version

Summary of OsREG632 (All List)

OrganismOryza sativa  
IDOsREG632  
SequenceGGCCCGCA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count596  

Entry Sequences (596 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein. 
J013000E05CACGTGGGGCCCGCANONE 
J013027D08CACGTGGGGCCCGCANONE 
J013045K12CACGTGGGGCCCGCANONE 
J023119M03CACGTGGGGCCCGCANONE 
J065081F02CACGTGGGGCCCGCANONE 
J065180C08CACGTGGGGCCCGCANONE 
J065211M06CACGTGGGGCCCGCANONE 
J075073J06CACGTGGGGCCCGCANONE 
J075123A18CACGTGGGGCCCGCANONE 
J075124A07CACGTGGGGCCCGCANONE 
J075187B05CACGTGGGGCCCGCANONE 
Os01g0104600AK058683CAAGGCCCGCANONE 
AK100613CAAGGCCCGCASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
J075195M06CAAGGCCCGCANONE 
J090042G02CAAGGCCCGCANONE 
Os01g0144600006-037-H02TGTGGGCCCGCACGCCACNONE 
AK061501TGTGGGCCCGCACGCCACConserved hypothetical protein. 
AK102823TGTGGGCCCGCACGCCACNONE 
J033108P10TGTGGGCCCGCACGCCACNONE 
J043026K08TGTGGGCCCGCACGCCACNONE 
J090009H21TGTGGGCCCGCACGCCACNONE 
Os01g0176400AK111327TGCGGGCCSimilar to Photoreceptor-interacting protein-like. 
Os01g0266400009-169-A06CCCGGCCCGCANONE 
AK121188CCCGGCCCGCAConserved hypothetical protein. 
J023085H22CCCGGCCCGCANONE 
J080301K14CCCGGCCCGCANONE 
J080303B07CCCGGCCCGCANONE 
J080303H21CCCGGCCCGCANONE 
J080308F24CCCGGCCCGCANONE 
Os01g0283000AK073165CCCGGCCCGCAConserved hypothetical protein. 
J033023G08CCCGGCCCGCANONE 
Os01g0283100004-018-B01TGCGGGCCGGGNONE 
AK060908TGCGGGCCGGGNONE 
AK071713TGCGGGCCGGGSimilar to Ferripyochelin-binding protein-like. 
AK104205TGCGGGCCGGGNONE 
AK122051TGCGGGCCGGGNONE 
J023109L19TGCGGGCCGGGNONE 
Os01g0286000AK109824TGCGGGCCCSnf7 family protein. 
Os01g0510600006-075-H02TGCGGGCCNONE 
AK072814TGCGGGCCTetratricopeptide-like helical domain containing protein. 
AK104796TGCGGGCCNONE 
J013028A13TGCGGGCCNONE 
J013109A12TGCGGGCCNONE 
J023141A19TGCGGGCCNONE 
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE 
AJ251563TGCGGGCCCCACTGACAGNONE 
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel. 
AK104055TGCGGGCCCCACTGACAGNONE 
AK104419TGCGGGCCCCACTGACAGNONE 
J023057A07TGCGGGCCCCACTGACAGNONE 
J023068C08TGCGGGCCCCACTGACAGNONE 
J023148E24TGCGGGCCCCACTGACAGNONE 
J090045O22TGCGGGCCCCACTGACAGNONE 
J090045P03TGCGGGCCCCACTGACAGNONE 
J090050C18TGCGGGCCCCACTGACAGNONE 
J100023F01TGCGGGCCCCACTGACAGNONE 
J100051I18TGCGGGCCCCACTGACAGNONE 
J100060P17TGCGGGCCCCACTGACAGNONE 
Os01g0612600004-008-D07TGCGGGCCCCACTGACNONE 
004-008-D07TGCGGGCCGGGCCGNONE 
009-057-C09TGCGGGCCCCACTGACNONE 
009-057-C09TGCGGGCCGGGCCGNONE 
009-130-C01TGCGGGCCCCACTGACNONE 
009-130-C01TGCGGGCCGGGCCGNONE 
AK062906TGCGGGCCCCACTGACNONE 
AK062906TGCGGGCCGGGCCGNONE 
AK066561TGCGGGCCCCACTGACProtein of unknown function DUF1644 family protein. 
AK066561TGCGGGCCGGGCCGProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCCCACTGACNONE 
J013065E14TGCGGGCCGGGCCGNONE 
J013073D14TGCGGGCCCCACTGACNONE 
J013073D14TGCGGGCCGGGCCGNONE 
J023014A21TGCGGGCCCCACTGACNONE 
J023014A21TGCGGGCCGGGCCGNONE 
J023073M13TGCGGGCCCCACTGACNONE 
J023073M13TGCGGGCCGGGCCGNONE 
J023079F02TGCGGGCCCCACTGACNONE 
J023079F02TGCGGGCCGGGCCGNONE 
J023083B16TGCGGGCCCCACTGACNONE 
J023083B16TGCGGGCCGGGCCGNONE 
J023090G19TGCGGGCCCCACTGACNONE 
J023090G19TGCGGGCCGGGCCGNONE 
J023095F15TGCGGGCCCCACTGACNONE 
J023095F15TGCGGGCCGGGCCGNONE 
J023119H11TGCGGGCCCCACTGACNONE 
J023119H11TGCGGGCCGGGCCGNONE 
J033040B01TGCGGGCCCCACTGACNONE 
J033040B01TGCGGGCCGGGCCGNONE 
J033044F13TGCGGGCCCCACTGACNONE 
J033044F13TGCGGGCCGGGCCGNONE 
J033081E23TGCGGGCCCCACTGACNONE 
J033081E23TGCGGGCCGGGCCGNONE 
J033121K07TGCGGGCCCCACTGACNONE 
J033121K07TGCGGGCCGGGCCGNONE 
J033124D11TGCGGGCCCCACTGACNONE 
J033124D11TGCGGGCCGGGCCGNONE 
J033131N22TGCGGGCCCCACTGACNONE 
J033131N22TGCGGGCCGGGCCGNONE 
J065179E10TGCGGGCCCCACTGACNONE 
J065179E10TGCGGGCCGGGCCGNONE 
J090020A13TGCGGGCCCCACTGACNONE 
J090020A13TGCGGGCCGGGCCGNONE 
J090045K17TGCGGGCCCCACTGACNONE 
J090045K17TGCGGGCCGGGCCGNONE 
J090047M24TGCGGGCCCCACTGACNONE 
J090047M24TGCGGGCCGGGCCGNONE 
J090064G23TGCGGGCCCCACTGACNONE 
J090064G23TGCGGGCCGGGCCGNONE 
J090084G08TGCGGGCCCCACTGACNONE 
J090084G08TGCGGGCCGGGCCGNONE 
J090086F18TGCGGGCCCCACTGACNONE 
J090086F18TGCGGGCCGGGCCGNONE 
J100032D09TGCGGGCCCCACTGACNONE 
J100032D09TGCGGGCCGGGCCGNONE 
J100037O18TGCGGGCCCCACTGACNONE 
J100037O18TGCGGGCCGGGCCGNONE 
J100042B03TGCGGGCCCCACTGACNONE 
J100042B03TGCGGGCCGGGCCGNONE 
J100061D06TGCGGGCCCCACTGACNONE 
J100061D06TGCGGGCCGGGCCGNONE 
J100061I03TGCGGGCCCCACTGACNONE 
J100061I03TGCGGGCCGGGCCGNONE 
J100063B17TGCGGGCCCCACTGACNONE 
J100063B17TGCGGGCCGGGCCGNONE 
Os01g0672700AK121375TGCGGGCCDNA polymerase, beta-like region domain containing protein. 
J023127C22TGCGGGCCNONE 
J033092B05TGCGGGCCNONE 
J033129P21TGCGGGCCNONE 
J065079H18TGCGGGCCNONE 
Os01g0707300AK059962TGCGGGCCCACCTNONE 
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0725100J075035B02CTTGGGCCCGCANONE 
Os01g0728100005-004-B01GGCCCGCANONE 
Os01g0759200AK069231TGCGGGCCSimilar to PnC401 homologue. 
AK100202TGCGGGCCNONE 
J023013G02TGCGGGCCNONE 
J023027D23TGCGGGCCNONE 
J023052A11TGCGGGCCNONE 
J023086A13TGCGGGCCNONE 
Os01g0785300AK065434TGCGGGCCConserved hypothetical protein. 
AK109546TGCGGGCCNONE 
J065006F14TGCGGGCCNONE 
J075003C22TGCGGGCCNONE 
J075006O20TGCGGGCCNONE 
J075023B20TGCGGGCCNONE 
J075061A17TGCGGGCCNONE 
J075065F01TGCGGGCCNONE 
J075078F02TGCGGGCCNONE 
J075175E13TGCGGGCCNONE 
J075177I09TGCGGGCCNONE 
J075181K14TGCGGGCCNONE 
Os01g0798500006-106-C11CTGGGGCCCGCANONE 
AK061244CTGGGGCCCGCANONE 
AK068219CTGGGGCCCGCAMalate synthase-like family protein. 
J065199O16CTGGGGCCCGCANONE 
Os01g0814100006-089-C01TGCGGGCCNONE 
009-054-H04TGCGGGCCNONE 
AK059376TGCGGGCCNONE 
AK061173TGCGGGCCSimilar to Bindin (Fragment). 
Os01g0846300AK065949CCACGTGTTGCGGGCCGGGCCGGGSimilar to Protein phosphatase 2C. 
Os01g0870100AK067564GCCGGCCCGCAProtein of unknown function DUF1012 family protein. 
AK072312GCCGGCCCGCANONE 
AK103428CTCGGCCCGCACGCCTCNONE 
AK103428GCCGGCCCGCANONE 
Os01g0936800AK103322GGCCCGCAPapD-like domain containing protein. 
J023078G23GGCCCGCANONE 
J033033H10GGCCCGCANONE 
J033125J06GGCCCGCANONE 
J090022G08GGCCCGCANONE 
J090049B21GGCCCGCANONE 
J090081L13GGCCCGCANONE 
J090095J11GGCCCGCANONE 
Os01g0958200AK107370GGCCCGCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
J075001H07GGCCCGCANONE 
Os02g0140200AK066454ATTGGGCCCAGGCCCGCASimilar to Beta-amyrin synthase. 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0168500011-010-B05TGCGGGCCNONE 
AJ831493TGCGGGCCNONE 
AK073338TGCGGGCCNONE 
AK073486TGCGGGCCConserved hypothetical protein. 
J100059F05TGCGGGCCNONE 
J100082K14TGCGGGCCNONE 
J100090P09TGCGGGCCNONE 
Os02g0192300Os02g0192300TGCGGCCCGCAZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0198200J075078L15CGTGGGGCCCGCANONE 
J075097G10CGTGGGGCCCGCANONE 
J075099N12CGTGGGGCCCGCANONE 
J075142K24CGTGGGGCCCGCANONE 
J075199K14CGTGGGGCCCGCANONE 
Os02g0316200AK073932GTGTGGGGGCCCGCACyclin-like F-box domain containing protein. 
AK105757GTGTGGGGGCCCGCANONE 
J023039G03GTGTGGGGGCCCGCANONE 
J033076K03GTGTGGGGGCCCGCANONE 
J075157J22GTGTGGGGGCCCGCANONE 
J090097K02GTGTGGGGGCCCGCANONE 
J100053F10GTGTGGGGGCCCGCANONE 
Os02g0574900AK073087TGCGGGCCGCACyclin-like F-box domain containing protein. 
J033023M04TGCGGGCCGCANONE 
J033117N08TGCGGGCCGCANONE 
J075008F16TGCGGGCCGCANONE 
J075075I19TGCGGGCCGCANONE 
J075079A06TGCGGGCCGCANONE 
J075086I07TGCGGGCCGCANONE 
J075088F13TGCGGGCCGCANONE 
J075093D04TGCGGGCCGCANONE 
J075163C10TGCGGGCCGCANONE 
Os02g0625500011-025-C06CCCGGGCCCGCANONE 
AB050624CCCGGGCCCGCANONE 
AK059188CCCGGGCCCGCANONE 
AK059771CCCGGGCCCGCANONE 
AK101791CCCGGGCCCGCASimilar to Adenosine kinase-like protein (Fragment). 
AY224510CCCGGGCCCGCANONE 
J013152H02CCCGGGCCCGCANONE 
J023012P09CCCGGGCCCGCANONE 
J023127D16CCCGGGCCCGCANONE 
J033024G01CCCGGGCCCGCANONE 
J033025L19CCCGGGCCCGCANONE 
J033080M04CCCGGGCCCGCANONE 
J033101A08CCCGGGCCCGCANONE 
J033121L12CCCGGGCCCGCANONE 
J043017N15CCCGGGCCCGCANONE 
J065207J01CCCGGGCCCGCANONE 
J090049G12CCCGGGCCCGCANONE 
J100036A07CCCGGGCCCGCANONE 
J100076C04CCCGGGCCCGCANONE 
J100080N22CCCGGGCCCGCANONE 
Os02g0626100005-017-F11CTCGGCCCGCANONE 
AK058306CTCGGCCCGCANONE 
Os02g0658500AK120166ACCGGGCCCGCATGTCAGTGNONE 
Os02g0751600006-048-C01GGCCCGCANONE 
006-059-E07GGCCCGCANONE 
AK060441GGCCCGCANONE 
AK061027GGCCCGCANONE 
AK072946GGCCCGCAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104401GGCCCGCANONE 
J023150D22GGCCCGCANONE 
J075005E17GGCCCGCANONE 
J075019F10GGCCCGCANONE 
J075047K24GGCCCGCANONE 
J075052B13GGCCCGCANONE 
J075063M19GGCCCGCANONE 
J075136P10GGCCCGCANONE 
J075139E24GGCCCGCANONE 
J075152K11GGCCCGCANONE 
J075161A10GGCCCGCANONE 
J075187F20GGCCCGCANONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0129100003-009-E09CACGGCCCGCACCGCNONE 
AF384030CACGGCCCGCACCGCNONE 
AK098993CACGGCCCGCACCGCSeven transmembrane protein MLO2. 
AK111990CACGGCCCGCACCGCNONE 
J013098A12CACGGCCCGCACCGCNONE 
J023020M16CACGGCCCGCACCGCNONE 
J043001L02CACGGCCCGCACCGCNONE 
Os03g0133100013-080-E12CAAGGCCCGCANONE 
AK063608CAAGGCCCGCAHypothetical protein. 
AK119680CAAGGCCCGCANONE 
J075192B05CAAGGCCCGCANONE 
Os03g0143000AK073102GGCCCGCASAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24GGCCCGCANONE 
Os03g0176800AK103848GGCCCGCAConserved hypothetical protein. 
J033148K19GGCCCGCANONE 
J090079G01GGCCCGCANONE 
Os03g0206400AK066494CCCGGGCCCGCAConserved hypothetical protein. 
AK107011CCCGGGCCCGCANONE 
J065162G04CCCGGGCCCGCANONE 
Os03g0238700AK073387TCGTGGGCCGCAGGCCCGCASimilar to Acid phosphatase type 5. 
J033043K11TCGTGGGCCGCAGGCCCGCANONE 
Os03g0268300AK102684TGCGGGCCCCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TGCGGGCCCCNONE 
J013057J23TGCGGGCCCCNONE 
J013149I10TGCGGGCCCCNONE 
J013149M20TGCGGGCCCCNONE 
J013151D14TGCGGGCCCCNONE 
J013162O11TGCGGGCCCCNONE 
J023001F12TGCGGGCCCCNONE 
J023031B21TGCGGGCCCCNONE 
J023080A07TGCGGGCCCCNONE 
J023081N04TGCGGGCCCCNONE 
J023090C08TGCGGGCCCCNONE 
J023134G05TGCGGGCCCCNONE 
J023139G17TGCGGGCCCCNONE 
J023143I10TGCGGGCCCCNONE 
J023147D04TGCGGGCCCCNONE 
J023147O15TGCGGGCCCCNONE 
J033102K23TGCGGGCCCCNONE 
J033106C17TGCGGGCCCCNONE 
J075033G19TGCGGGCCCCNONE 
J075039J18TGCGGGCCCCNONE 
J075050K20TGCGGGCCCCNONE 
J075075J03TGCGGGCCCCNONE 
J075080E16TGCGGGCCCCNONE 
J075086L08TGCGGGCCCCNONE 
J075091K19TGCGGGCCCCNONE 
J075099O20TGCGGGCCCCNONE 
J075104I06TGCGGGCCCCNONE 
J075137C16TGCGGGCCCCNONE 
J075152G03TGCGGGCCCCNONE 
J075176N12TGCGGGCCCCNONE 
J100086K11TGCGGGCCCCNONE 
Os03g0278500AK070850GGCCCGCAPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
J023031B16GGCCCGCANONE 
Os03g0687700AK064673ACCGGCCCGCAConserved hypothetical protein. 
AK119706ACCGGCCCGCANONE 
J075042I10ACCGGCCCGCANONE 
J075111I20ACCGGCCCGCANONE 
J075176K09ACCGGCCCGCANONE 
J080072D18ACCGGCCCGCANONE 
J080306M23ACCGGCCCGCANONE 
Os03g0746000AK073682GACGGCCCGCAConserved hypothetical protein. 
AK111472GACGGCCCGCANONE 
J090083F05GACGGCCCGCANONE 
Os03g0822100AK101094TGCGGGCCTTGGGCTGTGGGCTGCSimilar to Transposase (Fragment). 
J033024N05TGCGGGCCTTGGGCTGTGGGCTGCNONE 
Os03g0825700AK067902TGCGGGCCCCACASimilar to Defective in exine formation. 
Os04g0128700AK107172TGCGGGCCCATTAThioredoxin-like fold domain containing protein. 
J065102M16TGCGGGCCCATTANONE 
J065124K01TGCGGGCCCATTANONE 
J065129I12TGCGGGCCCATTANONE 
J065192C08TGCGGGCCCATTANONE 
Os04g0382300AK071912TGCGGGCCCCACCNONE 
AK101795TGCGGGCCCCACCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0413600009-142-B05TGCGGCCCGCANONE 
AK121192TGCGGCCCGCASimilar to 40S ribosomal protein S14 (Clone MCH2). 
J023086F11TGCGGCCCGCANONE 
J065085D06TGCGGCCCGCANONE 
J075062H12TGCGGCCCGCANONE 
J075072I22TGCGGCCCGCANONE 
J075074H21TGCGGCCCGCANONE 
J075087L16TGCGGCCCGCANONE 
J075088D11TGCGGCCCGCANONE 
J075115N15TGCGGCCCGCANONE 
J100064G10TGCGGCCCGCANONE 
J100080E09TGCGGCCCGCANONE 
Os04g0626400006-050-B09AACGGCCCGCANONE 
006-072-C12AACGGCCCGCANONE 
006-092-C11AACGGCCCGCANONE 
AK059851AACGGCCCGCACalycin-like family protein. 
AK100069AACGGCCCGCANONE 
AK104062AACGGCCCGCANONE 
AK104663AACGGCCCGCANONE 
Os04g0636000015-046-E08AGCCCATAAGGCCCGCANONE 
AK065639AGCCCATAAGGCCCGCASPla/RYanodine receptor SPRY domain containing protein. 
AK099615AGCCCATAAGGCCCGCANONE 
Os04g0637500AK108202TGCGGGCCMitochodrial transcription termination factor-related family protein. 
J065163A11TGCGGGCCNONE 
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
J033075E19GCCACGTGGGCCCGCACCGCNONE 
J033109O19GCCACGTGGGCCCGCACCGCNONE 
J065002J12GCCACGTGGGCCCGCACCGCNONE 
J065026E22GCCACGTGGGCCCGCACCGCNONE 
J065061F05GCCACGTGGGCCCGCACCGCNONE 
J065068D22GCCACGTGGGCCCGCACCGCNONE 
J065072N14GCCACGTGGGCCCGCACCGCNONE 
J065085F02GCCACGTGGGCCCGCACCGCNONE 
J075055G19GCCACGTGGGCCCGCACCGCNONE 
J075105B14GCCACGTGGGCCCGCACCGCNONE 
J075118M17GCCACGTGGGCCCGCACCGCNONE 
J075193H02GCCACGTGGGCCCGCACCGCNONE 
J100040O05GCCACGTGGGCCCGCACCGCNONE 
J100064I04GCCACGTGGGCCCGCACCGCNONE 
Os04g0663800013-021-G09TGCGGGCCNONE 
AK105321TGCGGGCCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0669600AK110767GGCCCGCAPhospholipase/Carboxylesterase family protein. 
J065195K10GGCCCGCANONE 
Os04g0677033J100048A06CTTGGGCCCGCAConserved hypothetical protein. 
Os05g0116000AK058320CCACTGACATGCGGGCCCCACNONE 
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein. 
J023003L12CCACTGACATGCGGGCCCCACNONE 
J023025C18CCACTGACATGCGGGCCCCACNONE 
J023074E20CCACTGACATGCGGGCCCCACNONE 
J023128H09CCACTGACATGCGGGCCCCACNONE 
J033092N18CCACTGACATGCGGGCCCCACNONE 
J065009J09CCACTGACATGCGGGCCCCACNONE 
J090073L21CCACTGACATGCGGGCCCCACNONE 
Os05g0207700AK102665TGCGGGCCCACCCCCACTCCNONE 
AK103861TGCGGGCCCACCCCCACTCCSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os05g0219800AK102822GGCCCGCAGCCCACAASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0223300AK069616CCCGGCCCGGCCCGGCCCGCASimilar to RNA-binding protein. 
J080093O15CCCGGCCCGGCCCGGCCCGCANONE 
J090061N02CCCGGCCCGGCCCGGCCCGCANONE 
Os05g0400800AK065701TGCGGGCCGAASimilar to 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase, chloroplast precursor (EC 5.3.1.16) (Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase) (5-proFAR isomerase) (BBM II). 
Os05g0405400J090016P17GGCCCGCACGCGNONE 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
Os05g0502800016-060-H05CCCATCCACCGGCCCGCANONE 
AK064242CCCATCCACCGGCCCGCANONE 
AK065486CCCATCCACCGGCCCGCANAF1 domain containing protein. 
Os05g0524400AK063963CACGGCCCGCANONE 
AK072857CACGGCCCGCAPhosphofructokinase family protein. 
Os05g0535900AK101539GGTGGGGCCCGCANONE 
AK101555GGTGGGGCCCGCAIQ calmodulin-binding region domain containing protein. 
J013047J05GGTGGGGCCCGCANONE 
Os05g0539400AK068572GGCCCGCAGlycoside hydrolase, family 35 protein. 
J013063P08GGCCCGCANONE 
J013110N24GGCCCGCANONE 
J013156K22GGCCCGCANONE 
J043038A08GGCCCGCANONE 
J090004K18GGCCCGCANONE 
J090085F03GGCCCGCANONE 
Os05g0565200004-015-E06GGCCCGCANONE 
004-015-E06GGCCCGCANONE 
AK067090GGCCCGCASimilar to Urease accessory protein G. 
AK067090GGCCCGCASimilar to Urease accessory protein G. 
AK104200GGCCCGCANONE 
AK104200GGCCCGCANONE 
AK104368GGCCCGCANONE 
AK104368GGCCCGCANONE 
Os06g0157800AK121504CTCGGCCCGCASimilar to CG7224 (Fragment). 
J033022L20CTCGGCCCGCANONE 
J075033D09CTCGGCCCGCANONE 
Os06g0161800AK064664TGCGGGCCCACCTGTCProtein of unknown function DUF569 family protein. 
Os06g0184300AK102933TCCGGCCCGCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os06g0205250J065122J15TGCGGGCCConserved hypothetical protein. 
Os06g0258900AK067794GGGCCCGCAKetose-bisphosphate aldolase, class-II family protein. 
AK099384GGGCCCGCANONE 
Os06g0338900016-067-B02TGCGGGCCNONE 
AK100837TGCGGGCCNucleotidyl transferase domain containing protein. 
J013058L01TGCGGGCCNONE 
J013135N01TGCGGGCCNONE 
J023123E15TGCGGGCCNONE 
J033051J01TGCGGGCCNONE 
J090002O21TGCGGGCCNONE 
J090013F06TGCGGGCCNONE 
J090056F16TGCGGGCCNONE 
J090081G13TGCGGGCCNONE 
J090090P21TGCGGGCCNONE 
J100039F05TGCGGGCCNONE 
J100059J03TGCGGGCCNONE 
Os06g0506600009-119-E12GACGGCCCGCANONE 
J023086A18GACGGCCCGCANONE 
J033036I02GACGGCCCGCANONE 
J033125C16GACGGCCCGCANONE 
J065013I11GACGGCCCGCANONE 
J065026O21GACGGCCCGCANONE 
J065060H10GACGGCCCGCANONE 
J065067A15GACGGCCCGCANONE 
J065068F07GACGGCCCGCANONE 
J065085N06GACGGCCCGCANONE 
J065108N10GACGGCCCGCANONE 
J065161O11GACGGCCCGCANONE 
J065185J15GACGGCCCGCANONE 
J065191H18GACGGCCCGCANONE 
J065199J09GACGGCCCGCANONE 
J075005G03GACGGCCCGCANONE 
J075018C16GACGGCCCGCANONE 
J075061K20GACGGCCCGCANONE 
J075069J06GACGGCCCGCANONE 
J075075H19GACGGCCCGCANONE 
J075076D20GACGGCCCGCANONE 
J075078D16GACGGCCCGCANONE 
J075100J19GACGGCCCGCANONE 
J075110M11GACGGCCCGCANONE 
J075157N05GACGGCCCGCANONE 
J075171F20GACGGCCCGCANONE 
J075177G08GACGGCCCGCANONE 
J075179G08GACGGCCCGCANONE 
Os06g0507200J075010J21TGCGGGCCNONE 
J075170A14TGCGGGCCNONE 
Os06g0589500AK073322CCCGGGCCCGCAConserved hypothetical protein. 
J033030G15CCCGGGCCCGCANONE 
J033148N18CCCGGGCCCGCANONE 
Os07g0133500015-010-H05GGCCCGCANONE 
AB110179GGCCCGCANONE 
AK106244GGCCCGCAProtein of unknown function DUF1005 family protein. 
J090075I21GGCCCGCANONE 
Os07g0166800006-038-C11TGCGGGCCCACCCACGGGNONE 
012-080-F02TGCGGGCCCACCCACGGGNONE 
AK070524TGCGGGCCCACCCACGGGRad6 (Ubiquitin carrier protein). 
AK121382TGCGGGCCCACCCACGGGNONE 
J023022D19TGCGGGCCCACCCACGGGNONE 
J023055G02TGCGGGCCCACCCACGGGNONE 
J023073E02TGCGGGCCCACCCACGGGNONE 
J023125B08TGCGGGCCCACCCACGGGNONE 
J023127H21TGCGGGCCCACCCACGGGNONE 
J033052G01TGCGGGCCCACCCACGGGNONE 
J033067F13TGCGGGCCCACCCACGGGNONE 
J065046L14TGCGGGCCCACCCACGGGNONE 
J065178D11TGCGGGCCCACCCACGGGNONE 
J065205N17TGCGGGCCCACCCACGGGNONE 
J075006K17TGCGGGCCCACCCACGGGNONE 
J075051D20TGCGGGCCCACCCACGGGNONE 
J075109L04TGCGGGCCCACCCACGGGNONE 
J090024K15TGCGGGCCCACCCACGGGNONE 
J090025N04TGCGGGCCCACCCACGGGNONE 
J090049N09TGCGGGCCCACCCACGGGNONE 
J090070N12TGCGGGCCCACCCACGGGNONE 
J090078O21TGCGGGCCCACCCACGGGNONE 
J090083L07TGCGGGCCCACCCACGGGNONE 
J100063K16TGCGGGCCCACCCACGGGNONE 
J100083D14TGCGGGCCCACCCACGGGNONE 
Os07g0255900J075118F23CGCGTGCGGGCCConserved hypothetical protein. 
J075118F23GGCCCGCAConserved hypothetical protein. 
Os07g0504601J065068H15GGGCTTTTTTTCGGCCCGCAConserved hypothetical protein. 
J065095H08GGGCTTTTTTTCGGCCCGCANONE 
Os07g0623600AK063642TGCGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0647800AK102332GGGGCCCGCAConserved hypothetical protein. 
Os07g0691300009-078-C12GGGCCCGCANONE 
009-132-H04GGGCCCGCANONE 
AK069499GGGCCCGCAWound-induced WI12 family protein. 
Os07g0693500AK108401GGCCCGCANONE 
Os08g0107900014-055-C03TGTGGGGCCCGCANONE 
J065062G20TGTGGGGCCCGCANONE 
Os08g0143400015-006-A10TGCGGGCCCACCANONE 
AK066792TGCGGGCCCACCANONE 
AK120532TGCGGGCCCACCASWIRM domain containing protein. 
J100083F02TGCGGGCCCACCANONE 
Os08g0158900AK067062AAATGGGCCCGCAGTP1/OBG domain containing protein. 
J013089F04AAATGGGCCCGCANONE 
J013092D16AAATGGGCCCGCANONE 
J033120K14AAATGGGCCCGCANONE 
J033133F24AAATGGGCCCGCANONE 
J033145A10AAATGGGCCCGCANONE 
J033145A11AAATGGGCCCGCANONE 
J053048H24AAATGGGCCCGCANONE 
J053075H10AAATGGGCCCGCANONE 
Os08g0347200AK058279TGCGGGCCCHypothetical protein. 
J100058J16TGCGGGCCCNONE 
Os08g0411200AK120890TTCGGCCCGCASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0554000AK111661TGCGGGCCCACACWD-40 repeat containing protein. 
AK112044TGCGGGCCCACACNONE 
J013039N12TGCGGGCCCACACNONE 
J013134D02TGCGGGCCCACACNONE 
J013153B06TGCGGGCCCACACNONE 
J033044L16TGCGGGCCCACACNONE 
J033073P14TGCGGGCCCACACNONE 
Os09g0261300AK059648TTTCGGCCCGCASimilar to 4-nitrophenylphosphatase-like protein. 
AK121797TTTCGGCCCGCANONE 
J033095P18TTTCGGCCCGCANONE 
J043039L01TTTCGGCCCGCANONE 
J065153N19TTTCGGCCCGCANONE 
Os09g0274100009-112-B02AGTTGGGCCCGCANONE 
AK062823AGTTGGGCCCGCAConserved hypothetical protein. 
Os09g0369500013-023-F11TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105322TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105479TGCGGGCCCCACGCCTGGGCCCCConserved hypothetical protein. 
Os09g0538450J080302B10TGCGGGCCAGAHypothetical protein. 
Os09g0548700Os09g0548700GGCCCGCAFAD dependent oxidoreductase family protein. 
Os11g0130300AK059597TTCGGCCCGCANse1 non-SMC component of SMC5-6 complex family protein. 
AK101224TTCGGCCCGCANONE 
J033031D09TTCGGCCCGCANONE 
J033135B02TTCGGCCCGCANONE 
J100021A17TTCGGCCCGCANONE 
J100066G09TTCGGCCCGCANONE 
Os11g0146000009-080-E10GGGCCCGCANONE 
AK062645GGGCCCGCAHypothetical protein. 
Os11g0615700AB026561ACACGTGGGCCCGCANONE 
AK059521ACACGTGGGCCCGCANONE 
AK103487ACACGTGGGCCCGCAProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ACACGTGGGCCCGCANONE 
J065044A11ACACGTGGGCCCGCANONE 
J065090I02ACACGTGGGCCCGCANONE 
J065104I09ACACGTGGGCCCGCANONE 
J065187J10ACACGTGGGCCCGCANONE 
J075024E07ACACGTGGGCCCGCANONE 
J075025O13ACACGTGGGCCCGCANONE 
J090062N12ACACGTGGGCCCGCANONE 
J090087G06ACACGTGGGCCCGCANONE 
J090098K11ACACGTGGGCCCGCANONE 
Os11g0703100J100071A15TGCGGGCCGGGThaumatin, pathogenesis-related family protein. 
Os11g0703200Os11g0703200TGCGGGCCGGGNONE 
Os12g0108201013-071-B01TGCGGGCCCNONE 
J013060C24TGCGGGCCCNONE 
J023026L08TGCGGGCCCHypothetical protein. 
Os12g0242500J065129F10AATGGGCCGGCGCGGGTGCGGGCCNONE 
J090032G12AATGGGCCGGCGCGGGTGCGGGCCConserved hypothetical protein. 
Os12g0625000006-117-H03TGCGGGCCCCACCTGNONE 
AF073695TGCGGGCCCCACCTGNONE 
AK061993TGCGGGCCCCACCTGNONE 
AK099598TGCGGGCCCCACCTGCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 
Os12g0631600J075087C06GGGGCCCGCAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.