version

Summary of OsREG636 (All List)

OrganismOryza sativa  
IDOsREG636  
SequenceGGCGTGGA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1315  

Entry Sequences (1315 entries)

LocusGene modelSequenceDescription
Os01g0224100011-010-A11TCCACGCCNONE 
011-034-B03TCCACGCCNONE 
011-067-G07TCCACGCCNONE 
015-017-C02TCCACGCCNONE 
015-090-E01TCCACGCCNONE 
AK101054TCCACGCCNONE 
AK106517TCCACGCCSimilar to DNA binding protein-like protein. 
Os01g0253400AK108904CCTCGCCCGGCGTGGAProtein of unknown function DUF1218 family protein. 
Os01g0273800AK109645TCCACGCCACFAD dependent oxidoreductase family protein. 
Os01g0300900AK119559GGCGTGGANONE 
Os01g0386500015-009-C02TCCACGCCNONE 
AK106513TCCACGCCHypothetical protein. 
Os01g0390400AK067433TCCACGCCNONE 
AK067433TCCACGCCACNONE 
AK106834TCCACGCCNONE 
AK106834TCCACGCCACNONE 
J033069B09TCCACGCCNONE 
J033069B09TCCACGCCACNONE 
Os01g0528000AK119796TCCACGCCConserved hypothetical protein. 
Os01g0554100012-026-D02TCCACGCCNONE 
AK060977TCCACGCCNONE 
AK063461TCCACGCCNONE 
J075096C09TCCACGCCNONE 
J075154I16TCCACGCCNONE 
Os01g0561600AK069494TCCACGCCTCCytochrome P450 family protein. 
J023025F12TCCACGCCTCNONE 
J023036E02TCCACGCCTCNONE 
Os01g0582600J023150F24TCCACGCCCCCACConserved hypothetical protein. 
J100032A08TCCACGCCCCCACNONE 
Os01g0661800AK103579TCCACGCCConserved hypothetical protein. 
Os01g0667900013-097-A02TCCACGCCNONE 
014-011-C01TCCACGCCNONE 
AK105335TCCACGCCGlutaredoxin-like, plant II family protein. 
J065156F10TCCACGCCNONE 
J065163D22TCCACGCCNONE 
J065197J04TCCACGCCNONE 
J075122C02TCCACGCCNONE 
J100047L16TCCACGCCNONE 
Os01g0738300AK101943GGCGTGGAProtein kinase-like domain containing protein. 
Os01g0745700009-020-H03TCCACGCCNONE 
AK062377TCCACGCCNONE 
AK121896TCCACGCCSimilar to GATA transcription factor 3 (AtGATA-3). 
J033105E11TCCACGCCNONE 
J075022B21TCCACGCCNONE 
J075147O07TCCACGCCNONE 
Os01g0760600011-038-B09GAGGCGTGGANONE 
AB110193GAGGCGTGGANONE 
AK067557GAGGCGTGGANONE 
AK099338GAGGCGTGGANONE 
AK103133GAGGCGTGGANONE 
AK103586GAGGCGTGGAAspartate aminotransferase, cytoplasmic (EC 2.6.1.1) (Transaminase A). 
AK104829GAGGCGTGGANONE 
D14673GAGGCGTGGANONE 
J023030P20GAGGCGTGGANONE 
J023110C16GAGGCGTGGANONE 
J033025N16GAGGCGTGGANONE 
J033026K01GAGGCGTGGANONE 
J033026M02GAGGCGTGGANONE 
J033028M22GAGGCGTGGANONE 
J033036D08GAGGCGTGGANONE 
J033038A21GAGGCGTGGANONE 
J033044D24GAGGCGTGGANONE 
J033051F18GAGGCGTGGANONE 
J033095C16GAGGCGTGGANONE 
J090003F07GAGGCGTGGANONE 
J090009P10GAGGCGTGGANONE 
J090012D16GAGGCGTGGANONE 
J090023K01GAGGCGTGGANONE 
J090030J17GAGGCGTGGANONE 
J090033G02GAGGCGTGGANONE 
J090037I22GAGGCGTGGANONE 
J090038A17GAGGCGTGGANONE 
J090048K09GAGGCGTGGANONE 
J090069N01GAGGCGTGGANONE 
J090078C19GAGGCGTGGANONE 
J090089P15GAGGCGTGGANONE 
J090093D07GAGGCGTGGANONE 
J090095H01GAGGCGTGGANONE 
J100057J03GAGGCGTGGANONE 
Os01g0765200015-007-A08GGCGTGGANONE 
AK106232GGCGTGGAConserved hypothetical protein. 
Os01g0793900009-109-G11TCCACGCCNONE 
009-125-A10TCCACGCCNONE 
AK062811TCCACGCCConserved hypothetical protein. 
Os01g0836800006-021-C09TCCACGCCNONE 
006-091-F04TCCACGCCNONE 
014-013-D08TCCACGCCNONE 
015-018-F10TCCACGCCNONE 
015-058-H03TCCACGCCNONE 
AK061720TCCACGCCNONE 
AK066629TCCACGCCLung seven transmembrane receptor family protein. 
AK098958TCCACGCCNONE 
AK106145TCCACGCCNONE 
AK119783TCCACGCCNONE 
J013063N02TCCACGCCNONE 
J013071A10TCCACGCCNONE 
J013124C08TCCACGCCNONE 
J023055J07TCCACGCCNONE 
J023081H15TCCACGCCNONE 
J023082D01TCCACGCCNONE 
J023091F07TCCACGCCNONE 
J023091L13TCCACGCCNONE 
J023104G05TCCACGCCNONE 
J023110M16TCCACGCCNONE 
J023120F18TCCACGCCNONE 
J023128O11TCCACGCCNONE 
J023140B11TCCACGCCNONE 
J033023B15TCCACGCCNONE 
J033025E14TCCACGCCNONE 
J033027J21TCCACGCCNONE 
J033041F19TCCACGCCNONE 
J033044L10TCCACGCCNONE 
J033052M08TCCACGCCNONE 
J033084P07TCCACGCCNONE 
J033086P11TCCACGCCNONE 
J033090I20TCCACGCCNONE 
J033093D17TCCACGCCNONE 
J033099C04TCCACGCCNONE 
J033108M19TCCACGCCNONE 
J033124O20TCCACGCCNONE 
J033145D24TCCACGCCNONE 
J033145O09TCCACGCCNONE 
J043016F03TCCACGCCNONE 
J043037C06TCCACGCCNONE 
J053095L22TCCACGCCNONE 
J053100E09TCCACGCCNONE 
J065023G19TCCACGCCNONE 
J065197D03TCCACGCCNONE 
J090003E23TCCACGCCNONE 
J090012P18TCCACGCCNONE 
J090019E14TCCACGCCNONE 
J090021B01TCCACGCCNONE 
J090022J10TCCACGCCNONE 
J090045L06TCCACGCCNONE 
J090050J02TCCACGCCNONE 
J090065F15TCCACGCCNONE 
J100018A06TCCACGCCNONE 
J100022K07TCCACGCCNONE 
J100036H01TCCACGCCNONE 
J100044I09TCCACGCCNONE 
J100057M17TCCACGCCNONE 
J100058O04TCCACGCCNONE 
J100079C21TCCACGCCNONE 
J100079G13TCCACGCCNONE 
Os01g0844400AK070434TCCACGCCNONE 
AK071686TCCACGCCZinc finger, DHHC-type domain containing protein. 
J065037E10TCCACGCCNONE 
J065165F17TCCACGCCNONE 
Os01g0875000AK058560TCCACGCCConserved hypothetical protein. 
Os01g0916200AK101112TCCACGCCNONE 
Os01g0934000AK060679TCCACGCCNONE 
AK072525TCCACGCCWD40-like domain containing protein. 
J065097G12TCCACGCCNONE 
Os01g0942300AK063126TCCACGCCSimilar to Beta glucanase precursor (EC 3.2.1.73) (Fragment). 
Os01g0978000006-079-A03GGCGTGGANONE 
AK102326GGCGTGGANONE 
AK103874GGCGTGGASimilar to Uncoupling protein. 
J013060B17GGCGTGGANONE 
J033090K13GGCGTGGANONE 
J065062G06GGCGTGGANONE 
J065116K13GGCGTGGANONE 
J065118C23GGCGTGGANONE 
J090015A13GGCGTGGANONE 
J090061A15GGCGTGGANONE 
J090092B20GGCGTGGANONE 
J100053H02GGCGTGGANONE 
J100077L13GGCGTGGANONE 
Os02g0171700AK121438TCCACGCCConserved hypothetical protein. 
J023140H13TCCACGCCNONE 
Os02g0199300AK064726TCCACGCCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os02g0266800AK070674TCCACGCCNONE 
L34551TCCACGCCTranscriptional activator protein. 
Os02g0475300AK072737TCCACGCCNONE 
AK120516TCCACGCCMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0509500009-117-G07GGTCCACGCCNONE 
009-122-G08GGTCCACGCCNONE 
AK105187GGTCCACGCCConserved hypothetical protein. 
J065025C04GGTCCACGCCNONE 
J065030F10GGTCCACGCCNONE 
J065112P22GGTCCACGCCNONE 
J065116I22GGTCCACGCCNONE 
J065127F24GGTCCACGCCNONE 
J065176E11GGTCCACGCCNONE 
J065186F02GGTCCACGCCNONE 
J075041F12GGTCCACGCCNONE 
J075118L20GGTCCACGCCNONE 
J075181D20GGTCCACGCCNONE 
J090023P12GGTCCACGCCNONE 
Os02g0574800AK108451GGCGTGGAConserved hypothetical protein. 
Os02g0591700AK072777TCCACGCCSimilar to Candida glabrata strain CBS138 chromosome L complete sequence. 
J013096O06TCCACGCCNONE 
J023139B06TCCACGCCNONE 
J065114F05TCCACGCCNONE 
J090059C21TCCACGCCNONE 
Os02g0618250009-115-E10TCCACGCCNONE 
014-076-A03TCCACGCCNONE 
J065096D10TCCACGCCSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01TCCACGCCNONE 
J075092J11TCCACGCCNONE 
J075134F02TCCACGCCNONE 
Os02g0689700AK063776GGCGTGGARibosomal protein L18P/L5E family protein. 
AK063776TCCACGCCRibosomal protein L18P/L5E family protein. 
Os02g0707100AK065585TCCACGCCSimilar to Monodehydroascorbate reductase, seedling isozyme (EC 1.6.5.4) (MDAR seedling) (Ascorbate free radical reductase seedling) (AFR reductase seedling). 
J065065N03TCCACGCCNONE 
J065128G18TCCACGCCNONE 
Os02g0749800013-004-C10TTGTGGGCGTGGANONE 
016-002-A10TTGTGGGCGTGGANONE 
AK064731TTGTGGGCGTGGAMitochodrial transcription termination factor-related family protein. 
AK065868TTGTGGGCGTGGANONE 
J013043F09TTGTGGGCGTGGANONE 
J065005K17TTGTGGGCGTGGANONE 
Os02g0755200AK070699GTGGCGTGGASimilar to FLOWERING LOCUS D (Fragment). 
J023056I20GTGGCGTGGANONE 
J065048B13GTGGCGTGGANONE 
J065128H21GTGGCGTGGANONE 
J065201E09GTGGCGTGGANONE 
Os02g0771100AB040053TCCACGCCCACACNONE 
AK102740TCCACGCCCACACSimilar to COP1 (Fragment). 
AK111614TCCACGCCCACACNONE 
AK112098TCCACGCCCACACNONE 
J033106E23TCCACGCCCACACNONE 
Os02g0773300AK071811TCCACGCCPyridoxal phosphate-dependent deaminase family protein. 
J013056D10TCCACGCCNONE 
J013096G18TCCACGCCNONE 
Os02g0816700009-132-E07TCCACGCCNONE 
AK059572TCCACGCCConserved hypothetical protein. 
Os02g0816800013-089-A09TCCACGCCNONE 
AK102271TCCACGCCNAD-dependent epimerase/dehydratase family protein. 
J013105O04TCCACGCCNONE 
J013124I08TCCACGCCNONE 
J023002E08TCCACGCCNONE 
J023025C01TCCACGCCNONE 
J023037O12TCCACGCCNONE 
J023049N06TCCACGCCNONE 
J023069G18TCCACGCCNONE 
J033029M02TCCACGCCNONE 
J033037L22TCCACGCCNONE 
J033089A08TCCACGCCNONE 
J033103L07TCCACGCCNONE 
J033125L19TCCACGCCNONE 
J090008N20TCCACGCCNONE 
J090041F23TCCACGCCNONE 
J090092H16TCCACGCCNONE 
Os03g0106400AK108687GGCGTGGASimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os03g0119500AK060258GTGGCGTGGANONE 
Os03g0119700011-050-F05GTGGCGTGGANONE 
AK105249GTGGCGTGGANONE 
AK119410GTGGCGTGGATetratricopeptide-like helical domain containing protein. 
Os03g0126900AK109217GGCGTGGAConserved hypothetical protein. 
J065085G16GGCGTGGANONE 
J100086C03GGCGTGGANONE 
Os03g0129300AK067755TCCACGCCACSimilar to Glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.13) (Fragment). 
J013118G18TCCACGCCACNONE 
J065024E09TCCACGCCACNONE 
J065024I09TCCACGCCACNONE 
J065038L15TCCACGCCACNONE 
J065040E10TCCACGCCACNONE 
J065042C14TCCACGCCACNONE 
J065053F19TCCACGCCACNONE 
J065061D05TCCACGCCACNONE 
J065063H01TCCACGCCACNONE 
J065064D11TCCACGCCACNONE 
J065085I03TCCACGCCACNONE 
J065091A13TCCACGCCACNONE 
J065091O11TCCACGCCACNONE 
J065099G22TCCACGCCACNONE 
J065100E18TCCACGCCACNONE 
J065107B13TCCACGCCACNONE 
J065120A19TCCACGCCACNONE 
J065158E01TCCACGCCACNONE 
J065165D07TCCACGCCACNONE 
J065166K03TCCACGCCACNONE 
J065166P18TCCACGCCACNONE 
J065171K03TCCACGCCACNONE 
J065184H11TCCACGCCACNONE 
J065187H22TCCACGCCACNONE 
J065196N06TCCACGCCACNONE 
J065196P13TCCACGCCACNONE 
J065196P19TCCACGCCACNONE 
J065202P20TCCACGCCACNONE 
J065205L15TCCACGCCACNONE 
J075015H23TCCACGCCACNONE 
J075039I11TCCACGCCACNONE 
J075043L15TCCACGCCACNONE 
J075045C15TCCACGCCACNONE 
J075052F12TCCACGCCACNONE 
J075053J17TCCACGCCACNONE 
J075060L14TCCACGCCACNONE 
J075073G04TCCACGCCACNONE 
J075084H08TCCACGCCACNONE 
J075085O17TCCACGCCACNONE 
J075092E21TCCACGCCACNONE 
J075095M06TCCACGCCACNONE 
J075097H17TCCACGCCACNONE 
J075101I16TCCACGCCACNONE 
J075104B08TCCACGCCACNONE 
J075111K02TCCACGCCACNONE 
J075114M07TCCACGCCACNONE 
J075119G16TCCACGCCACNONE 
J075119M06TCCACGCCACNONE 
J075120B16TCCACGCCACNONE 
J075134K15TCCACGCCACNONE 
J075136M07TCCACGCCACNONE 
J075138L21TCCACGCCACNONE 
J075139H24TCCACGCCACNONE 
J075157C11TCCACGCCACNONE 
J075159H15TCCACGCCACNONE 
J075159N11TCCACGCCACNONE 
J075177F01TCCACGCCACNONE 
J075198H03TCCACGCCACNONE 
J090071B14TCCACGCCACNONE 
Os03g0130400AK070255GGTCCACGCCTCAdenylate kinase, subfamily protein. 
Os03g0151500AK109181TCCACGCCConserved hypothetical protein. 
Os03g0175200J090059M15GGCGTGGANONE 
Os03g0210600AK070125TCCACGCCConserved hypothetical protein. 
Os03g0222100AK070688TCCACGCCSimilar to Topoisomerase-like protein. 
J023057E15TCCACGCCNONE 
J023099M24TCCACGCCNONE 
J023147F14TCCACGCCNONE 
Os03g0225200AK065907TCCACGCCTCNONE 
AK074008TCCACGCCTCCyclin-like domain containing protein. 
J013044F04TCCACGCCTCNONE 
J090071F03TCCACGCCTCNONE 
Os03g0227800J013091I04GGCGTGGANONE 
J080305J16GGCGTGGANONE 
Os03g0255900009-164-C12GGCGTGGAGATGGGCNONE 
AK063057GGCGTGGAGATGGGCConserved hypothetical protein. 
Os03g0284000Os03g0284000GGCGTGGAConserved hypothetical protein. 
Os03g0298600009-095-C02TCCACGCCACCAACNONE 
AK066846TCCACGCCACCAACTetratricopeptide-like helical domain containing protein. 
Os03g0301200AK119578TCCACGCCNONE 
J013027D03TCCACGCCNONE 
J075035F14TCCACGCCNONE 
J090075I19TCCACGCCNONE 
J090081E22TCCACGCCNONE 
J100035I20TCCACGCCNONE 
J100051E18TCCACGCCNONE 
J100053H11TCCACGCCNONE 
J100081P07TCCACGCCNONE 
Os03g0302900011-005-H01TCCACGCCACNONE 
AK069222TCCACGCCACConserved hypothetical protein. 
J023014L15TCCACGCCACNONE 
J033023G12TCCACGCCACNONE 
J090008H16TCCACGCCACNONE 
Os03g0319300006-021-E05GAGGCGTGGANONE 
006-022-H12GAGGCGTGGANONE 
009-187-E02GAGGCGTGGANONE 
AF042840GAGGCGTGGANONE 
AK059756GAGGCGTGGACalmodulin (CaM). 
AK070090GAGGCGTGGANONE 
J065017J02GAGGCGTGGANONE 
J065028G17GAGGCGTGGANONE 
J065045N09GAGGCGTGGANONE 
J065078F21GAGGCGTGGANONE 
J065091H01GAGGCGTGGANONE 
J065112B19GAGGCGTGGANONE 
J065186E08GAGGCGTGGANONE 
J065199G12GAGGCGTGGANONE 
J075030K07GAGGCGTGGANONE 
J075050B02GAGGCGTGGANONE 
J075057G07GAGGCGTGGANONE 
J075070F01GAGGCGTGGANONE 
J075093N12GAGGCGTGGANONE 
J075095K13GAGGCGTGGANONE 
J075102D14GAGGCGTGGANONE 
J075103B17GAGGCGTGGANONE 
J075114K05GAGGCGTGGANONE 
J075142F18GAGGCGTGGANONE 
J075154L11GAGGCGTGGANONE 
J075185F08GAGGCGTGGANONE 
J090012A14GAGGCGTGGANONE 
J090044L10GAGGCGTGGANONE 
J100044C12GAGGCGTGGANONE 
J100088J19GAGGCGTGGANONE 
Os03g0321900AK073317TCCACGCCTCCMP/dCMP deaminase, zinc-binding domain containing protein. 
Os03g0343900009-077-C03TCCACGCCACGTGGCNONE 
AK105813TCCACGCCACGTGGCPhotosystem II protein PsbX family protein. 
J100059N03TCCACGCCACGTGGCNONE 
J100079C20TCCACGCCACGTGGCNONE 
Os03g0353300AK111467GGCGTGGAConserved hypothetical protein. 
Os03g0364400AK066529GTGGCGTGGASimilar to Phytosulfokine receptor-like protein. 
AK071963GTGGCGTGGANONE 
J013073L01GTGGCGTGGANONE 
J100037H12GTGGCGTGGANONE 
Os03g0374400016-027-B12TCCACGCCCCCGCGNONE 
AK069719TCCACGCCCCCGCGConserved hypothetical protein. 
J023020L05TCCACGCCCCCGCGNONE 
J023026H16TCCACGCCCCCGCGNONE 
J033025P22TCCACGCCCCCGCGNONE 
J075016I21TCCACGCCCCCGCGNONE 
J090015G21TCCACGCCCCCGCGNONE 
Os03g0374500Os03g0374500TCCACGCCCCCGCGHypothetical protein. 
Os03g0563100AK109527GGCGTGGAPlant-specific FAD-dependent oxidoreductase family protein. 
Os03g0578300014-071-F09TCCACGCCNONE 
J065098N06TCCACGCCNONE 
J065129D09TCCACGCCNONE 
J075018K16TCCACGCCNONE 
J075106D12TCCACGCCNONE 
J075106D18TCCACGCCNONE 
J075139J02TCCACGCCNONE 
J075170G09TCCACGCCNONE 
J080317I24TCCACGCCNONE 
J080319E11TCCACGCCNONE 
Os03g0583800AK064786TCCACGCCMpv17/PMP22 family protein. 
AK099233TCCACGCCNONE 
J013000B17TCCACGCCNONE 
J013071N13TCCACGCCNONE 
J013095M11TCCACGCCNONE 
J080068F05TCCACGCCNONE 
J080069C02TCCACGCCNONE 
J080072E22TCCACGCCNONE 
J100052H10TCCACGCCNONE 
J100053H09TCCACGCCNONE 
J100056G03TCCACGCCNONE 
Os03g0637600006-046-H01GGCGTGGANONE 
AK061561GGCGTGGANONE 
Os03g0701200006-042-B09TCCACGCCTCNONE 
006-097-E12TCCACGCCTCNONE 
AK061528TCCACGCCTCNONE 
AK061982TCCACGCCTCNONE 
AK099563TCCACGCCTCSimilar to Sugar-starvation induced protein (Fragment). 
J065034C24TCCACGCCTCNONE 
J075007L05TCCACGCCTCNONE 
J075104M20TCCACGCCTCNONE 
J075127H03TCCACGCCTCNONE 
Os03g0729600009-092-C12CGACACGTCCACGCCTCNONE 
009-156-H03CGACACGTCCACGCCTCNONE 
AK062697CGACACGTCCACGCCTCNONE 
AK063169CGACACGTCCACGCCTCConserved hypothetical protein. 
Os03g0739700003-104-A04TCCACGCCNONE 
AK062272TCCACGCCUncharacterized protein UPF0114 family protein. 
Os03g0758500016-015-D02TCCACGCCNONE 
AK059403TCCACGCCNONE 
AK102002TCCACGCCPlastocyanin-like domain containing protein. 
J033079N03TCCACGCCNONE 
J065012M05TCCACGCCNONE 
J065045H19TCCACGCCNONE 
J065050J08TCCACGCCNONE 
J075189D02TCCACGCCNONE 
J090018L03TCCACGCCNONE 
J100043O22TCCACGCCNONE 
J100088G17TCCACGCCNONE 
Os03g0776400015-009-D03GGCGTGGANONE 
AK106237GGCGTGGAConserved hypothetical protein. 
J100024C12GGCGTGGANONE 
J100083J23GGCGTGGANONE 
Os03g0786700AK067936TCCACGCCACN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os04g0103601J100031J08GGCGTGGAHypothetical protein. 
Os04g0405600015-003-G04GAGGCGTGGANONE 
AK068579GAGGCGTGGAProtein of unknown function DUF1350 family protein. 
AK101565GAGGCGTGGANONE 
J013023M11GAGGCGTGGANONE 
J013055A13GAGGCGTGGANONE 
J013157C11GAGGCGTGGANONE 
J033128I12GAGGCGTGGANONE 
J065193N19GAGGCGTGGANONE 
J090055C15GAGGCGTGGANONE 
J090058C22GAGGCGTGGANONE 
J090077L18GAGGCGTGGANONE 
J090086C04GAGGCGTGGANONE 
J090095D03GAGGCGTGGANONE 
J100040K04GAGGCGTGGANONE 
J100040M11GAGGCGTGGANONE 
Os04g0430600009-014-G12TCCACGCCNONE 
015-019-A08TCCACGCCNONE 
015-048-C08TCCACGCCNONE 
015-085-E11TCCACGCCNONE 
AK072050TCCACGCCNONE 
AK106337TCCACGCCConserved hypothetical protein. 
J065037C09TCCACGCCNONE 
J075125G18TCCACGCCNONE 
Os04g0438400AK067975TCCACGCCSimilar to Pectin methylesterase-like protein. 
Os04g0458900AK121454TCCACGCCSimilar to Pectin methylesterase-like protein. 
J023001D17TCCACGCCNONE 
J023042F14TCCACGCCNONE 
J023142P03TCCACGCCNONE 
Os04g0490000AK108365TCCACGCCTCCCACTCCSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0493000J013052L03TCCACGCCNONE 
J080308E10TCCACGCCNONE 
Os04g0502800AK099877GGCGTGGASimilar to Nodulin-like protein. 
J090040C16GGCGTGGANONE 
Os04g0566300009-017-D06ACGCGTCCACGCCACNONE 
AK062357ACGCGTCCACGCCACHypothetical protein. 
Os04g0567200AK110383TCCACGCCProtein of unknown function UPF0005 family protein. 
Os04g0636600AK073550GGCGTGGAConserved hypothetical protein. 
AK111077GGCGTGGANONE 
J033044F09GGCGTGGANONE 
J033091D12GGCGTGGANONE 
J043034F06GGCGTGGANONE 
J090017C08GGCGTGGANONE 
J090027K09GGCGTGGANONE 
J090033A12GGCGTGGANONE 
Os04g0636900009-009-D04TCCACGCCTCNONE 
009-010-G07TCCACGCCTCNONE 
009-048-H10TCCACGCCTCNONE 
013-066-B10TCCACGCCTCNONE 
014-093-G08TCCACGCCTCNONE 
015-025-C07TCCACGCCTCNONE 
J013058C15TCCACGCCTCNONE 
J013058E15TCCACGCCTCNONE 
J013072N16TCCACGCCTCNONE 
J013102O16TCCACGCCTCNONE 
J090069E22TCCACGCCTCNONE 
J100030G19TCCACGCCTCNONE 
J100050F15TCCACGCCTCNONE 
J100050L20TCCACGCCTCNONE 
J100054F18TCCACGCCTCNONE 
J100083P05TCCACGCCTCNONE 
Os04g0647800AK065350TCCACGCCCACCTSimilar to Glycerol kinase 2 (EC 2.7.1.30). 
AK069876TCCACGCCCACCTNONE 
AK104069TCCACGCCCACCTNONE 
Os04g0674000006-093-C01GAGGCGTGGANONE 
009-040-F06GAGGCGTGGANONE 
AK071276GAGGCGTGGANONE 
AK109377GAGGCGTGGAConserved hypothetical protein. 
AK119671GAGGCGTGGANONE 
J023084J11GAGGCGTGGANONE 
J023088F18GAGGCGTGGANONE 
J065099M12GAGGCGTGGANONE 
J065136J08GAGGCGTGGANONE 
J065167H22GAGGCGTGGANONE 
J075046L21GAGGCGTGGANONE 
J080029F17GAGGCGTGGANONE 
J080053C16GAGGCGTGGANONE 
J080053E24GAGGCGTGGANONE 
J080074D14GAGGCGTGGANONE 
J100029C12GAGGCGTGGANONE 
J100030D01GAGGCGTGGANONE 
J100044E16GAGGCGTGGANONE 
J100065N18GAGGCGTGGANONE 
J100077D18GAGGCGTGGANONE 
J100090P13GAGGCGTGGANONE 
Os04g0678200006-037-E05TCCACGCCNONE 
006-059-G04TCCACGCCNONE 
006-097-A11TCCACGCCNONE 
006-098-D11TCCACGCCNONE 
009-154-H11TCCACGCCNONE 
AK106193TCCACGCCProtein of unknown function DUF1218 family protein. 
J013064K07TCCACGCCNONE 
Os04g0681500AK105582GGCGTGGAEF-Hand type domain containing protein. 
Os05g0115100015-002-G01TCCACGCCNONE 
016-075-D04TCCACGCCNONE 
AK106226TCCACGCCProtein of unknown function DUF1635 family protein. 
AK110672TCCACGCCNONE 
J075034O20TCCACGCCNONE 
Os05g0295800AK070232TCCACGCCSimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03TCCACGCCNONE 
Os05g0301700006-021-F06GGCGTGGANONE 
006-092-B10GGCGTGGANONE 
006-097-A07GGCGTGGANONE 
006-103-F05GGCGTGGANONE 
006-117-B11GGCGTGGANONE 
016-010-A05GGCGTGGANONE 
J013056H13GGCGTGGANONE 
J013071O15GGCGTGGANONE 
J013091J17GGCGTGGANONE 
J013123L19GGCGTGGANONE 
J023012P18GGCGTGGANONE 
J023023M10GGCGTGGANONE 
J023028M19GGCGTGGANONE 
J023049J21GGCGTGGANONE 
J023055K06GGCGTGGANONE 
J023061F14GGCGTGGANONE 
J023066H16GGCGTGGANONE 
J023066J16GGCGTGGANONE 
J023082F16GGCGTGGANONE 
J023148A07GGCGTGGANONE 
J033046H23GGCGTGGANONE 
J033046L14GGCGTGGANONE 
J033124E20GGCGTGGANONE 
J033148D22GGCGTGGANONE 
J043021L21GGCGTGGANONE 
J053025A21GGCGTGGANONE 
J053032M02GGCGTGGANONE 
J053043C24GGCGTGGANONE 
J053057K17GGCGTGGANONE 
J053070B11GGCGTGGANONE 
J053077A02GGCGTGGANONE 
J065034K12GGCGTGGANONE 
J065075C09GGCGTGGANONE 
J065076P14GGCGTGGANONE 
J065127C06GGCGTGGANONE 
J065160K05GGCGTGGANONE 
J065191F21GGCGTGGANONE 
J090004E08GGCGTGGANONE 
J090053A12GGCGTGGANONE 
J090066E17GGCGTGGANONE 
J090097H02GGCGTGGANONE 
J100048P14GGCGTGGANONE 
J100051P09GGCGTGGANONE 
J100061L15GGCGTGGANONE 
J100062G09GGCGTGGANONE 
J100074F03GGCGTGGANONE 
Os05g0304800J075017I10GGCGTGGANONE 
J075019B14GGCGTGGANONE 
J075035K19GGCGTGGANONE 
J075048L17GGCGTGGAHistone-fold domain containing protein. 
J075067A14GGCGTGGANONE 
J075110J22GGCGTGGANONE 
J075149P12GGCGTGGANONE 
Os05g0306000AK071384TCCACGCCACemp24/gp25L/p24 family protein. 
Os05g0429000AK109617TCCACGCCCACACSimilar to Hydroxymethyltransferase. 
Os05g0430200J090095K16TCCACGCCNONE 
Os05g0437500AK102974TCCACGCCYip1 domain containing protein. 
Os05g0455600AK060152TCCACGCCTCPrenylated rab acceptor PRA1 family protein. 
AK103269TCCACGCCTCNONE 
AK105995TCCACGCCTCNONE 
J023109E13TCCACGCCTCNONE 
J023120K13TCCACGCCTCNONE 
J033124H03TCCACGCCTCNONE 
Os05g0519800AK069435GGCGTGGAProtein of unknown function DUF28 family protein. 
J023024L22GGCGTGGANONE 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
J023057L12TCTCGGCCCACGGCGTGGANONE 
Os05g0539400AK068572CGCCACGTCACTCCACGCCGlycoside hydrolase, family 35 protein. 
J013063P08CGCCACGTCACTCCACGCCNONE 
J013110N24CGCCACGTCACTCCACGCCNONE 
J013156K22CGCCACGTCACTCCACGCCNONE 
J043038A08CGCCACGTCACTCCACGCCNONE 
J090004K18CGCCACGTCACTCCACGCCNONE 
J090085F03CGCCACGTCACTCCACGCCNONE 
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CGCGTCGCCACGTGTCCACGCCNONE 
AK104323CGCGTCGCCACGTGTCCACGCCNONE 
Os06g0147000AK120978GGCGTGGAConserved hypothetical protein. 
J023041N20GGCGTGGANONE 
Os06g0168600AK068858TCCACGCCSimilar to Ribonucleotide reductase. 
Os06g0199300J065045H01TCCACGCCNONE 
J075177C22TCCACGCCNONE 
J080068H06TCCACGCCNONE 
J090048F01TCCACGCCNONE 
J100066F17TCCACGCCNONE 
Os06g0211200011-063-B02TCCACGCCNONE 
AK103188TCCACGCCSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 1) (AREB1). 
AK105312TCCACGCCNONE 
J065214N03TCCACGCCNONE 
J090046C13TCCACGCCNONE 
J090049L03TCCACGCCNONE 
J100074P03TCCACGCCNONE 
Os06g0232000006-109-B11TCCACGCCNONE 
011-080-C04TCCACGCCNONE 
016-019-G01TCCACGCCNONE 
AB110192TCCACGCCNONE 
AK068966TCCACGCCNONE 
AK071776TCCACGCCConserved hypothetical protein. 
AK106053TCCACGCCNONE 
J013146K14TCCACGCCNONE 
J023013A10TCCACGCCNONE 
J023029O20TCCACGCCNONE 
J023110G05TCCACGCCNONE 
J023135H04TCCACGCCNONE 
J033125H14TCCACGCCNONE 
J043009N01TCCACGCCNONE 
J090096E06TCCACGCCNONE 
J100070G19TCCACGCCNONE 
Os06g0248600AK111144TCCACGCCConserved hypothetical protein. 
Os06g0285400AK105829GGCGTGGANONE 
Os06g0286228AK069113TCCACGCCTCCupredoxin domain containing protein. 
Os06g0337100006-100-G05GGTCCACGCCGTTGGNONE 
AK061222GGTCCACGCCGTTGGConserved hypothetical protein. 
Os06g0542600J075111K18GGCGTGGAProtein of unknown function DUF295 family protein. 
Os06g0648500AK106895TCCACGCCACConserved hypothetical protein. 
Os06g0704700AK120907CGCCACGTCCACGCCTCNmrA-like family protein. 
AY224493CGCCACGTCCACGCCTCNONE 
Os06g0726100006-116-E04TCCACGCCTCNONE 
009-099-B08TCCACGCCTCNONE 
009-181-F01TCCACGCCTCNONE 
009-187-H08TCCACGCCTCNONE 
AK061280TCCACGCCTCSimilar to Seed chitinase-c. 
Z29962TCCACGCCTCNONE 
Os07g0180900006-055-B11TCCACGCCNONE 
006-103-F09TCCACGCCNONE 
011-009-E03TCCACGCCNONE 
011-035-H08TCCACGCCNONE 
014-043-F08TCCACGCCNONE 
AK060711TCCACGCCRibosomal protein L4/L1e family protein. 
AK060963TCCACGCCNONE 
AK104447TCCACGCCNONE 
AK104504TCCACGCCNONE 
AK104629TCCACGCCNONE 
J023003P15TCCACGCCNONE 
J023075H14TCCACGCCNONE 
J033101N17TCCACGCCNONE 
J033132M11TCCACGCCNONE 
J065081C24TCCACGCCNONE 
J080004L10TCCACGCCNONE 
J080009H21TCCACGCCNONE 
J080013F01TCCACGCCNONE 
J080022K24TCCACGCCNONE 
J080023C22TCCACGCCNONE 
J080024M16TCCACGCCNONE 
J080026K06TCCACGCCNONE 
J080030J23TCCACGCCNONE 
J080030L05TCCACGCCNONE 
J080031G03TCCACGCCNONE 
J080033C03TCCACGCCNONE 
J080033D02TCCACGCCNONE 
J080035A11TCCACGCCNONE 
J080035A14TCCACGCCNONE 
J080039E08TCCACGCCNONE 
J080040L15TCCACGCCNONE 
J080040M03TCCACGCCNONE 
J080041L21TCCACGCCNONE 
J080043E09TCCACGCCNONE 
J080048B14TCCACGCCNONE 
J080048O09TCCACGCCNONE 
J080051H01TCCACGCCNONE 
J080052H06TCCACGCCNONE 
J080065K05TCCACGCCNONE 
J080066D10TCCACGCCNONE 
J080066E23TCCACGCCNONE 
J080069F10TCCACGCCNONE 
J080074M06TCCACGCCNONE 
J080075D13TCCACGCCNONE 
J080076G02TCCACGCCNONE 
J080082G15TCCACGCCNONE 
J080082K06TCCACGCCNONE 
J080082P12TCCACGCCNONE 
J080085F01TCCACGCCNONE 
J080090H22TCCACGCCNONE 
J080092D07TCCACGCCNONE 
J080094M03TCCACGCCNONE 
J080094O10TCCACGCCNONE 
J090008I06TCCACGCCNONE 
J100058N20TCCACGCCNONE 
J100060M07TCCACGCCNONE 
J100062M08TCCACGCCNONE 
J100064L07TCCACGCCNONE 
J100073H16TCCACGCCNONE 
J100074C10TCCACGCCNONE 
J100075N06TCCACGCCNONE 
J100087P11TCCACGCCNONE 
J100088B13TCCACGCCNONE 
J100088J16TCCACGCCNONE 
J100088L17TCCACGCCNONE 
J100088O12TCCACGCCNONE 
Os07g0190900012-063-F11GGCGTGGANONE 
AK073533GGCGTGGASMAD/FHA domain containing protein. 
J013110O09GGCGTGGANONE 
J033041I12GGCGTGGANONE 
J033046D05GGCGTGGANONE 
J033101K24GGCGTGGANONE 
J090009F10GGCGTGGANONE 
J090095B17GGCGTGGANONE 
Os07g0214300AK107328GGCGTGGASeed allergenic protein RAG2 precursor. 
D11432GGCGTGGANONE 
D42139GGCGTGGANONE 
D42140GGCGTGGANONE 
D43657GGCGTGGANONE 
D43659GGCGTGGANONE 
J065067N22GGCGTGGANONE 
J075001F02GGCGTGGANONE 
J075001F03GGCGTGGANONE 
J075001K10GGCGTGGANONE 
J075001N06GGCGTGGANONE 
J075003C19GGCGTGGANONE 
J075003C24GGCGTGGANONE 
J075003J10GGCGTGGANONE 
J075004B12GGCGTGGANONE 
J075004K23GGCGTGGANONE 
J075005G17GGCGTGGANONE 
J075006G20GGCGTGGANONE 
J075007E23GGCGTGGANONE 
J075007F23GGCGTGGANONE 
J075010P10GGCGTGGANONE 
J075013F16GGCGTGGANONE 
J075017H12GGCGTGGANONE 
J075019O13GGCGTGGANONE 
J075020G23GGCGTGGANONE 
J075021G15GGCGTGGANONE 
J075021H18GGCGTGGANONE 
J075021N23GGCGTGGANONE 
J075025B03GGCGTGGANONE 
J075028E10GGCGTGGANONE 
J075028L03GGCGTGGANONE 
J075029D23GGCGTGGANONE 
J075029J09GGCGTGGANONE 
J075030K21GGCGTGGANONE 
J075031K19GGCGTGGANONE 
J075032F16GGCGTGGANONE 
J075033G23GGCGTGGANONE 
J075033O22GGCGTGGANONE 
J075035J03GGCGTGGANONE 
J075039F14GGCGTGGANONE 
J075039M23GGCGTGGANONE 
J075040G14GGCGTGGANONE 
J075042B13GGCGTGGANONE 
J075044N03GGCGTGGANONE 
J075046G15GGCGTGGANONE 
J075050D15GGCGTGGANONE 
J075050F23GGCGTGGANONE 
J075050J08GGCGTGGANONE 
J075052G19GGCGTGGANONE 
J075053G08GGCGTGGANONE 
J075053M18GGCGTGGANONE 
J075055F01GGCGTGGANONE 
J075058D20GGCGTGGANONE 
J075060K20GGCGTGGANONE 
J075067P06GGCGTGGANONE 
J075070K22GGCGTGGANONE 
J075071E21GGCGTGGANONE 
J075073D13GGCGTGGANONE 
J075075B12GGCGTGGANONE 
J075078D07GGCGTGGANONE 
J075079C13GGCGTGGANONE 
J075080B08GGCGTGGANONE 
J075080G23GGCGTGGANONE 
J075080L15GGCGTGGANONE 
J075083G24GGCGTGGANONE 
J075083L01GGCGTGGANONE 
J075084O06GGCGTGGANONE 
J075085K07GGCGTGGANONE 
J075088F06GGCGTGGANONE 
J075089D03GGCGTGGANONE 
J075089F23GGCGTGGANONE 
J075089G03GGCGTGGANONE 
J075090A17GGCGTGGANONE 
J075091N19GGCGTGGANONE 
J075091O21GGCGTGGANONE 
J075093H12GGCGTGGANONE 
J075096H23GGCGTGGANONE 
J075096K21GGCGTGGANONE 
J075096P07GGCGTGGANONE 
J075098F24GGCGTGGANONE 
J075099B01GGCGTGGANONE 
J075104L24GGCGTGGANONE 
J075105E22GGCGTGGANONE 
J075106H15GGCGTGGANONE 
J075108G12GGCGTGGANONE 
J075108K15GGCGTGGANONE 
J075115G04GGCGTGGANONE 
J075118J01GGCGTGGANONE 
J075119D14GGCGTGGANONE 
J075119G15GGCGTGGANONE 
J075120K02GGCGTGGANONE 
J075121J04GGCGTGGANONE 
J075122A19GGCGTGGANONE 
J075122N11GGCGTGGANONE 
J075123M09GGCGTGGANONE 
J075127M18GGCGTGGANONE 
J075129C12GGCGTGGANONE 
J075130M01GGCGTGGANONE 
J075134O08GGCGTGGANONE 
J075135C11GGCGTGGANONE 
J075135D24GGCGTGGANONE 
J075140K20GGCGTGGANONE 
J075142B08GGCGTGGANONE 
J075147H09GGCGTGGANONE 
J075148P05GGCGTGGANONE 
J075149E14GGCGTGGANONE 
J075149J18GGCGTGGANONE 
J075150E12GGCGTGGANONE 
J075151F14GGCGTGGANONE 
J075152H11GGCGTGGANONE 
J075154H06GGCGTGGANONE 
J075161A14GGCGTGGANONE 
J075162G13GGCGTGGANONE 
J075166E07GGCGTGGANONE 
J075166F06GGCGTGGANONE 
J075169P20GGCGTGGANONE 
J075170M14GGCGTGGANONE 
J075172J02GGCGTGGANONE 
J075172L24GGCGTGGANONE 
J075176K04GGCGTGGANONE 
J075176L10GGCGTGGANONE 
J075177I19GGCGTGGANONE 
J075177L24GGCGTGGANONE 
J075177O18GGCGTGGANONE 
J075179L10GGCGTGGANONE 
J075185C01GGCGTGGANONE 
J075185L14GGCGTGGANONE 
J075186D02GGCGTGGANONE 
J075188J05GGCGTGGANONE 
J075188P08GGCGTGGANONE 
J075190G17GGCGTGGANONE 
J075191C22GGCGTGGANONE 
J075192J02GGCGTGGANONE 
J075194G13GGCGTGGANONE 
J075194J04GGCGTGGANONE 
J075194M12GGCGTGGANONE 
J075198L01GGCGTGGANONE 
J075199E19GGCGTGGANONE 
J075199G17GGCGTGGANONE 
J075199L04GGCGTGGANONE 
X62091GGCGTGGANONE 
Os07g0227700AK120258GGCGTGGAConserved hypothetical protein. 
J090030H24GGCGTGGANONE 
Os07g0407350J065005B03TCCACGCCNONE 
J065058G23TCCACGCCNONE 
J065144A11TCCACGCCNONE 
J065175J02TCCACGCCConserved hypothetical protein. 
Os07g0416100AK063097TCCACGCCSimilar to WRKY transcription factor 53 (Transcription factor WRKY12). 
Os07g0419500J065210A06TCCACGCCNONE 
Os07g0483400AK108064GGCGTGGACCConserved hypothetical protein. 
Os07g0572800AK060818GTGGCGTGGANONE 
Os07g0602000AK071832GGGCCGTTTCCACGCCACSimilar to NADPH HC toxin reductase (Fragment). 
J023121D11GGGCCGTTTCCACGCCACNONE 
J023138E01GGGCCGTTTCCACGCCACNONE 
J023149O13GGGCCGTTTCCACGCCACNONE 
J090074M19GGGCCGTTTCCACGCCACNONE 
Os07g0605200AF091458TCCACGCCNONE 
AF139665TCCACGCCNONE 
AJ011675TCCACGCCNONE 
AK064704TCCACGCCMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15TCCACGCCNONE 
J090034M06TCCACGCCNONE 
J090079L24TCCACGCCNONE 
Os07g0607800012-042-C02CCAGCCCACCACGCCTCCACGCCNONE 
015-097-B06CCAGCCCACCACGCCTCCACGCCNONE 
AK069010CCAGCCCACCACGCCTCCACGCCNONE 
J013170I18CCAGCCCACCACGCCTCCACGCCNONE 
J090036G23CCAGCCCACCACGCCTCCACGCCNONE 
Os07g0620200AK099859TCCACGCCACHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04TCCACGCCACNONE 
Os07g0627100AK119510TCCACGCCConserved hypothetical protein. 
Os07g0645400009-125-B12GGCGTGGANONE 
015-038-A09GGCGTGGANONE 
AK119179GGCGTGGANONE 
Os07g0658400AK120896TCCACGCCNONE 
Os08g0139100006-027-E12TCCACGCCNONE 
006-089-E06TCCACGCCNONE 
006-113-G02TCCACGCCNONE 
AK061429TCCACGCCNONE 
AK099590TCCACGCCSimilar to DAG protein, chloroplast precursor. 
AK104727TCCACGCCNONE 
J013043H11TCCACGCCNONE 
J013049N13TCCACGCCNONE 
J065079F01TCCACGCCNONE 
J065122N24TCCACGCCNONE 
J065142J24TCCACGCCNONE 
J065193N03TCCACGCCNONE 
J075041I21TCCACGCCNONE 
J075145E04TCCACGCCNONE 
Os08g0236900AK109597GAGGCGTGGACTGGGCCTGConserved hypothetical protein. 
Os08g0260600AK108529TCCACGCCCACACGCCACACGCD9/CD37/CD63 antigen family protein. 
Os08g0387500AK105106TCCACGCCGCCCACAASimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0409500AK109792TCCACGCCVQ domain containing protein. 
Os08g0412500009-054-G03GGCGTGGANONE 
AK062505GGCGTGGAProtein of unknown function UPF0041 family protein. 
Os08g0440300006-085-D10GGCGTGGANONE 
AK103781GGCGTGGANONE 
AK105990GGCGTGGANONE 
AK107167GGCGTGGARibonuclease CAF1 family protein. 
AK109485GGCGTGGANONE 
J033095E19GGCGTGGANONE 
J033121K05GGCGTGGANONE 
J033145G16GGCGTGGANONE 
J043034L01GGCGTGGANONE 
J065054G24GGCGTGGANONE 
J065060B07GGCGTGGANONE 
J065064D22GGCGTGGANONE 
J065073J12GGCGTGGANONE 
J065077P15GGCGTGGANONE 
J065124B09GGCGTGGANONE 
J065152A04GGCGTGGANONE 
J065162I04GGCGTGGANONE 
J065166C02GGCGTGGANONE 
J065169J21GGCGTGGANONE 
J065187P06GGCGTGGANONE 
J065205F09GGCGTGGANONE 
J075080G09GGCGTGGANONE 
J075089L19GGCGTGGANONE 
J075105M16GGCGTGGANONE 
J075111J15GGCGTGGANONE 
J075134C19GGCGTGGANONE 
J075144D19GGCGTGGANONE 
J075162A11GGCGTGGANONE 
J075170B12GGCGTGGANONE 
J080311L13GGCGTGGANONE 
J090013I15GGCGTGGANONE 
J090062J23GGCGTGGANONE 
J100034P16GGCGTGGANONE 
J100036E21GGCGTGGANONE 
J100065A10GGCGTGGANONE 
Os08g0440500AK058761TCCACGCCCACGGMIR domain containing protein. 
Os08g0459300AK060409TCCACGCCAACGGCConserved hypothetical protein. 
AK101386TCCACGCCAACGGCNONE 
J033034E20TCCACGCCAACGGCNONE 
J033036F14TCCACGCCAACGGCNONE 
J065047G22TCCACGCCAACGGCNONE 
J065173C14TCCACGCCAACGGCNONE 
J065188O22TCCACGCCAACGGCNONE 
J065189C17TCCACGCCAACGGCNONE 
J065197I16TCCACGCCAACGGCNONE 
J065202E05TCCACGCCAACGGCNONE 
J075022D03TCCACGCCAACGGCNONE 
J075023K21TCCACGCCAACGGCNONE 
J075096D12TCCACGCCAACGGCNONE 
J075129K24TCCACGCCAACGGCNONE 
Os08g0473900012-010-C04TCCACGCCNONE 
012-025-A10TCCACGCCNONE 
012-025-C03TCCACGCCNONE 
012-030-H02TCCACGCCNONE 
012-033-A03TCCACGCCNONE 
012-044-F02TCCACGCCNONE 
012-046-F01TCCACGCCNONE 
012-050-C04TCCACGCCNONE 
012-051-G08TCCACGCCNONE 
012-051-H03TCCACGCCNONE 
012-056-F12TCCACGCCNONE 
012-062-E07TCCACGCCNONE 
012-067-C12TCCACGCCNONE 
012-073-B07TCCACGCCNONE 
012-078-H09TCCACGCCNONE 
012-083-G12TCCACGCCNONE 
012-086-C12TCCACGCCNONE 
012-089-H12TCCACGCCNONE 
012-091-B09TCCACGCCNONE 
012-092-G08TCCACGCCNONE 
014-045-D08TCCACGCCNONE 
015-004-H02TCCACGCCNONE 
015-005-G05TCCACGCCNONE 
015-007-D06TCCACGCCNONE 
015-014-G04TCCACGCCNONE 
015-019-G11TCCACGCCNONE 
015-037-G04TCCACGCCNONE 
015-044-D02TCCACGCCNONE 
015-046-A05TCCACGCCNONE 
015-049-D09TCCACGCCNONE 
015-052-F12TCCACGCCNONE 
015-054-E03TCCACGCCNONE 
015-066-D02TCCACGCCNONE 
015-070-H03TCCACGCCNONE 
015-074-H10TCCACGCCNONE 
015-077-C04TCCACGCCNONE 
015-090-A10TCCACGCCNONE 
015-091-F11TCCACGCCNONE 
016-002-G04TCCACGCCNONE 
016-004-E03TCCACGCCNONE 
016-008-H10TCCACGCCNONE 
016-015-G12TCCACGCCNONE 
016-018-G01TCCACGCCNONE 
016-023-C07TCCACGCCNONE 
016-023-G06TCCACGCCNONE 
016-027-G04TCCACGCCNONE 
016-039-G04TCCACGCCNONE 
016-044-A06TCCACGCCNONE 
016-053-H06TCCACGCCNONE 
016-063-H03TCCACGCCNONE 
016-066-A01TCCACGCCNONE 
016-066-E08TCCACGCCNONE 
016-072-G03TCCACGCCNONE 
016-088-C06TCCACGCCNONE 
016-090-D01TCCACGCCNONE 
AK119561TCCACGCCNONE 
AK119761TCCACGCCNONE 
J033024B15TCCACGCCNONE 
J033040A17TCCACGCCNONE 
J033117E15TCCACGCCNONE 
J033128F11TCCACGCCNONE 
J065006O09TCCACGCCNONE 
J065010E21TCCACGCCNONE 
J065011P15TCCACGCCNONE 
J065013M15TCCACGCCNONE 
J065019E20TCCACGCCNONE 
J065021I21TCCACGCCNONE 
J065022D23TCCACGCCNONE 
J065024L10TCCACGCCNONE 
J065026P16TCCACGCCNONE 
J065027C20TCCACGCCNONE 
J065027G06TCCACGCCNONE 
J065027G23TCCACGCCNONE 
J065028B11TCCACGCCNONE 
J065030J05TCCACGCCNONE 
J065031G17TCCACGCCNONE 
J065034J07TCCACGCCNONE 
J065037N01TCCACGCCNONE 
J065040H20TCCACGCCNONE 
J065041C22TCCACGCCNONE 
J065044A21TCCACGCCNONE 
J065044L06TCCACGCCNONE 
J065045J02TCCACGCCNONE 
J065048D10TCCACGCCNONE 
J065049H23TCCACGCCNONE 
J065049I21TCCACGCCNONE 
J065052D03TCCACGCCNONE 
J065055D22TCCACGCCNONE 
J065057L13TCCACGCCNONE 
J065058B13TCCACGCCNONE 
J065059B04TCCACGCCNONE 
J065059C05TCCACGCCNONE 
J065059K01TCCACGCCNONE 
J065063G19TCCACGCCNONE 
J065073E20TCCACGCCNONE 
J065075I10TCCACGCCNONE 
J065081I24TCCACGCCNONE 
J065084E05TCCACGCCNONE 
J065084E12TCCACGCCNONE 
J065084J12TCCACGCCNONE 
J065086H18TCCACGCCNONE 
J065087F07TCCACGCCNONE 
J065095J02TCCACGCCNONE 
J065097E24TCCACGCCNONE 
J065102I06TCCACGCCNONE 
J065104N21TCCACGCCNONE 
J065105A16TCCACGCCNONE 
J065107C13TCCACGCCNONE 
J065108N11TCCACGCCNONE 
J065112I04TCCACGCCNONE 
J065112J05TCCACGCCNONE 
J065112K17TCCACGCCNONE 
J065115I05TCCACGCCNONE 
J065120J21TCCACGCCNONE 
J065120K18TCCACGCCNONE 
J065121L19TCCACGCCNONE 
J065123K20TCCACGCCNONE 
J065123M10TCCACGCCNONE 
J065124L18TCCACGCCNONE 
J065127E19TCCACGCCNONE 
J065128B05TCCACGCCNONE 
J065130F11TCCACGCCNONE 
J065130P06TCCACGCCNONE 
J065132K13TCCACGCCNONE 
J065134I17TCCACGCCNONE 
J065139I11TCCACGCCNONE 
J065141G14TCCACGCCNONE 
J065141O04TCCACGCCNONE 
J065146P07TCCACGCCNONE 
J065148L24TCCACGCCNONE 
J065154H20TCCACGCCNONE 
J065155I05TCCACGCCNONE 
J065165F05TCCACGCCNONE 
J065166I20TCCACGCCNONE 
J065168D14TCCACGCCNONE 
J065168F12TCCACGCCNONE 
J065169F17TCCACGCCNONE 
J065169J11TCCACGCCNONE 
J065169O14TCCACGCCNONE 
J065171E05TCCACGCCNONE 
J065171L21TCCACGCCNONE 
J065175G24TCCACGCCNONE 
J065178M19TCCACGCCNONE 
J065179C17TCCACGCCNONE 
J065179E04TCCACGCCNONE 
J065180C03TCCACGCCNONE 
J065182D08TCCACGCCNONE 
J065183P17TCCACGCCNONE 
J065188N09TCCACGCCNONE 
J065190G15TCCACGCCNONE 
J065190N03TCCACGCCNONE 
J065191H11TCCACGCCNONE 
J065193C13TCCACGCCNONE 
J065193G19TCCACGCCNONE 
J065199F19TCCACGCCNONE 
J065202L20TCCACGCCNONE 
J065204K12TCCACGCCNONE 
J065206H08TCCACGCCNONE 
J065208E02TCCACGCCNONE 
J065210O09TCCACGCCNONE 
J065211L19TCCACGCCNONE 
J065211N19TCCACGCCNONE 
J065212I06TCCACGCCNONE 
J065213P21TCCACGCCNONE 
J065215C14TCCACGCCNONE 
J100032J03TCCACGCCNONE 
M24287TCCACGCCNONE 
Os08g0474750J075009C13TCCACGCCNONE 
J075122O14TCCACGCCHypothetical protein. 
Os08g0474800Os08g0474800TCCACGCCEsterase/lipase/thioesterase domain containing protein. 
Os08g0535600AK121683GAGGCGTGGACCZinc finger, Tim10/DDP-type family protein. 
J065077E05GAGGCGTGGACCNONE 
J075088M24GAGGCGTGGACCNONE 
J075140B03GAGGCGTGGACCNONE 
J090014B14GAGGCGTGGACCNONE 
Os09g0122500J065067B01TCCACGCCNONE 
J065113L16TCCACGCCHypothetical protein. 
Os09g0308900AK062084TCCACGCCCAGATNONE 
J013060K03TCCACGCCCAGATNONE 
J013064G04TCCACGCCCAGATNONE 
J013152G07TCCACGCCCAGATNONE 
J013159G16TCCACGCCCAGATNONE 
J033107G06TCCACGCCCAGATNONE 
J033114C08TCCACGCCCAGATNONE 
J043022I05TCCACGCCCAGATNONE 
J100029J12TCCACGCCCAGATNONE 
J100030N08TCCACGCCCAGATNONE 
J100063H20TCCACGCCCAGATNONE 
J100076I02TCCACGCCCAGATNONE 
Os09g0385300AK073247GGCGTGGAHypothetical protein. 
AK120455GGCGTGGANONE 
J013104G23GGCGTGGANONE 
J023110A14GGCGTGGANONE 
J033143F07GGCGTGGANONE 
J065036P14GGCGTGGANONE 
J065041I11GGCGTGGANONE 
J065103K11GGCGTGGANONE 
J065138M15GGCGTGGANONE 
J065138P09GGCGTGGANONE 
J065141J20GGCGTGGANONE 
J075063J16GGCGTGGANONE 
J075063K19GGCGTGGANONE 
J075085H08GGCGTGGANONE 
J075093C12GGCGTGGANONE 
J075127N08GGCGTGGANONE 
J075134E09GGCGTGGANONE 
J075166D06GGCGTGGANONE 
J075168K24GGCGTGGANONE 
J075197G05GGCGTGGANONE 
J080034J24GGCGTGGANONE 
Os09g0394300AK105580GGCGTGGACCGlycoside hydrolase, family 9 protein. 
J100046E13GGCGTGGACCNONE 
J100049L10GGCGTGGACCNONE 
J100074H21GGCGTGGACCNONE 
J100090G03GGCGTGGACCNONE 
Os09g0394900AK061821GGCGTGGASimilar to Annexin-like protein. 
AK099102GGCGTGGANONE 
J013089B01GGCGTGGANONE 
J023112N20GGCGTGGANONE 
J100065I03GGCGTGGANONE 
Os09g0485800AK108749GGCGTGGAConserved hypothetical protein. 
J065137H03GGCGTGGANONE 
Os09g0547300AK100643TCCACGCCProtein of unknown function DUF630 domain containing protein. 
Os09g0572900AK069270GGCGTGGASimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399TCCACGCCProtein prenyltransferase domain containing protein. 
Os11g0107700AK073061TCCACGCCProtein kinase-like domain containing protein. 
Os11g0169600J075003I07TCCACGCCNONE 
J100025P12TCCACGCCNONE 
J100056P17TCCACGCCNONE 
J100073F05TCCACGCCNONE 
J100084H07TCCACGCCNONE 
J100085M11TCCACGCCConserved hypothetical protein. 
Os11g0303800AK068654TCCACGCCACConserved hypothetical protein. 
J075084L14TCCACGCCACNONE 
Os11g0454300009-010-F05TCCACGCCNONE 
011-073-B07TCCACGCCNONE 
011-089-D03TCCACGCCNONE 
012-041-B07TCCACGCCNONE 
012-042-D12TCCACGCCNONE 
012-046-G11TCCACGCCNONE 
012-072-D10TCCACGCCNONE 
012-090-F06TCCACGCCNONE 
013-009-A10TCCACGCCNONE 
013-096-B03TCCACGCCNONE 
014-002-F10TCCACGCCNONE 
014-006-A10TCCACGCCNONE 
014-006-C05TCCACGCCNONE 
014-006-E01TCCACGCCNONE 
014-006-H04TCCACGCCNONE 
014-009-D05TCCACGCCNONE 
014-010-D07TCCACGCCNONE 
014-012-A10TCCACGCCNONE 
014-013-F08TCCACGCCNONE 
014-014-D01TCCACGCCNONE 
014-016-D07TCCACGCCNONE 
014-020-F09TCCACGCCNONE 
014-023-C07TCCACGCCNONE 
014-024-A03TCCACGCCNONE 
014-025-D11TCCACGCCNONE 
014-027-D02TCCACGCCNONE 
014-030-F11TCCACGCCNONE 
014-032-H06TCCACGCCNONE 
014-034-D06TCCACGCCNONE 
014-037-E04TCCACGCCNONE 
014-038-C02TCCACGCCNONE 
014-041-B08TCCACGCCNONE 
014-044-A10TCCACGCCNONE 
014-045-C11TCCACGCCNONE 
014-046-B04TCCACGCCNONE 
014-047-D01TCCACGCCNONE 
014-053-C03TCCACGCCNONE 
014-053-C09TCCACGCCNONE 
014-072-D09TCCACGCCNONE 
014-073-D09TCCACGCCNONE 
014-073-F01TCCACGCCNONE 
014-081-B04TCCACGCCNONE 
014-081-G07TCCACGCCNONE 
014-084-C10TCCACGCCNONE 
014-084-F03TCCACGCCNONE 
014-085-D08TCCACGCCNONE 
014-087-H10TCCACGCCNONE 
014-095-E02TCCACGCCNONE 
014-095-G07TCCACGCCNONE 
AK121952TCCACGCCSimilar to Water-stress inducible protein RAB21. 
J033107K14TCCACGCCNONE 
J065021B08TCCACGCCNONE 
J065059D24TCCACGCCNONE 
J065066D13TCCACGCCNONE 
J065070K11TCCACGCCNONE 
J065081I18TCCACGCCNONE 
J065120F19TCCACGCCNONE 
J065186M13TCCACGCCNONE 
J075031E22TCCACGCCNONE 
J075046F04TCCACGCCNONE 
J075069L13TCCACGCCNONE 
J075097G09TCCACGCCNONE 
J075099C23TCCACGCCNONE 
J075149N21TCCACGCCNONE 
J075150G23TCCACGCCNONE 
J075170K09TCCACGCCNONE 
J075173A09TCCACGCCNONE 
J075177C21TCCACGCCNONE 
Os11g0528500AK058434TCCACGCCACGCCACGCCACGCCACGCGCGCGASimilar to Rubredoxin 1 (Rd-1). 
J065110G13TCCACGCCACGCCACGCCACGCCACGCGCGCGANONE 
Os12g0106700AK106509GGCGTGGASimilar to OsPK4. 
Os12g0150100009-047-B11TCCACGCCNONE 
AK105075TCCACGCCSimilar to 60S ribosomal protein L26A. 
J013067G22TCCACGCCNONE 
J033103F08TCCACGCCNONE 
J065029P11TCCACGCCNONE 
J065043B18TCCACGCCNONE 
J065123E16TCCACGCCNONE 
J065141O20TCCACGCCNONE 
J065161O04TCCACGCCNONE 
J065201M07TCCACGCCNONE 
J075058I23TCCACGCCNONE 
J075172J08TCCACGCCNONE 
J100040L13TCCACGCCNONE 
Os12g0481100AK073151GGCGTGGASimilar to RNA helicase. 
Os12g0613500009-028-C05TCCACGCCNONE 
011-081-E10TCCACGCCNONE 
AB118018TCCACGCCNONE 
AK058205TCCACGCCNONE 
AK101273TCCACGCCLissencephaly type-1-like homology motif domain containing protein. 
J033033A11TCCACGCCNONE 
Os12g0638500AK072720TCCACGCCCACCTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.