE 
J053065L13TTATGGGCTCGGCCCATATNONE 
J053099H19TTATGGGCTCGGCCCATATNONE 
J053101D09TTATGGGCTCGGCCCATATNONE 
J075062C16TTATGGGCTCGGCCCATATNONE 
J075129P09TTATGGGCTCGGCCCATATNONE 
J075135C02TTATGGGCTCGGCCCATATNONE 
J075147P13TTATGGGCTCGGCCCATATNONE 
J090007K03TTATGGGCTCGGCCCATATNONE 
J090050M06TTATGGGCTCGGCCCATATNONE 
J090057M20TTATGGGCTCGGCCCATATNONE 
J090070B06TTATGGGCTCGGCCCATATNONE 
J090080D11TTATGGGCTCGGCCCATATNONE 
J100021D15TTATGGGCTCGGCCCATATNONE 
Os08g0167500006-063-D04AAGGCCCATATGGGCCCACAANONE 
006-066-G09AAGGCCCATATGGGCCCACAANONE 
AK061061AAGGCCCATATGGGCCCACAAConserved hypothetical protein. 
AK071197AAGGCCCATATGGGCCCACAANONE 
J023082N10AAGGCCCATATGGGCCCACAANONE 
Os08g0192900AK103422CAAGGCCCATATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645CAAGGCCCATATNONE 
Os08g0270200AK101221TTATGGGCCGAAAExosome-associated family protein. 
J090067H03TTATGGGCCGAAANONE 
Os08g0433200013-023-E07TATGGGCCGAAANONE 
AK099471TATGGGCCGAAAConserved hypothetical protein. 
J013024A05TATGGGCCGAAANONE 
J013065N03TATGGGCCGAAANONE 
J023111A21TATGGGCCGAAANONE 
J065035F10TATGGGCCGAAANONE 
J065083H01TATGGGCCGAAANONE 
J065159E03TATGGGCCGAAANONE 
J065186A03TATGGGCCGAAANONE 
J075032B02TATGGGCCGAAANONE 
J075038L14TATGGGCCGAAANONE 
J075047N21TATGGGCCGAAANONE 
J075076H05TATGGGCCGAAANONE 
J075110C08TATGGGCCGAAANONE 
J090096K17TATGGGCCGAAANONE 
Os08g0469500AK109599ATATGGGCCAAConserved hypothetical protein. 
Os08g0474600J075102L06CCAGGCCCATATNONE 
J075103J21CCAGGCCCATATNONE 
Os08g0495300Os08g0495300GCGGCCCATAConserved hypothetical protein. 
Os08g0517900015-019-D06AAAAGCCCAAAAAAGGCCCATATNONE 
AK064304AAAAGCCCAAAAAAGGCCCATATSimilar to 30S ribosomal protein S16. 
Os08g0532300009-122-A05TACGGCCCATAANONE 
009-129-H05TACGGCCCATAANONE 
AB011262TACGGCCCATAANONE 
AK065141TACGGCCCATAANONE 
AK119730TACGGCCCATAASimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14TACGGCCCATAANONE 
J013042K23TACGGCCCATAANONE 
J023057J08TACGGCCCATAANONE 
J023057N10TACGGCCCATAANONE 
J023113C21TACGGCCCATAANONE 
J053054E03TACGGCCCATAANONE 
J053062B07TACGGCCCATAANONE 
J053075O17TACGGCCCATAANONE 
J053075P09TACGGCCCATAANONE 
J065024H05TACGGCCCATAANONE 
J065049F22TACGGCCCATAANONE 
J065063L03TACGGCCCATAANONE 
J065102O07TACGGCCCATAANONE 
J065104M12TACGGCCCATAANONE 
J065119E04TACGGCCCATAANONE 
J065153E10TACGGCCCATAANONE 
J065168M24TACGGCCCATAANONE 
J065173I10TACGGCCCATAANONE 
J065181L04TACGGCCCATAANONE 
J065184I18TACGGCCCATAANONE 
J065203M15TACGGCCCATAANONE 
J075004C21TACGGCCCATAANONE 
J075047B11TACGGCCCATAANONE 
J075055F18TACGGCCCATAANONE 
J075065G09TACGGCCCATAANONE 
J075094O14TACGGCCCATAANONE 
J075143C22TACGGCCCATAANONE 
J075153K18TACGGCCCATAANONE 
J075164N10TACGGCCCATAANONE 
J075197C11TACGGCCCATAANONE 
J080001A01TACGGCCCATAANONE 
J080003B11TACGGCCCATAANONE 
J080006G17TACGGCCCATAANONE 
J080007J06TACGGCCCATAANONE 
J080010H12TACGGCCCATAANONE 
J080014I01TACGGCCCATAANONE 
J080015C16TACGGCCCATAANONE 
J080016P19TACGGCCCATAANONE 
J080020G24TACGGCCCATAANONE 
J080021E12TACGGCCCATAANONE 
J080023I11TACGGCCCATAANONE 
J080024H24TACGGCCCATAANONE 
J080025G18TACGGCCCATAANONE 
J080028H08TACGGCCCATAANONE 
J080030G08TACGGCCCATAANONE 
J080031H20TACGGCCCATAANONE 
J080034C20TACGGCCCATAANONE 
J080040H13TACGGCCCATAANONE 
J080044M04TACGGCCCATAANONE 
J080047D02TACGGCCCATAANONE 
J080049D17TACGGCCCATAANONE 
J080049J17TACGGCCCATAANONE 
J080050A05TACGGCCCATAANONE 
J080051C11TACGGCCCATAANONE 
J080051K06TACGGCCCATAANONE 
J080053A07TACGGCCCATAANONE 
J080053I08TACGGCCCATAANONE 
J080056L12TACGGCCCATAANONE 
J080061I19TACGGCCCATAANONE 
J080075G09TACGGCCCATAANONE 
J080078C23TACGGCCCATAANONE 
J080080I21TACGGCCCATAANONE 
J080084F04TACGGCCCATAANONE 
J080085K16TACGGCCCATAANONE 
J080097A12TACGGCCCATAANONE 
J080097N01TACGGCCCATAANONE 
J090027L10TACGGCCCATAANONE 
J100034N17TACGGCCCATAANONE 
Os08g0532400AK101608TTATGGGCCGTASimilar to AT.I.24-7 protein. 
Os08g0554000AK111661TGCGGCCCATATWD-40 repeat containing protein. 
AK112044TGCGGCCCATATNONE 
J013039N12TGCGGCCCATATNONE 
J013134D02TGCGGCCCATATNONE 
J013153B06TGCGGCCCATATNONE 
J033044L16TGCGGCCCATATNONE 
J033073P14TGCGGCCCATATNONE 
Os08g0557000AK059917TAGGCCCATAANONE 
AK100496TAGGCCCATAASimilar to Protein-L-isoaspartate O-methyltransferase. 
Os08g0557400006-024-C02CCACGGCCCATATNONE 
AK060067CCACGGCCCATATProtein tyrosine phosphatase-like protein. 
AY224424CCACGGCCCATATNONE 
Os08g0563300009-007-B01ATATGGGCCCAANONE 
009-007-B01GGGCCGGCCCATAANONE 
AK062315ATATGGGCCCAASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK062315GGGCCGGCCCATAASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04ATATGGGCCCAANONE 
J065095F04GGGCCGGCCCATAANONE 
Os08g0564100AK063258GCCGGCCCATAASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0306700J023045A19TTATGGGCCTTGNONE 
Os09g0324300AK109691TACGGCCCATATCyclin-like F-box domain containing protein. 
AK109691TTATGGGCCGCCGTGGGCTTTCyclin-like F-box domain containing protein. 
Os09g0363700AK103667ATATGGGCCTAConserved hypothetical protein. 
J075001L14ATATGGGCCTANONE 
J075049M23ATATGGGCCTANONE 
J075051I04ATATGGGCCTANONE 
J075073L04ATATGGGCCTANONE 
J075077E03ATATGGGCCTANONE 
J075083J11ATATGGGCCTANONE 
J075094J22ATATGGGCCTANONE 
J075112E08ATATGGGCCTANONE 
J075137J23ATATGGGCCTANONE 
J075192E02ATATGGGCCTANONE 
J100039K04ATATGGGCCTANONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0395400AK109221TAGGCCCATAAGGATGGGCCGTAConserved hypothetical protein. 
J075009I06TAGGCCCATAAGGATGGGCCGTANONE 
Os09g0416400J075067A16TACGGCCCATAAConserved hypothetical protein. 
J075104N21TACGGCCCATAANONE 
J075106F04TACGGCCCATAANONE 
J075131F08TACGGCCCATAANONE 
Os09g0424600AK073882TATGGGCCGCAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
AK073882TTATGGGCCGCAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0458100AK109625TTATGGGCCGTAXyloglucan fucosyltransferase family protein. 
Os09g0459800AK060764ATATGGGCCACNONE 
AK100324ATATGGGCCACSimilar to ARP protein. 
AK102736ATATGGGCCACNONE 
Os09g0463700016-008-D06TAGGCCCATACNONE 
AK060708TAGGCCCATACSimilar to AHM1. 
J090013G05TAGGCCCATACNONE 
Os09g0471900AK073815AGTGGGCCCATAABacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0477700AK121644ATATGGGCCGGTConserved hypothetical protein. 
Os09g0478400AK107794GTATGGGCCTAConserved hypothetical protein. 
J065082F04GTATGGGCCTANONE 
Os09g0487500AK108131TCCGGCCCATAAConserved hypothetical protein. 
J080062L16TCCGGCCCATAANONE 
Os09g0495200AK102989CACTGACATATGGGCCCTConserved hypothetical protein. 
J075062H18CACTGACATATGGGCCCTNONE 
J075098G06CACTGACATATGGGCCCTNONE 
Os09g0498100015-046-G11AAGGCCCATACNONE 
AK064108AAGGCCCATACSimilar to 30S ribosomal protein S16. 
J065040H21AAGGCCCATACNONE 
J065062F05AAGGCCCATACNONE 
J065147B17AAGGCCCATACNONE 
J075098J22AAGGCCCATACNONE 
Os09g0498600AK066995CAGGCCCATANONE 
Os09g0538200009-076-A07CCAGGCCCATATNONE 
AB032061CCAGGCCCATATProteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
J065184D10CCAGGCCCATATNONE 
J075134I16CCAGGCCCATATNONE 
J100031G24CCAGGCCCATATNONE 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
Os09g0542200006-092-A09ATATGGGCCAGANONE 
AK064887ATATGGGCCAGAThioredoxin fold domain containing protein. 
AK104804ATATGGGCCAGANONE 
J013000K12ATATGGGCCAGANONE 
J013170A19ATATGGGCCAGANONE 
J033103B02ATATGGGCCAGANONE 
J065196J20ATATGGGCCAGANONE 
J075037H17ATATGGGCCAGANONE 
J075069H14ATATGGGCCAGANONE 
J075071C16ATATGGGCCAGANONE 
J075095N02ATATGGGCCAGANONE 
J075136N03ATATGGGCCAGANONE 
J075192L16ATATGGGCCAGANONE 
J100057N23ATATGGGCCAGANONE 
J100060O07ATATGGGCCAGANONE 
J100062F10ATATGGGCCAGANONE 
J100077I08ATATGGGCCAGANONE 
J100086B07ATATGGGCCAGANONE 
J100088L14ATATGGGCCAGANONE 
Os09g0558100009-028-D03ACGTGTCGGCCCATACNONE 
014-011-A04ACGTGTCGGCCCATACNONE 
AB030211ACGTGTCGGCCCATACSimilar to Low-temperature induced protein lt101.2. 
AK062410ACGTGTCGGCCCATACNONE 
J065006B17ACGTGTCGGCCCATACNONE 
J065067M15ACGTGTCGGCCCATACNONE 
J065075E19ACGTGTCGGCCCATACNONE 
J075011G16ACGTGTCGGCCCATACNONE 
J075015L22ACGTGTCGGCCCATACNONE 
J075035O11ACGTGTCGGCCCATACNONE 
J075072E15ACGTGTCGGCCCATACNONE 
J075100O22ACGTGTCGGCCCATACNONE 
Os09g0559800AK071542TTATGGGCCGASimilar to Transporter-like protein. 
J013063N24TTATGGGCCGANONE 
Os09g0563800AK068364TTATGGGCCTCConserved hypothetical protein. 
J075156H12TTATGGGCCTCNONE 
Os09g0565200004-007-A08ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-045-E10ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-051-A01ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-079-G03ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-C05ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-097-E11ATATGGGCCGTGATTTGGGCCCATGGNONE 
006-111-E07ATATGGGCCGTGATTTGGGCCCATGGNONE 
AK069121ATATGGGCCGTGATTTGGGCCCATGGSimilar to Nucleic acid-binding protein precursor. 
AK104354ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013090J23ATATGGGCCGTGATTTGGGCCCATGGNONE 
J013093C19ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023007A14ATATGGGCCGTGATTTGGGCCCATGGNONE 
J023099J21ATATGGGCCGTGATTTGGGCCCATGGNONE 
J065023L09ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075060J06ATATGGGCCGTGATTTGGGCCCATGGNONE 
J075092C03ATATGGGCCGTGATTTGGGCCCATGGNONE 
Os09g0569400AK063384ATATGGGCCTCBeta-lactamase-like domain containing protein. 
AK070608ATATGGGCCTCNONE 
Os11g0107500005-005-H05TATGGGCCTANONE 
009-118-E10TATGGGCCTANONE 
009-180-A04TATGGGCCTANONE 
AK121033TATGGGCCTAMacrophage migration inhibitory factor family protein. 
J013070C02TATGGGCCTANONE 
J013132P08TATGGGCCTANONE 
J023050K24TATGGGCCTANONE 
J053064N21TATGGGCCTANONE 
J053070L15TATGGGCCTANONE 
J053099E18TATGGGCCTANONE 
J065032A09TATGGGCCTANONE 
J065035L22TATGGGCCTANONE 
J065134D23TATGGGCCTANONE 
J065161L19TATGGGCCTANONE 
J065210K04TATGGGCCTANONE 
J075150A22TATGGGCCTANONE 
J090019C11TATGGGCCTANONE 
J090057N06TATGGGCCTANONE 
J090084D03TATGGGCCTANONE 
J090098L16TATGGGCCTANONE 
J100021H05TATGGGCCTANONE 
J100021N11TATGGGCCTANONE 
J100052B12TATGGGCCTANONE 
J100083N17TATGGGCCTANONE 
J100089D22TATGGGCCTANONE 
Os11g0115800AK106102CTCGGCCCATAAConserved hypothetical protein. 
J065057N13CTCGGCCCATAANONE 
Os11g0130500J065119D16ATATGGGCCGTANONE 
J065119D16GAGGCCCATCTAGGCCCATANONE 
J065169E14ATATGGGCCGTACyclin-like F-box domain containing protein. 
J065169E14GAGGCCCATCTAGGCCCATACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TACGGCCCATATConserved hypothetical protein. 
AK066342TTATGGGCCTAGATGGGCCTCConserved hypothetical protein. 
J065192M10TACGGCCCATATNONE 
J065192M10TTATGGGCCTAGATGGGCCTCNONE 
Os11g0145400009-117-C07GAGGCCCATAGCCCATCGSimilar to Ubiquitin-like protein 5. 
009-189-E08GAGGCCCATAGCCCATCGNONE 
J023127F18GAGGCCCATAGCCCATCGNONE 
J065071G10GAGGCCCATAGCCCATCGNONE 
J065118J21GAGGCCCATAGCCCATCGNONE 
J065184P05GAGGCCCATAGCCCATCGNONE 
J080301B06GAGGCCCATAGCCCATCGNONE 
J080303C06GAGGCCCATAGCCCATCGNONE 
J080304F18GAGGCCCATAGCCCATCGNONE 
J080308D02GAGGCCCATAGCCCATCGNONE 
J080309H09GAGGCCCATAGCCCATCGNONE 
J080311O09GAGGCCCATAGCCCATCGNONE 
J080311O15GAGGCCCATAGCCCATCGNONE 
J080312N11GAGGCCCATAGCCCATCGNONE 
J080313G04GAGGCCCATAGCCCATCGNONE 
J080313I06GAGGCCCATAGCCCATCGNONE 
J100077F22GAGGCCCATAGCCCATCGNONE 
Os11g0146700AK065900GTATGGGCCGTGNONE 
AK072412GTATGGGCCGTGRED-like, C-terminal family protein. 
Os11g0148600AK100066CAGGCCCATATConserved hypothetical protein. 
AK102442CAGGCCCATATNONE 
J065167F17CAGGCCCATATNONE 
Os11g0153700AK058576AAAGCCCAATAGGGCCCATATSimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
AK058576TAGGCCCATATGTGGGCCCAACASimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0202000AK063427GTATGGGCCTAGGCCCATCCACyclin-like F-box domain containing protein. 
AK122020GTATGGGCCTAGGCCCATCCANONE 
J033111N03GTATGGGCCTAGGCCCATCCANONE 
Os11g0249300AK060391ATATGGGCCGGCConserved hypothetical protein. 
Os11g0302700AK073931TGTGGGCCCATATRecA bacterial DNA recombination family protein. 
Os11g0549690J065085G07ATATGGGCCCTConserved hypothetical protein. 
J065218B08ATATGGGCCCTNONE 
J090036H16ATATGGGCCCTNONE 
Os11g0568300016-075-B02AGGGCCCATACNONE 
AK064398AGGGCCCATACHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282AGGGCCCATACNONE 
J033124M10AGGGCCCATACNONE 
J065120I21AGGGCCCATACNONE 
J065144H16AGGGCCCATACNONE 
Os11g0585100AK107496GAGGCCCATACConserved hypothetical protein. 
J065184E24GAGGCCCATACNONE 
Os11g0593100AK070035TATGGGCCGTGProtein of unknown function DUF295 family protein. 
J023038E14TATGGGCCGTGNONE 
J100062C21TATGGGCCGTGNONE 
Os11g0602600006-046-H02ATATGGGCCTTNONE 
006-056-H08ATATGGGCCTTNONE 
009-116-D05ATATGGGCCTTNONE 
AK072671ATATGGGCCTTSimilar to 40S ribosomal protein S9. 
AK104660ATATGGGCCTTNONE 
J023134P20ATATGGGCCTTNONE 
J023141O13ATATGGGCCTTNONE 
J033066I15ATATGGGCCTTNONE 
J033076A08ATATGGGCCTTNONE 
J033150J23ATATGGGCCTTNONE 
J065114P19ATATGGGCCTTNONE 
J065176B01ATATGGGCCTTNONE 
J065207H21ATATGGGCCTTNONE 
J080301L21ATATGGGCCTTNONE 
J080308A08ATATGGGCCTTNONE 
J080318K23ATATGGGCCTTNONE 
J080319F17ATATGGGCCTTNONE 
J080319I10ATATGGGCCTTNONE 
J090028C08ATATGGGCCTTNONE 
J090051I24ATATGGGCCTTNONE 
J090053L21ATATGGGCCTTNONE 
J090069C20ATATGGGCCTTNONE 
J100017G08ATATGGGCCTTNONE 
J100042B06ATATGGGCCTTNONE 
J100045G24ATATGGGCCTTNONE 
J100050J19ATATGGGCCTTNONE 
J100052D23ATATGGGCCTTNONE 
J100053M03ATATGGGCCTTNONE 
J100056D08ATATGGGCCTTNONE 
J100066B19ATATGGGCCTTNONE 
J100071N23ATATGGGCCTTNONE 
J100074H01ATATGGGCCTTNONE 
J100074H19ATATGGGCCTTNONE 
J100077C06ATATGGGCCTTNONE 
Os11g0704700AK102518AAGGCCCATAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023012E06AAGGCCCATAANONE 
J023022M10AAGGCCCATAANONE 
J023086E15AAGGCCCATAANONE 
J033022B08AAGGCCCATAANONE 
J033091K11AAGGCCCATAANONE 
J033095N01AAGGCCCATAANONE 
J090020H24AAGGCCCATAANONE 
Os12g0102100J013134H02AGGGCCCATATAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os12g0114000009-177-C09GTATGGGCCTANONE 
AK063119GTATGGGCCTAHypothetical protein. 
J065113E12GTATGGGCCTANONE 
Os12g0124400AK071024ATATGGGCCGAAExostosin-like family protein. 
AK071024TTATGGGCCTTExostosin-like family protein. 
Os12g0127500AK064595CAGGCCCATAAConserved hypothetical protein. 
AK064595TACGGCCCATATConserved hypothetical protein. 
AK064595TTATGGGCCTTConserved hypothetical protein. 
J065067F11CAGGCCCATAANONE 
J065067F11TACGGCCCATATNONE 
J065067F11TTATGGGCCTTNONE 
J090007D02CAGGCCCATAANONE 
J090007D02TACGGCCCATATNONE 
J090007D02TTATGGGCCTTNONE 
J100035G10CAGGCCCATAANONE 
J100035G10TACGGCCCATATNONE 
J100035G10TTATGGGCCTTNONE 
J100077J10CAGGCCCATAANONE 
J100077J10TACGGCCCATATNONE 
J100077J10TTATGGGCCTTNONE 
Os12g0136600AK064762TTATGGGCCTConserved hypothetical protein. 
J075198J21TTATGGGCCTNONE 
J080024B04TTATGGGCCTNONE 
J080042H13TTATGGGCCTNONE 
J080042J18TTATGGGCCTNONE 
J080068A13TTATGGGCCTNONE 
J080076G10TTATGGGCCTNONE 
J080076H12TTATGGGCCTNONE 
J080097E20TTATGGGCCTNONE 
J080097L07TTATGGGCCTNONE 
J090049I08TTATGGGCCTNONE 
Os12g0150100009-047-B11GAGGCCCATAANONE 
AK105075GAGGCCCATAASimilar to 60S ribosomal protein L26A. 
J013067G22GAGGCCCATAANONE 
J033103F08GAGGCCCATAANONE 
J065029P11GAGGCCCATAANONE 
J065043B18GAGGCCCATAANONE 
J065123E16GAGGCCCATAANONE 
J065141O20GAGGCCCATAANONE 
J065161O04GAGGCCCATAANONE 
J065201M07GAGGCCCATAANONE 
J075058I23GAGGCCCATAANONE 
J075172J08GAGGCCCATAANONE 
J100040L13GAGGCCCATAANONE 
Os12g0569900Os12g0569900TATGGGCCAGASimilar to Zn finger protein (Fragment). 
Os12g0572400016-084-F04GCAGCCCAAACATATGGGCCGCANONE 
AK065531GCAGCCCAAACATATGGGCCGCASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03GCAGCCCAAACATATGGGCCGCANONE 
J013034H02GCAGCCCAAACATATGGGCCGCANONE 
J033117N05GCAGCCCAAACATATGGGCCGCANONE 
J065027L09GCAGCCCAAACATATGGGCCGCANONE 
J065037D09GCAGCCCAAACATATGGGCCGCANONE 
J065197I09GCAGCCCAAACATATGGGCCGCANONE 
J090045C01GCAGCCCAAACATATGGGCCGCANONE 
J100031E11GCAGCCCAAACATATGGGCCGCANONE 
Os12g0574800AK073004TTGGCCCATAANONE 
AK102465TTGGCCCATAABromodomain transcription factor containing protein. 
AK121687TTGGCCCATAANONE 
J033070O18TTGGCCCATAANONE 
J075097O17TTGGCCCATAANONE 
J080069F02TTGGCCCATAANONE 
Os12g0596000AK073530ATATGGGCCGGGCSimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B). 
AK101541ATATGGGCCGGGCNONE 
Os12g0615500015-060-B05TATGGGCCTCNONE 
AK100235TATGGGCCTCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.