version

Summary of OsREG634 (All List)

OrganismOryza sativa  
IDOsREG634  
SequenceGGCCGAAA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1347  

Entry Sequences (1347 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422TAATGGGCCGAAAPeptidyl-tRNA hydrolase family protein. 
Os01g0179901J075009I05GAGGCCCATTGGGCCGAAANONE 
J075058D09GAGGCCCATTGGGCCGAAANONE 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
Os01g0184500AK060699GCTGGGCCGAAADEAD/DEAH box helicase, N-terminal domain containing protein. 
Os01g0229100006-113-G08ACGTGGGCCGAAANONE 
011-075-E08ACGTGGGCCGAAANONE 
AK061285ACGTGGGCCGAAANONE 
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein. 
J013059F08ACGTGGGCCGAAANONE 
J013059G08ACGTGGGCCGAAANONE 
J013059G09ACGTGGGCCGAAANONE 
J013069M12ACGTGGGCCGAAANONE 
J013105A19ACGTGGGCCGAAANONE 
J013149F07ACGTGGGCCGAAANONE 
J023073J07ACGTGGGCCGAAANONE 
J023130F24ACGTGGGCCGAAANONE 
J023147J08ACGTGGGCCGAAANONE 
J033028F13ACGTGGGCCGAAANONE 
J033115A16ACGTGGGCCGAAANONE 
J033135F02ACGTGGGCCGAAANONE 
J065031G16ACGTGGGCCGAAANONE 
J065058A09ACGTGGGCCGAAANONE 
J065089N15ACGTGGGCCGAAANONE 
J065130I09ACGTGGGCCGAAANONE 
J065191P09ACGTGGGCCGAAANONE 
J065197P14ACGTGGGCCGAAANONE 
J080306D15ACGTGGGCCGAAANONE 
J080308M06ACGTGGGCCGAAANONE 
J080315A03ACGTGGGCCGAAANONE 
J080315N11ACGTGGGCCGAAANONE 
J090046E14ACGTGGGCCGAAANONE 
J090058G09ACGTGGGCCGAAANONE 
J090077H05ACGTGGGCCGAAANONE 
J090087O20ACGTGGGCCGAAANONE 
Os01g0229200AK066024TTTCGGCCCACGTVHS domain containing protein. 
Os01g0271700J065184P16CGGGCCGAAANONE 
J075182E21CGGGCCGAAANONE 
J075191M19CGGGCCGAAANONE 
J090021E22CGGGCCGAAANONE 
Os01g0306100AK111041TTTCGGCCCAATPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0349800AK069610GGCCGAAASimilar to Cytochrome P450. 
Os01g0504500AK103784TTTCGGCCMulti antimicrobial extrusion protein MatE family protein. 
Os01g0513800012-032-E11GGCCGAAAAGCCCATANONE 
AK100776GGCCGAAAAGCCCATASimilar to Brix domain containing protein 1 homolog. 
J023120C10GGCCGAAAAGCCCATANONE 
J033044A22GGCCGAAAAGCCCATANONE 
J033048H13GGCCGAAAAGCCCATANONE 
J033118F03GGCCGAAAAGCCCATANONE 
J065176B05GGCCGAAAAGCCCATANONE 
J075026B19GGCCGAAAAGCCCATANONE 
J075048I23GGCCGAAAAGCCCATANONE 
J075141A19GGCCGAAAAGCCCATANONE 
J075148E05GGCCGAAAAGCCCATANONE 
J090031M12GGCCGAAAAGCCCATANONE 
Os01g0514300AK121086TTTCGGCCCATTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0570500AK111703GGCCGAAASimilar to Dual specificity kinase 1. 
AK111922GGCCGAAANONE 
Os01g0596300016-083-D09TTTCGGCCCACACNONE 
AK069151TTTCGGCCCACACCyclin-like F-box domain containing protein. 
J023007D17TTTCGGCCCACACNONE 
J065141M02TTTCGGCCCACACNONE 
Os01g0611000003-117-E07GGCCGAAANONE 
006-051-D01GGCCGAAANONE 
006-085-B10GGCCGAAANONE 
012-092-F03GGCCGAAANONE 
AK060682GGCCGAAANONE 
AK072500GGCCGAAASimilar to Unidentified precursor. 
AK105921GGCCGAAANONE 
J023001D07GGCCGAAANONE 
J023075J23GGCCGAAANONE 
J023127H12GGCCGAAANONE 
J033024H20GGCCGAAANONE 
J033025H03GGCCGAAANONE 
J065057F11GGCCGAAANONE 
J065096C07GGCCGAAANONE 
J065103A08GGCCGAAANONE 
J065137L11GGCCGAAANONE 
J065179I16GGCCGAAANONE 
J065197P22GGCCGAAANONE 
J075089M08GGCCGAAANONE 
J090008N14GGCCGAAANONE 
J090011K16GGCCGAAANONE 
J090075K24GGCCGAAANONE 
J090079E08GGCCGAAANONE 
Os01g0696000AK066735TGGATGGGCCGAAATTTCGGCCCATCANONE 
AK110917TGGATGGGCCGAAATTTCGGCCCATCASimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J013088G11TGGATGGGCCGAAATTTCGGCCCATCANONE 
J013102H08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J033126F08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J065053G13TGGATGGGCCGAAATTTCGGCCCATCANONE 
J075109I06TGGATGGGCCGAAATTTCGGCCCATCANONE 
J100073H07TGGATGGGCCGAAATTTCGGCCCATCANONE 
Os01g0708300AK060040GGCCGAAANONE 
Os01g0727400AK065692TTTCGGCCCGConserved hypothetical protein. 
Os01g0729500J065152I20GGCCGAAANONE 
Os01g0776600AK071643TTTCGGCCSimilar to Purple acid phosphatase (EC 3.1.3.2). 
Os01g0794400AK122041GGCCGAAAThioredoxin domain 2 containing protein. 
Os01g0839300AK064685GAGGCCCACTGGGCCGAAASimilar to 50S ribosomal protein L17. 
J065060I21GAGGCCCACTGGGCCGAAANONE 
Os01g0848900AK065438TTTCGGCCConserved hypothetical protein. 
J013025A05TTTCGGCCNONE 
J053026J20TTTCGGCCNONE 
J053027B19TTTCGGCCNONE 
J053033A12TTTCGGCCNONE 
J053039K16TTTCGGCCNONE 
J053039K17TTTCGGCCNONE 
J053051N18TTTCGGCCNONE 
J053053B06TTTCGGCCNONE 
J053060A12TTTCGGCCNONE 
J053074L18TTTCGGCCNONE 
J053083E22TTTCGGCCNONE 
J053086P22TTTCGGCCNONE 
J053095G12TTTCGGCCNONE 
J100018E11TTTCGGCCNONE 
Os01g0869000AK067351TTTCGGCCCATCCNONE 
AK121602TTTCGGCCCATCCProtein of unknown function DUF639 family protein. 
Os01g0871300AK059062GGCCGAAA1-aminocyclopropane-1-carboxylate synthase family protein. 
AK067545GGCCGAAANONE 
J013111C16GGCCGAAANONE 
Os01g0891700AK105471GGCCGAAALeucine rich repeat, N-terminal domain containing protein. 
Os01g0908100AK072293GCTGGGCCGAAATTTCGGCCCAGTARabGAP/TBC domain containing protein. 
J065010B13GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065010M12GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065047C19GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065069B18GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065071K24GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065142P04GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065170E11GCTGGGCCGAAATTTCGGCCCAGTANONE 
Os01g0958100AK058574TTTCGGCCNONE 
AK103090TTTCGGCCSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TTTCGGCCNONE 
Os02g0176400009-099-H11TCATGGGCCGAAANONE 
AK062746TCATGGGCCGAAAProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0189100AK111066GGCCGAAAConserved hypothetical protein. 
J053061N01GGCCGAAANONE 
J053088H13GGCCGAAANONE 
J065038F12GGCCGAAANONE 
J065083I18GGCCGAAANONE 
J065085A17GGCCGAAANONE 
J065110G06GGCCGAAANONE 
J065117J19GGCCGAAANONE 
J065120D21GGCCGAAANONE 
J065121C23GGCCGAAANONE 
J065174E03GGCCGAAANONE 
J075182G01GGCCGAAANONE 
J080302D10GGCCGAAANONE 
J080309F08GGCCGAAANONE 
J080310H15GGCCGAAANONE 
Os02g0192700004-020-H12TTTCGGCCCAACANONE 
006-024-H06TTTCGGCCCAACANONE 
006-042-F06TTTCGGCCCAACANONE 
006-050-D04TTTCGGCCCAACANONE 
006-059-E10TTTCGGCCCAACANONE 
006-070-B02TTTCGGCCCAACANONE 
006-084-A09TTTCGGCCCAACANONE 
006-114-E11TTTCGGCCCAACANONE 
006-117-E05TTTCGGCCCAACANONE 
009-126-D11TTTCGGCCCAACANONE 
AK061629TTTCGGCCCAACASimilar to Thioredoxin peroxidase. 
AK065909TTTCGGCCCAACANONE 
J013043E11TTTCGGCCCAACANONE 
J065038I09TTTCGGCCCAACANONE 
J065078C12TTTCGGCCCAACANONE 
J065122O14TTTCGGCCCAACANONE 
J065198H04TTTCGGCCCAACANONE 
Os02g0227200009-123-E01TTTCGGCCNONE 
AB018377TTTCGGCCNONE 
AK072428TTTCGGCCNONE 
AK120885TTTCGGCCEarly nodulin. 
J013022O14TTTCGGCCNONE 
J043034L12TTTCGGCCNONE 
J065030L16TTTCGGCCNONE 
J065056C10TTTCGGCCNONE 
J065066P11TTTCGGCCNONE 
J065101I24TTTCGGCCNONE 
J065102E21TTTCGGCCNONE 
J065113P17TTTCGGCCNONE 
J065120I17TTTCGGCCNONE 
J065122P08TTTCGGCCNONE 
J065124D04TTTCGGCCNONE 
J065140K10TTTCGGCCNONE 
J065140P20TTTCGGCCNONE 
J065147O15TTTCGGCCNONE 
J065148L22TTTCGGCCNONE 
J065159N03TTTCGGCCNONE 
J065180B09TTTCGGCCNONE 
J075027C19TTTCGGCCNONE 
J075120L04TTTCGGCCNONE 
J075134I10TTTCGGCCNONE 
J075161B08TTTCGGCCNONE 
J075172F11TTTCGGCCNONE 
J090073H01TTTCGGCCNONE 
J100017B11TTTCGGCCNONE 
J100030L05TTTCGGCCNONE 
J100064A03TTTCGGCCNONE 
Os02g0445700011-046-C10TTTCGGCCNONE 
Os02g0527300AK101934TTTCGGCCSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11TTTCGGCCNONE 
J033073P11TTTCGGCCNONE 
Os02g0530300014-069-H07TTTCGGCCNONE 
AK063708TTTCGGCCZinc finger, A20-type domain containing protein. 
Os02g0588500009-147-C07TTTCGGCCNONE 
AK062989TTTCGGCCNONE 
AK100170TTTCGGCCGlycerophosphoryl diester phosphodiesterase family protein. 
AK100542TTTCGGCCNONE 
J013152L08TTTCGGCCNONE 
J023014I01TTTCGGCCNONE 
J023025E23TTTCGGCCNONE 
J023038F09TTTCGGCCNONE 
J023038I12TTTCGGCCNONE 
J023055E20TTTCGGCCNONE 
J023058M10TTTCGGCCNONE 
J033026K18TTTCGGCCNONE 
J033030J10TTTCGGCCNONE 
J033034I18TTTCGGCCNONE 
J033036F07TTTCGGCCNONE 
J033070D10TTTCGGCCNONE 
J033095B07TTTCGGCCNONE 
J033138J17TTTCGGCCNONE 
J065006C23TTTCGGCCNONE 
J065123K08TTTCGGCCNONE 
J075028C17TTTCGGCCNONE 
J090002J22TTTCGGCCNONE 
J090054B13TTTCGGCCNONE 
J090061N13TTTCGGCCNONE 
J090083A16TTTCGGCCNONE 
J090088A05TTTCGGCCNONE 
J100039F04TTTCGGCCNONE 
J100040F03TTTCGGCCNONE 
J100042I06TTTCGGCCNONE 
J100052P04TTTCGGCCNONE 
J100057O08TTTCGGCCNONE 
J100076O07TTTCGGCCNONE 
Os02g0591700AK072777CCACGGCCGAAASimilar to Candida glabrata strain CBS138 chromosome L complete sequence. 
J013096O06CCACGGCCGAAANONE 
J023139B06CCACGGCCGAAANONE 
J065114F05CCACGGCCGAAANONE 
J090059C21CCACGGCCGAAANONE 
Os02g0593900Os02g0593900TATTGGGCCGAAAMethyltransferases-related family protein. 
Os02g0621500AK120798TTTCGGCCCAACCZinc finger, RING-type domain containing protein. 
Os02g0638000AK103830GGCCGAAANONE 
AK106548GGCCGAAAConserved hypothetical protein. 
Os02g0638650J090094O16GGCCGAAAPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os02g0672600AK070286TTTCGGCCSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174TTTCGGCCNONE 
Os02g0733300AK101108TCCAACGGCCGAAASimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446TCCAACGGCCGAAANONE 
Os02g0780800J090080O19TTTCGGCCCATTTNONE 
J090091I06TTTCGGCCCATTTNONE 
Os02g0795100016-001-E07GGCCGAAANONE 
AK106456GGCCGAAAEukaryotic transcription factor, DNA-binding domain containing protein. 
Os02g0798700AK101070GGCCGAAANeurochondrin family protein. 
AK103079GGCCGAAANONE 
J090045L09GGCCGAAANONE 
Os02g0814300AK111376CGGGCCGAAACytochrome c, monohaem domain containing protein. 
J065063I24CGGGCCGAAANONE 
Os02g0824900AK073217GGCCGAAANONE 
AK103528GGCCGAAAConserved hypothetical protein. 
J090069J01GGCCGAAANONE 
J090081B04GGCCGAAANONE 
Os03g0106200AK120128GGCCGAAAConserved hypothetical protein. 
Os03g0115200009-112-E09TTTCGGCCCAATANONE 
AK071287TTTCGGCCCAATASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TTTCGGCCCAATANONE 
J065075D17TTTCGGCCCAATANONE 
J065108G15TTTCGGCCCAATANONE 
J065165A16TTTCGGCCCAATANONE 
J075015O12TTTCGGCCCAATANONE 
J075022O06TTTCGGCCCAATANONE 
J075031H14TTTCGGCCCAATANONE 
J075033D10TTTCGGCCCAATANONE 
J075070A04TTTCGGCCCAATANONE 
J075127A05TTTCGGCCCAATANONE 
J100070B16TTTCGGCCCAATANONE 
Os03g0120300AK066854TTTCGGCCCATATProtein of unknown function DUF1084 family protein. 
AK104882TTTCGGCCCATATNONE 
J013075C10TTTCGGCCCATATNONE 
J090012B18TTTCGGCCCATATNONE 
J090087J08TTTCGGCCCATATNONE 
Os03g0123600006-064-G05ATCCAACGGCCGAAANONE 
AK101248ATCCAACGGCCGAAANONE 
AK105012ATCCAACGGCCGAAAProtein of unknown function Cys-rich family protein. 
AK109354ATCCAACGGCCGAAANONE 
J033032D06ATCCAACGGCCGAAANONE 
J080308A01ATCCAACGGCCGAAANONE 
J090071H02ATCCAACGGCCGAAANONE 
J100048C10ATCCAACGGCCGAAANONE 
Os03g0125700009-132-G03TAATGGGCCGAAANONE 
AK062913TAATGGGCCGAAAConserved hypothetical protein. 
J075046C16TAATGGGCCGAAANONE 
J075115L05TAATGGGCCGAAANONE 
J075143I05TAATGGGCCGAAANONE 
J075197O07TAATGGGCCGAAANONE 
Os03g0136200004-011-E10TTTCGGCCNONE 
006-067-A08TTTCGGCCNONE 
011-007-E02TTTCGGCCNONE 
011-099-H10TTTCGGCCNONE 
012-044-D08TTTCGGCCNONE 
013-045-G12TTTCGGCCNONE 
013-062-C09TTTCGGCCNONE 
013-072-F09TTTCGGCCNONE 
013-085-B12TTTCGGCCNONE 
013-097-E09TTTCGGCCNONE 
013-097-F09TTTCGGCCNONE 
014-013-C09TTTCGGCCNONE 
014-082-D08TTTCGGCCNONE 
015-071-A09TTTCGGCCNONE 
AF042333TTTCGGCCNONE 
AK060887TTTCGGCCNONE 
AK121681TTTCGGCC24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14TTTCGGCCNONE 
J013123F01TTTCGGCCNONE 
J023050A02TTTCGGCCNONE 
J033046H22TTTCGGCCNONE 
J033070A11TTTCGGCCNONE 
J065059G11TTTCGGCCNONE 
J065068F10TTTCGGCCNONE 
J065164A10TTTCGGCCNONE 
J075031F07TTTCGGCCNONE 
J075054J01TTTCGGCCNONE 
J075086M04TTTCGGCCNONE 
J075118K23TTTCGGCCNONE 
J075122A09TTTCGGCCNONE 
J075123D06TTTCGGCCNONE 
J075129A22TTTCGGCCNONE 
J075161E07TTTCGGCCNONE 
J075179H04TTTCGGCCNONE 
J075181C06TTTCGGCCNONE 
J075186A12TTTCGGCCNONE 
J090014H16TTTCGGCCNONE 
J090045G17TTTCGGCCNONE 
J090048B09TTTCGGCCNONE 
J090052J23TTTCGGCCNONE 
J090052K22TTTCGGCCNONE 
J090059F10TTTCGGCCNONE 
J090080F19TTTCGGCCNONE 
J100039J08TTTCGGCCNONE 
J100044K02TTTCGGCCNONE 
J100051E16TTTCGGCCNONE 
J100053F08TTTCGGCCNONE 
J100056F07TTTCGGCCNONE 
J100058A10TTTCGGCCNONE 
Os03g0138600Os03g0138600TTTCGGCCProtein of unknown function DUF810 family protein. 
Os03g0161000AK121425CCCCCACGGGTTTCGGCCNONE 
J023135K12CCCCCACGGGTTTCGGCCNONE 
Os03g0201700AK102580TTTCGGCCHypothetical protein. 
J033098B09TTTCGGCCNONE 
J065068H09TTTCGGCCNONE 
J100048D12TTTCGGCCNONE 
J100049K21TTTCGGCCNONE 
Os03g0260600AK106649GGCCGAAABasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0262400014-013-D09AAAAGCCCAAAAGGCCGAAANONE 
AK059989AAAAGCCCAAAAGGCCGAAASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18AAAAGCCCAAAAGGCCGAAANONE 
J033025J23AAAAGCCCAAAAGGCCGAAANONE 
J065047G10AAAAGCCCAAAAGGCCGAAANONE 
J065153H03AAAAGCCCAAAAGGCCGAAANONE 
J065155J08AAAAGCCCAAAAGGCCGAAANONE 
J075025C05AAAAGCCCAAAAGGCCGAAANONE 
Os03g0266900013-080-C12ATTTGGGCCGAAANONE 
014-010-A09ATTTGGGCCGAAANONE 
014-013-G10ATTTGGGCCGAAANONE 
014-019-D06ATTTGGGCCGAAANONE 
014-030-F08ATTTGGGCCGAAANONE 
014-039-C05ATTTGGGCCGAAANONE 
014-053-H08ATTTGGGCCGAAANONE 
014-089-F06ATTTGGGCCGAAANONE 
014-094-A05ATTTGGGCCGAAANONE 
014-098-C12ATTTGGGCCGAAANONE 
AK119243ATTTGGGCCGAAALow molecular mass heat shock protein Oshsp17.3. 
AK119717ATTTGGGCCGAAANONE 
D12635ATTTGGGCCGAAANONE 
M80186ATTTGGGCCGAAANONE 
Os03g0268200AK069243TTTCGGCCNONE 
AK099658TTTCGGCCNONE 
AK101486TTTCGGCCProtein kinase-like domain containing protein. 
AK121160TTTCGGCCNONE 
J023010P21TTTCGGCCNONE 
J023079P09TTTCGGCCNONE 
J033041M21TTTCGGCCNONE 
J065013H06TTTCGGCCNONE 
J065024C01TTTCGGCCNONE 
J065038G21TTTCGGCCNONE 
J065062C15TTTCGGCCNONE 
J090026J03TTTCGGCCNONE 
J090080F03TTTCGGCCNONE 
Os03g0302200AK120853GGCCGAAAZinc finger, RING-type domain containing protein. 
J023023P20GGCCGAAANONE 
J023064E11GGCCGAAANONE 
J033036C20GGCCGAAANONE 
J043029P08GGCCGAAANONE 
J065124C11GGCCGAAANONE 
J090001K02GGCCGAAANONE 
J090021D03GGCCGAAANONE 
J090034D03GGCCGAAANONE 
J090062J10GGCCGAAANONE 
J100037A15GGCCGAAANONE 
J100067M23GGCCGAAANONE 
Os03g0302700006-099-F12ATTTGGGCCGAAANONE 
AK112010ATTTGGGCCGAAAZinc finger, RING-type domain containing protein. 
AK121656ATTTGGGCCGAAANONE 
J075090A19ATTTGGGCCGAAANONE 
J075148M06ATTTGGGCCGAAANONE 
Os03g0321000AK103653GGCCGAAASimilar to Steroid membrane binding protein-like. 
Os03g0372700AK064323GGTTGGGCCGAAANONE 
AK073312GGTTGGGCCGAAALow temperature viability protein family protein. 
Os03g0383100AK107106CCCGGGCCGAAAConserved hypothetical protein. 
Os03g0656900AK066416TTTCGGCCCATGANusB/RsmB/TIM44 domain containing protein. 
J065157L23TTTCGGCCCATGANONE 
J065166P22TTTCGGCCCATGANONE 
Os03g0701900AK068404TTTCGGCCCGConserved hypothetical protein. 
Os03g0727800014-002-D07GGCCGAAANONE 
AK109453GGCCGAAACyclin-like F-box domain containing protein. 
Os03g0746000AK073682TTTCGGCCCAGGConserved hypothetical protein. 
AK111472TTTCGGCCCAGGNONE 
J090083F05TTTCGGCCCAGGNONE 
Os03g0748500AK110695TTTCGGCCCAAGNONE 
AK110695TTTCGGCCCAAGNONE 
Os03g0778100003-129-G04GGCCGAAANONE 
006-083-H10GGCCGAAANONE 
009-010-G08GGCCGAAANONE 
009-051-E05GGCCGAAANONE 
AF093634GGCCGAAANONE 
AK059890GGCCGAAANONE 
AK060493GGCCGAAANONE 
AK069791GGCCGAAASimilar to Photosystem-1 F subunit. 
J023031N02GGCCGAAANONE 
J075170I20GGCCGAAANONE 
Os03g0797600006-034-B06GGCCGAAANONE 
009-066-A01GGCCGAAANONE 
014-035-H08GGCCGAAANONE 
AK067446GGCCGAAASimilar to Helix-loop-helix protein homolog. 
AK068388GGCCGAAANONE 
AK104412GGCCGAAANONE 
Os03g0799000013-010-A07GGCCGTTTCGGCCNONE 
013-081-H02GGCCGTTTCGGCCNONE 
AK067840GGCCGTTTCGGCCSimilar to Histone H1. 
AK099211GGCCGTTTCGGCCNONE 
J065066F23GGCCGTTTCGGCCNONE 
J065138O20GGCCGTTTCGGCCNONE 
J065163G22GGCCGTTTCGGCCNONE 
J065211J01GGCCGTTTCGGCCNONE 
J080027D02GGCCGTTTCGGCCNONE 
J080029E20GGCCGTTTCGGCCNONE 
J080045D03GGCCGTTTCGGCCNONE 
J080060G13GGCCGTTTCGGCCNONE 
J080067E14GGCCGTTTCGGCCNONE 
J080067J04GGCCGTTTCGGCCNONE 
J080067J21GGCCGTTTCGGCCNONE 
J080068L09GGCCGTTTCGGCCNONE 
J080077E15GGCCGTTTCGGCCNONE 
J080078B03GGCCGTTTCGGCCNONE 
J080086H09GGCCGTTTCGGCCNONE 
J090095G02GGCCGTTTCGGCCNONE 
J100058H04GGCCGTTTCGGCCNONE 
Os03g0852400006-021-C11AGATGGGCCGAAANONE 
006-048-D09AGATGGGCCGAAANONE 
006-059-C05AGATGGGCCGAAANONE 
006-078-E01AGATGGGCCGAAANONE 
006-082-H09AGATGGGCCGAAANONE 
AK060985AGATGGGCCGAAANONE 
AK109338AGATGGGCCGAAAConserved hypothetical protein. 
Os04g0418000006-025-C05CGGGCCGAAANONE 
006-025-D11CGGGCCGAAANONE 
006-045-F02CGGGCCGAAANONE 
006-060-B04CGGGCCGAAANONE 
006-063-E03CGGGCCGAAANONE 
006-070-G08CGGGCCGAAANONE 
006-072-H05CGGGCCGAAANONE 
AK061030CGGGCCGAAANONE 
AK099124CGGGCCGAAANONE 
AK106155CGGGCCGAAAConserved hypothetical protein. 
AK119714CGGGCCGAAANONE 
J023039I07CGGGCCGAAANONE 
J065025N03CGGGCCGAAANONE 
Os04g0458800AK107933TTTCGGCCHypothetical protein. 
J075084C02TTTCGGCCNONE 
J075150E08TTTCGGCCNONE 
Os04g0476400J033082D17TTTCGGCCCGNONE 
Os04g0477900006-046-B01ATTGGGCCGAAANONE 
006-103-C03ATTGGGCCGAAANONE 
006-106-F09ATTGGGCCGAAANONE 
009-093-B07ATTGGGCCGAAANONE 
AK059948ATTGGGCCGAAASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTGGGCCGAAANONE 
J013158A11ATTGGGCCGAAANONE 
J023050E17ATTGGGCCGAAANONE 
J023078J03ATTGGGCCGAAANONE 
J033027G18ATTGGGCCGAAANONE 
J033086G10ATTGGGCCGAAANONE 
J090060G14ATTGGGCCGAAANONE 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0528100009-090-G06TTTCGGCCCAGCCNONE 
009-168-C11TTTCGGCCCAGCCNONE 
AK065957TTTCGGCCCAGCCConserved hypothetical protein. 
J013039G20TTTCGGCCCAGCCNONE 
J013044D08TTTCGGCCCAGCCNONE 
J065013L14TTTCGGCCCAGCCNONE 
J065143H08TTTCGGCCCAGCCNONE 
J065146C14TTTCGGCCCAGCCNONE 
J065149K22TTTCGGCCCAGCCNONE 
J065156B18TTTCGGCCCAGCCNONE 
J065201A04TTTCGGCCCAGCCNONE 
J065209A04TTTCGGCCCAGCCNONE 
Os04g0636000015-046-E08GGCCGAAANONE 
AK065639GGCCGAAASPla/RYanodine receptor SPRY domain containing protein. 
AK099615GGCCGAAANONE 
Os04g0640800AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os04g0685800AK070891GGCCGAAACGCGTGGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GGCCGAAACGCGTGGNONE 
J023069G19GGCCGAAACGCGTGGNONE 
J023097E09GGCCGAAACGCGTGGNONE 
J065071A01GGCCGAAACGCGTGGNONE 
J065186F08GGCCGAAACGCGTGGNONE 
J075044B21GGCCGAAACGCGTGGNONE 
J075120N18GGCCGAAACGCGTGGNONE 
J075131B22GGCCGAAACGCGTGGNONE 
J100041H18GGCCGAAACGCGTGGNONE 
J100042P13GGCCGAAACGCGTGGNONE 
Os05g0121500006-117-B10TTTCGGCCCACTNONE 
009-059-D04TTTCGGCCCACTNONE 
J065066C12TTTCGGCCCACTConserved hypothetical protein. 
J075013I12TTTCGGCCCACTNONE 
J090046D18TTTCGGCCCACTNONE 
Os05g0169400AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0194600AK102487TTTCGGCCCGPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTCGGCCCGNONE 
J100041A08TTTCGGCCCGNONE 
Os05g0328000AK107977TTTCGGCCCGGAConserved hypothetical protein. 
J065005I02TTTCGGCCCGGANONE 
J065049M05TTTCGGCCCGGANONE 
J080005F01TTTCGGCCCGGANONE 
J080005H15TTTCGGCCCGGANONE 
J080005K23TTTCGGCCCGGANONE 
J080007O03TTTCGGCCCGGANONE 
J080013H09TTTCGGCCCGGANONE 
J080024C02TTTCGGCCCGGANONE 
J080026M22TTTCGGCCCGGANONE 
J080029K21TTTCGGCCCGGANONE 
J080032K04TTTCGGCCCGGANONE 
J080034M16TTTCGGCCCGGANONE 
J080037G11TTTCGGCCCGGANONE 
J080040L01TTTCGGCCCGGANONE 
J080041D13TTTCGGCCCGGANONE 
J080043G20TTTCGGCCCGGANONE 
J080046H17TTTCGGCCCGGANONE 
J080048A05TTTCGGCCCGGANONE 
J080064C21TTTCGGCCCGGANONE 
J080067E15TTTCGGCCCGGANONE 
J080071P05TTTCGGCCCGGANONE 
J080074H16TTTCGGCCCGGANONE 
J080076A18TTTCGGCCCGGANONE 
J080076D20TTTCGGCCCGGANONE 
J080077J15TTTCGGCCCGGANONE 
J080085J11TTTCGGCCCGGANONE 
J080086E08TTTCGGCCCGGANONE 
J080088I23TTTCGGCCCGGANONE 
J080088I24TTTCGGCCCGGANONE 
J080089D05TTTCGGCCCGGANONE 
J080093B04TTTCGGCCCGGANONE 
J080093D07TTTCGGCCCGGANONE 
J080094A09TTTCGGCCCGGANONE 
J080096I12TTTCGGCCCGGANONE 
J080097L23TTTCGGCCCGGANONE 
Os05g0379300AK109293TTTCGGCCCATCAConserved hypothetical protein. 
Os05g0423500015-048-C11TTTCGGCCNONE 
AK066000TTTCGGCCProtein kinase-like domain containing protein. 
J013049L02TTTCGGCCNONE 
Os05g0424700AK107848GGGCCGAAASimilar to Copper transporter 1. 
Os05g0446500AK069373TTTCGGCCConserved hypothetical protein. 
AK099953TTTCGGCCNONE 
Os05g0481800AK100952TTTCGGCCProtein prenyltransferase domain containing protein. 
AK110987TTTCGGCCNONE 
Os05g0503000AK068335TCATGGGCCGAAASimilar to Secretory carrier membrane protein. 
AK104049TCATGGGCCGAAANONE 
J013149D04TCATGGGCCGAAANONE 
J075085A06TCATGGGCCGAAANONE 
Os05g0534400AK101368TTTCGGCCSimilar to Calcineurin B-like protein 4 (SALT OVERLY SENSITIVE 3 protein). 
J033035L13TTTCGGCCNONE 
J065045H07TTTCGGCCNONE 
Os05g0535700009-067-F01GGCCGAAANONE 
AK061590GGCCGAAANONE 
AK062545GGCCGAAAConserved hypothetical protein. 
Os05g0540100AB021666AATTGGGCCGAAANONE 
AK060623AATTGGGCCGAAANONE 
AK103819AATTGGGCCGAAAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0548100AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0558900AK101679TTTCGGCCCATTSimilar to Frsb-prov protein. 
J013028M08TTTCGGCCCATTNONE 
J013074E16TTTCGGCCCATTNONE 
J013096L01TTTCGGCCCATTNONE 
J023085M19TTTCGGCCCATTNONE 
J033058I10TTTCGGCCCATTNONE 
J033091D18TTTCGGCCCATTNONE 
J033111H13TTTCGGCCCATTNONE 
J033114C18TTTCGGCCCATTNONE 
Os05g0571600Os05g0571600TTTCGGCCCAACCConserved hypothetical protein. 
Os05g0574500006-021-A08ATCCGACGGCCGAAANONE 
006-021-A08GGCCGAAANONE 
006-049-A11ATCCGACGGCCGAAANONE 
006-049-A11GGCCGAAANONE 
006-086-F03ATCCGACGGCCGAAANONE 
006-086-F03GGCCGAAANONE 
009-051-F06ATCCGACGGCCGAAANONE 
009-051-F06GGCCGAAANONE 
AB015287ATCCGACGGCCGAAANONE 
AB015287GGCCGAAANONE 
AB015972ATCCGACGGCCGAAANONE 
AB015972GGCCGAAANONE 
AK061714ATCCGACGGCCGAAANONE 
AK061714GGCCGAAANONE 
AK098889ATCCGACGGCCGAAANONE 
AK098889GGCCGAAANONE 
AK121699ATCCGACGGCCGAAASimilar to GTP-binding nuclear protein Ran1B (Fragment). 
AK121699GGCCGAAASimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCCGACGGCCGAAANONE 
J013001L15GGCCGAAANONE 
J013072D17ATCCGACGGCCGAAANONE 
J013072D17GGCCGAAANONE 
J023028M04ATCCGACGGCCGAAANONE 
J023028M04GGCCGAAANONE 
J023031F01ATCCGACGGCCGAAANONE 
J023031F01GGCCGAAANONE 
J023114L22ATCCGACGGCCGAAANONE 
J023114L22GGCCGAAANONE 
J033058L12ATCCGACGGCCGAAANONE 
J033058L12GGCCGAAANONE 
J033073D17ATCCGACGGCCGAAANONE 
J033073D17GGCCGAAANONE 
J043031D08ATCCGACGGCCGAAANONE 
J043031D08GGCCGAAANONE 
J043036G01ATCCGACGGCCGAAANONE 
J043036G01GGCCGAAANONE 
J065144O04ATCCGACGGCCGAAANONE 
J065144O04GGCCGAAANONE 
J065181O08ATCCGACGGCCGAAANONE 
J065181O08GGCCGAAANONE 
J080066B20ATCCGACGGCCGAAANONE 
J080066B20GGCCGAAANONE 
Os06g0113600016-067-E03TGTGGGCCGAAANONE 
AK062095TGTGGGCCGAAANONE 
AK101235TGTGGGCCGAAACyclin-like F-box domain containing protein. 
AK122025TGTGGGCCGAAANONE 
J013022O19TGTGGGCCGAAANONE 
J023045P05TGTGGGCCGAAANONE 
J033031K01TGTGGGCCGAAANONE 
J033034I09TGTGGGCCGAAANONE 
J033041O04TGTGGGCCGAAANONE 
J033071K03TGTGGGCCGAAANONE 
J033075K16TGTGGGCCGAAANONE 
J033097M01TGTGGGCCGAAANONE 
J033099M22TGTGGGCCGAAANONE 
J033108N15TGTGGGCCGAAANONE 
J033121D18TGTGGGCCGAAANONE 
J033125O06TGTGGGCCGAAANONE 
J033139M16TGTGGGCCGAAANONE 
J033145P18TGTGGGCCGAAANONE 
J033149D05TGTGGGCCGAAANONE 
Os06g0136000AK060303GGCCGAAASimilar to Hypersensitive-induced reaction protein 4. 
AK102678GGCCGAAANONE 
J075185K19GGCCGAAANONE 
J090028C16GGCCGAAANONE 
J090099N12GGCCGAAANONE 
J100070O10GGCCGAAANONE 
Os06g0136700AK065081TTTCGGCCCAATSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08TTTCGGCCCAATNONE 
J013039I03TTTCGGCCCAATNONE 
Os06g0192500AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0192600AB033535GGCCGAAANONE 
AK061876GGCCGAAA26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7). 
AK070538GGCCGAAANONE 
AK100060GGCCGAAANONE 
AK103801GGCCGAAANONE 
Os06g0213400012-003-C10GGCCGAAANONE 
AK071478GGCCGAAAProtein of unknown function DUF829, eukaryotic family protein. 
J023092B08GGCCGAAANONE 
Os06g0233200AK108060GGCCGAAASimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os06g0246500AK105105TTTCGGCCCATASimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0325500011-037-D06TTTCGGCCNONE 
011-093-G07TTTCGGCCNONE 
AK063974TTTCGGCCProtein of unknown function DUF89 family protein. 
AK099286TTTCGGCCNONE 
J065124G18TTTCGGCCNONE 
J065160K08TTTCGGCCNONE 
J065207O08TTTCGGCCNONE 
J075011D18TTTCGGCCNONE 
J075012D02TTTCGGCCNONE 
J075090F13TTTCGGCCNONE 
J075164A04TTTCGGCCNONE 
J075198I19TTTCGGCCNONE 
Os06g0547900AK100950TTTCGGCCCATCTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665TTTCGGCCCATCTNONE 
J023139I22TTTCGGCCCATCTNONE 
J090066J10TTTCGGCCCATCTNONE 
Y13437TTTCGGCCCATCTNONE 
Os06g0560400AK103575TTTCGGCCNONE 
AK108074TTTCGGCCProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0634600011-029-F10TTTCGGCCCAAATNONE 
011-057-B11TTTCGGCCCAAATNONE 
AK122074TTTCGGCCCAAATProtein of unknown function FAF1 domain containing protein. 
J033118C24TTTCGGCCCAAATNONE 
J033132A01TTTCGGCCCAAATNONE 
J065059I05TTTCGGCCCAAATNONE 
J100069I04TTTCGGCCCAAATNONE 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os06g0726800AK070518TTTCGGCCG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12TTTCGGCCNONE 
J053032B13TTTCGGCCNONE 
X82036TTTCGGCCNONE 
Os07g0121500J100066O17TTTCGGCCNONE 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0435400AK111603TTTCGGCCCATCTSimilar to WD40. 
Os07g0498300009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0504601J065068H15GGGCTTTTTTTCGGCCCGCAConserved hypothetical protein. 
J065095H08GGGCTTTTTTTCGGCCCGCANONE 
Os07g0516200AK061373GGCCGAAASimilar to Endoribonuclease, L-PSP family. 
Os07g0559100Os07g0559100GGCCGAAAConserved hypothetical protein. 
Os07g0562700003-111-G08GCTGGGCCGAAANONE 
004-013-E07GCTGGGCCGAAANONE 
006-021-D03GCTGGGCCGAAANONE 
006-021-D07GCTGGGCCGAAANONE 
006-021-F09GCTGGGCCGAAANONE 
006-023-D01GCTGGGCCGAAANONE 
006-024-F04GCTGGGCCGAAANONE 
006-024-G09GCTGGGCCGAAANONE 
006-024-G11GCTGGGCCGAAANONE 
006-025-A10GCTGGGCCGAAANONE 
006-025-B08GCTGGGCCGAAANONE 
006-025-E10GCTGGGCCGAAANONE 
006-025-F10GCTGGGCCGAAANONE 
006-026-B04GCTGGGCCGAAANONE 
006-026-C08GCTGGGCCGAAANONE 
006-026-D03GCTGGGCCGAAANONE 
006-026-F03GCTGGGCCGAAANONE 
006-026-F08GCTGGGCCGAAANONE 
006-026-F12GCTGGGCCGAAANONE 
006-027-A10GCTGGGCCGAAANONE 
006-027-C03GCTGGGCCGAAANONE 
006-028-C03GCTGGGCCGAAANONE 
006-029-E02GCTGGGCCGAAANONE 
006-029-G05GCTGGGCCGAAANONE 
006-030-A10GCTGGGCCGAAANONE 
006-030-C06GCTGGGCCGAAANONE 
006-030-D03GCTGGGCCGAAANONE 
006-030-D06GCTGGGCCGAAANONE 
006-030-G05GCTGGGCCGAAANONE 
006-031-B10GCTGGGCCGAAANONE 
006-031-D04GCTGGGCCGAAANONE 
006-031-D11GCTGGGCCGAAANONE 
006-031-H09GCTGGGCCGAAANONE 
006-032-C09GCTGGGCCGAAANONE 
006-032-H09GCTGGGCCGAAANONE 
006-033-B02GCTGGGCCGAAANONE 
006-033-B09GCTGGGCCGAAANONE 
006-033-E01GCTGGGCCGAAANONE 
006-033-F06GCTGGGCCGAAANONE 
006-033-G03GCTGGGCCGAAANONE 
006-034-A08GCTGGGCCGAAANONE 
006-034-C09GCTGGGCCGAAANONE 
006-034-F06GCTGGGCCGAAANONE 
006-035-B12GCTGGGCCGAAANONE 
006-035-C12GCTGGGCCGAAANONE 
006-035-H04GCTGGGCCGAAANONE 
006-035-H12GCTGGGCCGAAANONE 
006-036-A05GCTGGGCCGAAANONE 
006-036-A09GCTGGGCCGAAANONE 
006-036-B10GCTGGGCCGAAANONE 
006-036-C03GCTGGGCCGAAANONE 
006-036-E06GCTGGGCCGAAANONE 
006-037-H11GCTGGGCCGAAANONE 
006-038-G01GCTGGGCCGAAANONE 
006-039-B01GCTGGGCCGAAANONE 
006-039-B12GCTGGGCCGAAANONE 
006-039-C02GCTGGGCCGAAANONE 
006-039-E06GCTGGGCCGAAANONE 
006-039-G12GCTGGGCCGAAANONE 
006-040-G07GCTGGGCCGAAANONE 
006-041-H04GCTGGGCCGAAANONE 
006-042-A11GCTGGGCCGAAANONE 
006-042-E07GCTGGGCCGAAANONE 
006-042-F12GCTGGGCCGAAANONE 
006-043-C01GCTGGGCCGAAANONE 
006-045-H12GCTGGGCCGAAANONE 
006-046-A12GCTGGGCCGAAANONE 
006-046-F03GCTGGGCCGAAANONE 
006-047-A07GCTGGGCCGAAANONE 
006-047-A09GCTGGGCCGAAANONE 
006-047-E10GCTGGGCCGAAANONE 
006-047-G12GCTGGGCCGAAANONE 
006-048-B04GCTGGGCCGAAANONE 
006-049-D01GCTGGGCCGAAANONE 
006-049-G02GCTGGGCCGAAANONE 
006-049-G10GCTGGGCCGAAANONE 
006-049-H04GCTGGGCCGAAANONE 
006-050-D05GCTGGGCCGAAANONE 
006-050-F05GCTGGGCCGAAANONE 
006-051-B05GCTGGGCCGAAANONE 
006-051-G12GCTGGGCCGAAANONE 
006-052-D12GCTGGGCCGAAANONE 
006-053-D06GCTGGGCCGAAANONE 
006-054-H02GCTGGGCCGAAANONE 
006-055-A03GCTGGGCCGAAANONE 
006-055-C01GCTGGGCCGAAANONE 
006-055-E07GCTGGGCCGAAANONE 
006-055-H06GCTGGGCCGAAANONE 
006-056-F06GCTGGGCCGAAANONE 
006-057-D03GCTGGGCCGAAANONE 
006-057-D05GCTGGGCCGAAANONE 
006-057-G01GCTGGGCCGAAANONE 
006-058-A03GCTGGGCCGAAANONE 
006-058-B06GCTGGGCCGAAANONE 
006-059-A09GCTGGGCCGAAANONE 
006-059-H11GCTGGGCCGAAANONE 
006-060-A04GCTGGGCCGAAANONE 
006-060-A09GCTGGGCCGAAANONE 
006-060-C11GCTGGGCCGAAANONE 
006-060-D08GCTGGGCCGAAANONE 
006-061-A04GCTGGGCCGAAANONE 
006-061-E01GCTGGGCCGAAANONE 
006-061-G10GCTGGGCCGAAANONE 
006-061-H12GCTGGGCCGAAANONE 
006-062-B07GCTGGGCCGAAANONE 
006-062-G03GCTGGGCCGAAANONE 
006-062-H12GCTGGGCCGAAANONE 
006-063-D05GCTGGGCCGAAANONE 
006-063-E04GCTGGGCCGAAANONE 
006-063-F05GCTGGGCCGAAANONE 
006-063-G05GCTGGGCCGAAANONE 
006-064-B07GCTGGGCCGAAANONE 
006-065-C11GCTGGGCCGAAANONE 
006-065-H02GCTGGGCCGAAANONE 
006-067-C12GCTGGGCCGAAANONE 
006-067-F10GCTGGGCCGAAANONE 
006-068-E02GCTGGGCCGAAANONE 
006-068-G04GCTGGGCCGAAANONE 
006-069-A02GCTGGGCCGAAANONE 
006-071-A07GCTGGGCCGAAANONE 
006-072-F11GCTGGGCCGAAANONE 
006-072-F12GCTGGGCCGAAANONE 
006-073-E12GCTGGGCCGAAANONE 
006-073-F08GCTGGGCCGAAANONE 
006-073-H07GCTGGGCCGAAANONE 
006-074-A07GCTGGGCCGAAANONE 
006-075-A12GCTGGGCCGAAANONE 
006-075-B01GCTGGGCCGAAANONE 
006-075-H10GCTGGGCCGAAANONE 
006-075-H12GCTGGGCCGAAANONE 
006-076-B06GCTGGGCCGAAANONE 
006-077-A09GCTGGGCCGAAANONE 
006-077-D05GCTGGGCCGAAANONE 
006-078-C11GCTGGGCCGAAANONE 
006-078-D12GCTGGGCCGAAANONE 
006-078-E02GCTGGGCCGAAANONE 
006-079-A01GCTGGGCCGAAANONE 
006-079-E02GCTGGGCCGAAANONE 
006-079-F03GCTGGGCCGAAANONE 
006-080-G11GCTGGGCCGAAANONE 
006-081-C02GCTGGGCCGAAANONE 
006-081-C08GCTGGGCCGAAANONE 
006-082-B06GCTGGGCCGAAANONE 
006-082-C11GCTGGGCCGAAANONE 
006-082-H04GCTGGGCCGAAANONE 
006-083-E04GCTGGGCCGAAANONE 
006-083-H12GCTGGGCCGAAANONE 
006-084-C08GCTGGGCCGAAANONE 
006-084-E07GCTGGGCCGAAANONE 
006-084-E10GCTGGGCCGAAANONE 
006-085-E06GCTGGGCCGAAANONE 
006-085-E10GCTGGGCCGAAANONE 
006-086-F06GCTGGGCCGAAANONE 
006-087-D08GCTGGGCCGAAANONE 
006-087-F03GCTGGGCCGAAANONE 
006-087-F10GCTGGGCCGAAANONE 
006-087-G07GCTGGGCCGAAANONE 
006-088-A02GCTGGGCCGAAANONE 
006-089-A04GCTGGGCCGAAANONE 
006-089-B12GCTGGGCCGAAANONE 
006-089-D06GCTGGGCCGAAANONE 
006-089-D10GCTGGGCCGAAANONE 
006-089-H05GCTGGGCCGAAANONE 
006-090-C06GCTGGGCCGAAANONE 
006-091-A03GCTGGGCCGAAANONE 
006-091-E04GCTGGGCCGAAANONE 
006-091-H12GCTGGGCCGAAANONE 
006-092-A08GCTGGGCCGAAANONE 
006-092-F01GCTGGGCCGAAANONE 
006-092-G08GCTGGGCCGAAANONE 
006-093-B12GCTGGGCCGAAANONE 
006-093-D04GCTGGGCCGAAANONE 
006-093-F01GCTGGGCCGAAANONE 
006-094-A08GCTGGGCCGAAANONE 
006-094-F01GCTGGGCCGAAANONE 
006-094-F03GCTGGGCCGAAANONE 
006-095-C12GCTGGGCCGAAANONE 
006-095-E10GCTGGGCCGAAANONE 
006-095-E12GCTGGGCCGAAANONE 
006-095-G06GCTGGGCCGAAANONE 
006-096-B12GCTGGGCCGAAANONE 
006-096-C12GCTGGGCCGAAANONE 
006-096-G02GCTGGGCCGAAANONE 
006-097-D01GCTGGGCCGAAANONE 
006-097-D07GCTGGGCCGAAANONE 
006-097-F04GCTGGGCCGAAANONE 
006-098-C07GCTGGGCCGAAANONE 
006-098-D04GCTGGGCCGAAANONE 
006-099-E06GCTGGGCCGAAANONE 
006-099-F02GCTGGGCCGAAANONE 
006-099-F10GCTGGGCCGAAANONE 
006-100-A07GCTGGGCCGAAANONE 
006-100-B10GCTGGGCCGAAANONE 
006-100-G01GCTGGGCCGAAANONE 
006-100-H06GCTGGGCCGAAANONE 
006-101-D01GCTGGGCCGAAANONE 
006-101-F03GCTGGGCCGAAANONE 
006-102-A12GCTGGGCCGAAANONE 
006-102-B11GCTGGGCCGAAANONE 
006-102-C03GCTGGGCCGAAANONE 
006-102-F11GCTGGGCCGAAANONE 
006-103-A08GCTGGGCCGAAANONE 
006-103-B06GCTGGGCCGAAANONE 
006-103-D01GCTGGGCCGAAANONE 
006-103-F02GCTGGGCCGAAANONE 
006-104-B02GCTGGGCCGAAANONE 
006-104-C01GCTGGGCCGAAANONE 
006-104-F09GCTGGGCCGAAANONE 
006-104-H11GCTGGGCCGAAANONE 
006-105-A03GCTGGGCCGAAANONE 
006-105-D09GCTGGGCCGAAANONE 
006-106-B10GCTGGGCCGAAANONE 
006-107-A06GCTGGGCCGAAANONE 
006-107-C04GCTGGGCCGAAANONE 
006-107-E03GCTGGGCCGAAANONE 
006-107-F05GCTGGGCCGAAANONE 
006-108-C09GCTGGGCCGAAANONE 
006-109-C09GCTGGGCCGAAANONE 
006-109-D10GCTGGGCCGAAANONE 
006-109-E06GCTGGGCCGAAANONE 
006-109-E10GCTGGGCCGAAANONE 
006-110-A06GCTGGGCCGAAANONE 
006-110-C11GCTGGGCCGAAANONE 
006-111-A02GCTGGGCCGAAANONE 
006-111-F02GCTGGGCCGAAANONE 
006-112-A08GCTGGGCCGAAANONE 
006-112-H06GCTGGGCCGAAANONE 
006-113-A08GCTGGGCCGAAANONE 
006-113-B01GCTGGGCCGAAANONE 
006-113-C05GCTGGGCCGAAANONE 
006-113-D01GCTGGGCCGAAANONE 
006-113-D04GCTGGGCCGAAANONE 
006-113-D06GCTGGGCCGAAANONE 
006-113-E09GCTGGGCCGAAANONE 
006-114-F06GCTGGGCCGAAANONE 
006-116-B02GCTGGGCCGAAANONE 
006-117-B07GCTGGGCCGAAANONE 
006-117-G04GCTGGGCCGAAANONE 
006-118-D01GCTGGGCCGAAANONE 
006-118-D12GCTGGGCCGAAANONE 
006-118-F12GCTGGGCCGAAANONE 
006-118-G12GCTGGGCCGAAANONE 
006-119-B08GCTGGGCCGAAANONE 
006-120-E09GCTGGGCCGAAANONE 
006-120-G05GCTGGGCCGAAANONE 
006-120-G10GCTGGGCCGAAANONE 
009-022-D12GCTGGGCCGAAANONE 
009-051-H08GCTGGGCCGAAANONE 
009-065-F05GCTGGGCCGAAANONE 
009-070-A06GCTGGGCCGAAANONE 
009-073-B07GCTGGGCCGAAANONE 
009-092-C10GCTGGGCCGAAANONE 
009-093-D03GCTGGGCCGAAANONE 
009-103-B04GCTGGGCCGAAANONE 
009-106-H08GCTGGGCCGAAANONE 
009-120-B05GCTGGGCCGAAANONE 
009-121-F05GCTGGGCCGAAANONE 
009-122-B04GCTGGGCCGAAANONE 
009-122-D08GCTGGGCCGAAANONE 
009-123-F07GCTGGGCCGAAANONE 
009-125-G02GCTGGGCCGAAANONE 
009-128-F02GCTGGGCCGAAANONE 
009-128-H07GCTGGGCCGAAANONE 
009-131-C06GCTGGGCCGAAANONE 
009-132-F08GCTGGGCCGAAANONE 
009-133-G08GCTGGGCCGAAANONE 
009-134-D09GCTGGGCCGAAANONE 
009-135-F01GCTGGGCCGAAANONE 
009-149-E11GCTGGGCCGAAANONE 
009-153-H04GCTGGGCCGAAANONE 
009-161-E04GCTGGGCCGAAANONE 
009-163-A09GCTGGGCCGAAANONE 
009-163-C05GCTGGGCCGAAANONE 
009-163-E10GCTGGGCCGAAANONE 
009-165-F04GCTGGGCCGAAANONE 
009-166-A07GCTGGGCCGAAANONE 
009-169-G12GCTGGGCCGAAANONE 
009-172-G08GCTGGGCCGAAANONE 
009-179-E06GCTGGGCCGAAANONE 
009-181-F09GCTGGGCCGAAANONE 
009-190-G07GCTGGGCCGAAANONE 
009-191-D01GCTGGGCCGAAANONE 
009-195-G02GCTGGGCCGAAANONE 
AF022738GCTGGGCCGAAANONE 
AK061512GCTGGGCCGAAANONE 
AK068972GCTGGGCCGAAANONE 
AK103926GCTGGGCCGAAANONE 
AK103999GCTGGGCCGAAANONE 
AK104224GCTGGGCCGAAANONE 
AK104465GCTGGGCCGAAANONE 
AK104495GCTGGGCCGAAANONE 
AK109399GCTGGGCCGAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCTGGGCCGAAANONE 
AK119545GCTGGGCCGAAANONE 
J013043L10GCTGGGCCGAAANONE 
J013050A09GCTGGGCCGAAANONE 
J023001G03GCTGGGCCGAAANONE 
J023024D14GCTGGGCCGAAANONE 
J023072E11GCTGGGCCGAAANONE 
J023149E18GCTGGGCCGAAANONE 
J033029B16GCTGGGCCGAAANONE 
J065001O21GCTGGGCCGAAANONE 
J065035B04GCTGGGCCGAAANONE 
J065044D18GCTGGGCCGAAANONE 
J065057F12GCTGGGCCGAAANONE 
J065060A11GCTGGGCCGAAANONE 
J065062G15GCTGGGCCGAAANONE 
J065080F13GCTGGGCCGAAANONE 
J065084N12GCTGGGCCGAAANONE 
J065101D02GCTGGGCCGAAANONE 
J065107C07GCTGGGCCGAAANONE 
J065112N24GCTGGGCCGAAANONE 
J065141I16GCTGGGCCGAAANONE 
J065147D05GCTGGGCCGAAANONE 
J065167H02GCTGGGCCGAAANONE 
J065207K23GCTGGGCCGAAANONE 
J075008E16GCTGGGCCGAAANONE 
J075014F03GCTGGGCCGAAANONE 
J075015O17GCTGGGCCGAAANONE 
J075020H20GCTGGGCCGAAANONE 
J075021E22GCTGGGCCGAAANONE 
J075023N13GCTGGGCCGAAANONE 
J075028H10GCTGGGCCGAAANONE 
J075040F20GCTGGGCCGAAANONE 
J075051L23GCTGGGCCGAAANONE 
J075069G16GCTGGGCCGAAANONE 
J075084F24GCTGGGCCGAAANONE 
J075090H09GCTGGGCCGAAANONE 
J075092M21GCTGGGCCGAAANONE 
J075110C10GCTGGGCCGAAANONE 
J075111J12GCTGGGCCGAAANONE 
J075114L04GCTGGGCCGAAANONE 
J075139E02GCTGGGCCGAAANONE 
J075160M10GCTGGGCCGAAANONE 
J075176J03GCTGGGCCGAAANONE 
J075183I17GCTGGGCCGAAANONE 
J075191N10GCTGGGCCGAAANONE 
J075193D07GCTGGGCCGAAANONE 
J075194M16GCTGGGCCGAAANONE 
J075197K04GCTGGGCCGAAANONE 
J080032I11GCTGGGCCGAAANONE 
J080076M11GCTGGGCCGAAANONE 
J080311J08GCTGGGCCGAAANONE 
J080317E05GCTGGGCCGAAANONE 
J090034L08GCTGGGCCGAAANONE 
J100040D19GCTGGGCCGAAANONE 
J100074C11GCTGGGCCGAAANONE 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0675250013-097-G10GGCCGAAANONE 
AK063620GGCCGAAAConserved hypothetical protein. 
J075026H18GGCCGAAANONE 
J075192A02GGCCGAAANONE 
Os07g0681700AK103213TTTCGGCCCAGCGlycosyl transferase, family 8 protein. 
Os07g0687300AK073043TTTCGGCCCAACASimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0270200AK101221TTATGGGCCGAAAExosome-associated family protein. 
J090067H03TTATGGGCCGAAANONE 
Os08g0425800009-168-F06TTTCGGCCNONE 
AK061339TTTCGGCCConserved hypothetical protein. 
AK101198TTTCGGCCNONE 
J033030L06TTTCGGCCNONE 
J100036D08TTTCGGCCNONE 
J100052I22TTTCGGCCNONE 
Os08g0433200013-023-E07TATGGGCCGAAANONE 
AK099471TATGGGCCGAAAConserved hypothetical protein. 
J013024A05TATGGGCCGAAANONE 
J013065N03TATGGGCCGAAANONE 
J023111A21TATGGGCCGAAANONE 
J065035F10TATGGGCCGAAANONE 
J065083H01TATGGGCCGAAANONE 
J065159E03TATGGGCCGAAANONE 
J065186A03TATGGGCCGAAANONE 
J075032B02TATGGGCCGAAANONE 
J075038L14TATGGGCCGAAANONE 
J075047N21TATGGGCCGAAANONE 
J075076H05TATGGGCCGAAANONE 
J075110C08TATGGGCCGAAANONE 
J090096K17TATGGGCCGAAANONE 
Os08g0521800006-099-A01TTTCGGCCNONE 
009-031-C06TTTCGGCCNONE 
AK067267TTTCGGCCConserved hypothetical protein. 
AK104809TTTCGGCCNONE 
J013098C23TTTCGGCCNONE 
J065043L13TTTCGGCCNONE 
Os08g0547500AK065731TTTCGGCCNONE 
AK102208TTTCGGCCSimilar to Kinesin-like protein NACK1. 
J013060E07TTTCGGCCNONE 
J013129D12TTTCGGCCNONE 
Os08g0567200AK067161GGCCGAAANONE 
J013094H15GGCCGAAANONE 
J065209H08GGCCGAAANONE 
Os09g0261300AK059648TTTCGGCCCGCASimilar to 4-nitrophenylphosphatase-like protein. 
AK121797TTTCGGCCCGCANONE 
J033095P18TTTCGGCCCGCANONE 
J043039L01TTTCGGCCCGCANONE 
J065153N19TTTCGGCCCGCANONE 
Os09g0324200AK109621TTTCGGCCTTTTGGGCTGACyclin-like F-box domain containing protein. 
Os09g0325300011-005-H08TTTCGGCCCAATTNONE 
AK068435TTTCGGCCCAATTConserved hypothetical protein. 
AK073998TTTCGGCCCAATTNONE 
J033071H21TTTCGGCCCAATTNONE 
J065214H05TTTCGGCCCAATTNONE 
Os09g0409000AK107676TTTCGGCCCConserved hypothetical protein. 
Os09g0423300AK066315TTTCGGCCNONE 
AK099808TTTCGGCCProtein prenyltransferase domain containing protein. 
J013061B19TTTCGGCCNONE 
J013067H08TTTCGGCCNONE 
J013098J22TTTCGGCCNONE 
J033122M04TTTCGGCCNONE 
J090082H17TTTCGGCCNONE 
J090098C18TTTCGGCCNONE 
Os09g0531900AK073015CCTCGCCCACAAATGGGCCGAAASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0537100AK072188TTTCGGCCHypothetical protein. 
Os09g0537600006-054-B05TTTCGGCCNONE 
AK061004TTTCGGCCSimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20TTTCGGCCNONE 
J075029H16TTTCGGCCNONE 
Os09g0549700J053039F06TAATGGGCTTTCGGCCCATGTNONE 
J065089F23TAATGGGCTTTCGGCCCATGTRibosomal protein L18P/L5E family protein. 
J065090G14TAATGGGCTTTCGGCCCATGTNONE 
J065093M17TAATGGGCTTTCGGCCCATGTNONE 
J065096L23TAATGGGCTTTCGGCCCATGTNONE 
J065152A18TAATGGGCTTTCGGCCCATGTNONE 
J065155H12TAATGGGCTTTCGGCCCATGTNONE 
Os11g0135000012-064-H01GGCCGAAANONE 
AK066565GGCCGAAANONE 
J013072J11GGCCGAAANONE 
J023074C16GGCCGAAANONE 
J065014O03GGCCGAAANONE 
J065095M12GGCCGAAANONE 
J065107A11GGCCGAAANONE 
J065160K17GGCCGAAANONE 
J065217C14GGCCGAAANONE 
J075014A07GGCCGAAANONE 
J075048F21GGCCGAAANONE 
J075061F01GGCCGAAANONE 
J075076F03GGCCGAAANONE 
J090079P15GGCCGAAANONE 
Os11g0139500AK121845AAATGGGCCGAAANONE 
Os11g0147000AK067232GGCCGAAASimilar to Long chain acyl-CoA synthetase 6 (EC 6.2.1.3). 
Os11g0148500005-005-G04GGCCGAAANONE 
AK061668GGCCGAAAPyruvate kinase family protein. 
AK099650GGCCGAAANONE 
J013035J10GGCCGAAANONE 
J013059F21GGCCGAAANONE 
J013099E15GGCCGAAANONE 
J013118D18GGCCGAAANONE 
J013124P19GGCCGAAANONE 
J013151I15GGCCGAAANONE 
J023048B15GGCCGAAANONE 
J023061L08GGCCGAAANONE 
J023065D18GGCCGAAANONE 
J023085D10GGCCGAAANONE 
J023105B08GGCCGAAANONE 
J023109A06GGCCGAAANONE 
J023111F01GGCCGAAANONE 
J023113P06GGCCGAAANONE 
J023127I11GGCCGAAANONE 
J023147E17GGCCGAAANONE 
J033027C14GGCCGAAANONE 
J033028A04GGCCGAAANONE 
J033029O22GGCCGAAANONE 
J033030C12GGCCGAAANONE 
J033031C08GGCCGAAANONE 
J033035C23GGCCGAAANONE 
J033035M20GGCCGAAANONE 
J033038A07GGCCGAAANONE 
J033044M24GGCCGAAANONE 
J033058H23GGCCGAAANONE 
J033061K10GGCCGAAANONE 
J033065L04GGCCGAAANONE 
J033068L22GGCCGAAANONE 
J033075L04GGCCGAAANONE 
J033079H06GGCCGAAANONE 
J033091F08GGCCGAAANONE 
J033092P07GGCCGAAANONE 
J033095F02GGCCGAAANONE 
J033095M11GGCCGAAANONE 
J033096H17GGCCGAAANONE 
J033105M05GGCCGAAANONE 
J033106F19GGCCGAAANONE 
J033112P11GGCCGAAANONE 
J033125M09GGCCGAAANONE 
J033128J07GGCCGAAANONE 
J033136F08GGCCGAAANONE 
J043001M03GGCCGAAANONE 
J043020H18GGCCGAAANONE 
J043020N20GGCCGAAANONE 
J053029O10GGCCGAAANONE 
J053037C05GGCCGAAANONE 
J053039P08GGCCGAAANONE 
J053043K16GGCCGAAANONE 
J053053I05GGCCGAAANONE 
J053069P20GGCCGAAANONE 
J053079K22GGCCGAAANONE 
J053089D01GGCCGAAANONE 
J053094B15GGCCGAAANONE 
J053094E04GGCCGAAANONE 
J090014L04GGCCGAAANONE 
J090029H02GGCCGAAANONE 
J090036O22GGCCGAAANONE 
J090048B20GGCCGAAANONE 
J090054C04GGCCGAAANONE 
J090090O18GGCCGAAANONE 
J090091H14GGCCGAAANONE 
J100034D15GGCCGAAANONE 
J100060E03GGCCGAAANONE 
J100083K16GGCCGAAANONE 
Os11g0227000009-006-C08GGCCGAAANONE 
AK059194GGCCGAAAHypothetical protein. 
J013120H11GGCCGAAANONE 
J065085K21GGCCGAAANONE 
J065127A12GGCCGAAANONE 
J065199M03GGCCGAAANONE 
J065219C05GGCCGAAANONE 
J075074O17GGCCGAAANONE 
J100023D20GGCCGAAANONE 
J100025C01GGCCGAAANONE 
J100032C15GGCCGAAANONE 
J100051G07GGCCGAAANONE 
Os11g0270000J100043N02GGCCGAAAConserved hypothetical protein. 
J100049K11GGCCGAAANONE 
J100069O14GGCCGAAANONE 
Os11g0497000AK111924GGGCCGAAASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCGAAANONE 
J065097A08GGGCCGAAANONE 
J065123J10GGGCCGAAANONE 
J075096F04GGGCCGAAANONE 
J080065C15GGGCCGAAANONE 
J090033J04GGGCCGAAANONE 
J090072N23GGGCCGAAANONE 
J100021E08GGGCCGAAANONE 
J100063H21GGGCCGAAANONE 
Os11g0539000AK071015TTTCGGCCCATCAConserved hypothetical protein. 
J023081E02TTTCGGCCCATCANONE 
Os11g0610700012-090-B04GGCCGAAANONE 
AK099760GGCCGAAAWD40-like domain containing protein. 
J065026G23GGCCGAAANONE 
J065062A01GGCCGAAANONE 
J065065J18GGCCGAAANONE 
J100026C05GGCCGAAANONE 
Os11g0616200AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0620300AJ704770CGGGCCGAAANONE 
AK107901CGGGCCGAAASimilar to Nonspecific lipid-transfer protein 2 (LTP 2). 
J075006M12CGGGCCGAAANONE 
J075046J22CGGGCCGAAANONE 
Os12g0120000011-024-E09ACATGGGCCGAAANONE 
AK105399ACATGGGCCGAAAProtein of unknown function DUF936, plant family protein. 
Os12g0150100009-047-B11ACCGGGCCGAAANONE 
AK105075ACCGGGCCGAAASimilar to 60S ribosomal protein L26A. 
J013067G22ACCGGGCCGAAANONE 
J033103F08ACCGGGCCGAAANONE 
J065029P11ACCGGGCCGAAANONE 
J065043B18ACCGGGCCGAAANONE 
J065123E16ACCGGGCCGAAANONE 
J065141O20ACCGGGCCGAAANONE 
J065161O04ACCGGGCCGAAANONE 
J065201M07ACCGGGCCGAAANONE 
J075058I23ACCGGGCCGAAANONE 
J075172J08ACCGGGCCGAAANONE 
J100040L13ACCGGGCCGAAANONE 
Os12g0443700AK069541TTTCGGCCSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881TTTCGGCCNONE 
Os12g0556100J065083C21TTTCGGCCCATCADrought induced 19 family protein. 
J065124M18TTTCGGCCCATCANONE 
J100032P22TTTCGGCCCATCANONE 
J100048N01TTTCGGCCCATCANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.