version

Summary of OsREG635 (All List)

OrganismOryza sativa  
IDOsREG635  
SequenceGGCCGAGA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1212  

Entry Sequences (1212 entries)

LocusGene modelSequenceDescription
Os01g0155600006-048-F03ATCTCGGCCCATANONE 
AK060171ATCTCGGCCCATANONE 
AK071635ATCTCGGCCCATASimilar to Splicing factor RSZ33. 
J023080A03ATCTCGGCCCATANONE 
J023100L15ATCTCGGCCCATANONE 
J033075I17ATCTCGGCCCATANONE 
J033085O09ATCTCGGCCCATANONE 
J033105E15ATCTCGGCCCATANONE 
J033132N10ATCTCGGCCCATANONE 
J033132P12ATCTCGGCCCATANONE 
J033149H12ATCTCGGCCCATANONE 
J043026M03ATCTCGGCCCATANONE 
J080305J10ATCTCGGCCCATANONE 
J080308K03ATCTCGGCCCATANONE 
J090023M04ATCTCGGCCCATANONE 
J090078F24ATCTCGGCCCATANONE 
J100066P05ATCTCGGCCCATANONE 
Os01g0166800AK073783ATCTCGGCCCGGCConserved hypothetical protein. 
AK099378ATCTCGGCCCGGCNONE 
J033026H10ATCTCGGCCCGGCNONE 
J033067O18ATCTCGGCCCGGCNONE 
J033108A17ATCTCGGCCCGGCNONE 
J065015J11ATCTCGGCCCGGCNONE 
J065204P09ATCTCGGCCCGGCNONE 
Os01g0191800AK061360TCTCGGCCCAGTANONE 
Os01g0221300011-021-E12TCTCGGCCCAACANONE 
AK073330TCTCGGCCCAACAConserved hypothetical protein. 
J013130J18TCTCGGCCCAACANONE 
J033024A12TCTCGGCCCAACANONE 
J065063H09TCTCGGCCCAACANONE 
J065093G05TCTCGGCCCAACANONE 
J090007K12TCTCGGCCCAACANONE 
Os01g0241100J065178A13TCTCGGCCHypothetical protein. 
J065179L12TCTCGGCCNONE 
Os01g0306100AK111041TTATGGGCCGAGAPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0309800AK110758GGGCCGAGASimilar to Hydrogenase expression/formation protein hypB. 
J065065I19GGGCCGAGANONE 
J065167H24GGGCCGAGANONE 
J065173I11GGGCCGAGANONE 
J075055J21GGGCCGAGANONE 
Os01g0321800AK064712ATCCAACGGCCGAGAGas vesicle protein GvpC repeat containing protein. 
J075175N03ATCCAACGGCCGAGANONE 
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE 
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE 
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE 
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE 
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE 
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE 
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE 
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE 
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE 
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE 
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE 
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE 
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
Os01g0672700AK121375TCTCGGCCCGDNA polymerase, beta-like region domain containing protein. 
J023127C22TCTCGGCCCGNONE 
J033092B05TCTCGGCCCGNONE 
J033129P21TCTCGGCCCGNONE 
J065079H18TCTCGGCCCGNONE 
Os01g0673600AK122067ATCTCGGCCSimilar to Ubiquitin-conjugating enzyme E2. 
J013036H06ATCTCGGCCNONE 
J013110B18ATCTCGGCCNONE 
J013162K06ATCTCGGCCNONE 
J023121H14ATCTCGGCCNONE 
J033061M10ATCTCGGCCNONE 
J033117D10ATCTCGGCCNONE 
J033145L07ATCTCGGCCNONE 
J043027L23ATCTCGGCCNONE 
J053032D15ATCTCGGCCNONE 
J053046J22ATCTCGGCCNONE 
J065026F01ATCTCGGCCNONE 
J065160C17ATCTCGGCCNONE 
J065207H23ATCTCGGCCNONE 
J075019E11ATCTCGGCCNONE 
J075073M16ATCTCGGCCNONE 
J075101K09ATCTCGGCCNONE 
J075114I09ATCTCGGCCNONE 
J075165J18ATCTCGGCCNONE 
J075195P10ATCTCGGCCNONE 
J100049H06ATCTCGGCCNONE 
J100052A10ATCTCGGCCNONE 
J100066D15ATCTCGGCCNONE 
Os01g0687500AK069185ATCTCGGCCMethionyl-tRNA formyltransferase family protein. 
J023008N17ATCTCGGCCNONE 
J065001C09ATCTCGGCCNONE 
J065038M21ATCTCGGCCNONE 
Os01g0693900AK066034GGCCGAGATNONE 
AK099894GGCCGAGATPeptidyl-tRNA hydrolase family protein. 
J065165G19GGCCGAGATNONE 
J100042C04GGCCGAGATNONE 
Os01g0764600AK060621GTTTGGGCCGAGAFosfomycin resistance kinase FomA family protein. 
J013111L18GTTTGGGCCGAGANONE 
J013134N08GTTTGGGCCGAGANONE 
Os01g0788900AK073287TCTCGGCCNONE 
Os01g0830000012-056-G03CACGCCTCTCGGCCGCCACACGNONE 
015-092-H05CACGCCTCTCGGCCGCCACACGNONE 
AK121100CACGCCTCTCGGCCGCCACACGSimilar to Plastid sufB (Fragment). 
J023069G03CACGCCTCTCGGCCGCCACACGNONE 
J090047G13CACGCCTCTCGGCCGCCACACGNONE 
J090059K22CACGCCTCTCGGCCGCCACACGNONE 
Os01g0830100AK069755CGTGTGGCGGCCGAGAGGCGTGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0842200003-126-E01TCTCGGCCCAGGNONE 
AK102593TCTCGGCCCAGGNONE 
AK119896TCTCGGCCCAGGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTCGGCCCAGGNONE 
J033098G15TCTCGGCCCAGGNONE 
J090041L03TCTCGGCCCAGGNONE 
J090069J20TCTCGGCCCAGGNONE 
Os01g0850400AJ575220GGGCCGAGAGGCCCACGCGNONE 
AK108582GGGCCGAGAGGCCCACGCGSimilar to MYBY1 protein (Fragment). 
Os01g0869800006-029-F03TCTCGGCCNONE 
006-067-H02TCTCGGCCNONE 
006-084-A06TCTCGGCCNONE 
AK058284TCTCGGCCSimilar to Photosystem II subunit PsbS. 
AK071827TCTCGGCCNONE 
AK104275TCTCGGCCNONE 
J013049J07TCTCGGCCNONE 
J033089F12TCTCGGCCNONE 
J090094I11TCTCGGCCNONE 
Os01g0871300AK059062TCTCGGCC1-aminocyclopropane-1-carboxylate synthase family protein. 
AK067545TCTCGGCCNONE 
J013111C16TCTCGGCCNONE 
Os01g0888700AK073376GGCCGAGAProtein of unknown function RIO1 family protein. 
J033030B16GGCCGAGANONE 
J033098D06GGCCGAGANONE 
J033112A12GGCCGAGANONE 
J043003L24GGCCGAGANONE 
Os01g0895500014-018-F04GGCCGAGANONE 
AK063649GGCCGAGARhomboid-like protein family protein. 
J065077H12GGCCGAGANONE 
J065116J18GGCCGAGANONE 
J075194C08GGCCGAGANONE 
Os01g0908400009-140-E01TCTCGGCCCGNONE 
AK062957TCTCGGCCCGConserved hypothetical protein. 
AK099301TCTCGGCCCGNONE 
J065123M13TCTCGGCCCGNONE 
J075020O14TCTCGGCCCGNONE 
J075136L21TCTCGGCCCGNONE 
Os01g0922100AK110737ATCTCGGCCConserved hypothetical protein. 
Os02g0115900AF006825ATCTCGGCCCGTTNONE 
AK065743ATCTCGGCCCGTTEndosperm lumenal binding protein. 
AK119653ATCTCGGCCCGTTNONE 
Os02g0193500009-092-G09TCTCGGCCCATCANONE 
AK101237TCTCGGCCCATCAHypothetical protein. 
J033031K13TCTCGGCCCATCANONE 
J033034P12TCTCGGCCCATCANONE 
J080304L19TCTCGGCCCATCANONE 
J100059N21TCTCGGCCCATCANONE 
Os02g0220600AK061944ATCGGACGGCCGAGATElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946ATCGGACGGCCGAGATNONE 
D89802ATCGGACGGCCGAGATNONE 
J013042L22ATCGGACGGCCGAGATNONE 
J013056A14ATCGGACGGCCGAGATNONE 
J013120G13ATCGGACGGCCGAGATNONE 
J013155K19ATCGGACGGCCGAGATNONE 
J023002B10ATCGGACGGCCGAGATNONE 
J023080J19ATCGGACGGCCGAGATNONE 
J023081C08ATCGGACGGCCGAGATNONE 
J023090H05ATCGGACGGCCGAGATNONE 
J023091M07ATCGGACGGCCGAGATNONE 
J023115F09ATCGGACGGCCGAGATNONE 
J033025I23ATCGGACGGCCGAGATNONE 
J033026G12ATCGGACGGCCGAGATNONE 
J033035E15ATCGGACGGCCGAGATNONE 
J033040N13ATCGGACGGCCGAGATNONE 
J033046C17ATCGGACGGCCGAGATNONE 
J033069F02ATCGGACGGCCGAGATNONE 
J033071B16ATCGGACGGCCGAGATNONE 
J033071N22ATCGGACGGCCGAGATNONE 
J033088J02ATCGGACGGCCGAGATNONE 
J033092N24ATCGGACGGCCGAGATNONE 
J033093I09ATCGGACGGCCGAGATNONE 
J033126G06ATCGGACGGCCGAGATNONE 
J043003G15ATCGGACGGCCGAGATNONE 
J043010M11ATCGGACGGCCGAGATNONE 
J043024O20ATCGGACGGCCGAGATNONE 
J065092N03ATCGGACGGCCGAGATNONE 
J080004D17ATCGGACGGCCGAGATNONE 
J080010L09ATCGGACGGCCGAGATNONE 
J080021I11ATCGGACGGCCGAGATNONE 
J080022L01ATCGGACGGCCGAGATNONE 
J080029B01ATCGGACGGCCGAGATNONE 
J080032D11ATCGGACGGCCGAGATNONE 
J080039B11ATCGGACGGCCGAGATNONE 
J080040K17ATCGGACGGCCGAGATNONE 
J080041B21ATCGGACGGCCGAGATNONE 
J080052L24ATCGGACGGCCGAGATNONE 
J080054M12ATCGGACGGCCGAGATNONE 
J080057B15ATCGGACGGCCGAGATNONE 
J080078G15ATCGGACGGCCGAGATNONE 
J080078H06ATCGGACGGCCGAGATNONE 
J080079M03ATCGGACGGCCGAGATNONE 
J080088H16ATCGGACGGCCGAGATNONE 
J080093C11ATCGGACGGCCGAGATNONE 
J080095K09ATCGGACGGCCGAGATNONE 
J080095O20ATCGGACGGCCGAGATNONE 
J090009J19ATCGGACGGCCGAGATNONE 
J090040D04ATCGGACGGCCGAGATNONE 
J090052E14ATCGGACGGCCGAGATNONE 
J090063B14ATCGGACGGCCGAGATNONE 
J090071K04ATCGGACGGCCGAGATNONE 
J090075E12ATCGGACGGCCGAGATNONE 
J090087A06ATCGGACGGCCGAGATNONE 
J090094P03ATCGGACGGCCGAGATNONE 
J090098M14ATCGGACGGCCGAGATNONE 
Os02g0252100AF139211GGGCCGAGANONE 
AK062577GGGCCGAGASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051GGGCCGAGANONE 
J013156E01GGGCCGAGANONE 
J065001D02GGGCCGAGANONE 
J065042A05GGGCCGAGANONE 
J065116H01GGGCCGAGANONE 
J065167P13GGGCCGAGANONE 
J065168N07GGGCCGAGANONE 
J075093G21GGGCCGAGANONE 
J075109H15GGGCCGAGANONE 
J075194P17GGGCCGAGANONE 
Os02g0327700016-077-C07GGCCGAGATNONE 
AK068019GGCCGAGATProtein of unknown function DUF563 family protein. 
AK072325GGCCGAGATNONE 
J075069A18GGCCGAGATNONE 
J075069F06GGCCGAGATNONE 
Os02g0332700009-144-D04GGCCGAGANONE 
AK062975GGCCGAGAConserved hypothetical protein. 
Os02g0456500Os02g0456500TCTCGGCCNONE 
Os02g0594700AK111339GGCCGAGASimilar to Non-phototropic hypocotyl 3. 
J100037B14GGCCGAGANONE 
J100038E24GGCCGAGANONE 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0643500AK068423TCTCGGCCCACAAPentapeptide repeat containing protein. 
Os02g0672500AK109266GGCCGAGANONE 
Os02g0745100012-001-A06TCTCGGCCNONE 
AK069842TCTCGGCCSimilar to NOD26-like membrane integral protein ZmNIP2-1. 
J023031E16TCTCGGCCNONE 
J065089L08TCTCGGCCNONE 
J100042F04TCTCGGCCNONE 
J100051L18TCTCGGCCNONE 
J100057I03TCTCGGCCNONE 
J100060A19TCTCGGCCNONE 
J100060N02TCTCGGCCNONE 
J100062M17TCTCGGCCNONE 
J100068P18TCTCGGCCNONE 
J100088O22TCTCGGCCNONE 
Os02g0782100AK065421TCTCGGCCChorismate synthase family protein. 
J065038A03TCTCGGCCNONE 
Os02g0791300J100026B09TCTCGGCCCAGANONE 
J100039D05TCTCGGCCCAGAHelix-loop-helix DNA-binding domain containing protein. 
Os02g0795900012-075-B04TCTCGGCCNONE 
AK105305TCTCGGCCSimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21TCTCGGCCNONE 
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE 
AK060165TCTCGGCCCATTTCACGTGTCNONE 
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TCTCGGCCCATTTCACGTGTCNONE 
J023098C22TCTCGGCCCATTTCACGTGTCNONE 
J033123P06TCTCGGCCCATTTCACGTGTCNONE 
J065060N24TCTCGGCCCATTTCACGTGTCNONE 
J065069H22TCTCGGCCCATTTCACGTGTCNONE 
J065155N20TCTCGGCCCATTTCACGTGTCNONE 
J065170K07TCTCGGCCCATTTCACGTGTCNONE 
J090033D12TCTCGGCCCATTTCACGTGTCNONE 
Os02g0807750J075136J04CAACGGCCGAGATHypothetical protein. 
Os03g0124900AK070284TCTCGGCCVirulence factor, pectin lyase fold family protein. 
J013052O13TCTCGGCCNONE 
J023048L01TCTCGGCCNONE 
J090085D12TCTCGGCCNONE 
Os03g0148000AK110468GGCCGAGAProtein of unknown function DUF677 family protein. 
Os03g0187350J065013L15GGCCGAGAHypothetical protein. 
J065049N06GGCCGAGANONE 
J065090E15GGCCGAGANONE 
J065112I11GGCCGAGANONE 
J065114I10GGCCGAGANONE 
Os03g0188400AK107555TCTCGGCCACACACCTCGCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0189400AK067720TCTCGGCCSimilar to Alcohol dehydrogenase ADH. 
J043012M09TCTCGGCCNONE 
J043026L22TCTCGGCCNONE 
J075115C06TCTCGGCCNONE 
J100056M03TCTCGGCCNONE 
J100064I05TCTCGGCCNONE 
Os03g0249400009-059-H08AGTTGGGCCGAGANONE 
AK062522AGTTGGGCCGAGASimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05AGTTGGGCCGAGANONE 
J053052E06AGTTGGGCCGAGANONE 
J053061K22AGTTGGGCCGAGANONE 
J065108I02AGTTGGGCCGAGANONE 
Os03g0269300011-021-H03GGCCGAGANONE 
011-029-B01GGCCGAGANONE 
AK111855GGCCGAGANONE 
AK111884GGCCGAGAAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0299600009-037-H11TCTCGGCCCAGACTGACAGNONE 
011-072-E02TCTCGGCCCAGACTGACAGNONE 
AK068151TCTCGGCCCAGACTGACAGWound-induced WI12 family protein. 
J013132L05TCTCGGCCCAGACTGACAGNONE 
J023012P15TCTCGGCCCAGACTGACAGNONE 
J023022H03TCTCGGCCCAGACTGACAGNONE 
J023026N15TCTCGGCCCAGACTGACAGNONE 
J023056A21TCTCGGCCCAGACTGACAGNONE 
J023093P10TCTCGGCCCAGACTGACAGNONE 
J075143J10TCTCGGCCCAGACTGACAGNONE 
J075166I19TCTCGGCCCAGACTGACAGNONE 
J090010G13TCTCGGCCCAGACTGACAGNONE 
J090033D23TCTCGGCCCAGACTGACAGNONE 
J090090L22TCTCGGCCCAGACTGACAGNONE 
Os03g0301200AK119578TCTCGGCCNONE 
J013027D03TCTCGGCCNONE 
J075035F14TCTCGGCCNONE 
J090075I19TCTCGGCCNONE 
J090081E22TCTCGGCCNONE 
J100035I20TCTCGGCCNONE 
J100051E18TCTCGGCCNONE 
J100053H11TCTCGGCCNONE 
J100081P07TCTCGGCCNONE 
Os03g0302700006-099-F12ATCTCGGCCCGNONE 
AK112010ATCTCGGCCCGZinc finger, RING-type domain containing protein. 
AK121656ATCTCGGCCCGNONE 
J075090A19ATCTCGGCCCGNONE 
J075148M06ATCTCGGCCCGNONE 
Os03g0310600AK109731TCTCGGCCProtein of unknown function DUF247, plant family protein. 
Os03g0321800006-065-G02GGCCGTGGGCCGAGANONE 
AK061075GGCCGTGGGCCGAGANONE 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
J065122E07GGCCGTGGGCCGAGANONE 
J065187N05GGCCGTGGGCCGAGANONE 
J065214K09GGCCGTGGGCCGAGANONE 
J090050M01GGCCGTGGGCCGAGANONE 
Os03g0390600009-122-E09ATCTCGGCCGTCCGANONE 
J065165K04ATCTCGGCCGTCCGANONE 
Os03g0425100AK070206CAACGGCCGAGATHypothetical protein. 
J023042E01CAACGGCCGAGATNONE 
Os03g0625900AK101109GGCCGAGAWD40-like domain containing protein. 
Os03g0646100AK100526TCTCGGCCSimilar to Plastid division protein ftsZ1 precursor. 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0747500AK108009TCTCGGCCSeed maturation protein domain containing protein. 
Os03g0753100AB003324TCTCGGCCNONE 
AK100227TCTCGGCCTranscription factor, MADS-box domain containing protein. 
AY551917TCTCGGCCNONE 
AY551922TCTCGGCCNONE 
AY551926TCTCGGCCNONE 
J023012N20TCTCGGCCNONE 
J023048E14TCTCGGCCNONE 
Os03g0784400AK103474CAAGCCCAATGGGCCGAGAProtein of unknown function DUF1692 domain containing protein. 
J023135I15CAAGCCCAATGGGCCGAGANONE 
J033130D12CAAGCCCAATGGGCCGAGANONE 
J043035E20CAAGCCCAATGGGCCGAGANONE 
J065206K15CAAGCCCAATGGGCCGAGANONE 
J075053J20CAAGCCCAATGGGCCGAGANONE 
J075129B11CAAGCCCAATGGGCCGAGANONE 
J090003E22CAAGCCCAATGGGCCGAGANONE 
J100023E23CAAGCCCAATGGGCCGAGANONE 
Os03g0784900006-053-H11CGATGGGCCGAGANONE 
009-165-F11CGATGGGCCGAGANONE 
AK060949CGATGGGCCGAGAConserved hypothetical protein. 
AK099097CGATGGGCCGAGANONE 
J023019M19CGATGGGCCGAGANONE 
J065024O11CGATGGGCCGAGANONE 
J065106D20CGATGGGCCGAGANONE 
J065201L15CGATGGGCCGAGANONE 
J075031B04CGATGGGCCGAGANONE 
J075033C19CGATGGGCCGAGANONE 
J075035F11CGATGGGCCGAGANONE 
J075074K14CGATGGGCCGAGANONE 
J075083A22CGATGGGCCGAGANONE 
J075120O10CGATGGGCCGAGANONE 
J075153L20CGATGGGCCGAGANONE 
J075159G02CGATGGGCCGAGANONE 
J080001J18CGATGGGCCGAGANONE 
J080015I03CGATGGGCCGAGANONE 
J080027E23CGATGGGCCGAGANONE 
J080046D24CGATGGGCCGAGANONE 
J080053B17CGATGGGCCGAGANONE 
J080070P07CGATGGGCCGAGANONE 
J080076D18CGATGGGCCGAGANONE 
J080078E13CGATGGGCCGAGANONE 
J080090H03CGATGGGCCGAGANONE 
J100024F19CGATGGGCCGAGANONE 
J100052D15CGATGGGCCGAGANONE 
J100079B14CGATGGGCCGAGANONE 
Os03g0793700AK121667CCCATCCATCTCGGCCCCupin 1 domain containing protein. 
AY098743CCCATCCATCTCGGCCCNONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0803800012-043-D10TCTCGGCCCAATANONE 
AK063484TCTCGGCCCAATAConserved hypothetical protein. 
Os03g0830800AK109894TCTCGGCCPectinesterase inhibitor domain containing protein. 
Os04g0175900006-100-F11ATCTCGGCCNONE 
AK061551ATCTCGGCCWinged helix repressor DNA-binding domain containing protein. 
AK104764ATCTCGGCCNONE 
J075039D12ATCTCGGCCNONE 
Os04g0253000005-012-H08GGCCGAGANONE 
005-012-H08TCTCGGCCNONE 
009-095-D01GGCCGAGANONE 
009-095-D01TCTCGGCCNONE 
016-090-D11GGCCGAGANONE 
016-090-D11TCTCGGCCNONE 
AK073668GGCCGAGASimilar to Histone H1. 
AK073668TCTCGGCCSimilar to Histone H1. 
J013088G23GGCCGAGANONE 
J013088G23TCTCGGCCNONE 
J013162C07GGCCGAGANONE 
J013162C07TCTCGGCCNONE 
J023031N06GGCCGAGANONE 
J023031N06TCTCGGCCNONE 
J023039N07GGCCGAGANONE 
J023039N07TCTCGGCCNONE 
J023083I01GGCCGAGANONE 
J023083I01TCTCGGCCNONE 
J023083O14GGCCGAGANONE 
J023083O14TCTCGGCCNONE 
J023122B19GGCCGAGANONE 
J023122B19TCTCGGCCNONE 
J023133L08GGCCGAGANONE 
J023133L08TCTCGGCCNONE 
J033052L06GGCCGAGANONE 
J033052L06TCTCGGCCNONE 
J033080E10GGCCGAGANONE 
J033080E10TCTCGGCCNONE 
J090032L14GGCCGAGANONE 
J090032L14TCTCGGCCNONE 
J100022N05GGCCGAGANONE 
J100022N05TCTCGGCCNONE 
J100029A08GGCCGAGANONE 
J100029A08TCTCGGCCNONE 
J100029H18GGCCGAGANONE 
J100029H18TCTCGGCCNONE 
J100066D09GGCCGAGANONE 
J100066D09TCTCGGCCNONE 
J100077M22GGCCGAGANONE 
J100077M22TCTCGGCCNONE 
Os04g0436100AK072631TCTCGGCCCGPhenylacetic acid degradation-related protein domain containing protein. 
J023132I18TCTCGGCCCGNONE 
J065112K15TCTCGGCCCGNONE 
J065138F04TCTCGGCCCGNONE 
J075078D03TCTCGGCCCGNONE 
J090090K17TCTCGGCCCGNONE 
Os04g0463700015-076-E11GGCCGAGATNONE 
AK064338GGCCGAGATNONE 
AK068918GGCCGAGATSimilar to ADL064Wp. 
AK102269GGCCGAGATNONE 
J013043H02GGCCGAGATNONE 
J013102E08GGCCGAGATNONE 
J013169C17GGCCGAGATNONE 
J033088P15GGCCGAGATNONE 
J065146O17GGCCGAGATNONE 
J075065M01GGCCGAGATNONE 
J075075C15GGCCGAGATNONE 
J075161L06GGCCGAGATNONE 
J075186B19GGCCGAGATNONE 
Os04g0484900AK122179GGGCCGAGATSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J023093A12GGGCCGAGATNONE 
J033024H07GGGCCGAGATNONE 
J033149C03GGGCCGAGATNONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0508000AK071432ATTGGGCCGAGATProtein of unknown function DUF231, plant domain containing protein. 
Os04g0508100009-180-A02ATCTCGGCCCAATNONE 
AK121759ATCTCGGCCCAATConserved hypothetical protein. 
J023007G10ATCTCGGCCCAATNONE 
J033089A17ATCTCGGCCCAATNONE 
J065193E13ATCTCGGCCCAATNONE 
J075025M02ATCTCGGCCCAATNONE 
J075027J10ATCTCGGCCCAATNONE 
J075030N03ATCTCGGCCCAATNONE 
J075045I20ATCTCGGCCCAATNONE 
J075065E04ATCTCGGCCCAATNONE 
J075134M16ATCTCGGCCCAATNONE 
J075140B10ATCTCGGCCCAATNONE 
Os04g0517100AF467733TCTCGGCCNONE 
AK111798TCTCGGCCNONE 
AY323484TCTCGGCCNONE 
J023105H16TCTCGGCCNONE 
J033075H09TCTCGGCCNONE 
J033105G09TCTCGGCCNONE 
J043001K17TCTCGGCCNONE 
J065053F08TCTCGGCCNONE 
J075043E16TCTCGGCCNONE 
J075139P17TCTCGGCCNONE 
Y11414TCTCGGCCSimilar to Y19 protein. 
Os04g0520900AK068793TCTCGGCCCAAATProtein prenyltransferase domain containing protein. 
AK105606TCTCGGCCCAAATNONE 
Os04g0611300009-006-G08AGATGGGCCGAGATNONE 
009-011-C01AGATGGGCCGAGATNONE 
009-036-B09AGATGGGCCGAGATNONE 
009-116-G09AGATGGGCCGAGATNONE 
009-126-E09AGATGGGCCGAGATNONE 
009-132-F09AGATGGGCCGAGATNONE 
009-151-G07AGATGGGCCGAGATNONE 
009-155-C07AGATGGGCCGAGATNONE 
009-163-G01AGATGGGCCGAGATNONE 
009-169-G08AGATGGGCCGAGATNONE 
009-191-B02AGATGGGCCGAGATNONE 
009-196-A08AGATGGGCCGAGATNONE 
009-198-E07AGATGGGCCGAGATNONE 
014-015-F04AGATGGGCCGAGATNONE 
015-087-H04AGATGGGCCGAGATNONE 
AK062605AGATGGGCCGAGATNONE 
AK063022AGATGGGCCGAGATConserved hypothetical protein. 
AK066749AGATGGGCCGAGATNONE 
AK104924AGATGGGCCGAGATNONE 
J065002M20AGATGGGCCGAGATNONE 
J065045L23AGATGGGCCGAGATNONE 
J065101E05AGATGGGCCGAGATNONE 
J065140J23AGATGGGCCGAGATNONE 
J065179G11AGATGGGCCGAGATNONE 
J065191B18AGATGGGCCGAGATNONE 
J065192E03AGATGGGCCGAGATNONE 
J065199H21AGATGGGCCGAGATNONE 
J075067F01AGATGGGCCGAGATNONE 
J075089L01AGATGGGCCGAGATNONE 
J075147K22AGATGGGCCGAGATNONE 
J080069G23AGATGGGCCGAGATNONE 
J100053D10AGATGGGCCGAGATNONE 
J100078C10AGATGGGCCGAGATNONE 
Os04g0627000AK101563TCCGGGCCGAGANONE 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE 
Os04g0668300AK120932GGCCGAGAConserved hypothetical protein. 
J023036D13GGCCGAGANONE 
Os04g0674350J065104O14TCTCGGCCCATGGNONE 
J065118J19TCTCGGCCCATGGNONE 
J065167I12TCTCGGCCCATGGHypothetical protein. 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
AK102515ATCTCGGCCCATGAAAAGCCCNONE 
Os05g0176100AF030052ATCCGACGGCCGAGATNONE 
AK067850ATCCGACGGCCGAGATNONE 
AK067967ATCCGACGGCCGAGATNONE 
AK098978ATCCGACGGCCGAGATNONE 
AK099228ATCCGACGGCCGAGATNONE 
AK099281ATCCGACGGCCGAGATNONE 
AK100188ATCCGACGGCCGAGATSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140ATCCGACGGCCGAGATNONE 
Os05g0182700003-102-E07TTGTGGGCCGAGATNONE 
011-019-D04TTGTGGGCCGAGATNONE 
013-068-D09TTGTGGGCCGAGATNONE 
014-032-G03TTGTGGGCCGAGATNONE 
AK065911TTGTGGGCCGAGATProtein of unknown function DUF1664 family protein. 
AK104343TTGTGGGCCGAGATNONE 
J013045E01TTGTGGGCCGAGATNONE 
J013156L15TTGTGGGCCGAGATNONE 
J023029P17TTGTGGGCCGAGATNONE 
J023134I24TTGTGGGCCGAGATNONE 
J033099A10TTGTGGGCCGAGATNONE 
J033115L16TTGTGGGCCGAGATNONE 
J090007M24TTGTGGGCCGAGATNONE 
J090019F02TTGTGGGCCGAGATNONE 
Os05g0283600AK100359GGCCGAGATConserved hypothetical protein. 
AK106958GGCCGAGATNONE 
AK109539GGCCGAGATNONE 
J023083K23GGCCGAGATNONE 
Os05g0357100AK102042GGCCGAGA3'-5' exonuclease domain containing protein. 
J033081J05GGCCGAGANONE 
J100022A18GGCCGAGANONE 
Os05g0429000AK109617TCTCGGCCSimilar to Hydroxymethyltransferase. 
Os05g0456000AK058420GGCCGAGATMitochondrial glycoprotein family protein. 
AK102036GGCCGAGATNONE 
J065066F02GGCCGAGATNONE 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
J023057L12TCTCGGCCCACGGCGTGGANONE 
Os05g0571800009-157-G07ATCTCGGCCNONE 
AK063033ATCTCGGCCConserved hypothetical protein. 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os06g0115200J100029D05GGCCGAGANONE 
J100048P05GGCCGAGAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0135340J065061D17ATCTCGGCCCNONE 
J065159A10ATCTCGGCCCConserved hypothetical protein. 
Os06g0156700AK107226GGCCGAGATLipolytic enzyme, G-D-S-L family protein. 
J075021O05GGCCGAGATNONE 
J075023M12GGCCGAGATNONE 
J075041C14GGCCGAGATNONE 
J075041C19GGCCGAGATNONE 
J075064F08GGCCGAGATNONE 
J075116I03GGCCGAGATNONE 
J075123I02GGCCGAGATNONE 
Os06g0226600006-083-D04AGATGGGCCGAGANONE 
AK061806AGATGGGCCGAGANONE 
AK102752AGATGGGCCGAGATB2/DP1 and HVA22 related protein family protein. 
J013089J11AGATGGGCCGAGANONE 
J033106M05AGATGGGCCGAGANONE 
J100044M21AGATGGGCCGAGANONE 
J100056E06AGATGGGCCGAGANONE 
J100059F06AGATGGGCCGAGANONE 
Os06g0285400AK105829TCTCGGCCNONE 
Os06g0324000AK109614GGCCGAGAConserved hypothetical protein. 
Os06g0571400011-027-C01ATCTCGGCCGTCCNONE 
013-005-G03ATCTCGGCCGTCCNONE 
015-053-G02ATCTCGGCCGTCCNONE 
016-077-A05ATCTCGGCCGTCCNONE 
AK068226ATCTCGGCCGTCCSimilar to Elongation factor 1 gamma-like protein (Fragment). 
AK103928ATCTCGGCCGTCCNONE 
AK104931ATCTCGGCCGTCCNONE 
AY224444ATCTCGGCCGTCCNONE 
J013044F14ATCTCGGCCGTCCNONE 
J013092L16ATCTCGGCCGTCCNONE 
J033028B03ATCTCGGCCGTCCNONE 
J033048B03ATCTCGGCCGTCCNONE 
J033065D21ATCTCGGCCGTCCNONE 
J033087A07ATCTCGGCCGTCCNONE 
J033108N12ATCTCGGCCGTCCNONE 
J033111G07ATCTCGGCCGTCCNONE 
J043009P12ATCTCGGCCGTCCNONE 
J075079P19ATCTCGGCCGTCCNONE 
J090056J24ATCTCGGCCGTCCNONE 
J090071D10ATCTCGGCCGTCCNONE 
Os06g0622700AK107021TCTCGGCCCAATTEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTCGGCCCAATTNONE 
J065100L18TCTCGGCCCAATTNONE 
J065129N15TCTCGGCCCAATTNONE 
J065152M08TCTCGGCCCAATTNONE 
J065198M12TCTCGGCCCAATTNONE 
J090077J22TCTCGGCCCAATTNONE 
J100024G23TCTCGGCCCAATTNONE 
J100027L01TCTCGGCCCAATTNONE 
J100047C06TCTCGGCCCAATTNONE 
J100055D01TCTCGGCCCAATTNONE 
J100067M05TCTCGGCCCAATTNONE 
J100077M16TCTCGGCCCAATTNONE 
J100078M22TCTCGGCCCAATTNONE 
Os06g0663600AK100787AGATGGGCCGAGATEndonuclease V family protein. 
Os06g0691200AK108191TCTCGGCCSimilar to Thaumatin-like protein precursor. 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0698711AK070810CGACACGTCTCGGCCConserved hypothetical protein. 
J065019B03CGACACGTCTCGGCCNONE 
J065047C24CGACACGTCTCGGCCNONE 
Os06g0702800009-039-E05GGCCGAGANONE 
AK073948GGCCGAGAHypothetical protein. 
J023108K23GGCCGAGANONE 
J033072H04GGCCGAGANONE 
J065008G05GGCCGAGANONE 
J065128J12GGCCGAGANONE 
J065131A01GGCCGAGANONE 
J065173B12GGCCGAGANONE 
Os07g0108100Os07g0108100ATCTCGGCCCPeptidase C1A, papain family protein. 
Os07g0121500J100066O17ATCTCGGCCGTCCNONE 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0171200AK071075TCTCGGCCGalactose-1-phosphate uridyl transferase, class I family protein. 
Os07g0243200AK121036CCCACTCTTCTCGGCCCATCGSimilar to ADP-glucose pyrophosphorylase large subunit 2 (EC 2.7.7.27) (Fragment). 
D21272CCCACTCTTCTCGGCCCATCGNONE 
Os07g0274700J065002G18TCTCGGCCCACCCGNONE 
J065092L19TCTCGGCCCACCCGNONE 
J065099K11TCTCGGCCCACCCGNONE 
J065103L08TCTCGGCCCACCCGNONE 
J065185I19TCTCGGCCCACCCGNONE 
J075004L22TCTCGGCCCACCCGNONE 
J075007G03TCTCGGCCCACCCGNONE 
J075020E09TCTCGGCCCACCCGNONE 
J075046B02TCTCGGCCCACCCGNONE 
J075070D08TCTCGGCCCACCCGNONE 
J075118L24TCTCGGCCCACCCGNONE 
J075140C15TCTCGGCCCACCCGNONE 
J075157A21TCTCGGCCCACCCGNONE 
J075165J01TCTCGGCCCACCCGNONE 
J075172J18TCTCGGCCCACCCGNONE 
J075177P10TCTCGGCCCACCCGNONE 
J100042D15TCTCGGCCCACCCGNONE 
J100053M21TCTCGGCCCACCCGNONE 
J100067M12TCTCGGCCCACCCGNONE 
Os07g0545400009-136-E03GCAGCCCACAGGCCGAGANONE 
013-015-G08GCAGCCCACAGGCCGAGANONE 
AK059228GCAGCCCACAGGCCGAGANONE 
J065040D09GCAGCCCACAGGCCGAGANONE 
J065051C19GCAGCCCACAGGCCGAGANONE 
J065139B05GCAGCCCACAGGCCGAGANONE 
J065160E20GCAGCCCACAGGCCGAGANONE 
J065207I17GCAGCCCACAGGCCGAGANONE 
J080319M24GCAGCCCACAGGCCGAGANONE 
Os07g0564000AK069806AGTTGGGCCGAGAConserved hypothetical protein. 
Os07g0585800006-106-A05ACTGGGCCGAGANONE 
AK066419ACTGGGCCGAGANONE 
AK105064ACTGGGCCGAGASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01ACTGGGCCGAGANONE 
J065085B08ACTGGGCCGAGANONE 
J065099I23ACTGGGCCGAGANONE 
J065169A01ACTGGGCCGAGANONE 
J065187N13ACTGGGCCGAGANONE 
J065191L18ACTGGGCCGAGANONE 
J065194D04ACTGGGCCGAGANONE 
J065211M09ACTGGGCCGAGANONE 
J065212I02ACTGGGCCGAGANONE 
J090003C10ACTGGGCCGAGANONE 
J090025O11ACTGGGCCGAGANONE 
J090092F10ACTGGGCCGAGANONE 
J100055A04ACTGGGCCGAGANONE 
J100064A01ACTGGGCCGAGANONE 
J100080L02ACTGGGCCGAGANONE 
Os07g0595800011-069-G09GGCCGAGANONE 
AK066349GGCCGAGAPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05GGCCGAGANONE 
Os07g0606500AK068811ATCTCGGCCCATTTNONE 
AK121873ATCTCGGCCCATTTNONE 
J013159C05ATCTCGGCCCATTTNONE 
J075158B14ATCTCGGCCCATTTNONE 
Os07g0633200AK061338GGGCCGAGASimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GGGCCGAGANONE 
J033096E22GGGCCGAGANONE 
J033125D06GGGCCGAGANONE 
J075048C23GGGCCGAGANONE 
J075050G02GGGCCGAGANONE 
J075104J04GGGCCGAGANONE 
J075144N04GGGCCGAGANONE 
Os07g0637100AK111132TCTCGGCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os07g0657200AB042102CAACGGCCGAGATNONE 
AB042102CCAACGGCCGAGATNONE 
AK072927CAACGGCCGAGATWD40-like domain containing protein. 
AK072927CCAACGGCCGAGATWD40-like domain containing protein. 
AK100911CAACGGCCGAGATNONE 
AK100911CCAACGGCCGAGATNONE 
Os07g0673400009-130-B03TCTCGGCCNONE 
014-016-A11TCTCGGCCNONE 
AF491815TCTCGGCCNONE 
AK064061TCTCGGCCUniversal stress protein (Usp) family protein. 
AK073356TCTCGGCCNONE 
AY224503TCTCGGCCNONE 
J033028K22TCTCGGCCNONE 
J065010E10TCTCGGCCNONE 
Os08g0113800J033069I12TCTCGGCCCAAACNONE 
J053050I07TCTCGGCCCAAACNONE 
J065006J11TCTCGGCCCAAACNONE 
J065013D02TCTCGGCCCAAACNONE 
J065055L24TCTCGGCCCAAACNONE 
J065071I11TCTCGGCCCAAACConserved hypothetical protein. 
J065093G12TCTCGGCCCAAACNONE 
J065101N03TCTCGGCCCAAACNONE 
Os08g0116800AK063695TCTCGGCCCAGGExoribonuclease domain containing protein. 
Os08g0122400AK071781TCTCGGCCCConserved hypothetical protein. 
J023110A01TCTCGGCCCNONE 
Os08g0129200014-040-E08AGTGGGCCGAGATNONE 
AK070034AGTGGGCCGAGATNONE 
AK101577AGTGGGCCGAGATSimilar to Cold shock protein-1. 
J065137A09AGTGGGCCGAGATNONE 
J100062K14AGTGGGCCGAGATNONE 
Os08g0187700AK099689GATCGGACGGCCGAGAGCCCATCARegulation of nuclear pre-mRNA protein domain containing protein. 
Os08g0249000AK109938GGCCGAGAZinc finger, B-box domain containing protein. 
Os08g0260600AK108529AGTTGGGCCGAGACD9/CD37/CD63 antigen family protein. 
Os08g0351700AK109269TCTCGGCCConserved hypothetical protein. 
Os08g0379400006-033-C10CGGGCCGAGATNONE 
006-112-H05CGGGCCGAGATNONE 
AK069608CGGGCCGAGATSimilar to Quinone oxidoreductase-like protein. 
AK104318CGGGCCGAGATNONE 
AK109433CGGGCCGAGATNONE 
AK112013CGGGCCGAGATNONE 
J065163C05CGGGCCGAGATNONE 
Os08g0430000AK120950GATCCGACGGCCGAGATConserved hypothetical protein. 
Os08g0440000006-056-A06TCTCGGCCCAGTTNONE 
AK060959TCTCGGCCCAGTTNONE 
AK102539TCTCGGCCCAGTTVesicle transport v-SNARE family protein. 
J065012O03TCTCGGCCCAGTTNONE 
Os08g0441400011-033-F01CGGGCCGAGANONE 
015-084-B04CGGGCCGAGANONE 
AK063317CGGGCCGAGANONE 
AK064141CGGGCCGAGAConserved hypothetical protein. 
J065060F06CGGGCCGAGANONE 
J075110A22CGGGCCGAGANONE 
J080307P11CGGGCCGAGANONE 
J090041E06CGGGCCGAGANONE 
Os08g0474750J075009C13GGCCGAGANONE 
J075122O14GGCCGAGAHypothetical protein. 
Os08g0474800Os08g0474800GGCCGAGAEsterase/lipase/thioesterase domain containing protein. 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0546300AK064717GGCCGAGAConserved hypothetical protein. 
AK119794GGCCGAGANONE 
D10982GGCCGAGANONE 
J080044B21GGCCGAGANONE 
Os09g0437900AK107833TCTCGGCCSimilar to Adrenodoxin. 
Os09g0453000AK120561TCTCGGCCCAGAProtein of unknown function UPF0220 family protein. 
AK121475TCTCGGCCCAGANONE 
J013132I06TCTCGGCCCAGANONE 
J023148P12TCTCGGCCCAGANONE 
J033147G24TCTCGGCCCAGANONE 
J053089L13TCTCGGCCCAGANONE 
J053097D02TCTCGGCCCAGANONE 
J065013M20TCTCGGCCCAGANONE 
J075148M10TCTCGGCCCAGANONE 
J075153M04TCTCGGCCCAGANONE 
J075197C14TCTCGGCCCAGANONE 
J080311M12TCTCGGCCCAGANONE 
J090022J07TCTCGGCCCAGANONE 
J090026D19TCTCGGCCCAGANONE 
J090033D10TCTCGGCCCAGANONE 
J090084N05TCTCGGCCCAGANONE 
J090087H04TCTCGGCCCAGANONE 
J100028I02TCTCGGCCCAGANONE 
J100088N15TCTCGGCCCAGANONE 
Os09g0458100AK109625GTTGGGCCGAGATXyloglucan fucosyltransferase family protein. 
Os09g0528100009-173-A08ACTGGGCCGAGANONE 
009-190-G12ACTGGGCCGAGANONE 
AK059096ACTGGGCCGAGASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0528200006-021-E01GGCCGAGANONE 
AK059755GGCCGAGANONE 
Os09g0538700Os09g0538700GGCCGAGAGlutelin family protein. 
Os09g0539100AK071977ATCTCGGCCSimilar to 3-dehydroquinate synthase-like protein. 
AK098959ATCTCGGCCNONE 
Os09g0539700011-017-A06GGCCGAGAConserved hypothetical protein. 
015-017-B06GGCCGAGANONE 
J090082D24GGCCGAGANONE 
Os09g0572900AK069270TCGTGGGCCTCTCGGCCCAAGSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399CTTGGGCCGAGAGGCCCACGAProtein prenyltransferase domain containing protein. 
Os11g0139100009-099-H06TCTCGGCCCACTNONE 
AK121443TCTCGGCCCACTSimilar to 50S ribosomal protein L24. 
J023140O18TCTCGGCCCACTNONE 
J023143M23TCTCGGCCCACTNONE 
J033079G04TCTCGGCCCACTNONE 
J043004D20TCTCGGCCCACTNONE 
J065097F05TCTCGGCCCACTNONE 
Os11g0148600AK100066AAATGGGCCGAGAConserved hypothetical protein. 
AK102442AAATGGGCCGAGANONE 
J065167F17AAATGGGCCGAGANONE 
Os11g0270000J100043N02TCTCGGCCConserved hypothetical protein. 
J100049K11TCTCGGCCNONE 
J100069O14TCTCGGCCNONE 
Os11g0444800AK061328ATCTCGGCCConserved hypothetical protein. 
Os11g0557700AK071694ATCTCGGCCGTCCNONE 
AK107593ATCTCGGCCGTCCSAM (and some other nucleotide) binding motif domain containing protein. 
J023108E23ATCTCGGCCGTCCNONE 
Os11g0602600006-046-H02ATCTCGGCCCATTTNONE 
006-046-H02TAATGGGCCGAGANONE 
006-056-H08ATCTCGGCCCATTTNONE 
006-056-H08TAATGGGCCGAGANONE 
009-116-D05ATCTCGGCCCATTTNONE 
009-116-D05TAATGGGCCGAGANONE 
AK072671ATCTCGGCCCATTTSimilar to 40S ribosomal protein S9. 
AK072671TAATGGGCCGAGASimilar to 40S ribosomal protein S9. 
AK104660ATCTCGGCCCATTTNONE 
AK104660TAATGGGCCGAGANONE 
J023134P20ATCTCGGCCCATTTNONE 
J023134P20TAATGGGCCGAGANONE 
J023141O13ATCTCGGCCCATTTNONE 
J023141O13TAATGGGCCGAGANONE 
J033066I15ATCTCGGCCCATTTNONE 
J033066I15TAATGGGCCGAGANONE 
J033076A08ATCTCGGCCCATTTNONE 
J033076A08TAATGGGCCGAGANONE 
J033150J23ATCTCGGCCCATTTNONE 
J033150J23TAATGGGCCGAGANONE 
J065114P19ATCTCGGCCCATTTNONE 
J065114P19TAATGGGCCGAGANONE 
J065176B01ATCTCGGCCCATTTNONE 
J065176B01TAATGGGCCGAGANONE 
J065207H21ATCTCGGCCCATTTNONE 
J065207H21TAATGGGCCGAGANONE 
J080301L21ATCTCGGCCCATTTNONE 
J080301L21TAATGGGCCGAGANONE 
J080308A08ATCTCGGCCCATTTNONE 
J080308A08TAATGGGCCGAGANONE 
J080318K23ATCTCGGCCCATTTNONE 
J080318K23TAATGGGCCGAGANONE 
J080319F17ATCTCGGCCCATTTNONE 
J080319F17TAATGGGCCGAGANONE 
J080319I10ATCTCGGCCCATTTNONE 
J080319I10TAATGGGCCGAGANONE 
J090028C08ATCTCGGCCCATTTNONE 
J090028C08TAATGGGCCGAGANONE 
J090051I24ATCTCGGCCCATTTNONE 
J090051I24TAATGGGCCGAGANONE 
J090053L21ATCTCGGCCCATTTNONE 
J090053L21TAATGGGCCGAGANONE 
J090069C20ATCTCGGCCCATTTNONE 
J090069C20TAATGGGCCGAGANONE 
J100017G08ATCTCGGCCCATTTNONE 
J100017G08TAATGGGCCGAGANONE 
J100042B06ATCTCGGCCCATTTNONE 
J100042B06TAATGGGCCGAGANONE 
J100045G24ATCTCGGCCCATTTNONE 
J100045G24TAATGGGCCGAGANONE 
J100050J19ATCTCGGCCCATTTNONE 
J100050J19TAATGGGCCGAGANONE 
J100052D23ATCTCGGCCCATTTNONE 
J100052D23TAATGGGCCGAGANONE 
J100053M03ATCTCGGCCCATTTNONE 
J100053M03TAATGGGCCGAGANONE 
J100056D08ATCTCGGCCCATTTNONE 
J100056D08TAATGGGCCGAGANONE 
J100066B19ATCTCGGCCCATTTNONE 
J100066B19TAATGGGCCGAGANONE 
J100071N23ATCTCGGCCCATTTNONE 
J100071N23TAATGGGCCGAGANONE 
J100074H01ATCTCGGCCCATTTNONE 
J100074H01TAATGGGCCGAGANONE 
J100074H19ATCTCGGCCCATTTNONE 
J100074H19TAATGGGCCGAGANONE 
J100077C06ATCTCGGCCCATTTNONE 
J100077C06TAATGGGCCGAGANONE 
Os11g0616200AK069189TCTCGGCCGCCACGTConserved hypothetical protein. 
J023004N19TCTCGGCCGCCACGTNONE 
Os11g0657200AK059959TCTCGGCCCATT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AATGGGCCGAGANONE 
AK062752AATGGGCCGAGASimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0703900009-118-C12GGCCGAGANONE 
AK119710GGCCGAGANONE 
J080038G19GGCCGAGANONE 
J080054L02GGCCGAGANONE 
J080068K07GGCCGAGANONE 
J080069A04GGCCGAGANONE 
J080081I01GGCCGAGANONE 
J080091E17GGCCGAGANONE 
Os11g0707000003-106-C01GGCCGAGATNONE 
003-130-G06GGCCGAGATNONE 
005-012-E05GGCCGAGATNONE 
006-021-F04GGCCGAGATNONE 
006-031-E07GGCCGAGATNONE 
006-035-C03GGCCGAGATNONE 
006-038-D10GGCCGAGATNONE 
006-043-A10GGCCGAGATNONE 
006-043-G08GGCCGAGATNONE 
006-046-C03GGCCGAGATNONE 
006-055-G09GGCCGAGATNONE 
006-085-A03GGCCGAGATNONE 
006-118-E05GGCCGAGATNONE 
AB034698GGCCGAGATNONE 
AB034748GGCCGAGATNONE 
AB110180GGCCGAGATNONE 
AK060841GGCCGAGATNONE 
AK060847GGCCGAGATNONE 
AK064986GGCCGAGATNONE 
AK104332GGCCGAGATSimilar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments). 
AK119513GGCCGAGATNONE 
J013001C24GGCCGAGATNONE 
J013024I02GGCCGAGATNONE 
J013044O11GGCCGAGATNONE 
J013048O10GGCCGAGATNONE 
J013051A08GGCCGAGATNONE 
J013055H23GGCCGAGATNONE 
J013070N15GGCCGAGATNONE 
J013074C16GGCCGAGATNONE 
J013096P16GGCCGAGATNONE 
J013109A14GGCCGAGATNONE 
J013112C07GGCCGAGATNONE 
J013112N16GGCCGAGATNONE 
J013123B03GGCCGAGATNONE 
J013128G01GGCCGAGATNONE 
J013132L17GGCCGAGATNONE 
J013158I17GGCCGAGATNONE 
J013159L01GGCCGAGATNONE 
J023001H04GGCCGAGATNONE 
J023004L05GGCCGAGATNONE 
J023013G12GGCCGAGATNONE 
J023020K06GGCCGAGATNONE 
J023031J19GGCCGAGATNONE 
J023034A05GGCCGAGATNONE 
J023034E21GGCCGAGATNONE 
J023041M12GGCCGAGATNONE 
J023041P06GGCCGAGATNONE 
J023044C04GGCCGAGATNONE 
J023047H01GGCCGAGATNONE 
J023048D08GGCCGAGATNONE 
J023052H08GGCCGAGATNONE 
J023054D24GGCCGAGATNONE 
J023063G11GGCCGAGATNONE 
J023068O21GGCCGAGATNONE 
J023074C13GGCCGAGATNONE 
J023078O06GGCCGAGATNONE 
J023089K10GGCCGAGATNONE 
J023100O05GGCCGAGATNONE 
J023107N16GGCCGAGATNONE 
J023120L08GGCCGAGATNONE 
J023123N23GGCCGAGATNONE 
J023127M10GGCCGAGATNONE 
J023128C22GGCCGAGATNONE 
J023129C04GGCCGAGATNONE 
J023146H08GGCCGAGATNONE 
J053063N05GGCCGAGATNONE 
J053066F02GGCCGAGATNONE 
J053066N18GGCCGAGATNONE 
J053076G01GGCCGAGATNONE 
J065012O05GGCCGAGATNONE 
J065035L06GGCCGAGATNONE 
J065037M01GGCCGAGATNONE 
J065045N23GGCCGAGATNONE 
J065058F09GGCCGAGATNONE 
J065072E14GGCCGAGATNONE 
J065073I20GGCCGAGATNONE 
J065076B05GGCCGAGATNONE 
J065093B09GGCCGAGATNONE 
J065117A22GGCCGAGATNONE 
J065149J21GGCCGAGATNONE 
J065155M04GGCCGAGATNONE 
J065161J21GGCCGAGATNONE 
J065163H19GGCCGAGATNONE 
J065192A15GGCCGAGATNONE 
J065211L18GGCCGAGATNONE 
J075001K13GGCCGAGATNONE 
J075002J24GGCCGAGATNONE 
J075004N18GGCCGAGATNONE 
J075025H21GGCCGAGATNONE 
J075028F20GGCCGAGATNONE 
J075039F23GGCCGAGATNONE 
J075043M08GGCCGAGATNONE 
J075057D02GGCCGAGATNONE 
J075059I01GGCCGAGATNONE 
J075069P10GGCCGAGATNONE 
J075073D08GGCCGAGATNONE 
J075084I17GGCCGAGATNONE 
J075089I04GGCCGAGATNONE 
J075093O18GGCCGAGATNONE 
J075097N13GGCCGAGATNONE 
J075114B02GGCCGAGATNONE 
J075123E10GGCCGAGATNONE 
J075128C19GGCCGAGATNONE 
J075135F05GGCCGAGATNONE 
J075136A04GGCCGAGATNONE 
J075141B05GGCCGAGATNONE 
J075169H18GGCCGAGATNONE 
J075183L14GGCCGAGATNONE 
J075191N03GGCCGAGATNONE 
J080001C11GGCCGAGATNONE 
J080004F18GGCCGAGATNONE 
J080004H21GGCCGAGATNONE 
J080004O09GGCCGAGATNONE 
J080005J02GGCCGAGATNONE 
J080006I03GGCCGAGATNONE 
J080006J17GGCCGAGATNONE 
J080009I09GGCCGAGATNONE 
J080010I06GGCCGAGATNONE 
J080011A17GGCCGAGATNONE 
J080014N22GGCCGAGATNONE 
J080016E24GGCCGAGATNONE 
J080016P08GGCCGAGATNONE 
J080017G22GGCCGAGATNONE 
J080017P09GGCCGAGATNONE 
J080018D23GGCCGAGATNONE 
J080018E15GGCCGAGATNONE 
J080020K04GGCCGAGATNONE 
J080024P09GGCCGAGATNONE 
J080025G15GGCCGAGATNONE 
J080025N11GGCCGAGATNONE 
J080026H10GGCCGAGATNONE 
J080026N06GGCCGAGATNONE 
J080027C07GGCCGAGATNONE 
J080027M21GGCCGAGATNONE 
J080028I03GGCCGAGATNONE 
J080028K11GGCCGAGATNONE 
J080029B19GGCCGAGATNONE 
J080029G14GGCCGAGATNONE 
J080029G20GGCCGAGATNONE 
J080030A16GGCCGAGATNONE 
J080031C05GGCCGAGATNONE 
J080033M16GGCCGAGATNONE 
J080034C24GGCCGAGATNONE 
J080034F11GGCCGAGATNONE 
J080036B03GGCCGAGATNONE 
J080036C14GGCCGAGATNONE 
J080037C01GGCCGAGATNONE 
J080038M20GGCCGAGATNONE 
J080039K03GGCCGAGATNONE 
J080040M24GGCCGAGATNONE 
J080040P19GGCCGAGATNONE 
J080042L24GGCCGAGATNONE 
J080042O06GGCCGAGATNONE 
J080043A22GGCCGAGATNONE 
J080043N19GGCCGAGATNONE 
J080044A18GGCCGAGATNONE 
J080044P14GGCCGAGATNONE 
J080045K12GGCCGAGATNONE 
J080045N16GGCCGAGATNONE 
J080047A16GGCCGAGATNONE 
J080047B09GGCCGAGATNONE 
J080047E08GGCCGAGATNONE 
J080047G06GGCCGAGATNONE 
J080048H04GGCCGAGATNONE 
J080049B17GGCCGAGATNONE 
J080049D05GGCCGAGATNONE 
J080049G23GGCCGAGATNONE 
J080050D03GGCCGAGATNONE 
J080050J24GGCCGAGATNONE 
J080050O20GGCCGAGATNONE 
J080052E24GGCCGAGATNONE 
J080052K11GGCCGAGATNONE 
J080053B04GGCCGAGATNONE 
J080053D20GGCCGAGATNONE 
J080053E16GGCCGAGATNONE 
J080054H20GGCCGAGATNONE 
J080054H22GGCCGAGATNONE 
J080054N24GGCCGAGATNONE 
J080055H08GGCCGAGATNONE 
J080056H08GGCCGAGATNONE 
J080056H12GGCCGAGATNONE 
J080057N11GGCCGAGATNONE 
J080058D08GGCCGAGATNONE 
J080058D21GGCCGAGATNONE 
J080058E10GGCCGAGATNONE 
J080060J10GGCCGAGATNONE 
J080061O04GGCCGAGATNONE 
J080065M18GGCCGAGATNONE 
J080066D15GGCCGAGATNONE 
J080067E22GGCCGAGATNONE 
J080067N20GGCCGAGATNONE 
J080068F02GGCCGAGATNONE 
J080069G20GGCCGAGATNONE 
J080069O13GGCCGAGATNONE 
J080070I20GGCCGAGATNONE 
J080071H11GGCCGAGATNONE 
J080071H17GGCCGAGATNONE 
J080071O18GGCCGAGATNONE 
J080077G14GGCCGAGATNONE 
J080077H17GGCCGAGATNONE 
J080078B18GGCCGAGATNONE 
J080078D24GGCCGAGATNONE 
J080079H02GGCCGAGATNONE 
J080079J02GGCCGAGATNONE 
J080081O20GGCCGAGATNONE 
J080082E02GGCCGAGATNONE 
J080082N12GGCCGAGATNONE 
J080084E18GGCCGAGATNONE 
J080085P08GGCCGAGATNONE 
J080086B21GGCCGAGATNONE 
J080086L10GGCCGAGATNONE 
J080086L18GGCCGAGATNONE 
J080087D12GGCCGAGATNONE 
J080087E24GGCCGAGATNONE 
J080087G12GGCCGAGATNONE 
J080088J22GGCCGAGATNONE 
J080090C18GGCCGAGATNONE 
J080090L02GGCCGAGATNONE 
J080092N05GGCCGAGATNONE 
J080092P20GGCCGAGATNONE 
J080094D15GGCCGAGATNONE 
J080095A11GGCCGAGATNONE 
J080095K13GGCCGAGATNONE 
J080096L16GGCCGAGATNONE 
J080097F16GGCCGAGATNONE 
J080305J21GGCCGAGATNONE 
J080308I22GGCCGAGATNONE 
J080310E21GGCCGAGATNONE 
J080310G09GGCCGAGATNONE 
J090032M14GGCCGAGATNONE 
J090045I12GGCCGAGATNONE 
J090076M15GGCCGAGATNONE 
J090088C17GGCCGAGATNONE 
J090094B06GGCCGAGATNONE 
U74321GGCCGAGATNONE 
Os12g0106700AK106509GGCCGAGASimilar to OsPK4. 
Os12g0507600009-155-B05GGGTGGGCCCATCTCGGCCCATGANONE 
AK070613GGGTGGGCCCATCTCGGCCCATGAConserved hypothetical protein. 
J023063G03GGGTGGGCCCATCTCGGCCCATGANONE 
Os12g0599900AK101252TCTCGGCCCGGCCTetratricopeptide region domain containing protein. 
J033032F05TCTCGGCCCGGCCNONE 
Os12g0615800AK073946CAACGGCCGAGATD111/G-patch domain containing protein. 
J033071N19CAACGGCCGAGATNONE 
Os12g0621500AK111785GGCCGAGATSimilar to IRE. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.