version

Summary of OsREG633 (All List)

OrganismOryza sativa  
IDOsREG633  
SequenceGGCCCGGA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count805  

Entry Sequences (805 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03CGCGTGGGCCCGGANONE 
006-049-C10CGCGTGGGCCCGGANONE 
006-054-E02CGCGTGGGCCCGGANONE 
011-035-H02CGCGTGGGCCCGGANONE 
011-036-E04CGCGTGGGCCCGGANONE 
012-047-C08CGCGTGGGCCCGGANONE 
012-079-F08CGCGTGGGCCCGGANONE 
012-097-C02CGCGTGGGCCCGGANONE 
012-100-A07CGCGTGGGCCCGGANONE 
013-015-H05CGCGTGGGCCCGGANONE 
013-047-A03CGCGTGGGCCCGGANONE 
013-051-B05CGCGTGGGCCCGGANONE 
013-061-G02CGCGTGGGCCCGGANONE 
013-077-H02CGCGTGGGCCCGGANONE 
015-005-D04CGCGTGGGCCCGGANONE 
015-064-B06CGCGTGGGCCCGGANONE 
015-072-D02CGCGTGGGCCCGGANONE 
016-073-E09CGCGTGGGCCCGGANONE 
016-088-H03CGCGTGGGCCCGGANONE 
AK062063CGCGTGGGCCCGGANONE 
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277CGCGTGGGCCCGGANONE 
AK119645CGCGTGGGCCCGGANONE 
AY341828CGCGTGGGCCCGGANONE 
J013036O08CGCGTGGGCCCGGANONE 
J013037M17CGCGTGGGCCCGGANONE 
J013039B11CGCGTGGGCCCGGANONE 
J013039L20CGCGTGGGCCCGGANONE 
J013047B20CGCGTGGGCCCGGANONE 
J013048E23CGCGTGGGCCCGGANONE 
J013051E12CGCGTGGGCCCGGANONE 
J013051F12CGCGTGGGCCCGGANONE 
J013056B05CGCGTGGGCCCGGANONE 
J013057N24CGCGTGGGCCCGGANONE 
J013064D21CGCGTGGGCCCGGANONE 
J013065G24CGCGTGGGCCCGGANONE 
J013075L13CGCGTGGGCCCGGANONE 
J013075L24CGCGTGGGCCCGGANONE 
J013092F04CGCGTGGGCCCGGANONE 
J013092F10CGCGTGGGCCCGGANONE 
J013092M16CGCGTGGGCCCGGANONE 
J013096K06CGCGTGGGCCCGGANONE 
J013111F10CGCGTGGGCCCGGANONE 
J013120B17CGCGTGGGCCCGGANONE 
J013120P07CGCGTGGGCCCGGANONE 
J013122F18CGCGTGGGCCCGGANONE 
J013122H23CGCGTGGGCCCGGANONE 
J013126I15CGCGTGGGCCCGGANONE 
J013126L17CGCGTGGGCCCGGANONE 
J013129C15CGCGTGGGCCCGGANONE 
J013146A04CGCGTGGGCCCGGANONE 
J013146A06CGCGTGGGCCCGGANONE 
J013153F01CGCGTGGGCCCGGANONE 
J013156O06CGCGTGGGCCCGGANONE 
J013162D05CGCGTGGGCCCGGANONE 
J023008N04CGCGTGGGCCCGGANONE 
J023010D06CGCGTGGGCCCGGANONE 
J023011I23CGCGTGGGCCCGGANONE 
J023023I15CGCGTGGGCCCGGANONE 
J023025C08CGCGTGGGCCCGGANONE 
J023029H02CGCGTGGGCCCGGANONE 
J023033C18CGCGTGGGCCCGGANONE 
J023037D21CGCGTGGGCCCGGANONE 
J023049F17CGCGTGGGCCCGGANONE 
J023052B15CGCGTGGGCCCGGANONE 
J023061D03CGCGTGGGCCCGGANONE 
J023062M01CGCGTGGGCCCGGANONE 
J023089D24CGCGTGGGCCCGGANONE 
J023109J20CGCGTGGGCCCGGANONE 
J023109M21CGCGTGGGCCCGGANONE 
J023120N04CGCGTGGGCCCGGANONE 
J023122A04CGCGTGGGCCCGGANONE 
J023134F23CGCGTGGGCCCGGANONE 
J023149E20CGCGTGGGCCCGGANONE 
J033022A12CGCGTGGGCCCGGANONE 
J033022C04CGCGTGGGCCCGGANONE 
J033024K06CGCGTGGGCCCGGANONE 
J033026F23CGCGTGGGCCCGGANONE 
J033029J19CGCGTGGGCCCGGANONE 
J033040H20CGCGTGGGCCCGGANONE 
J033042P21CGCGTGGGCCCGGANONE 
J033043F14CGCGTGGGCCCGGANONE 
J033044G11CGCGTGGGCCCGGANONE 
J033052L10CGCGTGGGCCCGGANONE 
J033052O03CGCGTGGGCCCGGANONE 
J033052P03CGCGTGGGCCCGGANONE 
J033079B20CGCGTGGGCCCGGANONE 
J033089D21CGCGTGGGCCCGGANONE 
J033094P04CGCGTGGGCCCGGANONE 
J033103N02CGCGTGGGCCCGGANONE 
J033110J19CGCGTGGGCCCGGANONE 
J033114E17CGCGTGGGCCCGGANONE 
J033115K04CGCGTGGGCCCGGANONE 
J033119I06CGCGTGGGCCCGGANONE 
J033121L10CGCGTGGGCCCGGANONE 
J033123H14CGCGTGGGCCCGGANONE 
J033136H10CGCGTGGGCCCGGANONE 
J033139L07CGCGTGGGCCCGGANONE 
J033143G23CGCGTGGGCCCGGANONE 
J043021F16CGCGTGGGCCCGGANONE 
J080304G01CGCGTGGGCCCGGANONE 
J080305H24CGCGTGGGCCCGGANONE 
J080309B11CGCGTGGGCCCGGANONE 
J080315N09CGCGTGGGCCCGGANONE 
J080319J20CGCGTGGGCCCGGANONE 
J090014D01CGCGTGGGCCCGGANONE 
J090067F08CGCGTGGGCCCGGANONE 
J090079P18CGCGTGGGCCCGGANONE 
J090082K13CGCGTGGGCCCGGANONE 
J090093K17CGCGTGGGCCCGGANONE 
J090099G18CGCGTGGGCCCGGANONE 
J100022K14CGCGTGGGCCCGGANONE 
J100052G17CGCGTGGGCCCGGANONE 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0254900AK068204CGTGTGGGGCCCGGASimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530CGTGTGGGGCCCGGANONE 
Os01g0639900004-009-H08GGCCCGGANONE 
006-050-F07GGCCCGGANONE 
006-120-D04GGCCCGGANONE 
AF182806GGCCCGGANONE 
AK060890GGCCCGGASimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825GGCCCGGANONE 
J075022I06GGCCCGGANONE 
U08404GGCCCGGANONE 
Os01g0685900AK064024GGCCCGGANONE 
AK102005GGCCCGGASimilar to 65kD microtubule associated protein. 
Os01g0720700J033124M22TCCGGGCCCACGCNONE 
J065006G21TCCGGGCCCACGCNONE 
J065025M24TCCGGGCCCACGCNONE 
J065041J02TCCGGGCCCACGCNONE 
J065044B14TCCGGGCCCACGCNONE 
J065061J06TCCGGGCCCACGCNONE 
J065116L21TCCGGGCCCACGCNONE 
J075030F18TCCGGGCCCACGCNONE 
J075034K17TCCGGGCCCACGCNONE 
J075063I02TCCGGGCCCACGCNONE 
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase. 
J075188L15TCCGGGCCCACGCNONE 
J075197B17TCCGGGCCCACGCNONE 
Os01g0743400AK059177TCCGGGCCGCASimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114TCCGGGCCGCANONE 
J065070E07TCCGGGCCGCANONE 
J065152G11TCCGGGCCGCANONE 
Os01g0750900AK111087TCCGGGCCGGGConserved hypothetical protein. 
J100042H18TCCGGGCCGGGNONE 
J100044L13TCCGGGCCGGGNONE 
Os01g0865100016-066-A05TCCGGGCCCCACCNONE 
AK065779TCCGGGCCCCACCNONE 
AK071410TCCGGGCCCCACCSimilar to Uricase (Fragment). 
J013039E23TCCGGGCCCCACCNONE 
J023024I07TCCGGGCCCCACCNONE 
J065160J15TCCGGGCCCCACCNONE 
J090052J17TCCGGGCCCCACCNONE 
Os01g0877500AK101067GGTGGGCCCGGAProtein of unknown function UPF0054 family protein. 
Os02g0199800AK072970TCCGGGCCSimilar to No pollen. 
Os02g0301400AK121646CGGCCCGGAThioredoxin-like fold domain containing protein. 
J033028E10CGGCCCGGANONE 
J033058J23CGGCCCGGANONE 
Os02g0527300AK101934TCCGGGCCCCGCCGAGATSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11TCCGGGCCCCGCCGAGATNONE 
J033073P11TCCGGGCCCCGCCGAGATNONE 
Os02g0601800AB060276GACGGCCCGGATCCGACCCGCNONE 
AK099539GACGGCCCGGATCCGACCCGCNONE 
AK101873GACGGCCCGGATCCGACCCGCBromodomain containing protein. 
AK106801GACGGCCCGGATCCGACCCGCNONE 
AK121758GACGGCCCGGATCCGACCCGCNONE 
AK121891GACGGCCCGGATCCGACCCGCNONE 
J013059H01GACGGCCCGGATCCGACCCGCNONE 
J013092F08GACGGCCCGGATCCGACCCGCNONE 
J013146J04GACGGCCCGGATCCGACCCGCNONE 
J023001K12GACGGCCCGGATCCGACCCGCNONE 
J023002H16GACGGCCCGGATCCGACCCGCNONE 
J023013B10GACGGCCCGGATCCGACCCGCNONE 
J023081I22GACGGCCCGGATCCGACCCGCNONE 
J023084K19GACGGCCCGGATCCGACCCGCNONE 
J023150E24GACGGCCCGGATCCGACCCGCNONE 
J033023B18GACGGCCCGGATCCGACCCGCNONE 
J033025F18GACGGCCCGGATCCGACCCGCNONE 
J033048P08GACGGCCCGGATCCGACCCGCNONE 
J033060M24GACGGCCCGGATCCGACCCGCNONE 
J033070G06GACGGCCCGGATCCGACCCGCNONE 
J033088P12GACGGCCCGGATCCGACCCGCNONE 
J033105C13GACGGCCCGGATCCGACCCGCNONE 
J043009N18GACGGCCCGGATCCGACCCGCNONE 
J065103G21GACGGCCCGGATCCGACCCGCNONE 
J075039H15GACGGCCCGGATCCGACCCGCNONE 
J090014K10GACGGCCCGGATCCGACCCGCNONE 
J090022N02GACGGCCCGGATCCGACCCGCNONE 
J090033F18GACGGCCCGGATCCGACCCGCNONE 
J090033I04GACGGCCCGGATCCGACCCGCNONE 
J090041F11GACGGCCCGGATCCGACCCGCNONE 
J090045P20GACGGCCCGGATCCGACCCGCNONE 
J090054B01GACGGCCCGGATCCGACCCGCNONE 
J090055M12GACGGCCCGGATCCGACCCGCNONE 
J090071K09GACGGCCCGGATCCGACCCGCNONE 
J090098O16GACGGCCCGGATCCGACCCGCNONE 
J090099P15GACGGCCCGGATCCGACCCGCNONE 
J100050I16GACGGCCCGGATCCGACCCGCNONE 
Os02g0702600AK102549TCCGGGCCProtein of unknown function DUF315 domain containing protein. 
AK102962TCCGGGCCNONE 
Os02g0705100012-046-E01GGCCCGGANONE 
AK063491GGCCCGGAEpoxide hydrolase family protein. 
J065184H07GGCCCGGANONE 
Os02g0768600006-034-F01TCCGGGCCNONE 
006-046-G07TCCGGGCCNONE 
006-054-C07TCCGGGCCNONE 
006-056-F07TCCGGGCCNONE 
006-100-C02TCCGGGCCNONE 
AK059725TCCGGGCCNONE 
AK098996TCCGGGCCNONE 
AK099120TCCGGGCCNONE 
AK104659TCCGGGCCNONE 
J065043H04TCCGGGCCNONE 
J075034N21TCCGGGCCNONE 
J075145C18TCCGGGCCNONE 
J080016H01TCCGGGCCNONE 
J080040F01TCCGGGCCNONE 
J080047L23TCCGGGCCNONE 
J080049B22TCCGGGCCNONE 
J080062J16TCCGGGCCNONE 
J080064C23TCCGGGCCNONE 
J080064L22TCCGGGCCNONE 
J080077N01TCCGGGCCNONE 
J080097G17TCCGGGCCNONE 
J100065L15TCCGGGCCNONE 
J100066K23TCCGGGCCNONE 
J100088C07TCCGGGCCNONE 
J100090H09TCCGGGCCNONE 
Os03g0131500AK109755TCCGGGCCGGTVitamin K epoxide reductase domain containing protein. 
Os03g0146000006-105-H06TCCGGGCCNONE 
AK061250TCCGGGCCSimilar to RAB1X. 
AK099130TCCGGGCCNONE 
J023043D11TCCGGGCCNONE 
J043009O17TCCGGGCCNONE 
Os03g0213800AK103114CCAGGCCCGGAMitochondrial substrate carrier family protein. 
Os03g0265900009-004-C01TCCGGGCCNONE 
009-045-B03TCCGGGCCNONE 
AK099963TCCGGGCCNONE 
AK120374TCCGGGCCConserved hypothetical protein. 
J013036A19TCCGGGCCNONE 
J013070J20TCCGGGCCNONE 
J013071C06TCCGGGCCNONE 
J013088C01TCCGGGCCNONE 
J013112H21TCCGGGCCNONE 
J065114K10TCCGGGCCNONE 
J100028M20TCCGGGCCNONE 
Os03g0266000AK068775GGCCCGGAOvarian tumour, otubain domain containing protein. 
AK104949GGCCCGGANONE 
J075149K24GGCCCGGANONE 
J075184C19GGCCCGGANONE 
Os03g0287900009-074-B07TCCGGGCCAGCCCAACCNONE 
014-027-E07TCCGGGCCAGCCCAACCNONE 
AK063663TCCGGGCCAGCCCAACCSimilar to Protein disulfide isomerase. 
J065009N21TCCGGGCCAGCCCAACCNONE 
Os03g0310800009-126-C10GGCCCGGANONE 
009-156-D02GGCCCGGANONE 
AK058663GGCCCGGANONE 
AK099476GGCCCGGASimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15GGCCCGGANONE 
J075046C12GGCCCGGANONE 
J075058D24GGCCCGGANONE 
J075151M03GGCCCGGANONE 
J075151M04GGCCCGGANONE 
J075153I20GGCCCGGANONE 
J075167J05GGCCCGGANONE 
J075179G06GGCCCGGANONE 
J100025I19GGCCCGGANONE 
J100025L21GGCCCGGANONE 
J100029C06GGCCCGGANONE 
J100068E24GGCCCGGANONE 
J100070F10GGCCCGGANONE 
J100083H23GGCCCGGANONE 
J100089H10GGCCCGGANONE 
Os03g0390400009-175-E06TCCGGGCCCATTTNONE 
013-040-G01TCCGGGCCCATTTNONE 
014-050-G05TCCGGGCCCATTTNONE 
AB025187TCCGGGCCCATTTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TCCGGGCCCATTTNONE 
J013033A17TCCGGGCCCATTTNONE 
J023028J08TCCGGGCCCATTTNONE 
J023061N05TCCGGGCCCATTTNONE 
J023077A03TCCGGGCCCATTTNONE 
J023086E01TCCGGGCCCATTTNONE 
J033022A08TCCGGGCCCATTTNONE 
J033040F24TCCGGGCCCATTTNONE 
J075073I24TCCGGGCCCATTTNONE 
J075081H01TCCGGGCCCATTTNONE 
J075175N19TCCGGGCCCATTTNONE 
J100025M03TCCGGGCCCATTTNONE 
J100036J06TCCGGGCCCATTTNONE 
J100045O18TCCGGGCCCATTTNONE 
J100062G15TCCGGGCCCATTTNONE 
J100090N19TCCGGGCCCATTTNONE 
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CGTGTGGGCCCGGGCCCGGANONE 
J023036P06CGTGTGGGCCCGGGCCCGGANONE 
J023145E24CGTGTGGGCCCGGGCCCGGANONE 
J033142I11CGTGTGGGCCCGGGCCCGGANONE 
J043003A10CGTGTGGGCCCGGGCCCGGANONE 
J075023H21CGTGTGGGCCCGGGCCCGGANONE 
J075145O10CGTGTGGGCCCGGGCCCGGANONE 
J075149A03CGTGTGGGCCCGGGCCCGGANONE 
J090099B09CGTGTGGGCCCGGGCCCGGANONE 
J100017L14CGTGTGGGCCCGGGCCCGGANONE 
J100050K18CGTGTGGGCCCGGGCCCGGANONE 
J100063P16CGTGTGGGCCCGGGCCCGGANONE 
Os03g0647400AK073665GGGCCCGGAGCK domain containing protein. 
J033051B07GGGCCCGGANONE 
Os03g0703300016-074-H01CTCGGCCCGGANONE 
AK073831CTCGGCCCGGACalponin-like actin-binding domain containing protein. 
Os03g0708400006-108-F11TCCGGGCCNONE 
AK066216TCCGGGCCProtein of unknown function DUF1295 family protein. 
Os03g0748500AK110695TCCGGGCCGAANONE 
Os03g0752700011-093-A02GGCCCGGANONE 
AK122157GGCCCGGAHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03GGCCCGGANONE 
J033096O19GGCCCGGANONE 
J033145P19GGCCCGGANONE 
J065008K09GGCCCGGANONE 
J065027J08GGCCCGGANONE 
J065073H12GGCCCGGANONE 
J065078G14GGCCCGGANONE 
J065092L12GGCCCGGANONE 
J065108D11GGCCCGGANONE 
J065140G10GGCCCGGANONE 
J065161D24GGCCCGGANONE 
J065170F04GGCCCGGANONE 
J075004K20GGCCCGGANONE 
J075069F16GGCCCGGANONE 
J075085B12GGCCCGGANONE 
J075087D24GGCCCGGANONE 
J075102G15GGCCCGGANONE 
J075123M06GGCCCGGANONE 
J090058D24GGCCCGGANONE 
J090068I12GGCCCGGANONE 
J090094A19GGCCCGGANONE 
Os03g0776000AK103010TCCGGGCCGlucose-6-phosphate isomerase, cytosolic A (EC 5.3.1.9) (GPI-A) (Phosphoglucose isomerase A) (PGI-A) (Phosphohexose isomerase A) (PHI- A). 
D45217TCCGGGCCNONE 
J013055D22TCCGGGCCNONE 
J033099D04TCCGGGCCNONE 
J033116J21TCCGGGCCNONE 
J090083J09TCCGGGCCNONE 
Os03g0822700005-010-E01TCCGGGCCCACCANONE 
006-088-H12TCCGGGCCCACCANONE 
AK061682TCCGGGCCCACCANONE 
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein. 
J023091N05TCCGGGCCCACCANONE 
Os03g0852600009-174-G04ATATGGGCCCGGANONE 
AK063101ATATGGGCCCGGAProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCGGANONE 
J090046K24ATATGGGCCCGGANONE 
Os03g0852900011-012-A12TCCGGGCCCAACTNONE 
AK100660TCCGGGCCCAACTSimilar to Cleavage and polyadenylation specificity factor, 73 kDa subunit (CPSF 73 kDa subunit). 
J013073D18TCCGGGCCCAACTNONE 
J013152K17TCCGGGCCCAACTNONE 
J023111N01TCCGGGCCCAACTNONE 
J065214G07TCCGGGCCCAACTNONE 
J090080E10TCCGGGCCCAACTNONE 
Os04g0306800AK067583GGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0390500AK066575TCCGGGCCCCNONE 
AK099908TCCGGGCCCCNONE 
AK100148TCCGGGCCCCNONE 
Os04g0418000006-025-C05TCCGGGCCCNONE 
006-025-D11TCCGGGCCCNONE 
006-045-F02TCCGGGCCCNONE 
006-060-B04TCCGGGCCCNONE 
006-063-E03TCCGGGCCCNONE 
006-070-G08TCCGGGCCCNONE 
006-072-H05TCCGGGCCCNONE 
AK061030TCCGGGCCCNONE 
AK099124TCCGGGCCCNONE 
AK106155TCCGGGCCCConserved hypothetical protein. 
AK119714TCCGGGCCCNONE 
J023039I07TCCGGGCCCNONE 
J065025N03TCCGGGCCCNONE 
Os04g0459500003-112-C04TCCGGGCCNONE 
005-007-G12TCCGGGCCNONE 
006-024-D09TCCGGGCCNONE 
006-029-A05TCCGGGCCNONE 
006-034-D04TCCGGGCCNONE 
006-035-A02TCCGGGCCNONE 
006-050-A04TCCGGGCCNONE 
006-055-D10TCCGGGCCNONE 
006-080-D10TCCGGGCCNONE 
006-087-F05TCCGGGCCNONE 
006-100-C06TCCGGGCCNONE 
006-101-H02TCCGGGCCNONE 
006-104-F04TCCGGGCCNONE 
006-106-G10TCCGGGCCNONE 
006-109-H05TCCGGGCCNONE 
006-111-E04TCCGGGCCNONE 
006-120-B05TCCGGGCCNONE 
013-002-F12TCCGGGCCNONE 
013-056-G09TCCGGGCCNONE 
013-089-G12TCCGGGCCNONE 
013-096-D05TCCGGGCCNONE 
014-045-E08TCCGGGCCNONE 
014-047-D08TCCGGGCCNONE 
AF010582TCCGGGCCNONE 
AF022730TCCGGGCCNONE 
AK067817TCCGGGCCNONE 
AK071685TCCGGGCCSimilar to GADPH (383 AA) (Fragment). 
AK103922TCCGGGCCNONE 
AK103932TCCGGGCCNONE 
AK103994TCCGGGCCNONE 
AK104690TCCGGGCCNONE 
AK119220TCCGGGCCNONE 
AK119522TCCGGGCCNONE 
J013089O16TCCGGGCCNONE 
J013091G09TCCGGGCCNONE 
J013154K22TCCGGGCCNONE 
J023001G11TCCGGGCCNONE 
J023012E14TCCGGGCCNONE 
J023087K19TCCGGGCCNONE 
J023108H17TCCGGGCCNONE 
J065001P05TCCGGGCCNONE 
J065001P20TCCGGGCCNONE 
J065005D17TCCGGGCCNONE 
J065005E14TCCGGGCCNONE 
J065009H11TCCGGGCCNONE 
J065017E02TCCGGGCCNONE 
J065021C13TCCGGGCCNONE 
J065021K14TCCGGGCCNONE 
J065023K19TCCGGGCCNONE 
J065039F09TCCGGGCCNONE 
J065039F13TCCGGGCCNONE 
J065043D11TCCGGGCCNONE 
J065055I15TCCGGGCCNONE 
J065055L02TCCGGGCCNONE 
J065059E24TCCGGGCCNONE 
J065059O20TCCGGGCCNONE 
J065062E22TCCGGGCCNONE 
J065093F24TCCGGGCCNONE 
J065097B02TCCGGGCCNONE 
J065099J02TCCGGGCCNONE 
J065102P12TCCGGGCCNONE 
J065104I07TCCGGGCCNONE 
J065118A15TCCGGGCCNONE 
J065118F09TCCGGGCCNONE 
J065122J12TCCGGGCCNONE 
J065124F06TCCGGGCCNONE 
J065124G17TCCGGGCCNONE 
J065132K22TCCGGGCCNONE 
J065157C08TCCGGGCCNONE 
J065162K20TCCGGGCCNONE 
J065163D15TCCGGGCCNONE 
J065171K06TCCGGGCCNONE 
J065180G19TCCGGGCCNONE 
J065182H17TCCGGGCCNONE 
J065182O14TCCGGGCCNONE 
J065186H16TCCGGGCCNONE 
J065191B03TCCGGGCCNONE 
J065196I19TCCGGGCCNONE 
J065198E21TCCGGGCCNONE 
J065198M07TCCGGGCCNONE 
J065210M16TCCGGGCCNONE 
J065218M12TCCGGGCCNONE 
J075001K03TCCGGGCCNONE 
J075002E04TCCGGGCCNONE 
J075003K20TCCGGGCCNONE 
J075004D03TCCGGGCCNONE 
J075005G14TCCGGGCCNONE 
J075015K12TCCGGGCCNONE 
J075021B19TCCGGGCCNONE 
J075026J17TCCGGGCCNONE 
J075027I04TCCGGGCCNONE 
J075035E15TCCGGGCCNONE 
J075038I04TCCGGGCCNONE 
J075040F02TCCGGGCCNONE 
J075041G10TCCGGGCCNONE 
J075045H10TCCGGGCCNONE 
J075048M01TCCGGGCCNONE 
J075048P09TCCGGGCCNONE 
J075055P04TCCGGGCCNONE 
J075056H01TCCGGGCCNONE 
J075063P11TCCGGGCCNONE 
J075067E11TCCGGGCCNONE 
J075072N21TCCGGGCCNONE 
J075076C07TCCGGGCCNONE 
J075081G19TCCGGGCCNONE 
J075092C11TCCGGGCCNONE 
J075092E20TCCGGGCCNONE 
J075093K19TCCGGGCCNONE 
J075094E17TCCGGGCCNONE 
J075094H19TCCGGGCCNONE 
J075095M01TCCGGGCCNONE 
J075098B01TCCGGGCCNONE 
J075106G19TCCGGGCCNONE 
J075112B05TCCGGGCCNONE 
J075114C05TCCGGGCCNONE 
J075114H06TCCGGGCCNONE 
J075114P03TCCGGGCCNONE 
J075115D19TCCGGGCCNONE 
J075121B06TCCGGGCCNONE 
J075123B08TCCGGGCCNONE 
J075126A06TCCGGGCCNONE 
J075127C21TCCGGGCCNONE 
J075127O10TCCGGGCCNONE 
J075130C17TCCGGGCCNONE 
J075132M23TCCGGGCCNONE 
J075136M23TCCGGGCCNONE 
J075142B11TCCGGGCCNONE 
J075144A21TCCGGGCCNONE 
J075151O07TCCGGGCCNONE 
J075161F16TCCGGGCCNONE 
J075166O12TCCGGGCCNONE 
J075173C13TCCGGGCCNONE 
J075178H13TCCGGGCCNONE 
J075181N24TCCGGGCCNONE 
J075186B02TCCGGGCCNONE 
J075191N15TCCGGGCCNONE 
J075193E05TCCGGGCCNONE 
J075197G18TCCGGGCCNONE 
J080305C13TCCGGGCCNONE 
J080310D22TCCGGGCCNONE 
J090010A06TCCGGGCCNONE 
J090046C20TCCGGGCCNONE 
J090070D07TCCGGGCCNONE 
J100035D02TCCGGGCCNONE 
J100050N01TCCGGGCCNONE 
Os04g0459600006-039-H09TCCGGGCCNONE 
AK061516TCCGGGCCRan-interacting Mog1 protein family protein. 
J065112J03TCCGGGCCNONE 
Os04g0491500AK068089TCCGGGCCGGCNONE 
AK101116TCCGGGCCGGCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0627000AK101563TCCGGGCCGAGANONE 
Os04g0659400AK070174CTCGGCCCGGAENT domain containing protein. 
Os04g0689700AK066225TCCGGGCCNucleotide-binding, alpha-beta plait domain containing protein. 
J013051K19TCCGGGCCNONE 
J033087C24TCCGGGCCNONE 
J090009C03TCCGGGCCNONE 
J090037D23TCCGGGCCNONE 
Os05g0156200AK071622TCCGGGCCGTTConserved hypothetical protein. 
J023099E19TCCGGGCCGTTNONE 
J090025C09TCCGGGCCGTTNONE 
J090071K23TCCGGGCCGTTNONE 
Os05g0320700AK100598TCCGGGCCCACGTSimilar to Cytochrome P450. 
AK104994TCCGGGCCCACGTNONE 
Os05g0328000AK107977TTTCGGCCCGGAConserved hypothetical protein. 
J065005I02TTTCGGCCCGGANONE 
J065049M05TTTCGGCCCGGANONE 
J080005F01TTTCGGCCCGGANONE 
J080005H15TTTCGGCCCGGANONE 
J080005K23TTTCGGCCCGGANONE 
J080007O03TTTCGGCCCGGANONE 
J080013H09TTTCGGCCCGGANONE 
J080024C02TTTCGGCCCGGANONE 
J080026M22TTTCGGCCCGGANONE 
J080029K21TTTCGGCCCGGANONE 
J080032K04TTTCGGCCCGGANONE 
J080034M16TTTCGGCCCGGANONE 
J080037G11TTTCGGCCCGGANONE 
J080040L01TTTCGGCCCGGANONE 
J080041D13TTTCGGCCCGGANONE 
J080043G20TTTCGGCCCGGANONE 
J080046H17TTTCGGCCCGGANONE 
J080048A05TTTCGGCCCGGANONE 
J080064C21TTTCGGCCCGGANONE 
J080067E15TTTCGGCCCGGANONE 
J080071P05TTTCGGCCCGGANONE 
J080074H16TTTCGGCCCGGANONE 
J080076A18TTTCGGCCCGGANONE 
J080076D20TTTCGGCCCGGANONE 
J080077J15TTTCGGCCCGGANONE 
J080085J11TTTCGGCCCGGANONE 
J080086E08TTTCGGCCCGGANONE 
J080088I23TTTCGGCCCGGANONE 
J080088I24TTTCGGCCCGGANONE 
J080089D05TTTCGGCCCGGANONE 
J080093B04TTTCGGCCCGGANONE 
J080093D07TTTCGGCCCGGANONE 
J080094A09TTTCGGCCCGGANONE 
J080096I12TTTCGGCCCGGANONE 
J080097L23TTTCGGCCCGGANONE 
Os05g0379300AK109293GGCCCGGAConserved hypothetical protein. 
Os05g0494600AK108158TCCGGGCCGAConserved hypothetical protein. 
Os05g0501300006-075-B11GGCCCGGANONE 
006-083-H08GGCCCGGANONE 
AK059889GGCCCGGASimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02GGCCCGGANONE 
Os05g0533600AK067577TCCGGGCCCCACTCCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560TCCGGGCCCCACTCCNONE 
AY373258TCCGGGCCCCACTCCNONE 
Os05g0594100006-034-F04TCCGGGCCGTTGNONE 
006-061-A02TCCGGGCCGTTGNONE 
009-081-E02TCCGGGCCGTTGNONE 
AK060122TCCGGGCCGTTGNONE 
AK106130TCCGGGCCGTTGSimilar to GDA2 protein. 
J023010C07TCCGGGCCGTTGNONE 
J023098J20TCCGGGCCGTTGNONE 
J023117G22TCCGGGCCGTTGNONE 
J023127J08TCCGGGCCGTTGNONE 
J033117G03TCCGGGCCGTTGNONE 
J033124I03TCCGGGCCGTTGNONE 
J043015K15TCCGGGCCGTTGNONE 
Os06g0107800009-133-F03TCCGGGCCGTTGGATNONE 
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein. 
Os06g0226500009-030-E06TCCGGGCCNONE 
AK071601TCCGGGCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J023102C01TCCGGGCCNONE 
Os06g0472200AK059428TCCGGGCCNONE 
AK103043TCCGGGCCSimilar to Isoflavone reductase homolog Bet v 6.0101 (Fragment). 
J033117F05TCCGGGCCNONE 
Os06g0603000AK068856TCCGGGCCCACCTGTCNONE 
AK104955TCCGGGCCCACCTGTCSimilar to Heme oxygenase 1 (Fragment). 
Os06g0663600AK100787TCCGGGCCGCAEndonuclease V family protein. 
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GATCCGACGGCCCGGANONE 
J033136G07GATCCGACGGCCCGGANONE 
J065092I12GATCCGACGGCCCGGANONE 
J065132F04GATCCGACGGCCCGGANONE 
J065143I11GATCCGACGGCCCGGANONE 
Os07g0162600015-024-F04CTTGGGCCCGGANONE 
015-024-F04TCGTGGGCCCGGANONE 
AK105789CTTGGGCCCGGANONE 
AK105789TCGTGGGCCCGGANONE 
AK106274CTTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
AK106274TCGTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
J100026E18CTTGGGCCCGGANONE 
J100026E18TCGTGGGCCCGGANONE 
J100037B07CTTGGGCCCGGANONE 
J100037B07TCGTGGGCCCGGANONE 
J100090H11CTTGGGCCCGGANONE 
J100090H11TCGTGGGCCCGGANONE 
Os07g0171100AF272978TCCGGGCCCACCACNONE 
AK062132TCCGGGCCCACCACNONE 
AK066475TCCGGGCCCACCACTetratricopeptide-like helical domain containing protein. 
J013068C23TCCGGGCCCACCACNONE 
Os07g0290800AK071498TCCGGGCCTic22-like family protein. 
J075099P10TCCGGGCCNONE 
Os07g0462700009-033-D05TCCGGGCCNONE 
009-033-D05TCCGGGCCNONE 
AK073834TCCGGGCCNONE 
AK073834TCCGGGCCNONE 
AK104968TCCGGGCCThioesterase superfamily domain containing protein. 
AK104968TCCGGGCCThioesterase superfamily domain containing protein. 
J065104G16TCCGGGCCNONE 
J065104G16TCCGGGCCNONE 
J065197C14TCCGGGCCNONE 
J065197C14TCCGGGCCNONE 
J065213E17TCCGGGCCNONE 
J065213E17TCCGGGCCNONE 
J065215D11TCCGGGCCNONE 
J065215D11TCCGGGCCNONE 
J075001J15TCCGGGCCNONE 
J075001J15TCCGGGCCNONE 
J075026M11TCCGGGCCNONE 
J075026M11TCCGGGCCNONE 
J075142G03TCCGGGCCNONE 
J075142G03TCCGGGCCNONE 
J075178H04TCCGGGCCNONE 
J075178H04TCCGGGCCNONE 
J100069P18TCCGGGCCNONE 
J100069P18TCCGGGCCNONE 
Os07g0474300AK108961CGCCACGTGTCCGGGCCCCConserved hypothetical protein. 
Os07g0530700AK060014GGCCCGGANONE 
Os07g0539950J065152C18TCCGGGCCNONE 
J065166J23TCCGGGCCHypothetical protein. 
Os07g0545400009-136-E03TCCGGGCCCACGANONE 
013-015-G08TCCGGGCCCACGANONE 
AK059228TCCGGGCCCACGANONE 
J065040D09TCCGGGCCCACGANONE 
J065051C19TCCGGGCCCACGANONE 
J065139B05TCCGGGCCCACGANONE 
J065160E20TCCGGGCCCACGANONE 
J065207I17TCCGGGCCCACGANONE 
J080319M24TCCGGGCCCACGANONE 
Os07g0546100AK058282TCCGGGCCCGGGNONE 
Os07g0558400003-103-C02GGCCCGGANONE 
003-115-G05GGCCCGGANONE 
006-025-B09GGCCCGGANONE 
006-025-G10GGCCCGGANONE 
006-027-E03GGCCCGGANONE 
006-036-C06GGCCCGGANONE 
006-045-B10GGCCCGGANONE 
006-051-H11GGCCCGGANONE 
006-053-H03GGCCCGGANONE 
006-057-B09GGCCCGGANONE 
006-062-C10GGCCCGGANONE 
006-075-B12GGCCCGGANONE 
006-079-F01GGCCCGGANONE 
006-082-D08GGCCCGGANONE 
006-087-F04GGCCCGGANONE 
006-089-E09GGCCCGGANONE 
006-090-C04GGCCCGGANONE 
006-091-H05GGCCCGGANONE 
006-093-E02GGCCCGGANONE 
006-093-E06GGCCCGGANONE 
006-093-H05GGCCCGGANONE 
006-095-C05GGCCCGGANONE 
006-097-B04GGCCCGGANONE 
006-097-C07GGCCCGGANONE 
006-097-D02GGCCCGGANONE 
006-097-H10GGCCCGGANONE 
006-098-C05GGCCCGGANONE 
006-099-H09GGCCCGGANONE 
006-104-B06GGCCCGGANONE 
006-105-B11GGCCCGGANONE 
006-106-E12GGCCCGGANONE 
006-107-B06GGCCCGGANONE 
006-109-A09GGCCCGGANONE 
006-112-D05GGCCCGGANONE 
006-118-C12GGCCCGGANONE 
006-118-E10GGCCCGGANONE 
006-120-D05GGCCCGGANONE 
006-120-E08GGCCCGGANONE 
009-055-D12GGCCCGGANONE 
009-108-E05GGCCCGGANONE 
009-125-H05GGCCCGGANONE 
009-150-A07GGCCCGGANONE 
009-198-C07GGCCCGGANONE 
AF058796GGCCCGGANONE 
AK058293GGCCCGGANONE 
AK098992GGCCCGGANONE 
AK103924GGCCCGGANONE 
AK104309GGCCCGGANONE 
AK104619GGCCCGGANONE 
AK119534GGCCCGGASimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13GGCCCGGANONE 
J043039O11GGCCCGGANONE 
J065176D03GGCCCGGANONE 
J075022K10GGCCCGGANONE 
J075065A02GGCCCGGANONE 
J075077D23GGCCCGGANONE 
J075088P15GGCCCGGANONE 
J075125D24GGCCCGGANONE 
J075125H11GGCCCGGANONE 
J075192H21GGCCCGGANONE 
J090080H18GGCCCGGANONE 
Os07g0619400009-095-D09TCCGGGCCCATATNONE 
AK062716TCCGGGCCCATATCalcium-binding EF-hand domain containing protein. 
Os07g0681500AK103662TCCGGGCCCACCTGACAGGNONE 
AK121650TCCGGGCCCACCTGACAGGAnkyrin repeat containing protein. 
Os08g0305000AK102896TCCGGGCCNONE 
AK107492TCCGGGCCHypothetical protein. 
Os08g0398700AK120068GGCCCGGAPeptidase M1, membrane alanine aminopeptidase family protein. 
AK120068TCCGGGCCPeptidase M1, membrane alanine aminopeptidase family protein. 
Os08g0440100AK068551TCCGGGCCCSimilar to Temperature stress-induced lipocalin. 
J013155M04TCCGGGCCCNONE 
J033041C20TCCGGGCCCNONE 
J043031L02TCCGGGCCCNONE 
J043038J23TCCGGGCCCNONE 
J065006F20TCCGGGCCCNONE 
J065030H05TCCGGGCCCNONE 
J065069H05TCCGGGCCCNONE 
J065078M19TCCGGGCCCNONE 
J065146E24TCCGGGCCCNONE 
J065154J17TCCGGGCCCNONE 
J065158L04TCCGGGCCCNONE 
J065182J20TCCGGGCCCNONE 
J065211P16TCCGGGCCCNONE 
J075020M18TCCGGGCCCNONE 
J075035J01TCCGGGCCCNONE 
J075037K13TCCGGGCCCNONE 
J075052E12TCCGGGCCCNONE 
J075056I12TCCGGGCCCNONE 
J075064H18TCCGGGCCCNONE 
J075121E06TCCGGGCCCNONE 
J075123H03TCCGGGCCCNONE 
J075146P20TCCGGGCCCNONE 
J075156O06TCCGGGCCCNONE 
J075158A14TCCGGGCCCNONE 
J075169L03TCCGGGCCCNONE 
J090013K02TCCGGGCCCNONE 
Os08g0525600AK103172TCCGGGCCGTTSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os09g0243200AK107718TCCGGGCCGAAZinc finger, RING-type domain containing protein. 
Os09g0325700011-041-G03CACGTGTCCGGGCCTGGNONE 
011-041-G03GGACGGCCCGGANONE 
AK063334CACGTGTCCGGGCCTGGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
AK063334GGACGGCCCGGASimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24CACGTGTCCGGGCCTGGNONE 
J080317M24GGACGGCCCGGANONE 
Os09g0416400J075067A16TCGGACGGCGGAGAGGTGGGCCCGGAConserved hypothetical protein. 
J075104N21TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075106F04TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075131F08TCGGACGGCGGAGAGGTGGGCCCGGANONE 
Os09g0424600AK073882TCCGGGCCGTGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0433700AK072369TCCGGGCCCSimilar to Pectin methylesterase (Fragment). 
Os09g0480400AK100641TCCGGGCCCCCCCGCGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
J023110G15TCCGGGCCCCCCCGCGNONE 
J090053K21TCCGGGCCCCCCCGCGNONE 
Os09g0522800015-033-B12CCCGGCCCGGANONE 
015-083-G12CCCGGCCCGGANONE 
AK070906CCCGGCCCGGAProtein of unknown function DUF1618 domain containing protein. 
J023065L17CCCGGCCCGGANONE 
J090090P20CCCGGCCCGGANONE 
Os11g0132700AK103286GGCCCGGACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0549615AK069660TCCGGGCCCACCTGAcid phosphatase, type 5 family protein. 
J023031L04TCCGGGCCCACCTGNONE 
Os12g0131300J090086B06GGCCCGGAHypothetical protein. 
Os12g0527500AK109836CCAGGCCCATCCGGGCCCACGGCCCyclin-like F-box domain containing protein. 
Os12g0564400009-069-F12TCCGGGCCNONE 
AK059949TCCGGGCCSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548TCCGGGCCNONE 
Os12g0572400016-084-F04CCCACTCCGGGCCNONE 
AK065531CCCACTCCGGGCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03CCCACTCCGGGCCNONE 
J013034H02CCCACTCCGGGCCNONE 
J033117N05CCCACTCCGGGCCNONE 
J065027L09CCCACTCCGGGCCNONE 
J065037D09CCCACTCCGGGCCNONE 
J065197I09CCCACTCCGGGCCNONE 
J090045C01CCCACTCCGGGCCNONE 
J100031E11CCCACTCCGGGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.