version

Summary of OsREG631 (All List)

OrganismOryza sativa  
IDOsREG631  
SequenceGGCCCCAC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count5975  

Entry Sequences (5975 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein. 
J013000E05CACGTGGGGCCCGCANONE 
J013027D08CACGTGGGGCCCGCANONE 
J013045K12CACGTGGGGCCCGCANONE 
J023119M03CACGTGGGGCCCGCANONE 
J065081F02CACGTGGGGCCCGCANONE 
J065180C08CACGTGGGGCCCGCANONE 
J065211M06CACGTGGGGCCCGCANONE 
J075073J06CACGTGGGGCCCGCANONE 
J075123A18CACGTGGGGCCCGCANONE 
J075124A07CACGTGGGGCCCGCANONE 
J075187B05CACGTGGGGCCCGCANONE 
Os01g0138900AK058378TGTGGGGCCCAGTAMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE 
006-081-C11CCCGTGGGCCCCACACNONE 
009-050-D04CCCGTGGGCCCCACACNONE 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18CCCGTGGGCCCCACACNONE 
J023112H22CCCGTGGGCCCCACACNONE 
J065048P05CCCGTGGGCCCCACACNONE 
J100068N20CCCGTGGGCCCCACACNONE 
J100073A02CCCGTGGGCCCCACACNONE 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
J033107B12CAGGTGGGCCCCACCNONE 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0250900AK065179GGTCCACGGGCCGGCCCCACHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
AK065179TGTGGGCCCCACGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
J013002D15GGTCCACGGGCCGGCCCCACNONE 
J013002D15TGTGGGCCCCACGNONE 
J013037K03GGTCCACGGGCCGGCCCCACNONE 
J013037K03TGTGGGCCCCACGNONE 
J013091F03GGTCCACGGGCCGGCCCCACNONE 
J013091F03TGTGGGCCCCACGNONE 
J013127B14GGTCCACGGGCCGGCCCCACNONE 
J013127B14TGTGGGCCCCACGNONE 
Os01g0253500J100088F12CGGGCCCCACGTConserved hypothetical protein. 
Os01g0254900AK068204CGTGTGGGGCCCGGASimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530CGTGTGGGGCCCGGANONE 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0270100006-096-H09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-009-C10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-054-E06GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
014-085-F09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK073275GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK104155GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J033025K21GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075065H10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075143G10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J100059J02GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
Os01g0272600015-046-G06CTCGGCCCCACACNONE 
AK067786CTCGGCCCCACACConserved hypothetical protein. 
Os01g0273800AK109645GGCCCCACAFAD dependent oxidoreductase family protein. 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0277700006-081-F10AGGTGGGCCCCACCNONE 
014-013-D02AGGTGGGCCCCACCNONE 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
AK099198AGGTGGGCCCCACCNONE 
J023115B14AGGTGGGCCCCACCNONE 
J065017F22AGGTGGGCCCCACCNONE 
J065090C03AGGTGGGCCCCACCNONE 
J065165H07AGGTGGGCCCCACCNONE 
Os01g0281100AK109672TGTGGGGCCConserved hypothetical protein. 
J065013K07TGTGGGGCCNONE 
J065040E15TGTGGGGCCNONE 
J065127F12TGTGGGGCCNONE 
J075155K23TGTGGGGCCNONE 
Os01g0293100AK106850GTCAGTGGGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os01g0323600J023095C13GGGTGGGCCCCACTCCNONE 
Os01g0327500AK107756TGTGGGGCCCACTConserved hypothetical protein. 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
J013033M01GGGTGGGCCCCACACGNONE 
J013159H24GGGTGGGCCCCACACGNONE 
J023008E13GGGTGGGCCCCACACGNONE 
J023030I11GGGTGGGCCCCACACGNONE 
J065137G08GGGTGGGCCCCACACGNONE 
J065139H16GGGTGGGCCCCACACGNONE 
J065154K13GGGTGGGCCCCACACGNONE 
J075176C02GGGTGGGCCCCACACGNONE 
Os01g0558600006-120-G12GGGTGGGCCCCACGNONE 
J013100N20GGGTGGGCCCCACGNONE 
J033043P09GGGTGGGCCCCACGNONE 
J033125M18GGGTGGGCCCCACGNONE 
J053043N11GGGTGGGCCCCACGNONE 
J065008E07GGGTGGGCCCCACGNONE 
J065080O16GGGTGGGCCCCACGNONE 
J075002G24GGGTGGGCCCCACGNONE 
J075123C09GGGTGGGCCCCACGNONE 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0580300AK063468GCGGGCCCCACCTGTCConserved hypothetical protein. 
Os01g0581300AK066182TTCGTGGGGCCCSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TTCGTGGGGCCCNONE 
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE 
AJ251563TGCGGGCCCCACTGACAGNONE 
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel. 
AK104055TGCGGGCCCCACTGACAGNONE 
AK104419TGCGGGCCCCACTGACAGNONE 
J023057A07TGCGGGCCCCACTGACAGNONE 
J023068C08TGCGGGCCCCACTGACAGNONE 
J023148E24TGCGGGCCCCACTGACAGNONE 
J090045O22TGCGGGCCCCACTGACAGNONE 
J090045P03TGCGGGCCCCACTGACAGNONE 
J090050C18TGCGGGCCCCACTGACAGNONE 
J100023F01TGCGGGCCCCACTGACAGNONE 
J100051I18TGCGGGCCCCACTGACAGNONE 
J100060P17TGCGGGCCCCACTGACAGNONE 
Os01g0596700AK107371AACGGGCCCCACGFBD domain containing protein. 
Os01g0612600004-008-D07TGCGGGCCCCACTGACNONE 
009-057-C09TGCGGGCCCCACTGACNONE 
009-130-C01TGCGGGCCCCACTGACNONE 
AK062906TGCGGGCCCCACTGACNONE 
AK066561TGCGGGCCCCACTGACProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCCCACTGACNONE 
J013073D14TGCGGGCCCCACTGACNONE 
J023014A21TGCGGGCCCCACTGACNONE 
J023073M13TGCGGGCCCCACTGACNONE 
J023079F02TGCGGGCCCCACTGACNONE 
J023083B16TGCGGGCCCCACTGACNONE 
J023090G19TGCGGGCCCCACTGACNONE 
J023095F15TGCGGGCCCCACTGACNONE 
J023119H11TGCGGGCCCCACTGACNONE 
J033040B01TGCGGGCCCCACTGACNONE 
J033044F13TGCGGGCCCCACTGACNONE 
J033081E23TGCGGGCCCCACTGACNONE 
J033121K07TGCGGGCCCCACTGACNONE 
J033124D11TGCGGGCCCCACTGACNONE 
J033131N22TGCGGGCCCCACTGACNONE 
J065179E10TGCGGGCCCCACTGACNONE 
J090020A13TGCGGGCCCCACTGACNONE 
J090045K17TGCGGGCCCCACTGACNONE 
J090047M24TGCGGGCCCCACTGACNONE 
J090064G23TGCGGGCCCCACTGACNONE 
J090084G08TGCGGGCCCCACTGACNONE 
J090086F18TGCGGGCCCCACTGACNONE 
J100032D09TGCGGGCCCCACTGACNONE 
J100037O18TGCGGGCCCCACTGACNONE 
J100042B03TGCGGGCCCCACTGACNONE 
J100061D06TGCGGGCCCCACTGACNONE 
J100061I03TGCGGGCCCCACTGACNONE 
J100063B17TGCGGGCCCCACTGACNONE 
Os01g0635400AK102655CGTGGGGCCCCASimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
AK111923CGTGGGGCCCCANONE 
Os01g0645000AK108658GCGGGCCCCACGSimilar to TIS11 protein (dTIS11). 
Os01g0654500013-057-E05CAAGTGGGCCCCACGNONE 
AF155333CAAGTGGGCCCCACGNONE 
AK061752CAAGTGGGCCCCACGSimilar to NADP-isocitrate dehydrogenase. 
D21069CAAGTGGGCCCCACGNONE 
Os01g0667900013-097-A02GCGTCGCGCGGGCCCCACCNONE 
014-011-C01GCGTCGCGCGGGCCCCACCNONE 
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein. 
J065156F10GCGTCGCGCGGGCCCCACCNONE 
J065163D22GCGTCGCGCGGGCCCCACCNONE 
J065197J04GCGTCGCGCGGGCCCCACCNONE 
J075122C02GCGTCGCGCGGGCCCCACCNONE 
J100047L16GCGTCGCGCGGGCCCCACCNONE 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0706000006-098-D12TGTGGGCCCCACANONE 
AK059936TGTGGGCCCCACASimilar to RNA polymerase II transcriptional coactivator KELP. 
AK070545TGTGGGCCCCACANONE 
AK104192TGTGGGCCCCACANONE 
J023055M24TGTGGGCCCCACANONE 
J033102J04TGTGGGCCCCACANONE 
J065050P18TGTGGGCCCCACANONE 
J065076D07TGTGGGCCCCACANONE 
J065078O14TGTGGGCCCCACANONE 
J065104L13TGTGGGCCCCACANONE 
J065115J23TGTGGGCCCCACANONE 
J065143P08TGTGGGCCCCACANONE 
J065178N17TGTGGGCCCCACANONE 
J065179H14TGTGGGCCCCACANONE 
J065187J06TGTGGGCCCCACANONE 
J075047B18TGTGGGCCCCACANONE 
Os01g0716200AK062106TCTGGCCCCACCIQ calmodulin-binding region domain containing protein. 
AK098920TCTGGCCCCACCNONE 
J013002N06TCTGGCCCCACCNONE 
J013050O19TCTGGCCCCACCNONE 
J013074N19TCTGGCCCCACCNONE 
J013127F17TCTGGCCCCACCNONE 
J013155C17TCTGGCCCCACCNONE 
J013158K07TCTGGCCCCACCNONE 
J053086D01TCTGGCCCCACCNONE 
Os01g0719400012-066-H10GGCCCCACTTGNONE 
AK063516GGCCCCACTTGConserved hypothetical protein. 
Os01g0745400AK107872GGCCCCACASec34-like protein family protein. 
Os01g0757400AB110177GCCGGCCCCACCAACNONE 
AB110177GCGGGCCCCACCAACNONE 
AK058626GCCGGCCCCACCAACNONE 
AK058626GCGGGCCCCACCAACNONE 
AK102585GCCGGCCCCACCAACNONE 
AK102585GCGGGCCCCACCAACNONE 
AK105474GCCGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK105474GCGGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
J033098E22GCCGGCCCCACCAACNONE 
J033098E22GCGGGCCCCACCAACNONE 
J033105O19GCCGGCCCCACCAACNONE 
J033105O19GCGGGCCCCACCAACNONE 
J065019C21GCCGGCCCCACCAACNONE 
J065019C21GCGGGCCCCACCAACNONE 
J090082H11GCCGGCCCCACCAACNONE 
J090082H11GCGGGCCCCACCAACNONE 
J100050B19GCCGGCCCCACCAACNONE 
J100050B19GCGGGCCCCACCAACNONE 
J100078H19GCCGGCCCCACCAACNONE 
J100078H19GCGGGCCCCACCAACNONE 
Os01g0758400AK059301CAGGTGGGGCCCNONE 
AK071777CAGGTGGGGCCCSimilar to Phosphatidate cytidylyltransferase (EC 2.7.7.41) (CDP-diglyceride synthetase) (CDP-diglyceride pyrophosphorylase) (CDP-diacylglycerol synthase) (CDS) (CTP:phosphatidate cytidylyltransferase) (CDP-DAG synthase) (CDP-DG synthetase). 
Os01g0764000006-021-G03GGCCCCACACNONE 
006-025-C07GGCCCCACACNONE 
006-029-G11GGCCCCACACNONE 
006-030-C04GGCCCCACACNONE 
006-035-E05GGCCCCACACNONE 
006-037-G01GGCCCCACACNONE 
006-038-C01GGCCCCACACNONE 
006-039-G05GGCCCCACACNONE 
006-042-E11GGCCCCACACNONE 
006-044-H04GGCCCCACACNONE 
006-045-A10GGCCCCACACNONE 
006-045-C05GGCCCCACACNONE 
006-047-A11GGCCCCACACNONE 
006-048-H10GGCCCCACACNONE 
006-050-C01GGCCCCACACNONE 
006-050-H11GGCCCCACACNONE 
006-051-G10GGCCCCACACNONE 
006-051-G11GGCCCCACACNONE 
006-056-B04GGCCCCACACNONE 
006-063-F04GGCCCCACACNONE 
006-063-H12GGCCCCACACNONE 
006-065-G09GGCCCCACACNONE 
006-067-F11GGCCCCACACNONE 
006-073-D10GGCCCCACACNONE 
006-074-G09GGCCCCACACNONE 
006-075-D04GGCCCCACACNONE 
006-077-C10GGCCCCACACNONE 
006-082-A10GGCCCCACACNONE 
006-084-C12GGCCCCACACNONE 
006-085-F05GGCCCCACACNONE 
006-087-H12GGCCCCACACNONE 
006-092-E10GGCCCCACACNONE 
006-094-C06GGCCCCACACNONE 
006-096-G11GGCCCCACACNONE 
006-097-H11GGCCCCACACNONE 
006-101-A07GGCCCCACACNONE 
006-101-G08GGCCCCACACNONE 
006-110-E08GGCCCCACACNONE 
006-111-D04GGCCCCACACNONE 
006-116-H04GGCCCCACACNONE 
AK058894GGCCCCACACNONE 
AK059818GGCCCCACACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GGCCCCACACNONE 
J013119N15GGCCCCACACNONE 
J013123P15GGCCCCACACNONE 
J023055F24GGCCCCACACNONE 
J023125K17GGCCCCACACNONE 
J053050A20GGCCCCACACNONE 
J053056P10GGCCCCACACNONE 
J053074D19GGCCCCACACNONE 
J053078A14GGCCCCACACNONE 
J053086P10GGCCCCACACNONE 
J053094N23GGCCCCACACNONE 
J053095M23GGCCCCACACNONE 
J065006D02GGCCCCACACNONE 
J065030A17GGCCCCACACNONE 
J065030K04GGCCCCACACNONE 
J065035L12GGCCCCACACNONE 
J065046E12GGCCCCACACNONE 
J065065H19GGCCCCACACNONE 
J065073C01GGCCCCACACNONE 
J065105F01GGCCCCACACNONE 
J065131N16GGCCCCACACNONE 
J065144O13GGCCCCACACNONE 
J065160E12GGCCCCACACNONE 
J065160K02GGCCCCACACNONE 
J065163F09GGCCCCACACNONE 
J065165E18GGCCCCACACNONE 
J065174E04GGCCCCACACNONE 
J065175O08GGCCCCACACNONE 
J065191N24GGCCCCACACNONE 
J065193D19GGCCCCACACNONE 
J065198D04GGCCCCACACNONE 
J065200G09GGCCCCACACNONE 
J075016L06GGCCCCACACNONE 
J075017J11GGCCCCACACNONE 
J075019L08GGCCCCACACNONE 
J075028M08GGCCCCACACNONE 
J075029K05GGCCCCACACNONE 
J075039K04GGCCCCACACNONE 
J075047J22GGCCCCACACNONE 
J075079H13GGCCCCACACNONE 
J075095K14GGCCCCACACNONE 
J075111D21GGCCCCACACNONE 
J075131A19GGCCCCACACNONE 
J075147G20GGCCCCACACNONE 
J075158F11GGCCCCACACNONE 
J075166N10GGCCCCACACNONE 
J075196G09GGCCCCACACNONE 
J075198I24GGCCCCACACNONE 
J090001L08GGCCCCACACNONE 
J090026G07GGCCCCACACNONE 
J090050M15GGCCCCACACNONE 
J090071A01GGCCCCACACNONE 
J090072P16GGCCCCACACNONE 
J090078D22GGCCCCACACNONE 
J090089C18GGCCCCACACNONE 
J100019B07GGCCCCACACNONE 
J100019H15GGCCCCACACNONE 
J100019P09GGCCCCACACNONE 
J100023A16GGCCCCACACNONE 
J100023B09GGCCCCACACNONE 
J100026O18GGCCCCACACNONE 
J100027E09GGCCCCACACNONE 
J100028F22GGCCCCACACNONE 
J100029P05GGCCCCACACNONE 
J100031M19GGCCCCACACNONE 
J100032A11GGCCCCACACNONE 
J100036G19GGCCCCACACNONE 
J100038E22GGCCCCACACNONE 
J100040A12GGCCCCACACNONE 
J100040L02GGCCCCACACNONE 
J100043O13GGCCCCACACNONE 
J100045E20GGCCCCACACNONE 
J100046H18GGCCCCACACNONE 
J100047E08GGCCCCACACNONE 
J100050E08GGCCCCACACNONE 
J100050P14GGCCCCACACNONE 
J100051G10GGCCCCACACNONE 
J100052L12GGCCCCACACNONE 
J100056G24GGCCCCACACNONE 
J100066B15GGCCCCACACNONE 
J100068O15GGCCCCACACNONE 
J100070J16GGCCCCACACNONE 
J100074I22GGCCCCACACNONE 
J100075M12GGCCCCACACNONE 
J100077M09GGCCCCACACNONE 
J100077O14GGCCCCACACNONE 
J100079J08GGCCCCACACNONE 
J100080I16GGCCCCACACNONE 
Os01g0767600AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
J013131M12GGTGGGGCCCACGGNONE 
J023027B15GGTGGGGCCCACGGNONE 
J023059I06GGTGGGGCCCACGGNONE 
J023095L05GGTGGGGCCCACGGNONE 
J033033E20GGTGGGGCCCACGGNONE 
J033105F24GGTGGGGCCCACGGNONE 
J033148N05GGTGGGGCCCACGGNONE 
J065060H14GGTGGGGCCCACGGNONE 
J090093E17GGTGGGGCCCACGGNONE 
Os01g0776700J065046N20CATCCCCCGGCCCCACACGConserved hypothetical protein. 
J100086L02CATCCCCCGGCCCCACACGNONE 
Os01g0778700AK064933GGTGGGGCCCACCAConserved hypothetical protein. 
Os01g0780500AF225922GGCCCCACCTGTCNONE 
AK068498GGCCCCACCTGTCSCAMP family protein. 
J013157H06GGCCCCACCTGTCNONE 
J033088P18GGCCCCACCTGTCNONE 
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein. 
Os01g0801500AK060529CGTGGGGCCCBeta-1,3-glucanase precursor. 
AK099192CGTGGGGCCCNONE 
J023110B18CGTGGGGCCCNONE 
Os01g0812200003-009-E06GGTGGGGCCCACCTNONE 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AK104334GGTGGGGCCCACCTNONE 
J013030E13GGTGGGGCCCACCTNONE 
J013169M21GGTGGGGCCCACCTNONE 
J023012J16GGTGGGGCCCACCTNONE 
J023103F22GGTGGGGCCCACCTNONE 
J023123A01GGTGGGGCCCACCTNONE 
J023131F07GGTGGGGCCCACCTNONE 
J023146I01GGTGGGGCCCACCTNONE 
J033040K02GGTGGGGCCCACCTNONE 
J033079F06GGTGGGGCCCACCTNONE 
J033105G06GGTGGGGCCCACCTNONE 
J033117E08GGTGGGGCCCACCTNONE 
J043030C01GGTGGGGCCCACCTNONE 
J053043H16GGTGGGGCCCACCTNONE 
J053061H01GGTGGGGCCCACCTNONE 
J065044A03GGTGGGGCCCACCTNONE 
J065068E12GGTGGGGCCCACCTNONE 
J065069D09GGTGGGGCCCACCTNONE 
J065143M19GGTGGGGCCCACCTNONE 
J065193C10GGTGGGGCCCACCTNONE 
J065209D07GGTGGGGCCCACCTNONE 
J090083C17GGTGGGGCCCACCTNONE 
J090086G06GGTGGGGCCCACCTNONE 
J090093I09GGTGGGGCCCACCTNONE 
J100023G21GGTGGGGCCCACCTNONE 
J100025D15GGTGGGGCCCACCTNONE 
J100034B13GGTGGGGCCCACCTNONE 
J100040F10GGTGGGGCCCACCTNONE 
J100051E15GGTGGGGCCCACCTNONE 
J100056L08GGTGGGGCCCACCTNONE 
J100057H04GGTGGGGCCCACCTNONE 
J100085K20GGTGGGGCCCACCTNONE 
J100088G21GGTGGGGCCCACCTNONE 
Os01g0826400AK107199CACGGCCCCACGWRKY transcription factor 24 (WRKY24). 
AY341849CACGGCCCCACGNONE 
AY676925CACGGCCCCACGNONE 
AY870608CACGGCCCCACGNONE 
Os01g0829266J065010C18TGTGGGGCCCCACTCTNONE 
J065037A22TGTGGGGCCCCACTCTNONE 
J065044B02TGTGGGGCCCCACTCTConserved hypothetical protein. 
J065044B10TGTGGGGCCCCACTCTNONE 
J065051A06TGTGGGGCCCCACTCTNONE 
J065073E06TGTGGGGCCCCACTCTNONE 
J065074I11TGTGGGGCCCCACTCTNONE 
J065086D22TGTGGGGCCCCACTCTNONE 
J065104H10TGTGGGGCCCCACTCTNONE 
J065107C05TGTGGGGCCCCACTCTNONE 
J065124H16TGTGGGGCCCCACTCTNONE 
J065165F22TGTGGGGCCCCACTCTNONE 
J065169B11TGTGGGGCCCCACTCTNONE 
J065172G21TGTGGGGCCCCACTCTNONE 
J065191E05TGTGGGGCCCCACTCTNONE 
J065191F18TGTGGGGCCCCACTCTNONE 
Os01g0838725J065088G05GGCCCCACCTGNONE 
J065135D24GGCCCCACCTGConserved hypothetical protein. 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment). 
AK102882CCACCAACTGGGCCCCACANONE 
AK103686CCACCAACTGGGCCCCACANONE 
Os01g0852500015-058-H06TGTGGGGCCCGNONE 
AK069637TGTGGGGCCCGELM2 domain containing protein. 
AK100453TGTGGGGCCCGNONE 
Os01g0858900AK107493GACGGCCCCACCTGTCGlycosyl transferase, family 29 protein. 
J065097H23GACGGCCCCACCTGTCNONE 
J100070A02GACGGCCCCACCTGTCNONE 
J100072M10GACGGCCCCACCTGTCNONE 
Os01g0860700009-026-D05GGTGGGGCCCACANONE 
AK062402GGTGGGGCCCACAConserved hypothetical protein. 
Os01g0865100016-066-A05AGTGGGCCCCACCNONE 
016-066-A05TCCGGGCCCCACCNONE 
AK065779AGTGGGCCCCACCNONE 
AK065779TCCGGGCCCCACCNONE 
AK071410AGTGGGCCCCACCSimilar to Uricase (Fragment). 
AK071410TCCGGGCCCCACCSimilar to Uricase (Fragment). 
J013039E23AGTGGGCCCCACCNONE 
J013039E23TCCGGGCCCCACCNONE 
J023024I07AGTGGGCCCCACCNONE 
J023024I07TCCGGGCCCCACCNONE 
J065160J15AGTGGGCCCCACCNONE 
J065160J15TCCGGGCCCCACCNONE 
J090052J17AGTGGGCCCCACCNONE 
J090052J17TCCGGGCCCCACCNONE 
Os01g0867900AK061366ACTGACAGGTGGGGCCProtein of unknown function DUF502 family protein. 
Os01g0869000AK067351CGGGTGGGGCCCACCGCCCACGCCCAAACNONE 
AK121602CGGGTGGGGCCCACCGCCCACGCCCAAACProtein of unknown function DUF639 family protein. 
Os01g0874700011-001-F02ACGTGGGCCCCACCNONE 
012-048-H01ACGTGGGCCCCACCNONE 
012-094-B02ACGTGGGCCCCACCNONE 
AK073077ACGTGGGCCCCACCNONE 
AK105447ACGTGGGCCCCACCNONE 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
J100026G07ACGTGGGCCCCACCNONE 
J100030F07ACGTGGGCCCCACCNONE 
J100066J18ACGTGGGCCCCACCNONE 
J100077G12ACGTGGGCCCCACCNONE 
J100081K23ACGTGGGCCCCACCNONE 
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein. 
J065066N18CCACTGACATGTGGGCCCCACANONE 
Os01g0884400AK072566GGTGGGGCCCU box domain containing protein. 
Os01g0897200AK061505GGGCCCCACCTGTCAGTGNONE 
AK065055GGGCCCCACCTGTCAGTGNONE 
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GGGCCCCACCTGTCAGTGNONE 
AK121862GGGCCCCACCTGTCAGTGNONE 
J013001J04GGGCCCCACCTGTCAGTGNONE 
J033103A19GGGCCCCACCTGTCAGTGNONE 
J075005P18GGGCCCCACCTGTCAGTGNONE 
J090027D12GGGCCCCACCTGTCAGTGNONE 
J090032M01GGGCCCCACCTGTCAGTGNONE 
J090079K10GGGCCCCACCTGTCAGTGNONE 
J100018O17GGGCCCCACCTGTCAGTGNONE 
J100080H14GGGCCCCACCTGTCAGTGNONE 
J100088D08GGGCCCCACCTGTCAGTGNONE 
Os01g0897600J065120F23TGTGGGGCCNONE 
Os01g0904200AK068432GGCCCCACCProtein kinase-like domain containing protein. 
J100027C22GGCCCCACCNONE 
J100064A19GGCCCCACCNONE 
Os01g0911700012-079-H01GGCCCCACNONE 
012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05GGCCCCACNONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01GGCCCCACNONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07GGCCCCACNONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12GGCCCCACNONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03GGCCCCACNONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805GGCCCCACSimilar to Regulatory protein viviparous-1. 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441GGCCCCACNONE 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02GGCCCCACNONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01GGCCCCACNONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CACTGACAGGTGGGGCCGGANONE 
J013109E03CACTGACAGGTGGGGCCGGANONE 
J023081J12CACTGACAGGTGGGGCCGGANONE 
J023091E24CACTGACAGGTGGGGCCGGANONE 
J033022A01CACTGACAGGTGGGGCCGGANONE 
J033074C13CACTGACAGGTGGGGCCGGANONE 
J065199E03CACTGACAGGTGGGGCCGGANONE 
J075172O04CACTGACAGGTGGGGCCGGANONE 
J090007G18CACTGACAGGTGGGGCCGGANONE 
J090052B17CACTGACAGGTGGGGCCGGANONE 
J090074H01CACTGACAGGTGGGGCCGGANONE 
J100043J09CACTGACAGGTGGGGCCGGANONE 
J100059J05CACTGACAGGTGGGGCCGGANONE 
Os01g0931300012-055-E05CCTGGGCCCCACANONE 
012-055-E05GGCCCCACCNONE 
012-055-E05GGGCCCCACCNONE 
AK068196CCTGGGCCCCACATafazzin family protein. 
AK068196GGCCCCACCTafazzin family protein. 
AK068196GGGCCCCACCTafazzin family protein. 
AK099213CCTGGGCCCCACANONE 
AK099213GGCCCCACCNONE 
AK099213GGGCCCCACCNONE 
Os01g0934300AK072640CCTGGGCCCCACNONE 
J013073H18CCTGGGCCCCACNONE 
J023133P13CCTGGGCCCCACNONE 
J075098G20CCTGGGCCCCACNONE 
Os01g0939600AK068569GGTGGGGCCSimilar to Glycerol-3-phosphate dehydrogenase-like protein (Fragment). 
Os01g0952600AK067525CAGGTGGGGCCCAGATNONE 
AK070047CAGGTGGGGCCCAGATSimilar to LacZ (Fragment). 
Os01g0961200011-099-H06GGCCCCACACNONE 
AK105424GGCCCCACACCBS domain containing protein. 
J065169J18GGCCCCACACNONE 
J075109H12GGCCCCACACNONE 
Os01g0965800AK107795AACTGGGCCCCACTCTConserved hypothetical protein. 
Os01g0966400AK103064AGTGGGCCCCACALeucine-rich repeat, SDS22 containing protein. 
J023043O12AGTGGGCCCCACANONE 
J053084D04AGTGGGCCCCACANONE 
J090021L08AGTGGGCCCCACANONE 
Os02g0102900012-093-F04GGTGGGGCCNONE 
AK070603GGTGGGGCCSimilar to RuBisCO subunit binding-protein beta subunit, chloroplast (60 kDa chaperonin beta subunit) (CPN-60 beta) (Fragment). 
AK101537GGTGGGGCCNONE 
J013021H14GGTGGGGCCNONE 
J013162G08GGTGGGGCCNONE 
J023001E11GGTGGGGCCNONE 
J023059D06GGTGGGGCCNONE 
J023064K16GGTGGGGCCNONE 
J033022K15GGTGGGGCCNONE 
J033025O05GGTGGGGCCNONE 
J033035H05GGTGGGGCCNONE 
J033037A05GGTGGGGCCNONE 
J033066D15GGTGGGGCCNONE 
J033073N13GGTGGGGCCNONE 
J033088A22GGTGGGGCCNONE 
J033111I24GGTGGGGCCNONE 
J033114F06GGTGGGGCCNONE 
J033120I01GGTGGGGCCNONE 
J043001I24GGTGGGGCCNONE 
J090049O14GGTGGGGCCNONE 
J090061B20GGTGGGGCCNONE 
J090063P20GGTGGGGCCNONE 
J090073G18GGTGGGGCCNONE 
Os02g0109200AK108815GGCCCCACCNONE 
J100030O18GGCCCCACCNONE 
Os02g0121100012-035-F06GGCCCCACCCGNONE 
013-031-H05GGCCCCACCCGNONE 
013-058-E11GGCCCCACCCGNONE 
014-010-D01GGCCCCACCCGNONE 
AK070711GGCCCCACCCGConserved hypothetical protein. 
AK119758GGCCCCACCCGNONE 
J013033G12GGCCCCACCCGNONE 
J023007M16GGCCCCACCCGNONE 
J023020K20GGCCCCACCCGNONE 
J023061H10GGCCCCACCCGNONE 
J033027H20GGCCCCACCCGNONE 
J033051E18GGCCCCACCCGNONE 
J090005F12GGCCCCACCCGNONE 
J090017A20GGCCCCACCCGNONE 
J090018G11GGCCCCACCCGNONE 
J090062C18GGCCCCACCCGNONE 
J100027N10GGCCCCACCCGNONE 
J100032L14GGCCCCACCCGNONE 
J100045C14GGCCCCACCCGNONE 
J100061M09GGCCCCACCCGNONE 
J100062K11GGCCCCACCCGNONE 
J100064H11GGCCCCACCCGNONE 
J100074H16GGCCCCACCCGNONE 
J100082N01GGCCCCACCCGNONE 
Os02g0123200016-017-F04AGGTGGGCCCCACCTGNONE 
J033057C03AGGTGGGCCCCACCTGNONE 
J033087C11AGGTGGGCCCCACCTGNONE 
J033108J20AGGTGGGCCCCACCTGNONE 
J043015P08AGGTGGGCCCCACCTGNONE 
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE 
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE 
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE 
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE 
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE 
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE 
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE 
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE 
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE 
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE 
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE 
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE 
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE 
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE 
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE 
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE 
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE 
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE 
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE 
Os02g0129800AK109213GTGGTGGGGCCConserved hypothetical protein. 
Os02g0137800AK060530ACCGGGCCCCACCCCCCAConserved hypothetical protein. 
AK101629ACCGGGCCCCACCCCCCANONE 
J065195A10ACCGGGCCCCACCCCCCANONE 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
Os02g0149700AK103492GGGCCCCACAExo70 exocyst complex subunit family protein. 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0177700AK119941CAAGTGGGCCCCACCProtein of unknown function DUF588 family protein. 
Os02g0186500AK068056GGGCCCCACCSimilar to Protein kinase-like protein. 
AK099031GGGCCCCACCNONE 
J013111A12GGGCCCCACCNONE 
J013127K13GGGCCCCACCNONE 
J013132O11GGGCCCCACCNONE 
J023056A11GGGCCCCACCNONE 
J023078M08GGGCCCCACCNONE 
J033081F07GGGCCCCACCNONE 
J090079E24GGGCCCCACCNONE 
J090097I02GGGCCCCACCNONE 
Os02g0192500AK059580CAAGTGGGGCCNONE 
Os02g0198200J075078L15CGTGGGGCCCGCANONE 
J075097G10CGTGGGGCCCGCANONE 
J075099N12CGTGGGGCCCGCANONE 
J075142K24CGTGGGGCCCGCANONE 
J075199K14CGTGGGGCCCGCANONE 
Os02g0202600AK068376ACTGGGCCCCACCTGNONE 
AK099277ACTGGGCCCCACCTGNONE 
AK101844ACTGGGCCCCACCTGTetratricopeptide-like helical domain containing protein. 
J080001G13ACTGGGCCCCACCTGNONE 
J080011J23ACTGGGCCCCACCTGNONE 
J080015F12ACTGGGCCCCACCTGNONE 
J080017J03ACTGGGCCCCACCTGNONE 
J080030J24ACTGGGCCCCACCTGNONE 
J080038H02ACTGGGCCCCACCTGNONE 
J080041G13ACTGGGCCCCACCTGNONE 
J080044B13ACTGGGCCCCACCTGNONE 
J080044L10ACTGGGCCCCACCTGNONE 
J080046H11ACTGGGCCCCACCTGNONE 
J080057J01ACTGGGCCCCACCTGNONE 
J080062E13ACTGGGCCCCACCTGNONE 
J080062N11ACTGGGCCCCACCTGNONE 
J080063C17ACTGGGCCCCACCTGNONE 
J080064K11ACTGGGCCCCACCTGNONE 
J080064N09ACTGGGCCCCACCTGNONE 
J080067C17ACTGGGCCCCACCTGNONE 
J080067C23ACTGGGCCCCACCTGNONE 
J080069J21ACTGGGCCCCACCTGNONE 
J080070L23ACTGGGCCCCACCTGNONE 
J080085N15ACTGGGCCCCACCTGNONE 
J080094F03ACTGGGCCCCACCTGNONE 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0219900004-018-E11CCGTGGGCCCCACCCCCCACACNONE 
AK060915CCGTGGGCCCCACCCCCCACACNONE 
AK099194CCGTGGGCCCCACCCCCCACACNONE 
AK104206CCGTGGGCCCCACCCCCCACACNONE 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07CCGTGGGCCCCACCCCCCACACNONE 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0282600AK070262GTGTGGGCCCCACAConserved hypothetical protein. 
AK070262GTGTGGGGCCCACAConserved hypothetical protein. 
J023041L18GTGTGGGCCCCACANONE 
J023041L18GTGTGGGGCCCACANONE 
Os02g0282900AK121560GGTGGGGCCSimilar to 68 kDa protein HP68. 
Os02g0288200AK073147CCCGGCCCCACGCGTNONE 
AK102886CCCGGCCCCACGCGTConserved hypothetical protein. 
Os02g0316200AK073932GGCCCCACACyclin-like F-box domain containing protein. 
AK105757GGCCCCACANONE 
J023039G03GGCCCCACANONE 
J033076K03GGCCCCACANONE 
J075157J22GGCCCCACANONE 
J090097K02GGCCCCACANONE 
J100053F10GGCCCCACANONE 
Os02g0317400AK061254GGCCCCACAClathrin adaptor complex, small chain family protein. 
AK073474GGCCCCACANONE 
J033045O22GGCCCCACANONE 
J053023I18GGCCCCACANONE 
J053034H01GGCCCCACANONE 
J053034M24GGCCCCACANONE 
J065005K14GGCCCCACANONE 
J065092O13GGCCCCACANONE 
J065101K24GGCCCCACANONE 
J065174G18GGCCCCACANONE 
J065203J19GGCCCCACANONE 
J065218B15GGCCCCACANONE 
J090064B16GGCCCCACANONE 
Os02g0326700AK064977GGCCGGGCCCCACGRhomboid-like protein family protein. 
Os02g0438700012-040-C07GCGGGCCCCACACNONE 
AK062610GCGGGCCCCACACNONE 
AK105276GCGGGCCCCACACConserved hypothetical protein. 
J065104J01GCGGGCCCCACACNONE 
Os02g0460200004-018-C06GGCCCCACCNONE 
004-018-C06GGGCCCCACCNONE 
AK060911GGCCCCACCNONE 
AK060911GGGCCCCACCNONE 
AK065150GGCCCCACCConserved hypothetical protein. 
AK065150GGGCCCCACCConserved hypothetical protein. 
AK104536GGCCCCACCNONE 
AK104536GGGCCCCACCNONE 
J013002B08GGCCCCACCNONE 
J013002B08GGGCCCCACCNONE 
J075002P07GGCCCCACCNONE 
J075002P07GGGCCCCACCNONE 
J080003O09GGCCCCACCNONE 
J080003O09GGGCCCCACCNONE 
J080022O16GGCCCCACCNONE 
J080022O16GGGCCCCACCNONE 
J080027J03GGCCCCACCNONE 
J080027J03GGGCCCCACCNONE 
J080040A05GGCCCCACCNONE 
J080040A05GGGCCCCACCNONE 
J080051N22GGCCCCACCNONE 
J080051N22GGGCCCCACCNONE 
J080072G20GGCCCCACCNONE 
J080072G20GGGCCCCACCNONE 
J080077E08GGCCCCACCNONE 
J080077E08GGGCCCCACCNONE 
J080086I15GGCCCCACCNONE 
J080086I15GGGCCCCACCNONE 
J080087C19GGCCCCACCNONE 
J080087C19GGGCCCCACCNONE 
J080096E18GGCCCCACCNONE 
J080096E18GGGCCCCACCNONE 
Os02g0475300AK072737CCCCCGCGTCGTGGGCCCCACCTGNONE 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
Os02g0491400AK073233CCCGGCCCCACCTGTCSimilar to Peptidylprolyl isomerase. 
J090046J15CCCGGCCCCACCTGTCNONE 
Os02g0498650J075129C20GGCCCCACCTGConserved hypothetical protein. 
J090063B16GGCCCCACCTGNONE 
J090081H04GGCCCCACCTGNONE 
J090087C03GGCCCCACCTGNONE 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
Os02g0534600Os02g0534600TGTGGGGCCCACAConserved hypothetical protein. 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0559300AK100088AGTGGGCCCCACCCCGTCCGANONE 
AK121206AGTGGGCCCCACCCCGTCCGAProtein kinase-like domain containing protein. 
J023003H24AGTGGGCCCCACCCCGTCCGANONE 
J023088A16AGTGGGCCCCACCCCGTCCGANONE 
J023100K01AGTGGGCCCCACCCCGTCCGANONE 
J023127H24AGTGGGCCCCACCCCGTCCGANONE 
Os02g0562300AK073250ACCGGGCCCCACGTCalmodulin binding protein-like family protein. 
Os02g0564000AJ486976GGTGGGGCCCACCTGTCNONE 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
J065021E14GGTGGGGCCCACCTGTCNONE 
J065139E02GGTGGGGCCCACCTGTCNONE 
J065165G05GGTGGGGCCCACCTGTCNONE 
J065181H16GGTGGGGCCCACCTGTCNONE 
J065217K07GGTGGGGCCCACCTGTCNONE 
J065218L13GGTGGGGCCCACCTGTCNONE 
J100082K21GGTGGGGCCCACCTGTCNONE 
J100084K19GGTGGGGCCCACCTGTCNONE 
Os02g0564100006-072-A11GACAGGTGGGCCCCACCNONE 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK105951GACAGGTGGGCCCCACCNONE 
J100045C15GACAGGTGGGCCCCACCNONE 
Os02g0566400AK101019GGGCCCCACCTGConserved hypothetical protein. 
Os02g0578800009-044-A06CCGTGGGCCCCACANONE 
009-044-A06TGTGGGGCCCACTNONE 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
AK070066TGTGGGGCCCACTProtein of unknown function DUF962 family protein. 
Os02g0601800AB060276GGCCCCACACGNONE 
AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539GGCCCCACACGNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873GGCCCCACACGBromodomain containing protein. 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801GGCCCCACACGNONE 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758GGCCCCACACGNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891GGCCCCACACGNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01GGCCCCACACGNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08GGCCCCACACGNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04GGCCCCACACGNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12GGCCCCACACGNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16GGCCCCACACGNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10GGCCCCACACGNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22GGCCCCACACGNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19GGCCCCACACGNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24GGCCCCACACGNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18GGCCCCACACGNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18GGCCCCACACGNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08GGCCCCACACGNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24GGCCCCACACGNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06GGCCCCACACGNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12GGCCCCACACGNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13GGCCCCACACGNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18GGCCCCACACGNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21GGCCCCACACGNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15GGCCCCACACGNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10GGCCCCACACGNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02GGCCCCACACGNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18GGCCCCACACGNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04GGCCCCACACGNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11GGCCCCACACGNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20GGCCCCACACGNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01GGCCCCACACGNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12GGCCCCACACGNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09GGCCCCACACGNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16GGCCCCACACGNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15GGCCCCACACGNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16GGCCCCACACGNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0608500AK071922GACGGCCCCACCCGNONE 
AK099756GACGGCCCCACCCGSimilar to Ankyrin-kinase protein (Fragment). 
Os02g0629000009-047-E10CCCGGGCCCCACCCGNONE 
AK062480CCCGGGCCCCACCCGProtein of unknown function DUF584 family protein. 
Os02g0649300014-043-A05GGTGGGGCCCACGCGTNONE 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0658500012-083-D01CTCGGCCCCACGNONE 
016-061-E08CTCGGCCCCACGNONE 
AK099591CTCGGCCCCACGConserved hypothetical protein. 
AK107591CTCGGCCCCACGNONE 
J013043M11CTCGGCCCCACGNONE 
J100025J18CTCGGCCCCACGNONE 
J100059C10CTCGGCCCCACGNONE 
Os02g0677700AK119947TGTGGGCCCCACANONE 
Os02g0686300AK066567TGTGGGGCCConserved hypothetical protein. 
Os02g0686700AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
Os02g0698100009-089-H10TGTGGGCCCCACGNONE 
AK060614TGTGGGCCCCACGGalactose oxidase, central domain containing protein. 
J090039P20TGTGGGCCCCACGNONE 
Os02g0715300006-052-F10GGCCCCACCNONE 
006-099-G08GGCCCCACCNONE 
006-120-A02GGCCCCACCNONE 
009-114-D11GGCCCCACCNONE 
009-134-G11GGCCCCACCNONE 
009-151-H05GGCCCCACCNONE 
009-194-A09GGCCCCACCNONE 
AK059816GGCCCCACCConserved hypothetical protein. 
AK069489GGCCCCACCNONE 
J023024J01GGCCCCACCNONE 
J065087M04GGCCCCACCNONE 
J065089E20GGCCCCACCNONE 
J065137K15GGCCCCACCNONE 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0735200015-035-A06GGCCCCACANONE 
015-048-A05GGCCCCACANONE 
015-091-A06GGCCCCACANONE 
016-082-G07GGCCCCACANONE 
016-086-G04GGCCCCACANONE 
AB037595GGCCCCACANONE 
AK061157GGCCCCACANONE 
AK071969GGCCCCACANONE 
AK104987GGCCCCACANONE 
AK109397GGCCCCACAGlutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clone lambda-GS28). 
X14245GGCCCCACANONE 
Os02g0741100AK068712GGTGGGGCCCACASimilar to Chaperone protein dnaJ 16 (Protein ARG1-LIKE1) (AtARL1) (AtJ16) (AtDjB16). 
AK071144GGTGGGGCCCACANONE 
J065056A02GGTGGGGCCCACANONE 
J065212F10GGTGGGGCCCACANONE 
J080005J10GGTGGGGCCCACANONE 
J080013A11GGTGGGGCCCACANONE 
J080015E01GGTGGGGCCCACANONE 
J080022G23GGTGGGGCCCACANONE 
J080025C13GGTGGGGCCCACANONE 
J080026P14GGTGGGGCCCACANONE 
J080027D22GGTGGGGCCCACANONE 
J080027G13GGTGGGGCCCACANONE 
J080027L23GGTGGGGCCCACANONE 
J080027N23GGTGGGGCCCACANONE 
J080028F21GGTGGGGCCCACANONE 
J080028J18GGTGGGGCCCACANONE 
J080028P22GGTGGGGCCCACANONE 
J080038P04GGTGGGGCCCACANONE 
J080042M11GGTGGGGCCCACANONE 
J080043B19GGTGGGGCCCACANONE 
J080045J23GGTGGGGCCCACANONE 
J080047B06GGTGGGGCCCACANONE 
J080052F04GGTGGGGCCCACANONE 
J080057F01GGTGGGGCCCACANONE 
J080057G03GGTGGGGCCCACANONE 
J080060H12GGTGGGGCCCACANONE 
J080061L12GGTGGGGCCCACANONE 
J080062J17GGTGGGGCCCACANONE 
J080062M22GGTGGGGCCCACANONE 
J080072C01GGTGGGGCCCACANONE 
J080075F01GGTGGGGCCCACANONE 
J080076A09GGTGGGGCCCACANONE 
J080076I01GGTGGGGCCCACANONE 
J080077D01GGTGGGGCCCACANONE 
J080077F19GGTGGGGCCCACANONE 
J080079L19GGTGGGGCCCACANONE 
J080088B03GGTGGGGCCCACANONE 
J080090J15GGTGGGGCCCACANONE 
J080092J21GGTGGGGCCCACANONE 
J080095J12GGTGGGGCCCACANONE 
J090012C05GGTGGGGCCCACANONE 
J090039K19GGTGGGGCCCACANONE 
J090078L12GGTGGGGCCCACANONE 
Os02g0743500AK100319GGCCCCACGTGTCSimilar to EDR1. 
AK102767GGCCCCACGTGTCNONE 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AF395537GGCCCCACANONE 
AF395537GGTGGGGCCCACTTGNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AJ308110GGCCCCACANONE 
AJ308110GGTGGGGCCCACTTGNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
AK066446GGCCCCACASimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
AK066446GGTGGGGCCCACTTGSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0750500AK101960GTGTCACTGACATGTGGGGCCTGGSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GTGTCACTGACATGTGGGGCCTGGNONE 
J065054F02GTGTCACTGACATGTGGGGCCTGGNONE 
J065124N03GTGTCACTGACATGTGGGGCCTGGNONE 
J090001H12GTGTCACTGACATGTGGGGCCTGGNONE 
J100057J01GTGTCACTGACATGTGGGGCCTGGNONE 
J100062F12GTGTCACTGACATGTGGGGCCTGGNONE 
Os02g0766700AK072062CCCGGCCCCACSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2). 
J100073F09CCCGGCCCCACNONE 
Os02g0767500005-017-F10AACGGGCCCCACACGNONE 
AB016065AACGGGCCCCACACGNONE 
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter. 
J013020K11AACGGGCCCCACACGNONE 
J013066I18AACGGGCCCCACACGNONE 
J023012D02AACGGGCCCCACACGNONE 
J023020J16AACGGGCCCCACACGNONE 
J023022H13AACGGGCCCCACACGNONE 
J023044N15AACGGGCCCCACACGNONE 
J023067E15AACGGGCCCCACACGNONE 
J023079C06AACGGGCCCCACACGNONE 
J023080B07AACGGGCCCCACACGNONE 
J023081G11AACGGGCCCCACACGNONE 
J023091H22AACGGGCCCCACACGNONE 
J023092J03AACGGGCCCCACACGNONE 
J023114D02AACGGGCCCCACACGNONE 
J023121J15AACGGGCCCCACACGNONE 
J023128G10AACGGGCCCCACACGNONE 
J023132B15AACGGGCCCCACACGNONE 
J023140G10AACGGGCCCCACACGNONE 
J023142B10AACGGGCCCCACACGNONE 
J033026C15AACGGGCCCCACACGNONE 
J033029F21AACGGGCCCCACACGNONE 
J033037I09AACGGGCCCCACACGNONE 
J033046D11AACGGGCCCCACACGNONE 
J033081L20AACGGGCCCCACACGNONE 
J033097J19AACGGGCCCCACACGNONE 
J033125D19AACGGGCCCCACACGNONE 
J033125I04AACGGGCCCCACACGNONE 
J033141M21AACGGGCCCCACACGNONE 
J033143K08AACGGGCCCCACACGNONE 
J053091N01AACGGGCCCCACACGNONE 
J065093C20AACGGGCCCCACACGNONE 
J065104K11AACGGGCCCCACACGNONE 
J065143L16AACGGGCCCCACACGNONE 
J065205I23AACGGGCCCCACACGNONE 
J090057C12AACGGGCCCCACACGNONE 
J090075P11AACGGGCCCCACACGNONE 
Os02g0778200AK065948TCTGGGCCCCACCAminoacyl-tRNA synthetase, class I family protein. 
Os02g0781700006-066-G01GGCCCCACCTGTCAGTGGNONE 
006-066-G01GTGTGGGGCCNONE 
009-034-D03GGCCCCACCTGTCAGTGGNONE 
009-034-D03GTGTGGGGCCNONE 
009-194-D04GGCCCCACCTGTCAGTGGNONE 
009-194-D04GTGTGGGGCCNONE 
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein. 
AK061791GTGTGGGGCCConserved hypothetical protein. 
AK063223GGCCCCACCTGTCAGTGGNONE 
AK063223GTGTGGGGCCNONE 
AY224477GGCCCCACCTGTCAGTGGNONE 
AY224477GTGTGGGGCCNONE 
J013045H09GGCCCCACCTGTCAGTGGNONE 
J013045H09GTGTGGGGCCNONE 
J013061I22GGCCCCACCTGTCAGTGGNONE 
J013061I22GTGTGGGGCCNONE 
J013071F11GGCCCCACCTGTCAGTGGNONE 
J013071F11GTGTGGGGCCNONE 
J023130H07GGCCCCACCTGTCAGTGGNONE 
J023130H07GTGTGGGGCCNONE 
J043036K23GGCCCCACCTGTCAGTGGNONE 
J043036K23GTGTGGGGCCNONE 
J065010N07GGCCCCACCTGTCAGTGGNONE 
J065010N07GTGTGGGGCCNONE 
J065219I01GGCCCCACCTGTCAGTGGNONE 
J065219I01GTGTGGGGCCNONE 
J090073I15GGCCCCACCTGTCAGTGGNONE 
J090073I15GTGTGGGGCCNONE 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0801900006-113-E02GGCCCCACNONE 
AK109488GGCCCCACNONE 
AK109498GGCCCCACConserved hypothetical protein. 
J065007D19GGCCCCACNONE 
J065035G11GGCCCCACNONE 
J065044E05GGCCCCACNONE 
J065112N01GGCCCCACNONE 
J065143B03GGCCCCACNONE 
J065159A16GGCCCCACNONE 
J090007K23GGCCCCACNONE 
J090045N09GGCCCCACNONE 
J090049L20GGCCCCACNONE 
Os02g0804900J065051L05CGTGTGGGGCCNONE 
J065069D19CGTGTGGGGCCNONE 
J065073L01CGTGTGGGGCCNONE 
J065147K04CGTGTGGGGCCNONE 
J065166D17CGTGTGGGGCCNONE 
Os02g0817500AK072707CGGGCCCCACCACKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135CGGGCCCCACCACNONE 
U46758CGGGCCCCACCACNONE 
Os02g0817600006-085-G03GACAGGTGGGGCCCAGGNONE 
006-085-G03TTGTGGGCCCCACANONE 
AJ748648GACAGGTGGGGCCCAGGNONE 
AJ748648TTGTGGGCCCCACANONE 
AK069892GACAGGTGGGGCCCAGGAUX/IAA protein family protein. 
AK069892TTGTGGGCCCCACAAUX/IAA protein family protein. 
AK104501GACAGGTGGGGCCCAGGNONE 
AK104501TTGTGGGCCCCACANONE 
AK104802GACAGGTGGGGCCCAGGNONE 
AK104802TTGTGGGCCCCACANONE 
J013027H10GACAGGTGGGGCCCAGGNONE 
J013027H10TTGTGGGCCCCACANONE 
J013106L07GACAGGTGGGGCCCAGGNONE 
J013106L07TTGTGGGCCCCACANONE 
J013118N15GACAGGTGGGGCCCAGGNONE 
J013118N15TTGTGGGCCCCACANONE 
J013131H01GACAGGTGGGGCCCAGGNONE 
J013131H01TTGTGGGCCCCACANONE 
J013170C08GACAGGTGGGGCCCAGGNONE 
J013170C08TTGTGGGCCCCACANONE 
J023060C13GACAGGTGGGGCCCAGGNONE 
J023060C13TTGTGGGCCCCACANONE 
J033024K10GACAGGTGGGGCCCAGGNONE 
J033024K10TTGTGGGCCCCACANONE 
J033052I08GACAGGTGGGGCCCAGGNONE 
J033052I08TTGTGGGCCCCACANONE 
J090010H15GACAGGTGGGGCCCAGGNONE 
J090010H15TTGTGGGCCCCACANONE 
J090011J11GACAGGTGGGGCCCAGGNONE 
J090011J11TTGTGGGCCCCACANONE 
J090038P15GACAGGTGGGGCCCAGGNONE 
J090038P15TTGTGGGCCCCACANONE 
J090060B02GACAGGTGGGGCCCAGGNONE 
J090060B02TTGTGGGCCCCACANONE 
J100079J16GACAGGTGGGGCCCAGGNONE 
J100079J16TTGTGGGCCCCACANONE 
Os02g0817900AK068163GGCCCCACGTCytochrome P450 family protein. 
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE 
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa. 
AK103235GCGGGCCCCACGTGTCNONE 
Os03g0113900AK107900GTGTGGGCCCCACCProtein of unknown function DUF584 family protein. 
AK119700GTGTGGGCCCCACCNONE 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
AK106076ACGCGTGGGCCCCACCNONE 
J023003G19ACGCGTGGGCCCCACCNONE 
Os03g0130100AK110783GGCCCCACTCCSimilar to Acyl-activating enzyme 11. 
J065172I17GGCCCCACTCCNONE 
Os03g0138600Os03g0138600CGGGTGGGGCCProtein of unknown function DUF810 family protein. 
Os03g0138600GCCGGGCCCCACCACProtein of unknown function DUF810 family protein. 
Os03g0143600AB110188TGTGGGGCCNONE 
AK068424TGTGGGGCCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464TGTGGGGCCNONE 
AY224545TGTGGGGCCNONE 
J013154F02TGTGGGGCCNONE 
Os03g0151900009-084-F09GGCCCCACANONE 
009-084-F09GTGGGGCCCACTNONE 
AB032761GGCCCCACANONE 
AB032761GTGGGGCCCACTNONE 
AK105389GGCCCCACANONE 
AK105389GTGGGGCCCACTNONE 
AK121527GGCCCCACASimilar to Small GTP-binding protein. 
AK121527GTGGGGCCCACTSimilar to Small GTP-binding protein. 
J075028M03GGCCCCACANONE 
J075028M03GTGGGGCCCACTNONE 
J075031H15GGCCCCACANONE 
J075031H15GTGGGGCCCACTNONE 
J075045L24GGCCCCACANONE 
J075045L24GTGGGGCCCACTNONE 
J075055K14GGCCCCACANONE 
J075055K14GTGGGGCCCACTNONE 
J075100O08GGCCCCACANONE 
J075100O08GTGGGGCCCACTNONE 
J075112B20GGCCCCACANONE 
J075112B20GTGGGGCCCACTNONE 
J075188D21GGCCCCACANONE 
J075188D21GTGGGGCCCACTNONE 
Os03g0152000AK102357GGCCCCACCHeavy metal transport/detoxification protein domain containing protein. 
J023072F16GGCCCCACCNONE 
J033091H19GGCCCCACCNONE 
J065037B07GGCCCCACCNONE 
J065087E11GGCCCCACCNONE 
J065098H09GGCCCCACCNONE 
J065105L15GGCCCCACCNONE 
J065165N20GGCCCCACCNONE 
J065166C14GGCCCCACCNONE 
J065183M01GGCCCCACCNONE 
J065187C11GGCCCCACCNONE 
J075001H11GGCCCCACCNONE 
J075044D12GGCCCCACCNONE 
J075088L19GGCCCCACCNONE 
J075124A10GGCCCCACCNONE 
J075155D14GGCCCCACCNONE 
J075173I10GGCCCCACCNONE 
J090009D11GGCCCCACCNONE 
J090056G24GGCCCCACCNONE 
J100028I24GGCCCCACCNONE 
J100029D09GGCCCCACCNONE 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
J065192P15AGGTGGGCCCCACGAANONE 
Os03g0156500011-075-F02CGCGGGGGGGTGGGCCCCACACNONE 
012-077-G10CGCGGGGGGGTGGGCCCCACACNONE 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
J013088H17CGCGGGGGGGTGGGCCCCACACNONE 
J013135G21CGCGGGGGGGTGGGCCCCACACNONE 
J033050E10CGCGGGGGGGTGGGCCCCACACNONE 
J033050J01CGCGGGGGGGTGGGCCCCACACNONE 
J033129N23CGCGGGGGGGTGGGCCCCACACNONE 
J065085L16CGCGGGGGGGTGGGCCCCACACNONE 
J065101B19CGCGGGGGGGTGGGCCCCACACNONE 
J065167N03CGCGGGGGGGTGGGCCCCACACNONE 
J090009O21CGCGGGGGGGTGGGCCCCACACNONE 
J090049D11CGCGGGGGGGTGGGCCCCACACNONE 
J100017F23CGCGGGGGGGTGGGCCCCACACNONE 
J100040E12CGCGGGGGGGTGGGCCCCACACNONE 
J100055O18CGCGGGGGGGTGGGCCCCACACNONE 
J100061K08CGCGGGGGGGTGGGCCCCACACNONE 
J100072M05CGCGGGGGGGTGGGCCCCACACNONE 
J100077B08CGCGGGGGGGTGGGCCCCACACNONE 
J100086G03CGCGGGGGGGTGGGCCCCACACNONE 
Os03g0168200AK099530TGTGGGGCCGAAConserved hypothetical protein. 
Os03g0169500Os03g0169500CTGGGGCCCCACCTGTCSimilar to Cellulose synthase-like A4. 
Os03g0169600004-013-C11CCGTGGGCCCCACCACNONE 
011-035-C04CCGTGGGCCCCACCACNONE 
AK060900CCGTGGGCCCCACCACNONE 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
AK104523CCGTGGGCCCCACCACNONE 
AY224429CCGTGGGCCCCACCACNONE 
J013026L11CCGTGGGCCCCACCACNONE 
J013026N04CCGTGGGCCCCACCACNONE 
J013030D16CCGTGGGCCCCACCACNONE 
J013049P17CCGTGGGCCCCACCACNONE 
J013099D17CCGTGGGCCCCACCACNONE 
J013114M09CCGTGGGCCCCACCACNONE 
J013124F12CCGTGGGCCCCACCACNONE 
J013131J05CCGTGGGCCCCACCACNONE 
J023025M09CCGTGGGCCCCACCACNONE 
J090042J08CCGTGGGCCCCACCACNONE 
J090094F11CCGTGGGCCCCACCACNONE 
J100051I17CCGTGGGCCCCACCACNONE 
Os03g0169800AK068278GGTGGGCCCCACCTGTHNH nuclease domain containing protein. 
Os03g0175600AK059981GTTGGGCCCCACSimilar to Nit protein 2 (CUA002). 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0184100AK067400GGTGGGGCCCAGCHypothetical protein. 
J013030J24GGTGGGGCCCAGCNONE 
J013037M23GGTGGGGCCCAGCNONE 
J013106B15GGTGGGGCCCAGCNONE 
J013130H10GGTGGGGCCCAGCNONE 
J013152B03GGTGGGGCCCAGCNONE 
J013157J24GGTGGGGCCCAGCNONE 
J013157K04GGTGGGGCCCAGCNONE 
J033093A19GGTGGGGCCCAGCNONE 
J033106E24GGTGGGGCCCAGCNONE 
J090043G12GGTGGGGCCCAGCNONE 
Os03g0188200AK058578GGTGGGGCCCACTZinc finger, RING-type domain containing protein. 
Os03g0201600AK067825GGTGGGGCCCACCTGTCNONE 
Os03g0206400AK066494CCTGGGCCCCACConserved hypothetical protein. 
AK107011CCTGGGCCCCACNONE 
J065162G04CCTGGGCCCCACNONE 
Os03g0213600AK100407ACGTGGGGCCCConserved hypothetical protein. 
AK100407TGTGGGGCCCACCConserved hypothetical protein. 
Os03g0238800AY224467GTGGGGCCTGGCCACCAACConserved hypothetical protein. 
J013042E23GTGGGGCCTGGCCACCAACNONE 
Os03g0251500AK101151CTCGGCCCCACANONE 
AK101151GGCCCCACCNONE 
AK119298CTCGGCCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
AK119298GGCCCCACCSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0255200AK058212CAGGTGGGGCCCACTCCNONE 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0262700006-072-A10GGGCCCCACCNONE 
006-075-F12GGGCCCCACCNONE 
006-088-D03GGGCCCCACCNONE 
AK061109GGGCCCCACCHarpin-induced 1 domain containing protein. 
AK099159GGGCCCCACCNONE 
AK099322GGGCCCCACCNONE 
AK104530GGGCCCCACCNONE 
J053024C09GGGCCCCACCNONE 
J075142N24GGGCCCCACCNONE 
J100064C18GGGCCCCACCNONE 
Os03g0278200AK103544GCGGGCCCCACCACNAD-dependent epimerase/dehydratase family protein. 
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCATGGGCCCCACCTGNONE 
J023079P21CCATGGGCCCCACCTGNONE 
J023120G14CCATGGGCCCCACCTGNONE 
J090042F16CCATGGGCCCCACCTGNONE 
Os03g0285900AK073348GGCCCCACASimilar to Splicing factor RSZ33. 
J033025D08GGCCCCACANONE 
J033087M12GGCCCCACANONE 
J065008F11GGCCCCACANONE 
J065059C09GGCCCCACANONE 
J065070J11GGCCCCACANONE 
J065076L20GGCCCCACANONE 
J065083M19GGCCCCACANONE 
J065111I06GGCCCCACANONE 
J065112H18GGCCCCACANONE 
J065112J18GGCCCCACANONE 
J065140C08GGCCCCACANONE 
J065180P06GGCCCCACANONE 
J065187G12GGCCCCACANONE 
J065189B14GGCCCCACANONE 
J090042N02GGCCCCACANONE 
J090087M04GGCCCCACANONE 
Os03g0287900009-074-B07GCGGGCCCCACGTNONE 
014-027-E07GCGGGCCCCACGTNONE 
AK063663GCGGGCCCCACGTSimilar to Protein disulfide isomerase. 
J065009N21GCGGGCCCCACGTNONE 
Os03g0294200AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
AK069285CGTGTGGGGCCCSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0294600AK110762TGTGGGGCCGTGSimilar to Importin-beta1. 
Os03g0297100006-113-D12ATTTGGGCCCCACANONE 
AK061276ATTTGGGCCCCACASimilar to 40S ribosomal protein S7. 
J033119B03ATTTGGGCCCCACANONE 
J065205G10ATTTGGGCCCCACANONE 
J080069C17ATTTGGGCCCCACANONE 
J100069E15ATTTGGGCCCCACANONE 
J100081D07ATTTGGGCCCCACANONE 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0302800AK061293GCGGGCCCCACCCCCCAConserved hypothetical protein. 
AK061293GGGCCCCACCConserved hypothetical protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0305400009-198-D04GGTGGGGCCCACCTGTCNONE 
013-012-C06GGTGGGGCCCACCTGTCNONE 
014-034-D01GGTGGGGCCCACCTGTCNONE 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
J023012O22GGTGGGGCCCACCTGTCNONE 
J023097A13GGTGGGGCCCACCTGTCNONE 
J023107P16GGTGGGGCCCACCTGTCNONE 
J023113C14GGTGGGGCCCACCTGTCNONE 
Os03g0335300AK098846GGTGGGGCCCACCCNONE 
AK098891GGTGGGGCCCACCCNONE 
AK111509GGTGGGGCCCACCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847GGTGGGGCCCACCCNONE 
AK121413GGTGGGGCCCACCCNONE 
Os03g0337600AF119232CAAGTGGGCCCCACCNONE 
AK070859CAAGTGGGCCCCACCSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CAAGTGGGCCCCACCNONE 
J013147M17CAAGTGGGCCCCACCNONE 
J065083M01CAAGTGGGCCCCACCNONE 
J065199H24CAAGTGGGCCCCACCNONE 
Os03g0338600AK066604TGTGGGGCCtRNA pseudouridine synthase family protein. 
Os03g0340500012-007-F10GGCCCCACGTGTCAGTGNONE 
012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE 
AK099406GGCCCCACGTGTCAGTGNONE 
AK099406TGTGGGGCCCACGGGTCAGTGGNONE 
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC 2.4.1.13). 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13GGCCCCACGTGTCAGTGNONE 
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE 
J013063E02GGCCCCACGTGTCAGTGNONE 
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE 
J013063I02GGCCCCACGTGTCAGTGNONE 
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE 
J013157O07GGCCCCACGTGTCAGTGNONE 
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE 
J023131N05GGCCCCACGTGTCAGTGNONE 
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE 
J033033P05GGCCCCACGTGTCAGTGNONE 
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE 
J033040N16GGCCCCACGTGTCAGTGNONE 
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE 
J033044M19GGCCCCACGTGTCAGTGNONE 
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE 
J033086F24GGCCCCACGTGTCAGTGNONE 
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE 
J033097H01GGCCCCACGTGTCAGTGNONE 
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE 
J033106C22GGCCCCACGTGTCAGTGNONE 
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE 
J033128M13GGCCCCACGTGTCAGTGNONE 
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE 
J033133I15GGCCCCACGTGTCAGTGNONE 
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE 
J043027A21GGCCCCACGTGTCAGTGNONE 
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE 
J090028A09GGCCCCACGTGTCAGTGNONE 
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE 
J090053D06GGCCCCACGTGTCAGTGNONE 
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE 
J090083O17GGCCCCACGTGTCAGTGNONE 
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE 
J090099H10GGCCCCACGTGTCAGTGNONE 
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE 
J100036M05GGCCCCACGTGTCAGTGNONE 
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE 
Os03g0342900006-032-D01CCCGTGGGCCCCACNONE 
006-033-E10CCCGTGGGCCCCACNONE 
006-051-G06CCCGTGGGCCCCACNONE 
006-053-E05CCCGTGGGCCCCACNONE 
006-056-B05CCCGTGGGCCCCACNONE 
006-058-F04CCCGTGGGCCCCACNONE 
006-059-E05CCCGTGGGCCCCACNONE 
006-060-F10CCCGTGGGCCCCACNONE 
006-104-D12CCCGTGGGCCCCACNONE 
009-129-C12CCCGTGGGCCCCACNONE 
AK060136CCCGTGGGCCCCACNONE 
AK060980CCCGTGGGCCCCACNONE 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
AK104244CCCGTGGGCCCCACNONE 
AK104391CCCGTGGGCCCCACNONE 
AK104590CCCGTGGGCCCCACNONE 
AK104744CCCGTGGGCCCCACNONE 
AK106100CCCGTGGGCCCCACNONE 
J013000E10CCCGTGGGCCCCACNONE 
J075027O22CCCGTGGGCCCCACNONE 
J075052J03CCCGTGGGCCCCACNONE 
J075066E15CCCGTGGGCCCCACNONE 
J075095C17CCCGTGGGCCCCACNONE 
J075118N05CCCGTGGGCCCCACNONE 
J075187K22CCCGTGGGCCCCACNONE 
J090026L04CCCGTGGGCCCCACNONE 
J090059G16CCCGTGGGCCCCACNONE 
J100055P20CCCGTGGGCCCCACNONE 
J100062A10CCCGTGGGCCCCACNONE 
J100068G20CCCGTGGGCCCCACNONE 
Os03g0352800009-030-G08TGTGGGGCCCACANONE 
AK059673TGTGGGGCCCACASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17TGTGGGGCCCACANONE 
J075050N19TGTGGGGCCCACANONE 
J075104J18TGTGGGGCCCACANONE 
J075142K05TGTGGGGCCCACANONE 
J100050I19TGTGGGGCCCACANONE 
J100057N04TGTGGGGCCCACANONE 
Os03g0356484009-038-H01ACCGGGCCCCACANONE 
AK105146ACCGGGCCCCACATetratricopeptide-like helical domain containing protein. 
J065204G11ACCGGGCCCCACANONE 
Os03g0370000AK100033CCTGGGCCCCACCACSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
AK100033GGTGGGGCCCACCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0374400016-027-B12GGCCGGGCCCCACCCGNONE 
AK069719GGCCGGGCCCCACCCGConserved hypothetical protein. 
J023020L05GGCCGGGCCCCACCCGNONE 
J023026H16GGCCGGGCCCCACCCGNONE 
J033025P22GGCCGGGCCCCACCCGNONE 
J075016I21GGCCGGGCCCCACCCGNONE 
J090015G21GGCCGGGCCCCACCCGNONE 
Os03g0374500Os03g0374500GGCCGGGCCCCACCCGHypothetical protein. 
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein. 
J023010L17CAACGGCCCCACATGTCAGTGGNONE 
Os03g0387100AB026559GGCCCCACANONE 
AF022735GGCCCCACANONE 
AK058567GGCCCCACAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195GGCCCCACANONE 
J033030J15GGCCCCACANONE 
J033102N16GGCCCCACANONE 
J065056E08GGCCCCACANONE 
J065112M11GGCCCCACANONE 
J065170H07GGCCCCACANONE 
J075003P17GGCCCCACANONE 
J075074D06GGCCCCACANONE 
J075127F20GGCCCCACANONE 
J075129I01GGCCCCACANONE 
J075178A10GGCCCCACANONE 
J090071P12GGCCCCACANONE 
J100090D18GGCCCCACANONE 
Os03g0393900AK069809GGCCCCACASimilar to S.tuberosum patatin (Fragment). 
J023030J03GGCCCCACANONE 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0588600AK109508GGCCCCACCFrigida-like family protein. 
Os03g0588700Os03g0588700GCGGGCCCCACACConserved hypothetical protein. 
Os03g0588700GGCCCCACCConserved hypothetical protein. 
Os03g0633800AK073044CCCGGGCCCCACCTGTCSimilar to IAA6 (Fragment). 
AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22CCCGGGCCCCACCTGTCNONE 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13CCCGGGCCCCACCTGTCNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
AK068169ACGTGGGCCCCACANONE 
Os03g0639800AK103237GGCCCCACASnf7 family protein. 
AK103237GGCCCCACCSnf7 family protein. 
J023036L02GGCCCCACANONE 
J023036L02GGCCCCACCNONE 
J033108L13GGCCCCACANONE 
J033108L13GGCCCCACCNONE 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
AK108010AGTGGGCCCCACCACNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0669200J013037D23CAGGTGGGCCCCACANONE 
J013037D23GCGGGCCCCACGTNONE 
J023026K09CAGGTGGGCCCCACANONE 
J023026K09GCGGGCCCCACGTNONE 
J075008E21CAGGTGGGCCCCACANONE 
J075008E21GCGGGCCCCACGTNONE 
J075061B21CAGGTGGGCCCCACANONE 
J075061B21GCGGGCCCCACGTNONE 
J075151B13CAGGTGGGCCCCACANONE 
J075151B13GCGGGCCCCACGTNONE 
J075195L02CAGGTGGGCCCCACANONE 
J075195L02GCGGGCCCCACGTNONE 
J090061B07CAGGTGGGCCCCACANONE 
J090061B07GCGGGCCCCACGTNONE 
Os03g0670200011-069-G05TGTGGGCCCCACCGATCCGNONE 
AK069553TGTGGGCCCCACCGATCCGSimilar to YJR013Wp (Fragment). 
J023020O11TGTGGGCCCCACCGATCCGNONE 
J023114J22TGTGGGCCCCACCGATCCGNONE 
J100084F17TGTGGGCCCCACCGATCCGNONE 
J100087A11TGTGGGCCCCACCGATCCGNONE 
Os03g0684400AK100086AACTGGGCCCCACCMg2+ transporter protein, CorA-like family protein. 
Os03g0685500009-034-F03GGCCCCACANONE 
009-034-F03TCTGGCCCCACANONE 
009-081-B02GGCCCCACANONE 
009-081-B02TCTGGCCCCACANONE 
AB110171GGCCCCACANONE 
AB110171TCTGGCCCCACANONE 
AK062080GGCCCCACACHCH domain containing protein. 
AK062080TCTGGCCCCACACHCH domain containing protein. 
AK120726GGCCCCACANONE 
AK120726TCTGGCCCCACANONE 
J013099K19GGCCCCACANONE 
J013099K19TCTGGCCCCACANONE 
J023002L22GGCCCCACANONE 
J023002L22TCTGGCCCCACANONE 
J023052G18GGCCCCACANONE 
J023052G18TCTGGCCCCACANONE 
J023057J22GGCCCCACANONE 
J023057J22TCTGGCCCCACANONE 
J023095A10GGCCCCACANONE 
J023095A10TCTGGCCCCACANONE 
J033097N07GGCCCCACANONE 
J033097N07TCTGGCCCCACANONE 
J033132H15GGCCCCACANONE 
J033132H15TCTGGCCCCACANONE 
J065064M10GGCCCCACANONE 
J065064M10TCTGGCCCCACANONE 
J065069C22GGCCCCACANONE 
J065069C22TCTGGCCCCACANONE 
J065202I16GGCCCCACANONE 
J065202I16TCTGGCCCCACANONE 
J065214M17GGCCCCACANONE 
J065214M17TCTGGCCCCACANONE 
J075007E07GGCCCCACANONE 
J075007E07TCTGGCCCCACANONE 
J075016A20GGCCCCACANONE 
J075016A20TCTGGCCCCACANONE 
J075036C08GGCCCCACANONE 
J075036C08TCTGGCCCCACANONE 
J075057C03GGCCCCACANONE 
J075057C03TCTGGCCCCACANONE 
J075064H21GGCCCCACANONE 
J075064H21TCTGGCCCCACANONE 
J075078B13GGCCCCACANONE 
J075078B13TCTGGCCCCACANONE 
J075078D01GGCCCCACANONE 
J075078D01TCTGGCCCCACANONE 
J075087P03GGCCCCACANONE 
J075087P03TCTGGCCCCACANONE 
J075091N16GGCCCCACANONE 
J075091N16TCTGGCCCCACANONE 
J075110P14GGCCCCACANONE 
J075110P14TCTGGCCCCACANONE 
J075116J17GGCCCCACANONE 
J075116J17TCTGGCCCCACANONE 
J075148J23GGCCCCACANONE 
J075148J23TCTGGCCCCACANONE 
J075171C20GGCCCCACANONE 
J075171C20TCTGGCCCCACANONE 
J075175K20GGCCCCACANONE 
J075175K20TCTGGCCCCACANONE 
J080035F24GGCCCCACANONE 
J080035F24TCTGGCCCCACANONE 
J080058E06GGCCCCACANONE 
J080058E06TCTGGCCCCACANONE 
J080086E16GGCCCCACANONE 
J080086E16TCTGGCCCCACANONE 
J080301L22GGCCCCACANONE 
J080301L22TCTGGCCCCACANONE 
J080304O06GGCCCCACANONE 
J080304O06TCTGGCCCCACANONE 
J080305N09GGCCCCACANONE 
J080305N09TCTGGCCCCACANONE 
J080306J16GGCCCCACANONE 
J080306J16TCTGGCCCCACANONE 
J080306N17GGCCCCACANONE 
J080306N17TCTGGCCCCACANONE 
J080311O12GGCCCCACANONE 
J080311O12TCTGGCCCCACANONE 
J080315L06GGCCCCACANONE 
J080315L06TCTGGCCCCACANONE 
J080317H12GGCCCCACANONE 
J080317H12TCTGGCCCCACANONE 
J080317O05GGCCCCACANONE 
J080317O05TCTGGCCCCACANONE 
J080318L22GGCCCCACANONE 
J080318L22TCTGGCCCCACANONE 
J090065J21GGCCCCACANONE 
J090065J21TCTGGCCCCACANONE 
J090070G13GGCCCCACANONE 
J090070G13TCTGGCCCCACANONE 
J100028F03GGCCCCACANONE 
J100028F03TCTGGCCCCACANONE 
J100073D05GGCCCCACANONE 
J100073D05TCTGGCCCCACANONE 
Os03g0698900013-074-A08CGGGCCCCACCAACNONE 
013-074-A08TGGGGCCCCACGNONE 
AK073303CGGGCCCCACCAACAlkaline phytoceramidase family protein. 
AK073303TGGGGCCCCACGAlkaline phytoceramidase family protein. 
AK103953CGGGCCCCACCAACNONE 
AK103953TGGGGCCCCACGNONE 
J033024P22CGGGCCCCACCAACNONE 
J033024P22TGGGGCCCCACGNONE 
J065194N16CGGGCCCCACCAACNONE 
J065194N16TGGGGCCCCACGNONE 
J065195O11CGGGCCCCACCAACNONE 
J065195O11TGGGGCCCCACGNONE 
J075020F03CGGGCCCCACCAACNONE 
J075020F03TGGGGCCCCACGNONE 
J075032P18CGGGCCCCACCAACNONE 
J075032P18TGGGGCCCCACGNONE 
J075037H13CGGGCCCCACCAACNONE 
J075037H13TGGGGCCCCACGNONE 
J075147I01CGGGCCCCACCAACNONE 
J075147I01TGGGGCCCCACGNONE 
J075187B13CGGGCCCCACCAACNONE 
J075187B13TGGGGCCCCACGNONE 
J100043G08CGGGCCCCACCAACNONE 
J100043G08TGGGGCCCCACGNONE 
J100060L06CGGGCCCCACCAACNONE 
J100060L06TGGGGCCCCACGNONE 
J100063O21CGGGCCCCACCAACNONE 
J100063O21TGGGGCCCCACGNONE 
J100066O13CGGGCCCCACCAACNONE 
J100066O13TGGGGCCCCACGNONE 
J100072K20CGGGCCCCACCAACNONE 
J100072K20TGGGGCCCCACGNONE 
J100083G21CGGGCCCCACCAACNONE 
J100083G21TGGGGCCCCACGNONE 
J100085D07CGGGCCCCACCAACNONE 
J100085D07TGGGGCCCCACGNONE 
Os03g0712200AK073205GTGGTGGGGCCCAACZinc finger, RanBP2-type domain containing protein. 
AK098968GTGGTGGGGCCCAACNONE 
Os03g0713100J013039M09GGCCCCACANONE 
J023007K01GGCCCCACANONE 
J023073H01GGCCCCACANONE 
J023087M20GGCCCCACANONE 
J023142E01GGCCCCACANONE 
J033048E03GGCCCCACANONE 
J033048F03GGCCCCACASimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11GGCCCCACANONE 
J033074M20GGCCCCACANONE 
J033084M11GGCCCCACANONE 
J033091I23GGCCCCACANONE 
J033100C08GGCCCCACANONE 
J033123K19GGCCCCACANONE 
J090006P21GGCCCCACANONE 
J090045O16GGCCCCACANONE 
J100087M13GGCCCCACANONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0716200GGCCCCACCConserved hypothetical protein. 
Os03g0741400AK121838GGCCCCACCSimilar to SUSIBA2. 
J100032E12GGCCCCACCNONE 
Os03g0745600014-030-E09CCTGGGCCCCACANONE 
J053057E07CCTGGGCCCCACANONE 
J075044L08CCTGGGCCCCACANONE 
J075069C24CCTGGGCCCCACANONE 
J075127J02CCTGGGCCCCACAProtein of unknown function UPF0005 family protein. 
J075180G21CCTGGGCCCCACANONE 
J075189M22CCTGGGCCCCACANONE 
J075192P11CCTGGGCCCCACANONE 
Os03g0758800AJ252135GCCGTTGGGTGGGCCCCACGTNONE 
AJ312906GCCGTTGGGTGGGCCCCACGTNONE 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GCCGTTGGGTGGGCCCCACGTNONE 
J023109G09GCCGTTGGGTGGGCCCCACGTNONE 
J033038B14GCCGTTGGGTGGGCCCCACGTNONE 
J043013C09GCCGTTGGGTGGGCCCCACGTNONE 
J053096E21GCCGTTGGGTGGGCCCCACGTNONE 
J065026B08GCCGTTGGGTGGGCCCCACGTNONE 
J065062B16GCCGTTGGGTGGGCCCCACGTNONE 
J065066E03GCCGTTGGGTGGGCCCCACGTNONE 
J065091J12GCCGTTGGGTGGGCCCCACGTNONE 
J065164A06GCCGTTGGGTGGGCCCCACGTNONE 
J075014I20GCCGTTGGGTGGGCCCCACGTNONE 
J075117N07GCCGTTGGGTGGGCCCCACGTNONE 
J075142M03GCCGTTGGGTGGGCCCCACGTNONE 
J075175D04GCCGTTGGGTGGGCCCCACGTNONE 
J075188M01GCCGTTGGGTGGGCCCCACGTNONE 
J075199I20GCCGTTGGGTGGGCCCCACGTNONE 
J090010J12GCCGTTGGGTGGGCCCCACGTNONE 
J090025O16GCCGTTGGGTGGGCCCCACGTNONE 
J090041H05GCCGTTGGGTGGGCCCCACGTNONE 
J090078P07GCCGTTGGGTGGGCCCCACGTNONE 
J100031K10GCCGTTGGGTGGGCCCCACGTNONE 
J100055F23GCCGTTGGGTGGGCCCCACGTNONE 
J100064G05GCCGTTGGGTGGGCCCCACGTNONE 
J100080C24GCCGTTGGGTGGGCCCCACGTNONE 
J100080O07GCCGTTGGGTGGGCCCCACGTNONE 
J100090F01GCCGTTGGGTGGGCCCCACGTNONE 
Os03g0780600AK120180CCCGTGGGCCCCACGTNONE 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CCCGTGGGCCCCACGTNONE 
J033022G05CCCGTGGGCCCCACGTNONE 
J033028A16CCCGTGGGCCCCACGTNONE 
J033050M08CCCGTGGGCCCCACGTNONE 
J090053F04CCCGTGGGCCCCACGTNONE 
J090064E19CCCGTGGGCCCCACGTNONE 
J090083J24CCCGTGGGCCCCACGTNONE 
J100024I23CCCGTGGGCCCCACGTNONE 
Os03g0784500AK109744ACAGGTGGGGCCCACAANONE 
AK109744GGTGGGCCCCACCACNONE 
Os03g0788800AK071670GTGGGGCCCACGCZinc finger, RING-type domain containing protein. 
J013090J22GTGGGGCCCACGCNONE 
J023050M06GTGGGGCCCACGCNONE 
J023073A12GTGGGGCCCACGCNONE 
J023075P21GTGGGGCCCACGCNONE 
J023106F04GTGGGGCCCACGCNONE 
J075181H19GTGGGGCCCACGCNONE 
J090009C24GTGGGGCCCACGCNONE 
J100027L24GTGGGGCCCACGCNONE 
J100055F06GTGGGGCCCACGCNONE 
J100081C22GTGGGGCCCACGCNONE 
J100084I21GTGGGGCCCACGCNONE 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0793500AK103407GCCCGGCCCCACCACNONE 
AK103407GGCCCCACCTGTCNONE 
AK121620GCCCGGCCCCACCACSimilar to Casein kinase-like protein. 
AK121620GGCCCCACCTGTCSimilar to Casein kinase-like protein. 
Os03g0796600003-113-D10TCGTGGGCCCCACCNONE 
011-076-B12TCGTGGGCCCCACCNONE 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
J075105C03TCGTGGGCCCCACCNONE 
J080036O17TCGTGGGCCCCACCNONE 
J080064E16TCGTGGGCCCCACCNONE 
J080069E03TCGTGGGCCCCACCNONE 
J080079E23TCGTGGGCCCCACCNONE 
J090036H20TCGTGGGCCCCACCNONE 
J100029L10TCGTGGGCCCCACCNONE 
J100055G09TCGTGGGCCCCACCNONE 
Os03g0800500006-075-C12TCCGGCCCCACCNONE 
AK061104TCCGGCCCCACCNONE 
AK070229TCCGGCCCCACCPutative small multi-drug export family protein. 
J065152L13TCCGGCCCCACCNONE 
Os03g0805300004-009-D11GGCCCCACCNONE 
005-014-F01GGCCCCACCNONE 
009-019-H04GGCCCCACCNONE 
AK060885GGCCCCACCSimilar to Phosphoprotein phosphatase 2A isoform 4. 
AK099257GGCCCCACCNONE 
AK100350GGCCCCACCNONE 
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE 
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein. 
AK070287GACACGTGGGGCCCGGCNONE 
J023049O16GACACGTGGGGCCCGGCNONE 
J100025I21GACACGTGGGGCCCGGCNONE 
J100035K21GACACGTGGGGCCCGGCNONE 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
J013059D03CAGGTGGGCCCCACCNONE 
J013099J05CAGGTGGGCCCCACCNONE 
J013106M06CAGGTGGGCCCCACCNONE 
J013151H03CAGGTGGGCCCCACCNONE 
J023003G18CAGGTGGGCCCCACCNONE 
J023038M11CAGGTGGGCCCCACCNONE 
J023056M17CAGGTGGGCCCCACCNONE 
J023105F22CAGGTGGGCCCCACCNONE 
J033023F17CAGGTGGGCCCCACCNONE 
J033028J21CAGGTGGGCCCCACCNONE 
J033131J19CAGGTGGGCCCCACCNONE 
J033132E06CAGGTGGGCCCCACCNONE 
J090007L14CAGGTGGGCCCCACCNONE 
J090011H02CAGGTGGGCCCCACCNONE 
J090026D20CAGGTGGGCCCCACCNONE 
J090029H09CAGGTGGGCCCCACCNONE 
J090033B18CAGGTGGGCCCCACCNONE 
J090039J02CAGGTGGGCCCCACCNONE 
J090050D17CAGGTGGGCCCCACCNONE 
J090050I15CAGGTGGGCCCCACCNONE 
J090063G20CAGGTGGGCCCCACCNONE 
J090064J21CAGGTGGGCCCCACCNONE 
J090071E19CAGGTGGGCCCCACCNONE 
J090075F10CAGGTGGGCCCCACCNONE 
Os03g0811600009-134-B07TGTGGGCCCCACATGTCAGTGNONE 
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H. 
J023078H22TGTGGGCCCCACATGTCAGTGNONE 
Os03g0825700AK067902TGCGGGCCCCACASimilar to Defective in exine formation. 
Os03g0832600AK120137GGTGGGCCCCACASimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0833900AK073655GGTGGGGCCCSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800GGTGGGGCCCNONE 
AK104068GGTGGGGCCCNONE 
J075031J11GGTGGGGCCCNONE 
J075051N01GGTGGGGCCCNONE 
J075166D18GGTGGGGCCCNONE 
J075171E14GGTGGGGCCCNONE 
Os03g0836200009-165-F07CGGGCCCCACANONE 
009-165-F07GGGTGGGCCCCACCTGNONE 
015-092-G01CGGGCCCCACANONE 
015-092-G01GGGTGGGCCCCACCTGNONE 
AK058443CGGGCCCCACANONE 
AK058443GGGTGGGCCCCACCTGNONE 
AK067084CGGGCCCCACASimilar to RNA-binding protein RZ-1. 
AK067084GGGTGGGCCCCACCTGSimilar to RNA-binding protein RZ-1. 
AK101225CGGGCCCCACANONE 
AK101225GGGTGGGCCCCACCTGNONE 
J013092A03CGGGCCCCACANONE 
J013092A03GGGTGGGCCCCACCTGNONE 
J013095N17CGGGCCCCACANONE 
J013095N17GGGTGGGCCCCACCTGNONE 
J013147J18CGGGCCCCACANONE 
J013147J18GGGTGGGCCCCACCTGNONE 
J023019O10CGGGCCCCACANONE 
J023019O10GGGTGGGCCCCACCTGNONE 
J023065N18CGGGCCCCACANONE 
J023065N18GGGTGGGCCCCACCTGNONE 
J033113E18CGGGCCCCACANONE 
J033113E18GGGTGGGCCCCACCTGNONE 
J033133E03CGGGCCCCACANONE 
J033133E03GGGTGGGCCCCACCTGNONE 
J065059J15CGGGCCCCACANONE 
J065059J15GGGTGGGCCCCACCTGNONE 
J065075O11CGGGCCCCACANONE 
J065075O11GGGTGGGCCCCACCTGNONE 
J065119I07CGGGCCCCACANONE 
J065119I07GGGTGGGCCCCACCTGNONE 
J065171J03CGGGCCCCACANONE 
J065171J03GGGTGGGCCCCACCTGNONE 
J090016D21CGGGCCCCACANONE 
J090016D21GGGTGGGCCCCACCTGNONE 
J090081O03CGGGCCCCACANONE 
J090081O03GGGTGGGCCCCACCTGNONE 
J100040G18CGGGCCCCACANONE 
J100040G18GGGTGGGCCCCACCTGNONE 
J100040L10CGGGCCCCACANONE 
J100040L10GGGTGGGCCCCACCTGNONE 
J100055H13CGGGCCCCACANONE 
J100055H13GGGTGGGCCCCACCTGNONE 
J100059I22CGGGCCCCACANONE 
J100059I22GGGTGGGCCCCACCTGNONE 
J100078A08CGGGCCCCACANONE 
J100078A08GGGTGGGCCCCACCTGNONE 
Os03g0844100AK067164TAATGGGCCCCACGTCTCSimilar to Pti1 kinase-like protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
Os03g0858400AK102968GTTGGTGGGGCCGGGWD40-like domain containing protein. 
Os04g0118100006-100-G08GGCCCCACCNONE 
AK058463GGCCCCACCNONE 
J065078C03GGCCCCACCNONE 
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein. 
Os04g0266400AK065632GTGGTGGGCCCCACCACNONE 
AK068202GTGGTGGGCCCCACCACSimilar to AHM2 (Fragment). 
AK072046GTGGTGGGCCCCACCACNONE 
AK105688GTGGTGGGCCCCACCACNONE 
Os04g0271700AK059031ATCCAACGGCCCCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110ATCCAACGGCCCCACCNONE 
AK099145ATCCAACGGCCCCACCNONE 
J065045A03ATCCAACGGCCCCACCNONE 
Os04g0282400AK120187CCCGGGCCCCACACSimilar to FPF1 protein-like (RAA1). 
AK120187GCTGGGCCCCACCSimilar to FPF1 protein-like (RAA1). 
J013034O10CCCGGGCCCCACACNONE 
J013034O10GCTGGGCCCCACCNONE 
J013071G20CCCGGGCCCCACACNONE 
J013071G20GCTGGGCCCCACCNONE 
Os04g0321700003-103-G02AGTGGGCCCCACCNONE 
AK068732AGTGGGCCCCACCSimilar to Serine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
AK099397AGTGGGCCCCACCNONE 
Os04g0382300AK071912AGTGGGCCCCACGNONE 
AK071912TGCGGGCCCCACCNONE 
AK101795AGTGGGCCCCACGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
AK101795TGCGGGCCCCACCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0387600009-148-E01CCCGTGGGGCCCACGCNONE 
009-155-A11CCCGTGGGGCCCACGCNONE 
009-175-F04CCCGTGGGGCCCACGCNONE 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
J065035F12CCCGTGGGGCCCACGCNONE 
J065162C13CCCGTGGGGCCCACGCNONE 
J065169L19CCCGTGGGGCCCACGCNONE 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0399300AK105282ATATGGGCCCCACACSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
Os04g0408900009-183-E05TGTGGGGCCCACANONE 
AK058627TGTGGGGCCCACASimilar to DNA-binding protein S1FA. 
J023014N01TGTGGGGCCCACANONE 
J023088K23TGTGGGGCCCACANONE 
J065086B17TGTGGGGCCCACANONE 
J065095F08TGTGGGGCCCACANONE 
J065119N11TGTGGGGCCCACANONE 
J100032H17TGTGGGGCCCACANONE 
Os04g0412900AK073418ATATGGGCCCCACASec23/Sec24 trunk region domain containing protein. 
AK073418TGTGGGCCCCACCACSec23/Sec24 trunk region domain containing protein. 
J033027C24ATATGGGCCCCACANONE 
J033027C24TGTGGGCCCCACCACNONE 
J033044C16ATATGGGCCCCACANONE 
J033044C16TGTGGGCCCCACCACNONE 
J090023G03ATATGGGCCCCACANONE 
J090023G03TGTGGGCCCCACCACNONE 
J090082C21ATATGGGCCCCACANONE 
J090082C21TGTGGGCCCCACCACNONE 
Os04g0444900AK063657ACCGGGCCCCACACSimilar to Alfin-1. 
AK098960ACCGGGCCCCACACNONE 
J065037L14ACCGGGCCCCACACNONE 
J065037P22ACCGGGCCCCACACNONE 
J065173O15ACCGGGCCCCACACNONE 
Os04g0456700009-080-F10CAGGTGGGCCCCACCCGNONE 
009-143-C10CAGGTGGGCCCCACCCGNONE 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
J013002D12CAGGTGGGCCCCACCCGNONE 
J065027N14CAGGTGGGCCCCACCCGNONE 
J065139E16CAGGTGGGCCCCACCCGNONE 
J065165D09CAGGTGGGCCCCACCCGNONE 
J065179D14CAGGTGGGCCCCACCCGNONE 
J065198C03CAGGTGGGCCCCACCCGNONE 
J065198L22CAGGTGGGCCCCACCCGNONE 
J075139M08CAGGTGGGCCCCACCCGNONE 
J075150D14CAGGTGGGCCCCACCCGNONE 
J075172F01CAGGTGGGCCCCACCCGNONE 
J075197F03CAGGTGGGCCCCACCCGNONE 
J090059E16CAGGTGGGCCCCACCCGNONE 
J100063J01CAGGTGGGCCCCACCCGNONE 
J100085F13CAGGTGGGCCCCACCCGNONE 
J100088O10CAGGTGGGCCCCACCCGNONE 
Os04g0462500006-073-E08GTGGTGGGGCCGTGNONE 
006-073-E08TGTGGGCCCCACCNONE 
AK062065GTGGTGGGGCCGTGNONE 
AK062065TGTGGGCCCCACCNONE 
AK071311GTGGTGGGGCCGTGSimilar to 14-3-3-like protein GF14-6. 
AK071311TGTGGGCCCCACCSimilar to 14-3-3-like protein GF14-6. 
AK071822GTGGTGGGGCCGTGNONE 
AK071822TGTGGGCCCCACCNONE 
AK099243GTGGTGGGGCCGTGNONE 
AK099243TGTGGGCCCCACCNONE 
AK101938GTGGTGGGGCCGTGNONE 
AK101938TGTGGGCCCCACCNONE 
J013056F02GTGGTGGGGCCGTGNONE 
J013056F02TGTGGGCCCCACCNONE 
J023020E08GTGGTGGGGCCGTGNONE 
J023020E08TGTGGGCCCCACCNONE 
J023085B16GTGGTGGGGCCGTGNONE 
J023085B16TGTGGGCCCCACCNONE 
J023117D08GTGGTGGGGCCGTGNONE 
J023117D08TGTGGGCCCCACCNONE 
J023133K12GTGGTGGGGCCGTGNONE 
J023133K12TGTGGGCCCCACCNONE 
J033025G04GTGGTGGGGCCGTGNONE 
J033025G04TGTGGGCCCCACCNONE 
J033052A15GTGGTGGGGCCGTGNONE 
J033052A15TGTGGGCCCCACCNONE 
J033074G16GTGGTGGGGCCGTGNONE 
J033074G16TGTGGGCCCCACCNONE 
J033090A16GTGGTGGGGCCGTGNONE 
J033090A16TGTGGGCCCCACCNONE 
J033122A07GTGGTGGGGCCGTGNONE 
J033122A07TGTGGGCCCCACCNONE 
J033133G09GTGGTGGGGCCGTGNONE 
J033133G09TGTGGGCCCCACCNONE 
J065002F16GTGGTGGGGCCGTGNONE 
J065002F16TGTGGGCCCCACCNONE 
J065030M09GTGGTGGGGCCGTGNONE 
J065030M09TGTGGGCCCCACCNONE 
J065056B11GTGGTGGGGCCGTGNONE 
J065056B11TGTGGGCCCCACCNONE 
J065115I10GTGGTGGGGCCGTGNONE 
J065115I10TGTGGGCCCCACCNONE 
J065120O09GTGGTGGGGCCGTGNONE 
J065120O09TGTGGGCCCCACCNONE 
J065124G21GTGGTGGGGCCGTGNONE 
J065124G21TGTGGGCCCCACCNONE 
J075031C14GTGGTGGGGCCGTGNONE 
J075031C14TGTGGGCCCCACCNONE 
J075040H07GTGGTGGGGCCGTGNONE 
J075040H07TGTGGGCCCCACCNONE 
J075047F04GTGGTGGGGCCGTGNONE 
J075047F04TGTGGGCCCCACCNONE 
J075065F14GTGGTGGGGCCGTGNONE 
J075065F14TGTGGGCCCCACCNONE 
J075066G20GTGGTGGGGCCGTGNONE 
J075066G20TGTGGGCCCCACCNONE 
J075105D01GTGGTGGGGCCGTGNONE 
J075105D01TGTGGGCCCCACCNONE 
J075147B04GTGGTGGGGCCGTGNONE 
J075147B04TGTGGGCCCCACCNONE 
J075149A12GTGGTGGGGCCGTGNONE 
J075149A12TGTGGGCCCCACCNONE 
J075172D07GTGGTGGGGCCGTGNONE 
J075172D07TGTGGGCCCCACCNONE 
J075190J11GTGGTGGGGCCGTGNONE 
J075190J11TGTGGGCCCCACCNONE 
J090038H18GTGGTGGGGCCGTGNONE 
J090038H18TGTGGGCCCCACCNONE 
J090087G05GTGGTGGGGCCGTGNONE 
J090087G05TGTGGGCCCCACCNONE 
J100025A10GTGGTGGGGCCGTGNONE 
J100025A10TGTGGGCCCCACCNONE 
J100025O10GTGGTGGGGCCGTGNONE 
J100025O10TGTGGGCCCCACCNONE 
J100027D02GTGGTGGGGCCGTGNONE 
J100027D02TGTGGGCCCCACCNONE 
J100027P06GTGGTGGGGCCGTGNONE 
J100027P06TGTGGGCCCCACCNONE 
J100032K04GTGGTGGGGCCGTGNONE 
J100032K04TGTGGGCCCCACCNONE 
J100056D21GTGGTGGGGCCGTGNONE 
J100056D21TGTGGGCCCCACCNONE 
J100060J08GTGGTGGGGCCGTGNONE 
J100060J08TGTGGGCCCCACCNONE 
J100063N19GTGGTGGGGCCGTGNONE 
J100063N19TGTGGGCCCCACCNONE 
J100064C14GTGGTGGGGCCGTGNONE 
J100064C14TGTGGGCCCCACCNONE 
J100064K18GTGGTGGGGCCGTGNONE 
J100064K18TGTGGGCCCCACCNONE 
J100070L21GTGGTGGGGCCGTGNONE 
J100070L21TGTGGGCCCCACCNONE 
J100072M17GTGGTGGGGCCGTGNONE 
J100072M17TGTGGGCCCCACCNONE 
J100074F21GTGGTGGGGCCGTGNONE 
J100074F21TGTGGGCCCCACCNONE 
J100087E05GTGGTGGGGCCGTGNONE 
J100087E05TGTGGGCCCCACCNONE 
U65956GTGGTGGGGCCGTGNONE 
U65956TGTGGGCCCCACCNONE 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0504200AK110863CGGGCCCCACConserved hypothetical protein. 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08TCGTGGGCCCCACCCGNONE 
Os04g0512500AK107826TGGTGGGCCCCACCConserved hypothetical protein. 
J100049D17TGGTGGGCCCCACCNONE 
J100080K12TGGTGGGCCCCACCNONE 
Os04g0559400AK106376AGATGGGCCCCACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0569900AK100392GGCCCCACCIQ calmodulin-binding region domain containing protein. 
J023086B08GGCCCCACCNONE 
Os04g0585100012-055-B08GTGGGGCCCACCNONE 
AK105286GTGGGGCCCACCZinc finger, DHHC-type domain containing protein. 
Os04g0591300009-006-D05GTGGGGCCNONE 
AK105120GTGGGGCCConserved hypothetical protein. 
Os04g0600200AB004864GGCCCCACCACNONE 
AB007452GGCCCCACCACNONE 
AK064040GGCCCCACCACSimilar to Alternative oxidase 1a (Fragment). 
Os04g0606800009-159-H11GTGGGGCCCACAAGTCAGTGGNONE 
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein. 
J033070J06GTGGGGCCCACAAGTCAGTGGNONE 
J033119D03GTGGGGCCCACAAGTCAGTGGNONE 
J100043F05GTGGGGCCCACAAGTCAGTGGNONE 
J100050A01GTGGGGCCCACAAGTCAGTGGNONE 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
Os04g0617050J065197A20GCTGGGCCCCACNONE 
J065197A20TGTGGGGCCCATGNONE 
J090067K01GCTGGGCCCCACAuxin responsive SAUR protein family protein. 
J090067K01TGTGGGGCCCATGAuxin responsive SAUR protein family protein. 
Os04g0645100AK072140ACGTGGGGCCCTetratricopeptide-like helical domain containing protein. 
Os04g0652900AK071125GTGGGGCCCACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03GTGGGGCCCACGGNONE 
J075142E01GTGGGGCCCACGGNONE 
Os04g0667000AK069874GGCCCCACTafazzin family protein. 
J100055P09GGCCCCACNONE 
J100057O12GGCCCCACNONE 
J100067H07GGCCCCACNONE 
J100070D06GGCCCCACNONE 
J100071J16GGCCCCACNONE 
J100072C15GGCCCCACNONE 
Os04g0673300006-055-C10CGTGTGGGTGTGGGCCCCACCCGNONE 
AK059734CGTGTGGGTGTGGGCCCCACCCGSimilar to ZmRR2 protein (Response regulator 2). 
J065006D12CGTGTGGGTGTGGGCCCCACCCGNONE 
J065218N11CGTGTGGGTGTGGGCCCCACCCGNONE 
Os04g0674600AK069645TGTGGGGCCCAGAOligopeptide transporter OPT superfamily protein. 
Os04g0678300AK102779GGGCCCCACCTGTCWD40-like domain containing protein. 
J033107J24GGGCCCCACCTGTCNONE 
J065165H03GGGCCCCACCTGTCNONE 
J065186I23GGGCCCCACCTGTCNONE 
J065194C13GGGCCCCACCTGTCNONE 
J090039O08GGGCCCCACCTGTCNONE 
J100029O21GGGCCCCACCTGTCNONE 
Os04g0679800AK060662CCGTGGGCCCCACGSimilar to RNA-binding protein-like protein. 
AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK099987CCGTGGGCCCCACGNONE 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
AK099987GACAGGTGGGCCCCACCNONE 
J013130B11CCGTGGGCCCCACGNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J013130B11GACAGGTGGGCCCCACCNONE 
J065049C17CCGTGGGCCCCACGNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J065049C17GACAGGTGGGCCCCACCNONE 
J075191N12CCGTGGGCCCCACGNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191N12GACAGGTGGGCCCCACCNONE 
J075191P12CCGTGGGCCCCACGNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12GACAGGTGGGCCCCACCNONE 
J100031C07CCGTGGGCCCCACGNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
J100031C07GACAGGTGGGCCCCACCNONE 
Os05g0110900AK073169AGTGGGCCCCACASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os05g0111200009-033-A06CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
J065006E13CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075001D12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075005J18CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075009L08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075012M21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075019K17CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075020D07CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075041D11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075051C03CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075060C05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075079N09CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075094B04CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075108E08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075115G05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075147L21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075161G12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168J11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168L11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075174F22CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
Os05g0113000AK067079TGTGGGCCCCACCTGAmino acid-binding ACT domain containing protein. 
Os05g0116000AK058320CCACTGACATGCGGGCCCCACNONE 
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein. 
J023003L12CCACTGACATGCGGGCCCCACNONE 
J023025C18CCACTGACATGCGGGCCCCACNONE 
J023074E20CCACTGACATGCGGGCCCCACNONE 
J023128H09CCACTGACATGCGGGCCCCACNONE 
J033092N18CCACTGACATGCGGGCCCCACNONE 
J065009J09CCACTGACATGCGGGCCCCACNONE 
J090073L21CCACTGACATGCGGGCCCCACNONE 
Os05g0116100006-049-G01CCTGGGCCCCACANONE 
006-064-F09CCTGGGCCCCACANONE 
006-082-A03CCTGGGCCCCACANONE 
006-092-G06CCTGGGCCCCACANONE 
006-102-F09CCTGGGCCCCACANONE 
AB037970CCTGGGCCCCACANONE 
AK061836CCTGGGCCCCACANONE 
AK070895CCTGGGCCCCACADehydroascorbate reductase. 
AY074786CCTGGGCCCCACANONE 
J013022K21CCTGGGCCCCACANONE 
J013154A03CCTGGGCCCCACANONE 
J023074C02CCTGGGCCCCACANONE 
J023091I19CCTGGGCCCCACANONE 
J023135M05CCTGGGCCCCACANONE 
J065027L11CCTGGGCCCCACANONE 
J065065A08CCTGGGCCCCACANONE 
J065120A08CCTGGGCCCCACANONE 
J065174A05CCTGGGCCCCACANONE 
J065184O22CCTGGGCCCCACANONE 
J065191D07CCTGGGCCCCACANONE 
J065209D04CCTGGGCCCCACANONE 
J075014F11CCTGGGCCCCACANONE 
J075036D03CCTGGGCCCCACANONE 
J075157D23CCTGGGCCCCACANONE 
J080007F15CCTGGGCCCCACANONE 
J080008N12CCTGGGCCCCACANONE 
J080010F22CCTGGGCCCCACANONE 
J080011C19CCTGGGCCCCACANONE 
J080011F12CCTGGGCCCCACANONE 
J080012E11CCTGGGCCCCACANONE 
J080015B12CCTGGGCCCCACANONE 
J080015O16CCTGGGCCCCACANONE 
J080016G24CCTGGGCCCCACANONE 
J080016K13CCTGGGCCCCACANONE 
J080018A02CCTGGGCCCCACANONE 
J080018H03CCTGGGCCCCACANONE 
J080022M01CCTGGGCCCCACANONE 
J080023D20CCTGGGCCCCACANONE 
J080023I01CCTGGGCCCCACANONE 
J080023J05CCTGGGCCCCACANONE 
J080024A09CCTGGGCCCCACANONE 
J080024I09CCTGGGCCCCACANONE 
J080025A10CCTGGGCCCCACANONE 
J080025G04CCTGGGCCCCACANONE 
J080027D21CCTGGGCCCCACANONE 
J080029M05CCTGGGCCCCACANONE 
J080030J01CCTGGGCCCCACANONE 
J080034D10CCTGGGCCCCACANONE 
J080036F18CCTGGGCCCCACANONE 
J080038N11CCTGGGCCCCACANONE 
J080039B07CCTGGGCCCCACANONE 
J080039E01CCTGGGCCCCACANONE 
J080039K11CCTGGGCCCCACANONE 
J080040B09CCTGGGCCCCACANONE 
J080040G11CCTGGGCCCCACANONE 
J080041H08CCTGGGCCCCACANONE 
J080041H19CCTGGGCCCCACANONE 
J080041O20CCTGGGCCCCACANONE 
J080042C15CCTGGGCCCCACANONE 
J080043C16CCTGGGCCCCACANONE 
J080043F18CCTGGGCCCCACANONE 
J080044B17CCTGGGCCCCACANONE 
J080044N10CCTGGGCCCCACANONE 
J080044O07CCTGGGCCCCACANONE 
J080045H15CCTGGGCCCCACANONE 
J080045I03CCTGGGCCCCACANONE 
J080046A05CCTGGGCCCCACANONE 
J080048I06CCTGGGCCCCACANONE 
J080049L04CCTGGGCCCCACANONE 
J080049M09CCTGGGCCCCACANONE 
J080050G11CCTGGGCCCCACANONE 
J080051G20CCTGGGCCCCACANONE 
J080053C09CCTGGGCCCCACANONE 
J080053I05CCTGGGCCCCACANONE 
J080053P18CCTGGGCCCCACANONE 
J080054K10CCTGGGCCCCACANONE 
J080054P14CCTGGGCCCCACANONE 
J080057L05CCTGGGCCCCACANONE 
J080062K11CCTGGGCCCCACANONE 
J080063C19CCTGGGCCCCACANONE 
J080065B03CCTGGGCCCCACANONE 
J080066E15CCTGGGCCCCACANONE 
J080066H05CCTGGGCCCCACANONE 
J080066I05CCTGGGCCCCACANONE 
J080068O11CCTGGGCCCCACANONE 
J080070L22CCTGGGCCCCACANONE 
J080071I12CCTGGGCCCCACANONE 
J080071N20CCTGGGCCCCACANONE 
J080072D10CCTGGGCCCCACANONE 
J080072I10CCTGGGCCCCACANONE 
J080074G03CCTGGGCCCCACANONE 
J080076E23CCTGGGCCCCACANONE 
J080076N03CCTGGGCCCCACANONE 
J080077N23CCTGGGCCCCACANONE 
J080084B13CCTGGGCCCCACANONE 
J080084F07CCTGGGCCCCACANONE 
J080085J15CCTGGGCCCCACANONE 
J080085P20CCTGGGCCCCACANONE 
J080090F21CCTGGGCCCCACANONE 
J080093H16CCTGGGCCCCACANONE 
J080093J01CCTGGGCCCCACANONE 
J080093L04CCTGGGCCCCACANONE 
J080097E24CCTGGGCCCCACANONE 
J090012G04CCTGGGCCCCACANONE 
J090054K05CCTGGGCCCCACANONE 
Os05g0119000AK069359GCGTGGGCCCCACCConserved hypothetical protein 245 family protein. 
J065020A09GCGTGGGCCCCACCNONE 
J065043F11GCGTGGGCCCCACCNONE 
J065182D16GCGTGGGCCCCACCNONE 
J065211L04GCGTGGGCCCCACCNONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
004-011-B09GCTGGGCCCCACGCGNONE 
004-011-B09GGCCCCACCNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03GCTGGGCCCCACGCGNONE 
006-063-A03GGCCCCACCNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12GCTGGGCCCCACGCGNONE 
006-077-E12GGCCCCACCNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12GCTGGGCCCCACGCGNONE 
006-079-E12GGCCCCACCNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11GCTGGGCCCCACGCGNONE 
006-100-B11GGCCCCACCNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12GCTGGGCCCCACGCGNONE 
009-109-A12GGCCCCACCNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07GCTGGGCCCCACGCGNONE 
009-123-C07GGCCCCACCNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09GCTGGGCCCCACGCGNONE 
009-163-D09GGCCCCACCNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11GCTGGGCCCCACGCGNONE 
009-170-D11GGCCCCACCNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01GCTGGGCCCCACGCGNONE 
009-173-C01GGCCCCACCNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01GCTGGGCCCCACGCGNONE 
009-192-E01GGCCCCACCNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01GCTGGGCCCCACGCGNONE 
011-048-G01GGCCCCACCNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883GCTGGGCCCCACGCGNONE 
AK060883GGCCCCACCNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289GCTGGGCCCCACGCGNONE 
AK068289GGCCCCACCNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554GCTGGGCCCCACGCGNONE 
AK071554GGCCCCACCNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AK099495GCTGGGCCCCACGCGXYPPX repeat containing protein. 
AK099495GGCCCCACCXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AY348312GCTGGGCCCCACGCGNONE 
AY348312GGCCCCACCNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16GCTGGGCCCCACGCGNONE 
J013037L16GGCCCCACCNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04GCTGGGCCCCACGCGNONE 
J013088P04GGCCCCACCNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14GCTGGGCCCCACGCGNONE 
J013099D14GGCCCCACCNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19GCTGGGCCCCACGCGNONE 
J013146E19GGCCCCACCNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18GCTGGGCCCCACGCGNONE 
J013147E18GGCCCCACCNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19GCTGGGCCCCACGCGNONE 
J023104E19GGCCCCACCNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20GCTGGGCCCCACGCGNONE 
J023128O20GGCCCCACCNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16GCTGGGCCCCACGCGNONE 
J023132D16GGCCCCACCNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13GCTGGGCCCCACGCGNONE 
J023143E13GGCCCCACCNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15GCTGGGCCCCACGCGNONE 
J033028F15GGCCCCACCNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24GCTGGGCCCCACGCGNONE 
J033133D24GGCCCCACCNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07GCTGGGCCCCACGCGNONE 
J053091M07GGCCCCACCNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15GCTGGGCCCCACGCGNONE 
J075029L15GGCCCCACCNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12GCTGGGCCCCACGCGNONE 
J075097M12GGCCCCACCNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11GCTGGGCCCCACGCGNONE 
J075103J11GGCCCCACCNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10GCTGGGCCCCACGCGNONE 
J075138J10GGCCCCACCNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18GCTGGGCCCCACGCGNONE 
J075172K18GGCCCCACCNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15GCTGGGCCCCACGCGNONE 
J080001C15GGCCCCACCNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13GCTGGGCCCCACGCGNONE 
J080002M13GGCCCCACCNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01GCTGGGCCCCACGCGNONE 
J080009K01GGCCCCACCNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01GCTGGGCCCCACGCGNONE 
J080010N01GGCCCCACCNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23GCTGGGCCCCACGCGNONE 
J080011D23GGCCCCACCNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13GCTGGGCCCCACGCGNONE 
J080013C13GGCCCCACCNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16GCTGGGCCCCACGCGNONE 
J080013M16GGCCCCACCNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02GCTGGGCCCCACGCGNONE 
J080018J02GGCCCCACCNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03GCTGGGCCCCACGCGNONE 
J080020F03GGCCCCACCNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05GCTGGGCCCCACGCGNONE 
J080020G05GGCCCCACCNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05GCTGGGCCCCACGCGNONE 
J080021D05GGCCCCACCNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19GCTGGGCCCCACGCGNONE 
J080030A19GGCCCCACCNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16GCTGGGCCCCACGCGNONE 
J080031A16GGCCCCACCNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23GCTGGGCCCCACGCGNONE 
J080033J23GGCCCCACCNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07GCTGGGCCCCACGCGNONE 
J080035H07GGCCCCACCNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24GCTGGGCCCCACGCGNONE 
J080039M24GGCCCCACCNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16GCTGGGCCCCACGCGNONE 
J080042B16GGCCCCACCNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03GCTGGGCCCCACGCGNONE 
J080043B03GGCCCCACCNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01GCTGGGCCCCACGCGNONE 
J080045G01GGCCCCACCNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17GCTGGGCCCCACGCGNONE 
J080045K17GGCCCCACCNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09GCTGGGCCCCACGCGNONE 
J080047A09GGCCCCACCNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22GCTGGGCCCCACGCGNONE 
J080047I22GGCCCCACCNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14GCTGGGCCCCACGCGNONE 
J080048M14GGCCCCACCNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02GCTGGGCCCCACGCGNONE 
J080049J02GGCCCCACCNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15GCTGGGCCCCACGCGNONE 
J080052C15GGCCCCACCNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11GCTGGGCCCCACGCGNONE 
J080052E11GGCCCCACCNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22GCTGGGCCCCACGCGNONE 
J080052M22GGCCCCACCNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21GCTGGGCCCCACGCGNONE 
J080056O21GGCCCCACCNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04GCTGGGCCCCACGCGNONE 
J080059J04GGCCCCACCNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17GCTGGGCCCCACGCGNONE 
J080059O17GGCCCCACCNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04GCTGGGCCCCACGCGNONE 
J080064N04GGCCCCACCNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03GCTGGGCCCCACGCGNONE 
J080066A03GGCCCCACCNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22GCTGGGCCCCACGCGNONE 
J080066I22GGCCCCACCNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13GCTGGGCCCCACGCGNONE 
J080069C13GGCCCCACCNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03GCTGGGCCCCACGCGNONE 
J080069J03GGCCCCACCNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04GCTGGGCCCCACGCGNONE 
J080069N04GGCCCCACCNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01GCTGGGCCCCACGCGNONE 
J080071A01GGCCCCACCNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03GCTGGGCCCCACGCGNONE 
J080071C03GGCCCCACCNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02GCTGGGCCCCACGCGNONE 
J080071J02GGCCCCACCNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17GCTGGGCCCCACGCGNONE 
J080080D17GGCCCCACCNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06GCTGGGCCCCACGCGNONE 
J080084O06GGCCCCACCNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20GCTGGGCCCCACGCGNONE 
J080085O20GGCCCCACCNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15GCTGGGCCCCACGCGNONE 
J080086H15GGCCCCACCNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06GCTGGGCCCCACGCGNONE 
J080094K06GGCCCCACCNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05GCTGGGCCCCACGCGNONE 
J080095C05GGCCCCACCNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04GCTGGGCCCCACGCGNONE 
J080095G04GGCCCCACCNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03GCTGGGCCCCACGCGNONE 
J080096F03GGCCCCACCNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20GCTGGGCCCCACGCGNONE 
J080096F20GGCCCCACCNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05GCTGGGCCCCACGCGNONE 
J090004H05GGCCCCACCNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10GCTGGGCCCCACGCGNONE 
J090012P10GGCCCCACCNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09GCTGGGCCCCACGCGNONE 
J090021B09GGCCCCACCNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08GCTGGGCCCCACGCGNONE 
J090034M08GGCCCCACCNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21GCTGGGCCCCACGCGNONE 
J090046G21GGCCCCACCNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24GCTGGGCCCCACGCGNONE 
J090055K24GGCCCCACCNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05GCTGGGCCCCACGCGNONE 
J090055L05GGCCCCACCNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17GCTGGGCCCCACGCGNONE 
J090057H17GGCCCCACCNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21GCTGGGCCCCACGCGNONE 
J090082K21GGCCCCACCNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07GCTGGGCCCCACGCGNONE 
J100022A07GGCCCCACCNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02GCTGGGCCCCACGCGNONE 
J100022M02GGCCCCACCNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11GCTGGGCCCCACGCGNONE 
J100069K11GGCCCCACCNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24GCTGGGCCCCACGCGNONE 
J100086C24GGCCCCACCNONE 
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor. 
D12777CCACTGACATGTGGGCCCCACCTGNONE 
J013002F13CCACTGACATGTGGGCCCCACCTGNONE 
J013029I15CCACTGACATGTGGGCCCCACCTGNONE 
J013033A10CCACTGACATGTGGGCCCCACCTGNONE 
J013035H24CCACTGACATGTGGGCCCCACCTGNONE 
J013051H21CCACTGACATGTGGGCCCCACCTGNONE 
J013098H05CCACTGACATGTGGGCCCCACCTGNONE 
J023060B04CCACTGACATGTGGGCCCCACCTGNONE 
J023130D23CCACTGACATGTGGGCCCCACCTGNONE 
J033140N08CCACTGACATGTGGGCCCCACCTGNONE 
J053039L22CCACTGACATGTGGGCCCCACCTGNONE 
J080007K21CCACTGACATGTGGGCCCCACCTGNONE 
Os05g0148600003-016-C11CGGGTGGGCCCCACACACACCNONE 
003-016-C11GGGCCCCACCCGNONE 
003-016-C11GGTGGGGCCCGTTNONE 
AK066168CGGGTGGGCCCCACACACACCNONE 
AK066168GGGCCCCACCCGNONE 
AK066168GGTGGGGCCCGTTNONE 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
AK104336GGGCCCCACCCGSimilar to Na+/H+ antiporter. 
AK104336GGTGGGGCCCGTTSimilar to Na+/H+ antiporter. 
AY360145CGGGTGGGCCCCACACACACCNONE 
AY360145GGGCCCCACCCGNONE 
AY360145GGTGGGGCCCGTTNONE 
J013055J22CGGGTGGGCCCCACACACACCNONE 
J013055J22GGGCCCCACCCGNONE 
J013055J22GGTGGGGCCCGTTNONE 
J013057M24CGGGTGGGCCCCACACACACCNONE 
J013057M24GGGCCCCACCCGNONE 
J013057M24GGTGGGGCCCGTTNONE 
J013074N03CGGGTGGGCCCCACACACACCNONE 
J013074N03GGGCCCCACCCGNONE 
J013074N03GGTGGGGCCCGTTNONE 
J013158A22CGGGTGGGCCCCACACACACCNONE 
J013158A22GGGCCCCACCCGNONE 
J013158A22GGTGGGGCCCGTTNONE 
J075118H09CGGGTGGGCCCCACACACACCNONE 
J075118H09GGGCCCCACCCGNONE 
J075118H09GGTGGGGCCCGTTNONE 
Os05g0163700AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0164100AF456329CCCCCGCGTGGGCCCCACCCGNONE 
AF456329CGGGTGGGGCCCACCCGNONE 
AF456329CGTGTGGGCCCCACGNONE 
AK065086CCCCCGCGTGGGCCCCACCCGNONE 
AK065086CGGGTGGGGCCCACCCGNONE 
AK065086CGTGTGGGCCCCACGNONE 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
AK072243CGGGTGGGGCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
AK072243CGTGTGGGCCCCACGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CCCCCGCGTGGGCCCCACCCGNONE 
J013001L18CGGGTGGGGCCCACCCGNONE 
J013001L18CGTGTGGGCCCCACGNONE 
J013132O12CCCCCGCGTGGGCCCCACCCGNONE 
J013132O12CGGGTGGGGCCCACCCGNONE 
J013132O12CGTGTGGGCCCCACGNONE 
J023003N09CCCCCGCGTGGGCCCCACCCGNONE 
J023003N09CGGGTGGGGCCCACCCGNONE 
J023003N09CGTGTGGGCCCCACGNONE 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os05g0198000J080004C03TGTGGGCCCCACProtein of unknown function DUF247, plant family protein. 
J080004M24TGTGGGCCCCACNONE 
J080004O15TGTGGGCCCCACNONE 
J080006E14TGTGGGCCCCACNONE 
J080006I07TGTGGGCCCCACNONE 
J080007N13TGTGGGCCCCACNONE 
J080009C21TGTGGGCCCCACNONE 
J080009L03TGTGGGCCCCACNONE 
J080010F10TGTGGGCCCCACNONE 
J080015H04TGTGGGCCCCACNONE 
J080015L04TGTGGGCCCCACNONE 
J080018C21TGTGGGCCCCACNONE 
J080022M22TGTGGGCCCCACNONE 
J080027O19TGTGGGCCCCACNONE 
J080030I07TGTGGGCCCCACNONE 
J080037P07TGTGGGCCCCACNONE 
J080044C18TGTGGGCCCCACNONE 
J080049F14TGTGGGCCCCACNONE 
J080050F04TGTGGGCCCCACNONE 
J080052B18TGTGGGCCCCACNONE 
J080081B11TGTGGGCCCCACNONE 
J080083G12TGTGGGCCCCACNONE 
J080086A11TGTGGGCCCCACNONE 
J080087C06TGTGGGCCCCACNONE 
J080088E06TGTGGGCCCCACNONE 
J080091O21TGTGGGCCCCACNONE 
J080094N23TGTGGGCCCCACNONE 
Os05g0213500003-114-G10GGGTGGGCCCCACCACNONE 
AK065280GGGTGGGCCCCACCACConserved hypothetical protein. 
J013002L23GGGTGGGCCCCACCACNONE 
J023056H04GGGTGGGCCCCACCACNONE 
J075051G09GGGTGGGCCCCACCACNONE 
J075139N23GGGTGGGCCCCACCACNONE 
J100031B01GGGTGGGCCCCACCACNONE 
J100075M20GGGTGGGCCCCACCACNONE 
Os05g0215000004-016-E07GTGGGGCCNONE 
006-022-D08GTGGGGCCNONE 
006-025-A08GTGGGGCCNONE 
006-025-B01GTGGGGCCNONE 
006-029-C05GTGGGGCCNONE 
006-031-A03GTGGGGCCNONE 
006-031-C06GTGGGGCCNONE 
006-031-H02GTGGGGCCNONE 
006-033-A04GTGGGGCCNONE 
006-035-G09GTGGGGCCNONE 
006-037-A08GTGGGGCCNONE 
006-037-F06GTGGGGCCNONE 
006-038-D11GTGGGGCCNONE 
006-039-A05GTGGGGCCNONE 
006-041-E07GTGGGGCCNONE 
006-043-A01GTGGGGCCNONE 
006-048-H04GTGGGGCCNONE 
006-051-H07GTGGGGCCNONE 
006-053-E04GTGGGGCCNONE 
006-056-A07GTGGGGCCNONE 
006-056-A11GTGGGGCCNONE 
006-058-B10GTGGGGCCNONE 
006-059-E09GTGGGGCCNONE 
006-059-F12GTGGGGCCNONE 
006-061-D12GTGGGGCCNONE 
006-061-E06GTGGGGCCNONE 
006-062-E03GTGGGGCCNONE 
006-064-G09GTGGGGCCNONE 
006-065-B04GTGGGGCCNONE 
006-066-C09GTGGGGCCNONE 
006-069-H02GTGGGGCCNONE 
006-071-C04GTGGGGCCNONE 
006-071-E09GTGGGGCCNONE 
006-076-B04GTGGGGCCNONE 
006-077-E02GTGGGGCCNONE 
006-078-A08GTGGGGCCNONE 
006-082-F05GTGGGGCCNONE 
006-084-E02GTGGGGCCNONE 
006-085-E03GTGGGGCCNONE 
006-086-F04GTGGGGCCNONE 
006-088-F07GTGGGGCCNONE 
006-094-C07GTGGGGCCNONE 
006-099-B01GTGGGGCCNONE 
006-101-E02GTGGGGCCNONE 
006-105-A09GTGGGGCCNONE 
006-106-E09GTGGGGCCNONE 
006-106-F04GTGGGGCCNONE 
006-109-F03GTGGGGCCNONE 
006-113-D08GTGGGGCCNONE 
006-118-C02GTGGGGCCNONE 
006-120-F01GTGGGGCCNONE 
006-120-G09GTGGGGCCNONE 
009-118-B09GTGGGGCCNONE 
009-123-E09GTGGGGCCNONE 
009-131-B09GTGGGGCCNONE 
009-183-H06GTGGGGCCNONE 
009-186-E09GTGGGGCCNONE 
009-197-C05GTGGGGCCNONE 
AK059729GTGGGGCCBURP domain containing protein. 
AK060134GTGGGGCCNONE 
AK060149GTGGGGCCNONE 
AK103934GTGGGGCCNONE 
AK104171GTGGGGCCNONE 
AK104178GTGGGGCCNONE 
AK104216GTGGGGCCNONE 
AK104258GTGGGGCCNONE 
AK104285GTGGGGCCNONE 
AK104369GTGGGGCCNONE 
AK104485GTGGGGCCNONE 
AK104531GTGGGGCCNONE 
AK104575GTGGGGCCNONE 
AK104940GTGGGGCCNONE 
AK109415GTGGGGCCNONE 
AK119543GTGGGGCCNONE 
J013110H02GTGGGGCCNONE 
J100054P09GTGGGGCCNONE 
Os05g0217000AK062517GGTGGGGCCCACCProtein of unknown function DUF1070 family protein. 
J075142D02GGTGGGGCCCACCNONE 
Os05g0217800004-006-H06GTGGGGCCNONE 
004-010-H10GTGGGGCCNONE 
005-019-G04GTGGGGCCNONE 
006-021-A11GTGGGGCCNONE 
006-021-A12GTGGGGCCNONE 
006-021-C01GTGGGGCCNONE 
006-021-C02GTGGGGCCNONE 
006-021-E03GTGGGGCCNONE 
006-021-E06GTGGGGCCNONE 
006-021-E10GTGGGGCCNONE 
006-021-F12GTGGGGCCNONE 
006-021-G04GTGGGGCCNONE 
006-021-G08GTGGGGCCNONE 
006-021-G12GTGGGGCCNONE 
006-021-H07GTGGGGCCNONE 
006-022-B09GTGGGGCCNONE 
006-022-D09GTGGGGCCNONE 
006-022-E12GTGGGGCCNONE 
006-022-F06GTGGGGCCNONE 
006-022-F11GTGGGGCCNONE 
006-022-F12GTGGGGCCNONE 
006-022-G03GTGGGGCCNONE 
006-022-H06GTGGGGCCNONE 
006-023-A04GTGGGGCCNONE 
006-023-B04GTGGGGCCNONE 
006-023-C06GTGGGGCCNONE 
006-023-E04GTGGGGCCNONE 
006-023-F06GTGGGGCCNONE 
006-023-G01GTGGGGCCNONE 
006-023-G12GTGGGGCCNONE 
006-023-H03GTGGGGCCNONE 
006-024-A03GTGGGGCCNONE 
006-024-A11GTGGGGCCNONE 
006-024-B03GTGGGGCCNONE 
006-024-B06GTGGGGCCNONE 
006-024-D03GTGGGGCCNONE 
006-024-E07GTGGGGCCNONE 
006-024-F01GTGGGGCCNONE 
006-024-G02GTGGGGCCNONE 
006-024-H10GTGGGGCCNONE 
006-025-A02GTGGGGCCNONE 
006-025-A03GTGGGGCCNONE 
006-025-C04GTGGGGCCNONE 
006-025-D03GTGGGGCCNONE 
006-025-D04GTGGGGCCNONE 
006-025-D07GTGGGGCCNONE 
006-025-D09GTGGGGCCNONE 
006-025-G06GTGGGGCCNONE 
006-025-G07GTGGGGCCNONE 
006-025-H03GTGGGGCCNONE 
006-026-B09GTGGGGCCNONE 
006-026-D07GTGGGGCCNONE 
006-026-D12GTGGGGCCNONE 
006-026-E07GTGGGGCCNONE 
006-026-G07GTGGGGCCNONE 
006-026-H08GTGGGGCCNONE 
006-027-A03GTGGGGCCNONE 
006-027-B10GTGGGGCCNONE 
006-027-D07GTGGGGCCNONE 
006-027-D08GTGGGGCCNONE 
006-027-G04GTGGGGCCNONE 
006-027-H09GTGGGGCCNONE 
006-027-H12GTGGGGCCNONE 
006-028-A02GTGGGGCCNONE 
006-028-A08GTGGGGCCNONE 
006-028-B07GTGGGGCCNONE 
006-028-C01GTGGGGCCNONE 
006-028-C10GTGGGGCCNONE 
006-028-D07GTGGGGCCNONE 
006-028-E01GTGGGGCCNONE 
006-028-E02GTGGGGCCNONE 
006-028-F11GTGGGGCCNONE 
006-029-A08GTGGGGCCNONE 
006-029-B12GTGGGGCCNONE 
006-029-C02GTGGGGCCNONE 
006-029-C03GTGGGGCCNONE 
006-029-E11GTGGGGCCNONE 
006-029-F01GTGGGGCCNONE 
006-029-F06GTGGGGCCNONE 
006-029-G03GTGGGGCCNONE 
006-029-H04GTGGGGCCNONE 
006-030-A05GTGGGGCCNONE 
006-030-A12GTGGGGCCNONE 
006-030-B02GTGGGGCCNONE 
006-030-D04GTGGGGCCNONE 
006-030-F08GTGGGGCCNONE 
006-030-G08GTGGGGCCNONE 
006-030-G11GTGGGGCCNONE 
006-030-H08GTGGGGCCNONE 
006-031-B07GTGGGGCCNONE 
006-031-C02GTGGGGCCNONE 
006-031-D09GTGGGGCCNONE 
006-031-E11GTGGGGCCNONE 
006-031-F06GTGGGGCCNONE 
006-031-F08GTGGGGCCNONE 
006-031-F11GTGGGGCCNONE 
006-031-F12GTGGGGCCNONE 
006-031-G03GTGGGGCCNONE 
006-031-G04GTGGGGCCNONE 
006-031-H04GTGGGGCCNONE 
006-031-H08GTGGGGCCNONE 
006-032-B04GTGGGGCCNONE 
006-032-E04GTGGGGCCNONE 
006-032-E12GTGGGGCCNONE 
006-032-G01GTGGGGCCNONE 
006-032-H12GTGGGGCCNONE 
006-033-A07GTGGGGCCNONE 
006-033-B10GTGGGGCCNONE 
006-033-C08GTGGGGCCNONE 
006-033-D07GTGGGGCCNONE 
006-033-F07GTGGGGCCNONE 
006-033-H01GTGGGGCCNONE 
006-033-H05GTGGGGCCNONE 
006-034-A01GTGGGGCCNONE 
006-034-A02GTGGGGCCNONE 
006-034-A04GTGGGGCCNONE 
006-034-C06GTGGGGCCNONE 
006-034-C12GTGGGGCCNONE 
006-034-E02GTGGGGCCNONE 
006-034-F05GTGGGGCCNONE 
006-034-F12GTGGGGCCNONE 
006-034-G11GTGGGGCCNONE 
006-035-A04GTGGGGCCNONE 
006-035-B11GTGGGGCCNONE 
006-035-C01GTGGGGCCNONE 
006-035-G03GTGGGGCCNONE 
006-035-G08GTGGGGCCNONE 
006-036-A01GTGGGGCCNONE 
006-036-A11GTGGGGCCNONE 
006-036-C10GTGGGGCCNONE 
006-036-D05GTGGGGCCNONE 
006-036-D10GTGGGGCCNONE 
006-036-D12GTGGGGCCNONE 
006-036-G04GTGGGGCCNONE 
006-037-A04GTGGGGCCNONE 
006-037-B08GTGGGGCCNONE 
006-037-E01GTGGGGCCNONE 
006-037-H01GTGGGGCCNONE 
006-038-E02GTGGGGCCNONE 
006-038-G07GTGGGGCCNONE 
006-038-G11GTGGGGCCNONE 
006-039-B10GTGGGGCCNONE 
006-039-D01GTGGGGCCNONE 
006-039-E04GTGGGGCCNONE 
006-039-E11GTGGGGCCNONE 
006-039-F01GTGGGGCCNONE 
006-039-H11GTGGGGCCNONE 
006-040-B06GTGGGGCCNONE 
006-040-C04GTGGGGCCNONE 
006-040-F11GTGGGGCCNONE 
006-040-G10GTGGGGCCNONE 
006-040-H01GTGGGGCCNONE 
006-041-C03GTGGGGCCNONE 
006-041-G11GTGGGGCCNONE 
006-042-A02GTGGGGCCNONE 
006-042-A12GTGGGGCCNONE 
006-042-B08GTGGGGCCNONE 
006-042-C01GTGGGGCCNONE 
006-042-D04GTGGGGCCNONE 
006-042-D09GTGGGGCCNONE 
006-042-E12GTGGGGCCNONE 
006-042-F11GTGGGGCCNONE 
006-042-G05GTGGGGCCNONE 
006-042-G07GTGGGGCCNONE 
006-042-H07GTGGGGCCNONE 
006-043-A06GTGGGGCCNONE 
006-043-A08GTGGGGCCNONE 
006-043-B02GTGGGGCCNONE 
006-043-B07GTGGGGCCNONE 
006-043-B12GTGGGGCCNONE 
006-043-D06GTGGGGCCNONE 
006-043-E03GTGGGGCCNONE 
006-043-H09GTGGGGCCNONE 
006-044-C01GTGGGGCCNONE 
006-044-D07GTGGGGCCNONE 
006-044-F01GTGGGGCCNONE 
006-044-H06GTGGGGCCNONE 
006-045-A02GTGGGGCCNONE 
006-045-A03GTGGGGCCNONE 
006-045-A11GTGGGGCCNONE 
006-045-C10GTGGGGCCNONE 
006-045-C11GTGGGGCCNONE 
006-045-D01GTGGGGCCNONE 
006-045-D04GTGGGGCCNONE 
006-045-E11GTGGGGCCNONE 
006-045-F09GTGGGGCCNONE 
006-045-G03GTGGGGCCNONE 
006-045-H06GTGGGGCCNONE 
006-046-A06GTGGGGCCNONE 
006-046-B07GTGGGGCCNONE 
006-046-B12GTGGGGCCNONE 
006-046-D04GTGGGGCCNONE 
006-046-E10GTGGGGCCNONE 
006-046-G01GTGGGGCCNONE 
006-046-G11GTGGGGCCNONE 
006-046-H06GTGGGGCCNONE 
006-046-H09GTGGGGCCNONE 
006-047-A12GTGGGGCCNONE 
006-047-B06GTGGGGCCNONE 
006-047-F05GTGGGGCCNONE 
006-047-F06GTGGGGCCNONE 
006-047-G07GTGGGGCCNONE 
006-047-G09GTGGGGCCNONE 
006-047-G11GTGGGGCCNONE 
006-047-H05GTGGGGCCNONE 
006-047-H08GTGGGGCCNONE 
006-047-H11GTGGGGCCNONE 
006-048-A04GTGGGGCCNONE 
006-048-A07GTGGGGCCNONE 
006-048-C02GTGGGGCCNONE 
006-048-D07GTGGGGCCNONE 
006-048-E05GTGGGGCCNONE 
006-048-G01GTGGGGCCNONE 
006-048-G02GTGGGGCCNONE 
006-049-A01GTGGGGCCNONE 
006-049-A10GTGGGGCCNONE 
006-049-B10GTGGGGCCNONE 
006-049-D10GTGGGGCCNONE 
006-049-E10GTGGGGCCNONE 
006-049-E11GTGGGGCCNONE 
006-049-F06GTGGGGCCNONE 
006-049-F12GTGGGGCCNONE 
006-049-H10GTGGGGCCNONE 
006-050-B04GTGGGGCCNONE 
006-050-B07GTGGGGCCNONE 
006-050-D03GTGGGGCCNONE 
006-050-E01GTGGGGCCNONE 
006-050-F06GTGGGGCCNONE 
006-050-G09GTGGGGCCNONE 
006-050-H12GTGGGGCCNONE 
006-051-B01GTGGGGCCNONE 
006-051-B10GTGGGGCCNONE 
006-051-B11GTGGGGCCNONE 
006-051-C11GTGGGGCCNONE 
006-051-D07GTGGGGCCNONE 
006-051-E12GTGGGGCCNONE 
006-052-A04GTGGGGCCNONE 
006-052-A10GTGGGGCCNONE 
006-052-B08GTGGGGCCNONE 
006-052-B10GTGGGGCCNONE 
006-052-C12GTGGGGCCNONE 
006-052-D07GTGGGGCCNONE 
006-052-F12GTGGGGCCNONE 
006-052-G10GTGGGGCCNONE 
006-052-H09GTGGGGCCNONE 
006-053-C02GTGGGGCCNONE 
006-053-E06GTGGGGCCNONE 
006-053-E08GTGGGGCCNONE 
006-053-F07GTGGGGCCNONE 
006-053-G02GTGGGGCCNONE 
006-053-G04GTGGGGCCNONE 
006-054-A02GTGGGGCCNONE 
006-054-B06GTGGGGCCNONE 
006-054-B07GTGGGGCCNONE 
006-054-C08GTGGGGCCNONE 
006-054-D01GTGGGGCCNONE 
006-054-D02GTGGGGCCNONE 
006-054-F02GTGGGGCCNONE 
006-054-G02GTGGGGCCNONE 
006-054-G09GTGGGGCCNONE 
006-055-A02GTGGGGCCNONE 
006-055-C08GTGGGGCCNONE 
006-055-C09GTGGGGCCNONE 
006-055-D05GTGGGGCCNONE 
006-055-G04GTGGGGCCNONE 
006-055-G05GTGGGGCCNONE 
006-055-G06GTGGGGCCNONE 
006-055-H02GTGGGGCCNONE 
006-056-D08GTGGGGCCNONE 
006-056-D11GTGGGGCCNONE 
006-056-E05GTGGGGCCNONE 
006-056-E06GTGGGGCCNONE 
006-056-E07GTGGGGCCNONE 
006-056-G03GTGGGGCCNONE 
006-056-H04GTGGGGCCNONE 
006-056-H05GTGGGGCCNONE 
006-057-A08GTGGGGCCNONE 
006-057-A12GTGGGGCCNONE 
006-057-B08GTGGGGCCNONE 
006-057-F09GTGGGGCCNONE 
006-057-G12GTGGGGCCNONE 
006-058-A12GTGGGGCCNONE 
006-058-B11GTGGGGCCNONE 
006-058-C06GTGGGGCCNONE 
006-058-C07GTGGGGCCNONE 
006-058-E04GTGGGGCCNONE 
006-058-F11GTGGGGCCNONE 
006-058-G08GTGGGGCCNONE 
006-058-G10GTGGGGCCNONE 
006-058-H12GTGGGGCCNONE 
006-059-B08GTGGGGCCNONE 
006-060-D11GTGGGGCCNONE 
006-060-F05GTGGGGCCNONE 
006-060-F11GTGGGGCCNONE 
006-060-F12GTGGGGCCNONE 
006-061-C12GTGGGGCCNONE 
006-062-B08GTGGGGCCNONE 
006-062-C01GTGGGGCCNONE 
006-062-C03GTGGGGCCNONE 
006-062-E11GTGGGGCCNONE 
006-062-F01GTGGGGCCNONE 
006-062-F04GTGGGGCCNONE 
006-062-G05GTGGGGCCNONE 
006-062-H01GTGGGGCCNONE 
006-062-H03GTGGGGCCNONE 
006-063-A08GTGGGGCCNONE 
006-063-B01GTGGGGCCNONE 
006-063-B06GTGGGGCCNONE 
006-063-B11GTGGGGCCNONE 
006-063-C02GTGGGGCCNONE 
006-063-C09GTGGGGCCNONE 
006-063-E02GTGGGGCCNONE 
006-063-E05GTGGGGCCNONE 
006-063-E06GTGGGGCCNONE 
006-063-F12GTGGGGCCNONE 
006-063-G03GTGGGGCCNONE 
006-063-G04GTGGGGCCNONE 
006-063-H03GTGGGGCCNONE 
006-063-H06GTGGGGCCNONE 
006-064-A05GTGGGGCCNONE 
006-064-B03GTGGGGCCNONE 
006-064-B04GTGGGGCCNONE 
006-064-B10GTGGGGCCNONE 
006-064-C01GTGGGGCCNONE 
006-064-G08GTGGGGCCNONE 
006-064-H05GTGGGGCCNONE 
006-065-A01GTGGGGCCNONE 
006-065-C01GTGGGGCCNONE 
006-065-D01GTGGGGCCNONE 
006-065-E01GTGGGGCCNONE 
006-065-E02GTGGGGCCNONE 
006-066-A11GTGGGGCCNONE 
006-066-B02GTGGGGCCNONE 
006-066-B12GTGGGGCCNONE 
006-066-F06GTGGGGCCNONE 
006-066-H06GTGGGGCCNONE 
006-067-A04GTGGGGCCNONE 
006-067-F06GTGGGGCCNONE 
006-067-H03GTGGGGCCNONE 
006-068-A03GTGGGGCCNONE 
006-068-D04GTGGGGCCNONE 
006-068-D10GTGGGGCCNONE 
006-068-H03GTGGGGCCNONE 
006-068-H09GTGGGGCCNONE 
006-069-E09GTGGGGCCNONE 
006-069-F09GTGGGGCCNONE 
006-070-A09GTGGGGCCNONE 
006-070-B07GTGGGGCCNONE 
006-070-C02GTGGGGCCNONE 
006-070-H01GTGGGGCCNONE 
006-071-A03GTGGGGCCNONE 
006-071-C02GTGGGGCCNONE 
006-071-C09GTGGGGCCNONE 
006-071-C11GTGGGGCCNONE 
006-071-D09GTGGGGCCNONE 
006-071-D11GTGGGGCCNONE 
006-071-E01GTGGGGCCNONE 
006-071-E02GTGGGGCCNONE 
006-071-E11GTGGGGCCNONE 
006-071-G10GTGGGGCCNONE 
006-071-H06GTGGGGCCNONE 
006-072-A12GTGGGGCCNONE 
006-072-B12GTGGGGCCNONE 
006-072-C08GTGGGGCCNONE 
006-072-F10GTGGGGCCNONE 
006-073-A03GTGGGGCCNONE 
006-074-B07GTGGGGCCNONE 
006-074-C05GTGGGGCCNONE 
006-074-D09GTGGGGCCNONE 
006-074-D11GTGGGGCCNONE 
006-074-E09GTGGGGCCNONE 
006-074-E11GTGGGGCCNONE 
006-074-F07GTGGGGCCNONE 
006-074-H07GTGGGGCCNONE 
006-075-A02GTGGGGCCNONE 
006-075-A07GTGGGGCCNONE 
006-075-A10GTGGGGCCNONE 
006-075-A11GTGGGGCCNONE 
006-075-C02GTGGGGCCNONE 
006-075-D02GTGGGGCCNONE 
006-075-E01GTGGGGCCNONE 
006-075-E09GTGGGGCCNONE 
006-075-F02GTGGGGCCNONE 
006-075-F07GTGGGGCCNONE 
006-075-H04GTGGGGCCNONE 
006-076-B09GTGGGGCCNONE 
006-076-D01GTGGGGCCNONE 
006-076-H02GTGGGGCCNONE 
006-076-H08GTGGGGCCNONE 
006-077-A01GTGGGGCCNONE 
006-077-A03GTGGGGCCNONE 
006-077-A11GTGGGGCCNONE 
006-077-B04GTGGGGCCNONE 
006-077-B06GTGGGGCCNONE 
006-077-C07GTGGGGCCNONE 
006-077-D11GTGGGGCCNONE 
006-077-E06GTGGGGCCNONE 
006-077-E11GTGGGGCCNONE 
006-077-F10GTGGGGCCNONE 
006-077-G05GTGGGGCCNONE 
006-077-H01GTGGGGCCNONE 
006-077-H02GTGGGGCCNONE 
006-077-H04GTGGGGCCNONE 
006-078-A06GTGGGGCCNONE 
006-078-C01GTGGGGCCNONE 
006-078-F08GTGGGGCCNONE 
006-078-H07GTGGGGCCNONE 
006-078-H12GTGGGGCCNONE 
006-079-B12GTGGGGCCNONE 
006-079-C08GTGGGGCCNONE 
006-079-F07GTGGGGCCNONE 
006-079-G07GTGGGGCCNONE 
006-080-A01GTGGGGCCNONE 
006-080-E01GTGGGGCCNONE 
006-080-H03GTGGGGCCNONE 
006-080-H06GTGGGGCCNONE 
006-081-A09GTGGGGCCNONE 
006-081-B02GTGGGGCCNONE 
006-081-B05GTGGGGCCNONE 
006-081-D01GTGGGGCCNONE 
006-081-E06GTGGGGCCNONE 
006-081-E08GTGGGGCCNONE 
006-082-A06GTGGGGCCNONE 
006-082-C10GTGGGGCCNONE 
006-082-F03GTGGGGCCNONE 
006-082-F11GTGGGGCCNONE 
006-082-G03GTGGGGCCNONE 
006-082-H02GTGGGGCCNONE 
006-083-A05GTGGGGCCNONE 
006-083-B05GTGGGGCCNONE 
006-083-C07GTGGGGCCNONE 
006-083-D06GTGGGGCCNONE 
006-083-E02GTGGGGCCNONE 
006-083-E08GTGGGGCCNONE 
006-083-F07GTGGGGCCNONE 
006-083-H06GTGGGGCCNONE 
006-084-A02GTGGGGCCNONE 
006-084-B04GTGGGGCCNONE 
006-084-B06GTGGGGCCNONE 
006-084-D02GTGGGGCCNONE 
006-085-A01GTGGGGCCNONE 
006-085-B06GTGGGGCCNONE 
006-085-E05GTGGGGCCNONE 
006-085-E11GTGGGGCCNONE 
006-085-F06GTGGGGCCNONE 
006-085-H09GTGGGGCCNONE 
006-086-B02GTGGGGCCNONE 
006-086-E11GTGGGGCCNONE 
006-086-F01GTGGGGCCNONE 
006-086-G08GTGGGGCCNONE 
006-087-C09GTGGGGCCNONE 
006-087-D06GTGGGGCCNONE 
006-087-D07GTGGGGCCNONE 
006-087-G01GTGGGGCCNONE 
006-088-B10GTGGGGCCNONE 
006-088-B12GTGGGGCCNONE 
006-088-C12GTGGGGCCNONE 
006-088-E12GTGGGGCCNONE 
006-088-F01GTGGGGCCNONE 
006-088-F03GTGGGGCCNONE 
006-088-G09GTGGGGCCNONE 
006-089-A06GTGGGGCCNONE 
006-089-C02GTGGGGCCNONE 
006-089-H01GTGGGGCCNONE 
006-089-H03GTGGGGCCNONE 
006-089-H08GTGGGGCCNONE 
006-090-A03GTGGGGCCNONE 
006-090-A05GTGGGGCCNONE 
006-090-D04GTGGGGCCNONE 
006-090-D07GTGGGGCCNONE 
006-091-A12GTGGGGCCNONE 
006-091-C04GTGGGGCCNONE 
006-091-C08GTGGGGCCNONE 
006-091-D03GTGGGGCCNONE 
006-091-D06GTGGGGCCNONE 
006-091-E12GTGGGGCCNONE 
006-091-F01GTGGGGCCNONE 
006-091-F08GTGGGGCCNONE 
006-092-A04GTGGGGCCNONE 
006-092-C12GTGGGGCCNONE 
006-092-D06GTGGGGCCNONE 
006-092-E04GTGGGGCCNONE 
006-092-E12GTGGGGCCNONE 
006-092-H04GTGGGGCCNONE 
006-092-H05GTGGGGCCNONE 
006-092-H11GTGGGGCCNONE 
006-093-A10GTGGGGCCNONE 
006-093-A12GTGGGGCCNONE 
006-093-C06GTGGGGCCNONE 
006-093-D06GTGGGGCCNONE 
006-093-E10GTGGGGCCNONE 
006-093-F04GTGGGGCCNONE 
006-093-F05GTGGGGCCNONE 
006-093-G04GTGGGGCCNONE 
006-093-G11GTGGGGCCNONE 
006-093-H01GTGGGGCCNONE 
006-093-H02GTGGGGCCNONE 
006-093-H06GTGGGGCCNONE 
006-094-B06GTGGGGCCNONE 
006-094-C03GTGGGGCCNONE 
006-094-C04GTGGGGCCNONE 
006-094-D05GTGGGGCCNONE 
006-094-E10GTGGGGCCNONE 
006-094-G11GTGGGGCCNONE 
006-095-A05GTGGGGCCNONE 
006-095-A07GTGGGGCCNONE 
006-095-A09GTGGGGCCNONE 
006-095-B12GTGGGGCCNONE 
006-095-C09GTGGGGCCNONE 
006-095-D02GTGGGGCCNONE 
006-095-E04GTGGGGCCNONE 
006-095-F01GTGGGGCCNONE 
006-095-F04GTGGGGCCNONE 
006-095-G04GTGGGGCCNONE 
006-095-G08GTGGGGCCNONE 
006-095-H05GTGGGGCCNONE 
006-095-H06GTGGGGCCNONE 
006-096-C05GTGGGGCCNONE 
006-096-C08GTGGGGCCNONE 
006-096-D09GTGGGGCCNONE 
006-096-E11GTGGGGCCNONE 
006-096-H04GTGGGGCCNONE 
006-097-A06GTGGGGCCNONE 
006-097-B07GTGGGGCCNONE 
006-097-B09GTGGGGCCNONE 
006-097-B12GTGGGGCCNONE 
006-097-D09GTGGGGCCNONE 
006-097-E03GTGGGGCCNONE 
006-097-E05GTGGGGCCNONE 
006-097-H02GTGGGGCCNONE 
006-097-H07GTGGGGCCNONE 
006-098-E02GTGGGGCCNONE 
006-098-E07GTGGGGCCNONE 
006-098-F02GTGGGGCCNONE 
006-098-F11GTGGGGCCNONE 
006-098-G03GTGGGGCCNONE 
006-098-G06GTGGGGCCNONE 
006-098-G07GTGGGGCCNONE 
006-098-G10GTGGGGCCNONE 
006-098-H11GTGGGGCCNONE 
006-099-A10GTGGGGCCNONE 
006-099-A12GTGGGGCCNONE 
006-099-B03